View
5
Download
0
Category
Preview:
Citation preview
HOMEOSTASIE DES COFACTEURS METALLIQUES DE LA NITROGENASE
(MOLYBDÈNE ET VANADIUM) CHEZ AZOTOBACTER VINELANDII EN
PRÉSENCE DE MATIÈRES ORGANIQUE ET MINÉRALE
par
Christelle Jouogo Noumsi
thèse présentée au Département de biologie en vue
de l'obtention du grade de docteur ès sciences (Ph.D.)
FACULTÉ DES SCIENCES
UNIVERSITÉ DE SHERBROOKE
Sherbrooke, Québec, Canada, Décembre 2016
Le 09 Décembre 2016
le jury a accepté la thèse de madame Christelle Jouogo Noumsi
dans sa version finale
Membres du jury
Professeur Jean-Philippe Bellenger
Directeur de recherche
Département de chimie, Université de Sherbrooke
Professeur Vincent Burrus
Co-directeur de recherche
Département de biologie, Université de Sherbrooke
Professeur Marc Amyot
Évaluateur externe
Département de sciences biologiques, Université de Montréal
Professeur Pascale Beauregard
Évaluateur interne
Département de biologie, Université de Sherbrooke
Professeur Sébastien Rodrigue
Président-rapporteur
Département de biologie, Université de Sherbrooke
iv
SOMMAIRE
La fixation biologique du diazote (N2) constitue une étape importante du cycle
biogéochimique de l’azote (N). Cette réaction permet la réduction du N2 atmosphérique,
non biodisponible, en ammonium (NH3) bioassimilable par tous les organismes vivants.
Cette réaction est limitée par différents facteurs, menant à une limitation de la production
primaire dans de nombreux écosystèmes, particulièrement nordiques. En effet, la fixation
biologique d’azote dans tous les écosystèmes dépend d’un nombre réduit de procaryotes
appelés diazotrophes qui sont capables de rompre la triple liaison N-N pour former
l’ammoniac. Cette réaction qui est catalysée pas une métalloenzyme, la nitrogénase,
requiert beaucoup d’énergie sous forme d’ATP, compte tenue de l’énergie de liaison liant
les atomes d’azote. La nitrogénase existe sous trois isoformes, que l’on différencie
principalement par la nature du métal cofacteur du site actif : les nitrogénases au
molybdène (Mo), au vanadium (V) et au fer (Fe). La répartition des isoformes de la
nitrogénase n’est pas homogène chez les diazotrophes. Alors que tous possèdent la
nitrogénase au Mo, seulement quelques-uns ont en supplément la nitrogénase au V et/ou
celle au Fe. De plus, les isoformes de la nitrogénase ne sont pas équivalentes en termes
d’efficacité de réduction de N2. La Mo-nitrogénase est la plus efficace à température
ambiante car elle utilise le moins d’ATP pour réduire une mole de diazote. Elle est suivie
de l’isoforme au V, et enfin celle au Fe. Chez les diazotrophes possédant plus d’une
nitrogénase (ex. Azotobacter vinelandii), l’utilisation de celles-ci suit une hiérarchie
reflétant ces efficacités relatives; la Mo-nitrogénase est exprimée par défaut, la V-
nitrogénase est exprimée en absence de Mo et celle au Fer en absence de Mo et de V. Du
fait de leur moindre efficacité, de leur présence chez seulement certains diazotrophes, en
supplément de la Mo-nitrogénase, et de leur régulation sous contrôle du Mo, la fixation
d’azote est considérée comme dépendant principalement du Mo. Pourtant depuis
quelques années, plusieurs évidences remettent en cause cette prédominance de la Mo-
nitrogénase: (i) la conservation des nitrogénases alternatives au fil de l’évolution suggère
qu’elles ont un rôle important; (ii) la limitation de la fixation par le Mo de nombreux
écosystèmes; (iii) l’omniprésence des gènes des nitrogénases alternatives dans de
v
nombreux écosystèmes, limités en Mo ou non. Malgré leur importance potentielle, notre
compréhension de la contribution des nitrogénases alternatives à la fixation biologique de
diazote en milieu naturel reste très limitée.
Plusieurs facteurs peuvent influencer l’utilisation des nitrogénases, tels que la
température et l’accès aux métaux essentiels. L’acquisition des métaux cofacteurs
constitue un paramètre d’intérêt majeur, car l’activation des gènes des nitrogénases est
fortement dépendante de la disponibilité en métaux cofacteurs. Dans les sols le
molybdène et le vanadium, présents essentiellement sous forme de molybdate (MoO42-
) et
vanadate (VO43-
), sont fortement complexés à la matrice (matière organique et oxydes) ce
qui peut limiter leur disponibilité pour les fixateurs d’azote. Chez certains diazotrophes
(ex. Azotobacter vinelandii) il a été démontré que l’acquisition des métaux cofacteurs
(Fe, Mo et V) est assurée par des métallophores, petits ligands organiques produits par les
êtres vivants pour chélater les métaux. Leur grande affinité pour les métaux permet aux
diazotrophes de pouvoir acquérir sélectivement les métaux pour la fixation biologique
d’azote. En milieu naturel les interactions entre complexes naturels (matière organique,
oxydes) et métallophores jouent sans doute un rôle important dans la biodisponibilité des
métaux cofacteurs de la nitrogénase et donc leur utilisation. Cependant, les études sur
l’acquisition des métaux et leur utilisation pour la fixation d’azote restent souvent
limitées à des conditions de laboratoire peu représentatives de la réalité (métaux
cofacteurs non complexés).
L’hypothèse de ce projet doctoral était que la présence d’agents naturels complexant les
métaux cofacteurs de la nitrogénase (Mo et V) pouvait influencer significativement la
stratégie d’acquisition et d’utilisation de ceux-ci, menant à une contribution accrue des
nitrogénases alternatives. Cette hypothèse a été testée en conditions de laboratoire en
utilisant Azotobacter vinelandii comme bactérie modèle ainsi que l’acide tannique et des
oxydes de fer comme agents complexants naturels modèles.
Ces travaux ont montré que la présence d’agents complexants (acide tannique et oxydes
de fer) entraîne des changements majeurs dans la gestion des métaux cofacteurs (Mo et
vi
V) chez A. vinelandii. Les stratégies d’acquisition des métaux cofacteurs sont fortement
modifiées en présence de complexants naturels avec (i) un changement important de la
quantité des metallophores produits ainsi que (ii) une acquisition simultanée de Mo et V
dans des conditions traditionnellement considérée comme non limitantes en Mo. Ceci se
traduit par un changement important dans l’utilisation des nitrogénases; les niveaux de
transcrits élevés des gènes nifD et vnfD, spécifiques des nitrogénases au Mo et au V
respectivement, suggèrent une utilisation simultanée de ces isoenzymes pour assurer la
fixation d’azote. Ce projet a permis de mettre en évidence que face à un stress
métallique, l’utilisation des isoformes de la nitrogénase par A. vinelandii est un processus
plus versatile que précédemment décrit et que le coût d’acquisition des métaux dans ces
conditions serait un facteur important de la régulation de l’activité des nitrogénases. Ces
travaux démontrent que la hiérarchie des nitrogénases établie sur la base d’expériences de
laboratoire ne s’applique sans doute pas aux milieux naturels. Ceci suggère que les
nitrogénases alternatives pourraient contribuer à la fixation d’azote de manière plus
importante que présentement admis.
Mots clés : fixation biologique d’azote, nitrogénase, métaux essentiels, métallophores,
homéostasie, dynamique d’acquisition et d’utilisation, Azotobacter vinelandii
vii
REMERCIEMENTS
J’aimerais tout d’abord remercier grandement Jean-Philippe et Vincent pour avoir permis
que tout ce travail soit possible. Grâce à eux j’ai beaucoup appris durant ces quatre
années, et j’ai aussi appris à apprendre. Ce fût un véritable challenge et j’ai eu un
accompagnement des plus formidables. Rigueur, persévérance, autonomie, éthique, sont
les maîtres mots qui décrivent le mieux l’encadrement qu’ils m’ont apporté. Je ne pouvais
espérer mieux.
Je remercie toutes les sources de financement ayant permis ce doctorat (les chaires de
recherche du Canada détenues par JPB et VB et le soutien facultaire au recrutement aux
études supérieures).
Les membres de mon comité de conseillers Ryszard, Pascale et Sébastien, je vous
remercie pour l’encadrement administratif et pour les conseils que vous m’avez donné
durant mon doctorat.
Mes partenaires de laboratoire, présents et passés. J’ai eu la chance de faire partie de
deux équipes aussi différentes que formidables. Ce fût tellement agréable de travailler
avec vous, j’ai beaucoup appris grâce à votre aide. J’ai en plus eu la chance de trouver en
vous de fantastiques amis avec qui la vie continuait hors laboratoire. Nicolas, Dominic,
Geneviève, Éric, (Mireille), Nina, Romain Da., Marion, Lorène, Jefferson, Augustin,
Romain Du., Fanny, je n’ai pas assez de place ici pour vous exprimer toute ma gratitude,
mais vous le savez, je n’en pense pas moins.
À mes amis (formidablement géniaux), Suzy, Nil, Sarah (choupinette), Liliane, Thomas,
Hugo, Svilena, Hervé, Loïc, pour ne citer qu’eux, un énorme merci pour le soutien
quotidien.
Ma famille, loin des yeux, près du cœur. Vous m’accompagnez depuis le début, merci
pour le soutien, merci pour l’amour dont vous m’abreuvez. À ma maman. À ma sœur
Mireille. À mon frère Guy Alain...
viii
TABLE DES MATIÈRES
SOMMAIRE ............................................................................................................................ iv
REMERCIEMENTS ............................................................................................................... vii
LISTE DES ABRÉVIATIONS ................................................................................................ xi
LISTE DES TABLEAUX ......................................................................................................xiii
LISTE DES FIGURES ........................................................................................................... xiv
CHAPITRE 1 .......................................................................................................................... 16
INTRODUCTION GÉNÉRALE ............................................................................................ 16
1.1. Cycles biogéochimiques des éléments ........................................................................... 16
1.2. Cycle de l’azote ............................................................................................................. 17
1.3. La fixation biologique d’azote ...................................................................................... 19
1.4. Les acteurs de la fixation .............................................................................................. 20
1.5. La nitrogénase : structure et fonctionnement .............................................................. 21
1.5.1. La nitrogénase au molybdène ................................................................................... 22
1.5.2. Les nitrogénases alternatives .................................................................................... 23
1.6. Les gènes impliqués dans la fixation biologique d’azote.............................................. 25
1.6.1. Gènes structurels ...................................................................................................... 26
1.6.2. Les autres gènes des clusters nif, vnf et anf ............................................................... 26
1.7. Importance des micronutriments pour la fixation biologique d’azote ........................ 27
1.7.1. Les métaux essentiels des isoformes des nitrogénases ............................................... 28
1.7.2. Spéciation et stratégies d’acquisition des métaux cofacteurs de la nitrogénase .......... 29
1.8. Organisme d’étude : Azotobacter vinelandii ................................................................. 31
1.9. Hypothèse générale et objectifs .................................................................................... 34
CHAPITRE 2 .......................................................................................................................... 36
RÉSULTATS........................................................................................................................... 36
2.1. Effet de la matière organique sur l’homéostasie des métaux cofacteurs de la
nitrogénase pour la fixation d’azote chez A. vinelandii ...................................................... 36
2.1.1. Présentation de l’article ............................................................................................ 36
2.1.2 Contribution à l’article .............................................................................................. 37
2.1.3. Page titre.................................................................................................................. 39
2.1.4. Summary ................................................................................................................. 40
ix
2.1.5. Introduction ............................................................................................................. 40
2.1.6. Result and Discussion .............................................................................................. 42
2.1.7. Conclusion ............................................................................................................... 51
2.1.8. Experimental procedures .......................................................................................... 52
2.1.8.1. Bacterial strain, Culture medium and growth conditions .................................... 52
2.1.8.2. Growth curves and growth rates ........................................................................ 52
2.1.8.3. Metallophores quantification ............................................................................. 53
2.1.8.4. RNA isolation, cDNA synthesis and quantitative PCR assays ............................ 53
2.1.8.5. Statistics and curve fitting ................................................................................. 54
2.1.9. Acknowledgments ................................................................................................... 54
2.1.10. References ............................................................................................................. 55
2.1.11. Supporting information .......................................................................................... 71
2.2. Les oxydes de fer modulent l’acquisition et l’utilisation des métaux essentiels pour la
croissance diazotrophe d’Azotobacter vinelandii................................................................. 84
2.2.1. Présentation de l’article ............................................................................................ 84
2.2.2 Contribution à l’article .............................................................................................. 86
2.2.3. Page titre.................................................................................................................. 87
2.2.4. Summary ................................................................................................................. 88
2.2.5. Introduction ............................................................................................................. 88
2.2.6. Result and Discussion .............................................................................................. 91
2.2.7. Conclusion ............................................................................................................. 101
2.2.8. Experimental procedure ......................................................................................... 102
2.2.8.1. Bacterial strain, Culture medium and growth conditions .................................. 102
2.2.8.2. Growth curves and growth rates ...................................................................... 102
2.2.8.3. Cellular metal quotas ....................................................................................... 103
2.2.8.4. Quantification of metallophores ....................................................................... 103
2.2.8.5. RNA isolation and cDNA synthesis ................................................................. 104
2.2.8.6. Quantitative PCR assays .................................................................................. 104
2.2.8.7. Statistics and curve fitting ............................................................................... 105
2.2.9. Acknowledgments ................................................................................................. 105
2.2.10. References ........................................................................................................... 106
2.2.11. Supporting information ........................................................................................ 122
x
CHAPITRE 3 ........................................................................................................................ 127
DISCUSSION GÉNÉRALE ET CONCLUSION ................................................................. 127
3.1. Perspectives d’amélioration du projet de recherche : présence et activité des
nitrogénases ....................................................................................................................... 128
3.2. La nitrogénase au vanadium : véritable avantage? ................................................... 129
3.3. La hiérarchie des nitrogénases : un concept révolu? ................................................. 129
3.4. Les métallophores : clef de voute de la régulation de l’utilisation des nitrogénases en
milieu naturel?................................................................................................................... 131
3.4.1. Les métallophores, système d’acquisition versatile de contrôle du stress métallique 131
3.4.2. Le coût d’acquisition des métaux ........................................................................... 133
3.5. La régulation des nitrogénases : un consortium multifactoriel ................................. 135
3.6. Répartition des isoformes des nitrogénases chez les diazotrophes ............................ 136
ANNEXE ............................................................................................................................... 138
BIBLIOGRAPHIE ................................................................................................................ 171
xi
LISTE DES ABRÉVIATIONS
ADN : acide désoxyribonucléique
ADP : adénosine diphosphate
ARN : acide ribonucléique
ATP: adénosine triphosphate
C: carbone
cDNA : complementary DNA
Da: daltons
DNase: deoxyribonuclease
FBA: fixation biologique d’azote
Fe: fer/iron
HLB:hydrophilic lipophilic balanced
ICP-MS : inductively coupled plasma mass spectrometry
ISARA: isotopic acetylene reduction assay
LC: liquid chromatography
MeOH: methanol
Mg : magnésium
Mo: molybdène/molybdenum
mRNA : messenger RNA
MS: mass spectrometry
N: azote
xii
N2 : diazote/dinitrogen
Nase: nitrogénase/nitrogenase
NH3 : ammoniac
OD: optical density
qRT-PCR: quantitative reverse transcriptase polymerase chain reaction
UHPLC: ultra-high performance liquid chromatography
V: vanadium
xiii
LISTE DES TABLEAUX
Chapitre 1
Tableau 1. Concentrations clés en métaux essentiels molybdène, vanadium et fer lors de la
croissance diazotrophe d’Azotobacter vinelandii. ....................................................................... 31
Chapitre 2
1er
article
Table S1: Statistics analysesa of cellular metal quotas ratio Mo:V = 1:1 .................................... 78
Table S2: Statistics analysesa of cellular metal quotas ratio Mo:V = 1:4 .................................... 78
Table S3: primers used in quantitative PCR (5’-3’) ................................................................... 81
2ème
article
Table 1 Molybdenum and vanadium remaining in solution after addition of 55 µM and 505 µM
FeCl3. ........................................................................................................................................ 92
Table S1. Statistical analysesa of cellular metal quotas ............................................................ 126
xiv
LISTE DES FIGURES
Chapitre 1
Figure 1. Représentation schématique des cycles biogéochimiques des éléments. ...................... 17
Figure 2. Cycle de l’azote. ........................................................................................................ 18
Figure 3. Évolution des apports anthropiques en azote dans les écosystèmes terrestres. ............. 20
Figure 4. Structure cristallographique de la nitrogénase au molybdène ...................................... 23
Figure 5. Organisation des clusters nif, vnf et anf de la fixation biologique d’azote chez A.
vinelandii .................................................................................................................................. 25
Figure 6. Groupements fonctionnels des métallophores ............................................................. 30
Figure 7. Structure chimique des métallophores produits par A. vinelandii ................................ 32
Chapitre 2
1er
article
Figure 1: Growth curves of Azotobacter vinelandii. .................................................................. 43
Figure 2: Metallophores production by Azotobacter vinelandii along the growth. ...................... 44
Figure 3: Evolution of cellular metal to phosphorus quotas in A. vinelandii............................... 46
Figure 4: Relative expression of nifD, vnfD and anfD during the exponential growth phase. ..... 48
Figure 5: Summary of the effects of the presence of tannic acids on nitrogenase metal cofactors
management by A. vinelandii. .................................................................................................... 50
Figure S1: Growth curves of Azotobacter vinelandii. ................................................................ 73
Figure S2: Metallophores production by Azotobacter vinelandii along the growth..................... 74
Figure S3: Evolution of cellular metal to phosphorus quotas in Azotobacter vinelandii. ............ 75
Figure S4: Relative expression of nifD, vnfD and anfD during the exponential growth phase. ... 76
Figure S5: A. Tannic acid-molybdenum complexation spectra, B. Tannic acid-vanadium
complexation spectra. ................................................................................................................ 77
Figure S6: Vanadium uptake rates between sampling times. ..................................................... 79
Figure S7: ARA (left axis) and instantaneous growth rates (right axis) along the exponential
phase ......................................................................................................................................... 80
2ème
article
Figure 1. Growth curves of A. vinelandii................................................................................... 93
Figure 2. Evolution of cellular metal to phosphorus quotas in A. vinelandii. .............................. 95
Figure 3. Metallophore production by A. vinelandii during growth. ........................................... 97
Figure 4. Relative expression of nifD and vnfD in control conditions during the exponential
growth phase. ............................................................................................................................ 99
xv
Figure 5. Relative expression of nifD and vnfD during the exponential growth phase. ............. 100
Figure S1. Growth curves of A. vinelandii at two pH values. ................................................... 123
Figure S2. Vanadium uptake rates between sampling times..................................................... 124
Figure S3. Relative expression of anfD during the exponential growth phase. ......................... 125
16
CHAPITRE 1
INTRODUCTION GÉNÉRALE
1.1. Cycles biogéochimiques des éléments
A l’échelle de la planète Terre, le cycle biogéochimique d’un élément représente les
différentes voies et différents moyens menant à la transformation et aux transferts de cet
élément au travers des principaux réservoirs; atmosphère, hydrosphère, lithosphère et
biosphère. Ces procédés sont des réactions d’ordre physique (ex. transport, convection),
chimique (ex. hydrolyse, oxydo-réduction) et biologique (ex. photosynthèse, respiration).
Le fonctionnement et le devenir des écosystèmes est directement dépendant des
interactions complexes au sein et entre les cycles biogéochimiques des éléments. Il est
donc particulièrement pertinent, notamment dans les circonstances actuelles de
changements climatiques, d’approfondir nos connaissances sur ces cycles, afin de mieux
prédire le devenir de notre environnement. Un intérêt particulier est porté à l’étude des
cycles des éléments indispensables à la vie, car la biosphère constitue un point commun à
tous les grands réservoirs. La biosphère est souvent représentée au centre des réservoirs
pour illustrer son implication dans tous les cycles biogéochimiques (figure 1). Les cycles
des éléments majeurs carbone, hydrogène, azote, oxygène, phosphore et souffre
(CHNOPS) ont donc fait l’objet d’intenses travaux au fil des années (Mackenzie et al.,
2013). Les flux de ces éléments (sous diverses formes) à travers les réservoirs sont assez
bien connus à ce jour, et les procédés permettant ces flux peu à peu élucidés.
17
Figure 1. Représentation schématique des cycles biogéochimiques des éléments.
Les flèches indiquent les flux des éléments au travers des grands réservoirs.
La complexité du cycle d’un élément peut provenir de diverses sources : (i) les formes et
les propriétés que peuvent adopter cet élément vont influencer sa présence et son
abondance dans les grands réservoirs, (ii) l’impact de facteurs biotiques et abiotiques sur
sa transformation et sa circulation à travers ces réservoirs et, (iii) l’interaction avec
d’autres cycles biogéochimiques.
1.2. Cycle de l’azote
L’azote est un élément indispensable à la vie, qui entre dans la composition des acides
aminés, des bases azotées des acides nucléiques. De nombreux travaux ont montré que le
taux de productivité primaire nette dans divers écosystèmes terrestres et aquatiques est
18
limité par l’azote (Vitousek and Howarth, 1991; Hooper and Johnson, 1999; LeBauer and
Treseder, 2008). Le taux de productivité primaire étant la quantité de matière organique
produite par unité de temps à partir de matière minérale et d’énergie. L’azote semble donc
conditionner l’expansion de la vie dans de nombreux écosystèmes. Le cycle de l’azote est
subdivisé en cinq étapes principales que sont la fixation d’azote, l’assimilation, la
minéralisation (ou ammonification), la nitrification et la dénitrification ; et tous les
niveaux trophiques y participent (figure 2).
Figure 2. Cycle de l’azote. Transformations et flux des composés azotés par les voies
naturelles (flèches vertes) et anthropiques (flèches mauves).
19
1.3. La fixation biologique d’azote
L’atmosphère est le principal réservoir naturel de l’azote, dont il représente environ 78%
de la composition. Le diazote de l’air étant une forme peu utilisable par la biosphère, la
fixation d’azote (N2 NH3) est considérée comme une étape clé du cycle de cet élément.
Cette étape constitue d’ailleurs la principale source d’azote biodisponible dans les
écosystèmes ne subissant pas ou peu d’influence anthropique. La fixation biologique
d’azote (FBA) est évaluée à 175×106 tonnes d’azote fixé par an (Cech, 2010; Burns and
Hardy, 2012). La réaction de réduction de N2, catalysée par l’enzyme nitrogénase, est
particulièrement couteuse en énergie (équation 1.1) (Rees et al., 2005). En effet, l’énergie
(ΔG) de la triple liaison N-N est d’environ 226 kcal/mole, comparé par exemple à une
liaison N-H de 96 kcal/mole (Schlesinger and Bernhardt, 2013).
N2 + (6+2n)H+ + (6+2n)e
- + p(6+2n)ATP → 2NH3+ nH2 + p(6+2n)ADP + p(6+2n)Pi
(equation 1.1)
Si la FBA subit des contraintes affectant la production de NH3, toute la biosphère qui en
dépend peut être limitée en azote. La limitation en azote attribuable à un déficit de la FBA
est d’ailleurs une problématique retrouvée dans de nombreux écosystèmes naturels
(Vitousek and Howarth, 1991).
Avec la révolution industrielle et l’accroissement des besoins agricoles, l’apport en
composés azotés par l’Homme sur la planète n’a cessé de croitre depuis un siècle pour
atteindre 192 × 106 tonnes d’azote fixé par an en 2008 (Gu et al., 2013) (Figure 3). Ceci
fait de l’Homme la première source d’azote réduit de la planète. Les sources d’azote
réduit d’origine anthropiques sont multiples (Figure 3).
20
Figure 3. Évolution des apports anthropiques en azote dans les écosystèmes
terrestres. Sources et teneurs d’azote fixé par l’activité humaine : agriculture, carburants
fossiles, production industrielle, fertilisants. En comparaison à la fixation naturelle (zone entre les
traits interrompus). Tiré de Gu et al 2013.
Malgré cet apport anthropique considérable d’azote fixé, la FBA demeure la principale
voie d’entrée de cet élément dans les écosystèmes terrestres et aquatiques ne subissant pas
ou peu de perturbations anthropiques (ex. écosystèmes boréaux et subarctiques). Élucider
les mécanismes contrôlant la FBA reste donc d’un intérêt majeur pour mieux comprendre
le fonctionnement et l’évolution de nos écosystèmes.
1.4. Les acteurs de la fixation
Les fixateurs d’azote ou diazotrophes sont exclusivement des procaryotes, que l’on
retrouve dispersés au sein des bactéries, cyanobactéries et archées. Cette capacité à
réduire le N2 n’est pas spécifique à des branches particulières du vivant, il arrive donc
21
qu’au sein d’un même genre, seulement quelques espèces soient en mesure d’effectuer la
réaction. Les bactéries et les cyanobactéries peuvent former des associations avec des
eucaryotes, au sein desquelles l’un de leur rôle est de fournir de l’azote biodisponible
pour tous les partenaires impliqués. Dans ces cas, la fixation d’azote se fait dans des
structures spécialisées que sont les nodules racinaires (symbiose bactéries / plantes
supérieures) ou les saccules (symbiose lichénique). Ces structures permettent de maintenir
des conditions microaérophiles requises pour la réaction de FBA. Les diazotrophes libres
quant à eux, autotrophes ou hétérotrophes, peuvent être anaérobies, microaérophiles ou
aérobies. Les diazotrophes couvrent donc une très grande diversité de métabolismes de
vie et d’environnements.
1.5. La nitrogénase : structure et fonctionnement
L’enzyme catalysant la FBA est la nitrogénase (Nase). Il s’agit d’une métalloprotéine,
dont la nature du métal co-facteur situé au niveau du site actif diffère selon l’isoforme de
l’enzyme. Trois isoformes sont connus à ce jour, la Mo, la V- et la Fe-Nases (Bishop et
al., 1980, 1982; Hales et al., 1986; Robson et al., 1986; Chisnell et al., 1988; Joerger,
Jacobson, Premakumar, et al., 1989). L’isoforme au Mo est la plus étudiée et sera
présentée en détail. Seules les spécificités des deux autres formes seront détaillées
ensuite. Etant donné qu’il existe des petites différences de structure entre les mêmes
isoformes de différents diazotrophes, seulement les caractéristiques des Nases de
l’organisme étudié au cours de ce doctorat (Azotobacter vinelandii) seront présentées ici.
22
1.5.1. La nitrogénase au molybdène
La Nase au Mo est en quelque sorte l’isoforme universelle car elle est présente chez tous
les diazotrophes connus à ce jour. En théorie, elle est aussi la plus efficace, car c’est celle
qui nécessite le moins d’énergie pour réduire 1 mole de N2 (équation 1.2).
N2 + 8H+ + 8e
- + 16ATP → 2NH3 + H2 + 16ADP + 16Pi (équation 1.2)
Elle se présente sous forme d’un assemblage de trois sous-unités réparties en deux
principaux ensembles, la dinitrogénase réductase et la dinitrogénase, fonctionnant en
tandem.
La dinitrogénase réductase ou Fe-protéine, est un homodimère d’environ 64 kDaltons de
la sous-unité γ (figure 4). Elle sert d’accepteur d’électrons, de la ferrédoxine ou de la
flavodoxine, qu’elle transfère à la deuxième composante de la Nase. Un cluster fer-soufre
[4Fe-4S] relie les sous-unités γ entre elles. C’est ce cluster qui assure le transfert
d’électrons. Chaque sous-unité γ lie une molécule de Mg-ATP, qui fournit l’énergie
nécessaire au transfert d’électrons (Howard and Rees, 2006; Seefeldt et al., 2009).
La dinitrogénase ou MoFe-protéine est un tétramère des sous-unités α et β avec la
stœchiométrie α2β2, d’environ 230 kDaltons (figure 4). Elle contient deux types de
métallo-clusters : un P-cluster et un FeMo-cofacteur (Kirn and Rees, 1992). Le P-cluster,
situé à l’interface de chaque paire de sous-unités α et β, comporte deux clusters fer-soufre
([4Fe-4S] et [4Fe-3S]). Le P-cluster reçoit les électrons provenant de la Fe-protéine et les
transfère au cluster FeMo-cofacteur (Peters et al., 1995). Ce deuxième métallo-cluster est
formé de 7Fe-9S-Mo-homocitrate et d’un atome central X (C, N ou O) (Seefeldt et al.,
2009; Lancaster et al., 2011; Einsle, 2014). Le FeMo-cofacteur est situé au sein de chaque
sous-unité α et constitue le site catalytique de l’enzyme. Lors de l’assemblage de tous les
composants de la Nase, l’incorporation du FeMo-cofacteur constitue l’étape finale, la
23
maturation de l’enzyme qui l’amène à sa forme active. À ce site peuvent se fixer
différents substrats tels que le diazote (N2), des protons (H+), ou encore de l’acétylène
(C2H2) pour la réaction de réduction.
Figure 4. Structure cristallographique de la nitrogénase au molybdène . (Gauche)
Les sous-unités γ de la dinitrogénase réductase (Fe-protéine) sont représentées en gris. Les sous-
unités α et β de la dinitrogénase (MoFe-protéine) sont représentées en violet et rouge
respectivement. (Droite) Positions du MgADP et des métalloclusters impliqués dans le transfert
d’électrons pour la réduction de N2. Tiré de Hu and Ribbe, 2011.
1.5.2. Les nitrogénases alternatives
Les isoformes de la Nase au V et au Fe sont parfois retrouvées en plus de la Mo-Nase, et
ce, chez certains diazotrophes seulement. C’est l’une des raisons qui leur a valu le
qualificatif d’alternatives. En plus d’être des formes supplémentaires, elles sont
24
théoriquement moins efficaces dans l’activité de réduction de N2, parce qu’elles
nécessitent plus d’énergie pour réduire 1 mole de N2 (équations 1.3 et 1.4) (Masepohl et
al., 2002; Bothe et al., 2010).
V-Nase: N2 + 12H+ + 12e
- + 24ATP → 2NH3 + 3H2 + 24ADP + 24Pi (équation 1.3)
Fe-Nase: N2 + 21H+ + 21e
− + 42ATP → 2NH3 + 7.5H2 + 42ADP + 42Pi (équation 1.4)
En termes de structure, les Nases alternatives sont très semblables entre elles, et diffèrent
légèrement de l’isoforme au Mo. La Fe-protéine possède les mêmes structure et fonction
pour les trois types de Nase (Howard and Rees, 1996). C’est au niveau de la composante
dinitrogénase que l’on observe des différences majeures entre la Mo-Nase et les Nases
alternatives. Nous avons bien évidemment le changement du métal cofacteur Mo par V ou
Fe ; mais surtout, une sous-unité δ supplémentaire est présente en plus des sous-unités α
et β. Celle-ci semble impliquée dans la maturation de l’enzyme (insertion des FeV- et
FeFe-cofacteurs dans la dinitrogénase immature), et reste associée à la Nase
fonctionnelle. La stœchiométrie de ces sous-unités est variable selon les fixateurs, et
même au sein d’un même organisme, conduisant à des assemblages différents : αβ2,
α2β2δ2 ou α2β2δ4. Chez A. vinelandii la stœchiométrie menant à une V-Nase au meilleur
de son activité est une dinitrogénase en hétérooctamère des sous-unités α2β2δ4 faisant
environ 270 kDa (Lee et al., 2009). La FeFe-protéine quant à elle semble être constituée
d’un mélange des formes trimériques, tétramériques et hexamériques αβ2, α2β2 et α2β2δ2
(Masepohl et al., 2002). La Fe-Nase reste toujours l’isoforme pour laquelle il y a moins
d’études permettant de cerner la structure et le fonctionnement spécifiques (Hinnemann
and Nørskov, 2004).
Malgré ces différences de structure, les trois isoenzymes ont le même fonctionnement
global (même cheminement des électrons via les clusters), réduisent les mêmes substrats
mais avec une efficacité de réduction du N2 décroissante, allant de la Mo-Nase à la V-
Nase puis la Fe-Nase (Masepohl et al., 2002; Lee et al., 2009; Bothe et al., 2010).
25
1.6. Les gènes impliqués dans la fixation biologique d’azote
Une nomenclature a été mise en place pour distinguer les gènes des 3 types de Nases : (i)
nif (« nitrogen fixation ») pour les gènes de la Mo-Nase, (ii) vnf (« vanadium nitrogen
fixation ») pour les gènes de la V-Nase et (iii) anf (« alternative nitrogen fixation ») pour
ceux de la Fe-Nase (Joerger et al., 1989). De façon générale, les gènes impliqués dans la
fixation d’azote sont organisés en 7-8 opérons, organisés de manière assez semblable pour
les trois isoformes de la Nase (figure 5). Bien que certains gènes des clusters nif, vnf et
anf restent sans fonction connue ni prédite, la fonction de la plupart d’entre eux a été
caractérisée, surtout pour l’isoforme au Mo. Les détails sur les fonctions des gènes
présentés ici sont spécifiques à A. vinelandii, mais sont généralement similaires chez
d’autres fixateurs.
Figure 5. Organisation des clusters nif, vnf et anf de la fixation biologique
d’azote chez A. vinelandii. Les gènes structurels sont représentés en gris clair, ceux
impliqués dans l’assemblage des clusters [Fe-S] en gris foncé, ceux impliqués dans la régulation
en vert (activateurs) et rouge (répresseur), et les autres gènes en blanc. Adapté de (Dos Santos and
Dean, 2014).
26
1.6.1. Gènes structurels
Cette catégorie regroupe les gènes qui codent les protéines constitutives des Nases, les
protéines du squelette. Les sous-unités γ formant la composante dinitrogénase réductase
sont codées par les gènes nifH, vnfH et anfH pour les isoformes Mo-, V- et Fe-Nases
respectivement. Pour ce qui est de la composante dinitrogénase, les sous-unités α sont
codées par les gènes nifD, vnfD et anfD, tandis que les sous-unités β sont codées par les
gènes nifK, vnfK et anfK (Brigle et al., 1985). Les sous-unités δ spécifiques des Nases
alternatives sont codées par les gènes vnfG et anfG (Joerger et al., 1989; Joerger et al.,
1990). Les gènes H, D, K et G (lorsque présent) sont regroupés dans le même opéron,
sauf pour la V-Nase dont le gène H est situé dans un autre opéron avec le gène Fd (codant
un potentiel donneur d’électron ferrédoxine pour la Nase) (figure 5). De par cet
arrangement, les gènes structurels des Nases font donc quasiment tous partie du même
transcrit.
1.6.2. Les autres gènes des clusters nif, vnf et anf
De nombreux gènes des clusters nif, vnf et anf ont des rôles dits accessoires, bien que ces
gènes soient indispensables à la fixation d’azote. Ils sont impliqués dans les mécanismes
de conformation, de maturation et d’activation menant à des Nases actives capables de
lier et réduire leurs substrats (figure 5). D’autres gènes sont spécifiquement dédiés à la
régulation de la fixation d’azote. Les gènes nifA et nifL codent l’activateur et le répresseur
du cluster nif, respectivement. Les homologues de nifA ont été retrouvés dans les clusters
vnf et anf (vnfA et anfA) et assurent l’activation de l’expression des gènes vnf et anf
(Bennett et al., 1988; Joerger et al., 1989; Walmsley et al., 1994). Pour les Nases
alternatives, aucun homologue de nifL n’a été retrouvé (Joerger et al., 1989), suggérant
27
l’action de NifL dans la répression des Nases alternatives ou encore un mécanisme de
répression différent.
La formation, l’activité et la régulation d’une isoforme requiert donc la contribution d’un
grand nombre de gènes. La Mo-Nase nécessite la contribution des gènes du cluster nif,
tandis que les Nases alternatives requièrent à la fois les clusters vnf ou anf, ainsi que
certains gènes du cluster nif (Kennedy and Dean, 1992; Drummond et al., 1996).
1.7. Importance des micronutriments pour la fixation biologique d’azote
Malgré leur caractère essentiel à plusieurs activités biologiques, la dynamique des
micronutriments (métaux) a reçu moins d’attention que celle des macronutriments.
Pourtant cette dynamique influence les flux de macronutriments dans les grands
réservoirs en conditionnant fortement les activités biologiques (Stevenson and Cole,
1999; Hänsch and Mendel, 2009). L’intérêt pour les cycles biogéochimiques des
micronutriments a augmenté ces dernières années et il est certain qu’élucider ces cycles
nous permettra de mieux comprendre nos écosystèmes.
La FBA est un bon exemple de réaction faisant intervenir le cycle des micronutriments
dans celui d’un élément majeur. L’enzyme responsable de la FBA est une métalloenzyme,
donc complètement dépendante des métaux cofacteurs requis. La FBA est donc
étroitement liée aux cycles des éléments Mo, V et Fe. L’importance de ces métaux pour la
FBA a par exemple été mise en évidence dans des études portant sur le Mo dans les sols
de la forêt tropicale du Panama, ceux de l’Est Canadien (Barron et al., 2009; Jean et al.,
2013) ou encore en milieux aquatiques (Glass et al., 2012). Dans ces écosystèmes, la FBA
est limitée par la disponibilité du Mo (associée à une limitation par le P dans l’Est
Canadien).
28
1.7.1. Les métaux essentiels des isoformes des nitrogénases
L’ubiquité de la Mo-Nase ainsi que son efficacité supérieure à réduire le diazote suggère
une forte dépendance de la FBA à ce métal. La présence aléatoire des Nases alternatives
ainsi que leur plus faible efficacité à réduire le diazote suggèrent que celles-ci seraient
principalement utilisées dans des conditions limitantes quantitativement en Mo. Des
cultures pures de diazotrophes montrent effectivement une utilisation des Nases
alternatives seulement en absence ou en limitation en Mo (Schneider et al., 1991; Jacobitz
and Bishop, 1992; Thiel and Pratte, 2013), de même que des échantillons de terrain de la
symbiose diazotrophe Peltigera aphtosa (Darnajoux et al., 2016). Cependant de
nombreux travaux en laboratoire sont effectués dans des conditions peu réalistes où les
métaux cofacteurs sont fournis sous forme biodisponible (non complexée). Les
diazotrophes investissent alors préférentiellement dans l’acquisition du Mo qui a un
rendement de fixation d’azote plus avantageux. L’acquisition et l’utilisation de V
commence seulement lorsque le Mo devient limitant (quantitativement), établissant ainsi
une hiérarchie. La régulation de l’expression de la Nase au V par Mo, et de la Nase au Fe
par Mo et V (Jacobson et al., 1986; Walmsley and Kennedy, 1991; Premakumar et al.,
1998), semble supporter l’existence d’une hiérarchie dans l’activation des isoformes de la
Nase reflétant l’efficacité relative des isoformes et le contrôle par la disponibilité des
métaux cofacteurs.
Cependant, la mise en évidence de la limitation de la FBA par le Mo dans de nombreux
écosystèmes ainsi que l’omniprésence des gènes des Nases alternatives suggèrent que les
Nases alternatives pourraient être mises à contribution de manière récurrente en milieu
naturel afin de pallier à un manque de disponibilité du Mo (Silvester, 1989; Loveless et
al., 1999; Betancourt et al., 2008; Barron et al., 2009; Jean et al., 2013; Darnajoux et al.,
2014). Outre le facteur abondance qui influence la disponibilité du Mo et conduit à la
limitation en termes de quantité, il est important de prendre en compte le facteur
biodisponibilité du Mo et des autres métaux cofacteurs afin de mieux comprendre leur
utilisation.
29
La biodisponibilité des métaux constitue donc un paramètre important de notre
compréhension de la contribution des isoformes de la Nase à la FBA. Ce paramètre
dépend non seulement de la spéciation des métaux (selon les conditions physico-
chimiques), mais aussi des stratégies mises en œuvre par les diazotrophes pour les
acquérir.
1.7.2. Spéciation et stratégies d’acquisition des métaux cofacteurs de la nitrogénase
Le Mo est l’un des métaux d’intérêt biologique le moins abondant de l’écorce terrestre et
des sols puisqu’il est présent à environ 1 ppm (53ème
position). Le V est en moyenne 50 à
200 fois plus abondant, en moyenne 98 ppm (20ème
position) (Wedepohl, 1995). Ils sont
majoritairement présents dans les sols sous formes d’oxoanions, molybdate (MoO42-
(Mo(VI)) et vanadate (VO43-
(V)), très solubles donc théoriquement très biodisponibles et
mobiles (Alloway, 2013). Cependant, ces oxoanions sont complexés à la matrice du sol
par la matière organique et minérale (Branca et al., 1990; Peacock and Sherman, 2004;
Xu et al., 2006; Wichard et al., 2009b; Alloway, 2013; Marks et al., 2015). Cette
complexation permet de limiter le lessivage de ces composés ce qui peut être bénéfique
aux fixateurs d’azote, mais peut à l’inverse induire des problèmes de disponibilité pour
les organismes vivants.
Divers diazotrophes, comme d’autres organismes, ont développé des stratégies
d’acquisition de métaux leur permettant d’accéder à ces sources de métaux cofacteurs.
Ces stratégies reposent sur la production de ligands de haute affinité pour Fe, Mo et V, les
métallophores. Les métallophores sont des ligands de faible poids moléculaire (200 –
2000 Da) répartis en trois grandes familles selon les groupements fonctionnels permettant
de chélater les métaux : les hydroxamates, les catécholates et les carboxylates (Bellenger
et al., 2007; Ahmed and Holmström, 2014; Kraemer et al., 2015) (figure 6). Ces
groupements leur confèrent la capacité de complexer divers métaux avec plus ou moins
d’affinité.
30
Figure 6. Groupements fonctionnels des métallophores . A) groupement hydroxamate.
B) groupement catéchol. C) groupement carboxylate.
Diverses études ont démontré l’importance des métallophores, notamment catécholates,
dans l’homéostasie des métaux essentiels (Fe, Mo et V) pour la FBA chez le diazotrophe
modèle A. vinelandii (Duhme et al., 1996, 1997, 1998; Bellenger et al., 2007; J. P.
Bellenger et al., 2008; Kraepiel et al., 2009).
En milieu naturel, l’utilisation des divers isoformes de la Nase est sans doute fortement
dépendante de la capacité de l’organisme fixateur d’azote à acquérir les métaux essentiels.
Cette biodisponibilité est le résultat d’interactions complexes entre le milieu (spéciation)
et les systèmes d’acquisition des diazotrophes (métallophores). Ces interactions jouent
sans doute un rôle d’autant plus important que la disponibilité abiotique de Fe, Mo et V
est très faible. Cependant, la majorité de nos connaissances sur l’acquisition des métaux et
leur utilisation pour la FBA repose sur des expériences de laboratoire dans lesquelles les
métaux sont généralement fournis sous forme facilement biodisponible (Fe-EDTA,
Molybdate et vanadate non complexés). Ces conditions, très peu stressantes du point de
vue de l’acquisition des métaux, sont peu représentatives des conditions naturelles. Il est
ainsi pertinent de s’interroger sur la validité de nos conceptions actuelles de l’utilisation et
la relation des Nases (hiérarchie et activation en cascade).
31
1.8. Organisme d’étude : Azotobacter vinelandii
Azotobacter vinelandii est une Gammaprotéobactérie à Gram négatif, aérobie stricte,
possédant les 3 isoformes de la Nase (Bishop et al., 1980, 1982; Hales et al., 1986;
Chisnell et al., 1988; Joerger et al., 1989). C’est une bactérie ubiquiste se retrouvant dans
des horizons organiques (litière) et minéraux (rhizosphère). Elle réside dans les sols où
elle est exposée à un mélange de matières organique et minérale. Le génome d’A.
vinelandii OP utilisé pour les projets de ce doctorat a été entièrement séquencé en 2013
(Noar and Bruno-Bárcena, 2013). Cet organisme a fait l’objet de nombreuses études sur la
diazotrophie. L’homéostasie des métaux essentiels Fe, Mo et V en conditions
diazotrophes a été bien caractérisée dans des expériences de laboratoire ou les métaux ont
été fournis sous forme biodisponible (Fe-EDTA, molyddate et vanadate) (Bellenger et al.,
2011) (Tableau 1).
Tableau 1. Concentrations clés en métaux essentiels molybdène, vanadium et fer lors
de la croissance diazotrophe d’Azotobacter vinelandii.
Concentration
extracellulaire
(M)
Concentration
limitante
(M)
Quota cellulaire
limitant
(molmétal/molP)
Concentration
toxique (M)
Mo 1 × 10-7
1 × 10-6
≤ 3 × 10-8
2,6 × 10-4
≥ 1 × 10-5
V 5 × 10-7
1 × 10-6
≤ 10-7
N.D. ≥ 10-5
Fe 5 × 10-6
≤ 10-6
~ 8 × 10-3
˃ 5 × 10-5
N.D. : donnée Non Disponible
Le processus d’acquisition de ces métaux a également été bien élucidé. Le chélome (les
métallophores et leurs voies de synthèse) d’A. vinelandii a récemment été publié par
Baars et al., (2016). Six métallophores servent à assurer l’acquisition des métaux, des
catécholamides: acide 2,3-dihydroxybenzoique (monocatéchol), aminochéline
32
(monocatéchol), azotochéline (bis-catéchol), protochéline (tris-catéchol), un carboxylate :
vibrioferrine, et une pyoverdine : azotobactine (Cornish and Page, 1995; Duhme et al.,
1996; Baars et al., 2016) (figure 7).
Figure 7. Structure chimique des métallophores produits par A. vinelandii . (Haut)
DHBA : acide 2,3-dihydroxybenzoique, protochéline et vibrioferrine. (Bas) Aminochéline,
azotochéline et azotobactine.
La nature et l’abondance des ligands secrétés par la bactérie sont principalement fonction
du niveau de fer biodisponible, mais aussi d’autres métaux tels que Mo, V et tungstène
(W). Ceci est particulièrement vrai pour le DHBA et l’azotobactine, qui sont produits
abondamment dans des conditions de carence élevée en fer (Page and von Tigerstrom,
1982; Tindale et al., 2000). La production des autres espèces de métallophores est aussi
fer-dépendante, mais il a été démontré que d’autres métaux tels que le Mo, le tungstène
(W) et le V pouvaient moduler la production de certains ligands (Cornish and Page, 1995;
Duhme et al., 1996, 1998; Bellenger et al., 2007; Bellenger et al., 2008a; Bellenger et al.,
33
2008b; Wichard et al., 2009a; Duhme-Klair, 2009; Kraepiel et al., 2009; Wichard et al.,
2009b; Deicke et al., 2014).
Les métaux sont internalisés par A. vinelandii via des systèmes de transport de haute
affinité de type ABC pour Fe et Mo, tandis que celui pour le V reste à identifier (Page and
Huyer, 1984; Luque et al., 1993; Mouncey et al., 1995; Imperial et al., 1998; Stintzi et al.,
2000; Self et al., 2001). Par analogie avec les transporteurs ABC de haute affinité pour le
V identifiés chez Anabaena variabilis (Pratte and Thiel, 2006), le transport du V chez A.
vinelandii pourrait également dépendre d’un système de type ABC. L’utilisation des
isoformes des Nases par A. vinelandii pour la fixation d’azote en conditions de
laboratoires optimales (température > 15˚C, métaux essentiels sous forme biodisponibles)
suit une hiérarchie qui rappelle celle de l’efficacité théorique des isoformes : Mo-Nase,
V-Nase et enfin Fe-Nase (Masepohl et al., 2002; Bellenger et al., 2011). A. vinelandii
constitue donc un modèle idéal pour l’étude de l’acquisition et l’utilisation des métaux
cofacteurs à la diazotrophie.
34
1.9. Hypothèse générale et objectifs
L’hypothèse générale du projet de doctorat est que la présence d’agents complexants va
influencer la stratégie d’acquisition et d’utilisation des métaux essentiels à la diazotrophie
chez A. vinelandii et que les Nases alternatives, notamment au V, contribueront de
manière accrue à la FBA en conditions stressantes d’acquisition des métaux cofacteurs
(Mo et V).
Cette hypothèse a été testée en utilisant des agents complexants représentatifs des habitats
naturels de ce diazotrophe. L’acide tannique est représentatif de la matière organique
dissoute du sol, composée majoritairement de tannins dans la litière (Hättenschwiler and
Vitousek, 2000; Slabbert, 2012). Quant aux oxydes de Fe, ils constituent une composante
importante de la matière minérale des couches plus profondes du sol (Cornell and
Schwertmann, 2006; Robin et al., 2008).
Afin de tester l’hypothèse formulée précédemment, l’organisme modèle A. vinelandii a
été soumis à des stress abiotiques simulant les conditions environnementales, et sa
réponse a été suivie dans le cadre des sous-objectifs suivants :
Étudier l’effet de la présence de matière organique dissoute (Objectif 1) et d’oxydes de Fe
(Objectif 2) sur
- la croissance bactérienne diazotrophe par spectrophotométrie UV
- l’acquisition des métaux cofacteurs des Nases en suivant l’évolution du contenu
intracellulaire en métaux essentiels par analyse élémentaire (ICP-MS)
- la quantité et qualité des métallophores libérés dans le milieu extracellulaire par
spectrométrie de masse
35
- l’expression des gènes spécifiques aux différentes isoformes des Nases par RT-
qPCR.
36
CHAPITRE 2
RÉSULTATS
Les résultats obtenus au cours du doctorat sont pour la majorité contenus dans deux
articles scientifiques. L’un a été publié et l’autre a été soumis, tous deux dans des
journaux avec comité de lecture. Ce chapitre présente ces deux articles qui répondent aux
objectifs mentionnés dans la section précédente.
2.1. Effet de la matière organique sur l’homéostasie des métaux cofacteurs de la
nitrogénase pour la fixation d’azote chez A. vinelandii
2.1.1. Présentation de l’article
L’objectif de cette première étude était d’étudier la gestion des métaux essentiels pour la
fixation d’azote par A. vinelandii en présence de matière organique. En effet depuis
quelques années, plusieurs études remettent en question la prédominance de l’utilisation
du molybdène (Mo) sur le vanadium (V) et le fer (Fe) comme métaux cofacteurs pour la
diazotrophie. Ce questionnement s’appuie sur des données telles que l’abondance relative
des métaux cofacteurs essentiels ou encore la présence des gènes des Nases alternatives
dans plusieurs écosystèmes. Cependant aucune étude, à notre connaissance, n’a
réellement montré pourquoi et dans quelles conditions cette hiérarchie ne s’applique plus,
ou au moins dans quelles conditions la participation des autres métaux essentiels devient
significative.
Afin de se rapprocher des conditions environnementales d’A. vinelandii, nous avons
choisi comme facteur de stress l’ajout d’acide tannique. Cette molécule représente la
37
matière organique dissoute du sol, qui caractérise litière et rhizosphère, habitats naturels
de la bactérie diazotrophe. Nous avons vérifié dans un premier temps que l’acide tannique
complexe bien Mo et V dans nos conditions de culture. Nous avons ainsi pu montrer
qu’afin de conserver un taux de croissance optimal dans ces conditions, A. vinelandii
modifie sa stratégie d’acquisition des métaux, notamment en produisant (ou secrétant)
plus de métallophores protochéline et azotochéline. Elle se détourne alors d’une
acquisition préférentielle de Mo telle que connue jusqu’à lors, pour adopter une
acquisition simultanée de Mo et V. Cette stratégie a conduit à une internalisation
simultanée de Mo et V. Pour ce qui est de la contribution des différentes Nases à la
fixation d’azote, en suivant l’évolution des niveaux de transcrits des gènes nifD, vnfD et
anfD, spécifiques des isoformes au Mo, V et Fe respectivement, nous avons observé une
diminution du niveau de transcrits de nifD tandis que celui de vnfD augmente. Ce profil
suggère une contribution de la V-Nase à la fixation d’azote. Nous avons donc démontré
qu’en présence de matière organique, A. vinelandii tire profit de la diversité de ses Nases
pour assurer une croissance diazotrophe optimale en modifiant l’homéostasie des métaux
essentiels. Ceci suggère que dans l’horizon O (couche organique du sol, constitué de
litière et de matière organique en décomposition) des sols riche en matière organique, le
V pourrait contribuer de manière plus significative à la fixation d’azote.
Les résultats de cette étude sont présentés dans l’article qui suit :
Jouogo Noumsi C.1,2
, Pourhassan N.1, Darnajoux R.
1, Deicke M.
3, Wichard T.
3, Burrus
V.2, Bellenger JP.
1 (2016). Effect of organic matter on nitrogenase metal cofactors
homeostasis in Azotobacter vinelandii under diazotrophic conditions. Environ. Microbiol.
Rep. 8(1): 76–84. doi:10.1111/1758-2229.12353
2.1.2 Contribution à l’article
38
L’approche expérimentale a été définie avec Jean-Philippe Bellenger et Vincent Burrus.
J’ai réalisé les expériences de culture, analysé l’expression des gènes. L’analyse du
contenu intracellulaire en métaux par ICP-MS a été faite conjointement avec Romain
Darnajoux. La méthode de dosage des métallophores par UPLC-MS a été développée par
Nina Pourhassan, Michael Deicke et Thomas Wichard. L’analyse de ces métallophores a
été effectuée conjointement avec Nina Pourhassan. J’ai rédigé le manuscrit et généré les
figures, et tout cela a été révisé par tous les co-auteurs.
39
2.1.3. Page titre
Effect of organic matter on nitrogenase metal cofactors homeostasis in Azotobacter
vinelandii under diazotrophic conditions
Christelle Jouogo Noumsi 1,2
, Nina Pourhassan1, Romain Darnajoux
1, Michael Deicke
3,
Thomas Wichard3, Vincent Burrus
2, Jean-Philippe Bellenger
1.
1Département de chimie, Faculté des sciences, Université de Sherbrooke;
2Laboratory of bacterial molecular genetics, Département de biologie, Faculté des
sciences, Université de Sherbrooke, Sherbrooke (Québec), Canada.
3Friedrich Schiller University Jena, Institute for Inorganic and Analytical Chemistry, Jena
School for Microbial Communication, Lessingstr. 8, 07743 Jena, Germany.
Corresponding author: Jean-Philippe Bellenger
2500 Boulevard de l’université, J1K 2R1, Sherbrooke (Québec), Canada
Phone number: 819 821-7014. Fax number: 819 821-8017
Jean-Philippe.Bellenger@usherbrooke.ca
Running Title: Tannic acid modulates metal use in A. vinelandii
40
2.1.4. Summary
Biological nitrogen fixation can be catalyzed by three isozymes of nitrogenase: Mo-
nitrogenase, V-nitrogenase and Fe-nitrogenase. The activity of these isozymes strongly
depends on their metal cofactors, Mo, V and Fe, and their bioavailability in ecosystems.
Here, we show how metal bioavailability can be affected by the presence of tannic acid
(organic matter), and the subsequent consequences on diazotrophic growth of the soil
bacterium Azotobacter vinelandii. In the presence of tannic acids, A. vinelandii produces a
higher amount of metallophores, which coincides with an active, regulated and
concomitant acquisition of Mo and V under cellular conditions that are usually considered
not Mo limiting. The associated nitrogenase genes exhibit decreased nifD expression and
increased vnfD expression. Thus, in limiting bioavailable metal conditions, A. vinelandii
takes advantage of its nitrogenase diversity to ensure optimal diazotrophic growth.
Keywords: Azotobacter vinelandii, nitrogen fixation, metallophores, tannic acid
2.1.5. Introduction
Biological nitrogen fixation, the reaction that converts atmospheric dinitrogen (N2) into
bioavailable ammonia, is the main source of new nitrogen (N) in unmanaged ecosystems.
This reaction is key to the understanding of the N cycle and has been shown to limit net
primary production in many ecosystems (Galloway et al., 2004). Nitrogen fixers use the
enzyme nitrogenase, a metalloprotein, to catalyze the reaction. Three nitrogenase
isoforms have been described to date and classified based on the metal present in the
cofactor: the molybdenum nitrogenase (Mo-Nase), the vanadium nitrogenase (V-Nase)
and the iron-only nitrogenase (Fe-Nase) (Bishop et al., 1980, 1982; Hales et al., 1986;
Robson et al., 1986; Chisnell et al., 1988; Schneider et al., 1991; Rehder, 2000;
Masukawa et al., 2009). The canonical Mo-Nase is the most efficient isozyme at ambient
41
temperature and is found in all diazotrophs. The less efficient V-Nase and Fe-Nase, also
called alternative nitrogenases, are present in only few N2 fixers and have never been
reported in microorganisms living in symbiotic associations with higher plants (Loveless
and Bishop, 1999; Boyd et al., 2011). Thus, the Mo-Nase is considered as the
predominant isozyme responsible for N2 fixation worldwide. However, recent evidence
questions this paradigm. Several studies have reported that Mo is limiting biological N
fixation in many aquatic and terrestrial ecosystems (Silvester, 1989; Barron et al., 2009;
Glass et al., 2012; Jean et al., 2013). The presence of alternative nitrogenases has also
been reported in diverse aquatic and terrestrial ecosystems (Loveless et al., 1999;
Betancourt et al., 2008; Hodkinson et al., 2014). While the importance of alternative
nitrogenases to biological nitrogen fixation is becoming increasingly evident (Reed et al.,
2011), our understanding of the conditions under which alternative nitrogenases come
into play in natural habitats remains incomplete. Temperature could influence
nitrogenases use as the alternative V-Nase reduces N2 more efficiently than the Mo-Nase
under low temperature (< 15˚C) (Miller and Eady, 1988). Moreover, soils contain on
average 50-200 times more V than Mo (Wedepohl, 1995; Kabata-Pendias, 2010). The
relative availability of Mo and V could thus promote the use of alternative Nases.
In the environment, Mo and V are mostly found as oxoanions in aqueous solution and
can form complexes with plant-derived tannins and tannin-like compounds in the topsoil
((Abdel-Gawad and Issa, 1986)Branca et al., 1990; Kiboku and Yoshimura, 1958; Reddy
and Gloss, 1993; Poledniok, 2003; Wichard et al., 2009a). Tannins are among the most
abundant biomolecules in terrestrial biomass especially in litters (Hättenschwiler and
Vitousek, 2000; Slabbert, 2012). Therefore, binding of Mo and V to natural organic
matter (i.e. tannin like compounds) reduces leaching of essential trace metals, and is thus
a critical process supporting biological N fixation (Wichard et al., 2009a).
Organisms have developed efficient strategies to retrieve metals from their environment
by producing small organic ligands, known as metallophores, to impact metal speciation
in the extracellular environment and better control metal acquisition (Kraemer et al.,
2015). Metallophores produced by the non-symbiotic N2 fixer Azotobacter vinelandii
42
exhibit high affinity for several metals, including Fe, Mo and V, and are involved in a
specific and highly regulated uptake system for the acquisition of nitrogenase metal
cofactors (Duhme et al., 1996, 1998; Bellenger et al., 2007; Kraepiel et al., 2009;
Wichard et al., 2009b) . The efficiency of bacterial metallophores to compete with natural
metal-complexes is key to recruit Mo and likely V from natural sources, such as the leaf
litter and O-horizon of soils, both very rich in organic matter. Complex interactions
between metallophores and tannic acid complexes might significantly affect nitrogenase
metal cofactors (Fe, Mo, V) acquisition a use that remains to be determined.
To get a comprehensive view of the impact of natural organic matter on metal acquisition
and use by A. vinelandii, we evaluated the effect of the supplementation of growth media
with tannic acids, used as a model substance for dissolved organic matter, on: (1) bacterial
growth, (2) cellular Fe, V and Mo quotas, (3) production of metallophores, and (4)
relative expression of three target genes nifD, vnfD and anfD encoding the subunits of
Mo-Nase, V-Nase, and Fe-Nase, respectively (Rubio and Ludden, 2005). Experiments
were conducted in the presence of equimolar concentrations of Mo and V ([Mo] = [V] =
10-7
M, results are presented in Sup. Inf.), and in the presence of an excess of V ([Mo] =
5×10-8
M; [V] = 2×10-7
M) to mimic the relative abundance of these metals in natural leaf
litters (Jean et al., unpublished data).
2.1.6. Result and Discussion
The exponential growth rates of A. vinelandii were not significantly affected by the
presence of tannic acids (see the inset of Fig. 1 and Sup. Inf. 1 Fig. S1). The only
observable effect of the presence of tannic acids was a delay at the beginning of the
exponential growth phase (~ 1.5 and 3 hours for 1×10-5
M and 5×10-5
M tannic acids,
respectively). However, our data show that the presence of tannic acids has a significant
43
effect on both the strategy of metal acquisition by A. vinelandii and the activation of its
three nitrogenase isoforms.
Figure 1: Growth curves of Azotobacter vinelandii. Absorbance at 620 nm was plotted versus
time for the three tested conditions. The inset shows curve fitting of growth by a nonlinear
regression (exponential growth) and the growth rate values obtained for each condition at the
exponential phase. Values represent the mean ± SD; n = 3. Ctrl: control. TA: tannic acid.
In common artificial growth media, bacteria have access to readily bioavailable Mo and V
sources: un-complexed molybdate and vanadate (Duhme et al., 1998; Bellenger et al.,
2011). Our data confirm that tannic acids efficiently complexed Mo and V (Sup. Inf. 2 Fig
S5) which strongly reduces their bioavailability.
This stress on metal acquisition affected metallophore production; in the presence of
tannic acid the amount of metallophores released by A. vinelandii (i.e. protochelin and
azotochelin) was up to 28-fold higher than in untreated culture, especially during the late
exponential phase (Fig. 2 and Sup. Inf. 1 Fig. S2). Complexes of Mo or V with
44
azotochelin and protochelin possess higher stability constants than those with tannic acids
indicating that protochelin and azotochelin can retrieve Mo and V from tannic acids
(Abdel-Gawad and Issa, 1986; Bellenger et al., 2008a). The release of elevated amounts
of metallophores can thus improve the efficiency of metal recruitment from tannate
complexes. We conclude that the delayed growth observed during lag phase compared to
the control culture without tannic acid supplementation was due to an enhanced
production of metallophores necessary to gather the metals from the tannate complex to
support diazotrophic exponential growth.
Figure 2: Metallophores production by Azotobacter vinelandii along the growth. A.
Protochelin and B. Azotochelin concentrations in supernatants of A. vinelandii cultures at OD
0.05, 0.1, 0.2, 0.4, 0.6 and 0.8. Ctrl: control. TA: tannic acid. Values represent the mean ± SE; n =
3. A two-way ANOVA with a Tukey’s multiple comparisons test was used to compare each
metallophore concentrations per and between conditions along the growth and at each OD. Similar
letters indicate no significant difference (P > 0.05).
45
The presence of tannic acids did not simply impact metallophore amount; it also had
significant effects on the metal acquisition strategy used by the bacterium. Fe cellular
quotas (QFe) were not affected by growth phase nor the presence of tannic acids (Fig. 3A
and Sup. Inf. 1 Fig S3A). The QFe measured in this study were within the range required
to sustain diazotrophic growth= (31 ± 16) × QFe – 0.2, Bellenger et al., 2011). This was
expected since Fe was supplied as Fe-EDTA, a strong complex (stability constant log =
25.7) (Martell and Smith, 1989). Taking the relatively weak stability constant of ferrous-
tannate complexes into account, the presence of tannic acids likely did not affect Fe
equilibrium or the ability of A. vinelandii to acquire iron. As observed for Fe, the presence
of tannic acids had no significant effect on Mo cellular quotas (QMo) as compared to the
control (Fig. 3B and Sup. Inf. 1 Fig S3B). In the lag phase (until OD620 = 0.1), QMo were
high in all cultures (~1-5×10-3
molMo molP-1
). Then, QMo decreased with cell division,
until OD620 0.2/0.4 was reached. For OD620 > 0.4, the decrease in QMo was decoupled
from cell division. At the end of the exponential phase, QMo remained within or higher
than the optimum range of QMo required to sustain diazotrophic growth in A. vinelandii
= (607 ± 188) × QMo, Bellenger et al., 2011). Under such conditions, V is not required for
diazotrophic growth and is not expected to be actively taken up by the bacterium. This
assumption was confirmed by the control cultures where cellular V quotas (Qv) decreased
with cell division during growth suggesting limited or no acquisition of new V from the
medium (V ≤ 10-23
molV cell-1
min-1
) (Fig. 3C and Sup. Inf. 1 Fig S3C, Sup Inf. 4 Fig
S6). Moreover, we argue that the intracellular V pool at the early stage of growth likely
resulted from the acquisition of free vanadate through low affinity uptake systems or
passive diffusion.
46
Figure 3: Evolution of cellular metal to phosphorus quotas in A. vinelandii. Metals content
was measured at OD = 0.05, 0.1, 0.2, 0.4, 0.6 and 0.8. Iron A, molybdenum B and vanadium C
cellular quotas. Zones between grey lines represent the range of optimum metal (i.e. Fe, Mo, V)
cellular quota required to sustain diazotrophic growth with our cultures’ instantaneous growth
rates (Bellenger et al., 2011). Opened circles represent control conditions, opened and closed
triangles represent tannic acids at 1×10-5
M and tannic acids at 5×10-5 M, respectively. Ctrl:
control. TA: tannic acid. Values represent the mean ± SD; n = 3. A two-way ANOVA with a
Tukey’s multiple comparisons test was used to compare the metal quotas between conditions
(Results of statistical tests are presented in table S2 of supporting information).
47
The significance of these mechanisms was strongly reduced after production of
metallophores complexing Mo and V in the growth medium. Once complexed by
metallophores, V acquisition is tightly regulated (Bellenger et al., 2008b). In the presence
of tannic acids, acquisition of V started, and was actively controlled, earlier in the growth
phase than in the absence of tannic acids. From OD ~ 0.2, Qv was maintained constant
despite active cell division showing an acquisition of V from the medium at rates 2 to 96
times higher than in control cultures (~ 10-22
- 10-21
molV cell-1
min-1
) (Fig. 3C and Sup.
Inf. 1 Fig S3C, Sup Inf. 4 Fig S6). This increase unlikely resulted from V acquisition
through low affinity uptake systems because (i) a large fraction of V was complexed to
tannic acids (Sup. Inf. 2, Fig. S5) and (ii) at OD = 0.2 enough metallophores (at least ~
10-7
M) had been released to complex any V (and Mo). It is noteworthy that in the
presence of tannic acids, at OD > 0.2 both cellular V quotas (Qv) and V uptake rates (V)
reached optimum Qv and V (3×10-21
molV cell-1
min-1
) required to sustain diazotrophic
growth at = 0.15 OD h-1
using V-Nase alone (V = (521 ± 94) × QV, Bellenger et al.,
2011) (Fig. 3C and Sup. Inf. 1 Fig S3A, Sup. Info. 2 Fig. S6).
Finally, the presence of tannic acids also impacted Nase expression since vnfD was
significantly more expressed in the presence of tannic acids than in untreated control.
Briefly, nifD expression decreased along the exponential growth under all conditions (up
to 5 fold difference with 5×10-5
M tannic acids). During the early log phase, the presence
of tannic acids (1×10-5
M) led to a twofold decrease of nifD as compared to the control
(Fig. 4A and Sup. Inf. 1 Fig S4A). This difference vanished at mid and end-log phase.
vnfD expression was strongly induced during growth with and without tannic acids (up to
382 fold) (Fig. 4B and Sup. Inf. 1 Fig S4B). The effect of tannic acids appeared at mid-
log phase with a twofold increase of vnfD expression in the presence of tannic acids
(5×10-5
M) which was statistically significant in the Mo:V = 1:1 (10-7
M) experiments
(Sup. Inf. 1 Fig S4B). The expression of anfD remained relatively stable during the log
phase and under all conditions (Fig. 4C and Sup. Inf. 1 Fig S4C). The decrease of nifD
48
mRNA levels suggests that the levels of Mo-Nase could decrease, and be compensated by
boosted vnfD expression.
Figure 4: Relative expression of nifD, vnfD and anfD during the exponential growth phase.
Gene expression was measured by RT-qPCR. Ctrl: control. TA: tannic acid. Values represent the
mean ± SD; n = 3 or 4. A two-way ANOVA with a Tukey’s multiple comparisons test was used
to compare the mRNA levels between conditions and along the growth. Asterisks indicate
significant differences between the same genes in different conditions (* = P < 0.05, ** = P <
0.01, *** = P < 0.001).
49
While A. vinelandii is known to accumulate large amounts of Mo in specific storage
systems (Pienkos & Brill, 1981), no such system has been found for V to date. The
accumulation of V in cells can easily become toxic if not used in nitrogenase (Baysse et
al., 2000; Bellenger et al., 2011). We thus hypothesize that V, which has accumulated in
the cells in the presence of tannic acids, was utilized to produce V-Nase. Furthermore,
growth rates during the diazotrophic exponential phase were similar independently of the
presence of tannic acids, implying comparable N2 fixation rates under all conditions.
Differences observed in nitrogenase activity between control and tannic acids conditions
using acetylene reduction assay (ARA) (Sup. Info. 5, Fig. S7) were thus likely due to the
use of the alternative V-Nase, whose efficiency to reduce acetylene is known to be lower
than Mo-Nase, leading to less ethylene formation. During ARA, the V-Nase is known to
produce ethane in addition to ethylene (Dilworth et al., 1987). Ethane production can thus
be used as a proxy for V-Nase activity. Unfortunately, ethane represents only 2-5% of the
ethylene produced (Schneider et al., 1991) and under our experimental conditions
nitrogenase activity was insufficient to permit efficient quantification of ethane, if any.
Whether or not V-Nase is active under these conditions remains to be confirmed.
Nonetheless, these data contrast with the general assumption that V-Nases are activated
only under Mo limited conditions (Jacobson et al., 1986; Jacobitz and Bishop, 1992;
Bellenger et al., 2011).
Active acquisition of V, and use in V-Nase, under conditions during which cellular Mo
quotas (QMo) are sufficient to sustain diazotrophic growth are very surprising. It can be
explained by the higher cost of metal acquisition in the presence of tannic acids. Under
such conditions, the bacterium has access to limited amounts of readily available Mo
(non-complexed) in its environment and thus the probability of metal uptake is increased
by the release of metallophores with high affinity constants to trace metals (Kraemer,
2004). Considering the cost of the metallophore-based acquisition of Mo and V, it is likely
that the bacterium optimizes metal acquisition and growth by acquiring and using any
metal made available after metallophore production and not simply selecting Mo (Fig. 5).
50
The assumption that V is acquired and the V-Nase genes are activated only when Mo
becomes limiting for diazotrophic growth might be due to the oversimplified conditions
used in laboratory experiments to study metal acquisition and homeostasis in A.
vinelandii, and other N2 fixers (Bellenger et al., 2011; Pratte et al., 2013).
Figure 5: Summary of the effects of the presence of tannic acids on nitrogenase metal
cofactors management by A. vinelandii. Left side: in the presence of free inorganic Mo and V,
A. vinelandii releases metallophores to complex and control the acquisition of metals (Bellenger
et al., 2011). Mo-metallophore complexes are preferentially taken up and Mo is used to sustain
diazotrophic growth. Right side: in the presence of tannic acids, which bind both Mo and V, A.
vinelandii releases a larger amount of metallophores to compete with tannic acids complexes. The
extra cost associated with metal acquisition leads to significant changes in both V homeostasis
and use. V is taken up and V-Nase gene expression is increased under conditions that are
traditionally viewed as not Mo-limiting.
51
2.1.7. Conclusion
Our data show that the presence of tannic acids clearly induced a switch in A. vinelandii
metal acquisition strategy (improved metallophore production and V uptake) and
nitrogenases genes expression (enhanced vnfD expression). This strongly suggests that
under hindered metal recruitment, such as the presence of natural organic matter, A.
vinelandii manages the acquisition of nitrogenase metal cofactors and nitrogenase
expression in a more complex manner than previously reported. These results invite
reconsideration of the current model of nitrogenase hierarchy, i.e. the view that Mo-Nase
is the main nitrogenase and that V- and Fe-Nases are the alternative nitrogenases
(Bellenger et al., 2011). This paradigm was built on few key laboratory experiments that
are not representative of natural habitats. The assumption of the predominance of Mo-
Nase over other means of N2 fixation (V-Nase and Fe-Nase) is mostly based on the higher
efficiency of the Mo-Nase to reduce N2 compared to the alternative Nases (Masepohl et
al., 2002). Higher efficiency of the Mo-Nase was established in pure cultures where Mo
and V were provided as inorganic forms or using purified enzymes, and is only verified at
temperature above 15°C. The real efficiency of nitrogenase isoforms to reduce N2 in
natural habitats likely integrates the cost of metal cofactor acquisition (i.e. cost of
metallophore production and uptake). The effect of natural organic matter and oxides on
the efficiency of N2 fixers to acquire and use nitrogenase metal cofactors needs to be
further investigated in order to determine whether or not current views of nitrogenase
hierarchy, applies to natural habitats.
52
2.1.8. Experimental procedures
2.1.8.1. Bacterial strain, Culture medium and growth conditions
The bacterium Azotobacter vinelandii strain OP (ATCC 13705) was grown aerobically
under diazotrophic conditions at 25˚ C, 210 rpm in a liquid medium as described by
Bellenger et al., 2011. Fe, V and Mo concentrations were adjusted by adding solutions of
Fe-EDTA, NaVO3 and Na2MoO4 respectively, to reach [Fe] = 5×10-6
M, [Mo] = [V] =
1×10-7
M or [Mo] = 5×10-8
M and [V] = 2×10-7
M depending on the experimental setup.
All products were purchased from Sigma-Aldrich (Saint Louis, MI, USA) and used as is.
Two final concentrations of commercial tannic acid C76H52O46 (Fisher Science, Illinois),
were tested: 1×10-5
M and 5×10-5
M. The inoculums were grown in a Mo and V free
medium to avoid any significant Mo and V pre-supply, and any Mo storage. Before
inoculation of A. vinelandii, the media were left in growth conditions for at least 2 hours
to insure stable equilibrium between tannic acid and metals.
2.1.8.2. Growth curves and growth rates
Bacterial growth was monitored and growth rates () were calculated according to
Bellenger et al., (2011). Aliquots of cultures were taken at regular time intervals. Samples
were centrifuged for 15 minutes at 4400 rpm. The supernatants were collected for
metallophore quantification (see below). Cell pellets were then prepared for metals
analysis as described by Bellenger et al., (2011) with minor modifications (see Sup. Info.
7).
53
2.1.8.3. Metallophores quantification
Metallophores were extracted and quantified as previously described by Deicke et al.,
(2013) with minor modifications (see Sup. Info. 7). All species of each determined
metallophore were summed up.
2.1.8.4. RNA isolation, cDNA synthesis and quantitative PCR assays
Total RNA extractions were performed on culture aliquots collected throughout
exponential phases (OD620 = 0.2, 0.4, 0.6 and 0.8) and cDNA were synthesized as
described previously (Poulin-Laprade and Burrus, 2015). RNA purity and concentration
were evaluated with the RNA chip Bioanalyzer 2100 (Agilent) and the spectrophotometer
ND-1000 (Nanodrop). RNA samples were stored at -80°C and cDNA sample mixtures
were purified with the PCR Purification Kit (Qiagen) and stored at -80°C. A control
reaction in the absence of reverse transcriptase (no-RT reaction) was performed.
Quantitative PCR reactions were performed with Quantifast SYBR Green PCR master
mix (Qiagen) using a Mastercycler ep gradient S realplex4 system (Eppendorf AG) for
data acquisition and analysis as previously described (Daccord et al., 2012) with minor
modifications (Sup. Inf. 7 and, Sup. Inf. 6 Table S3). For normalization, the RNA
polymerase σ70 subunit gene rpoD was used (Savli et al., 2003) and results presented as
relative expression based on the ΔCt calculation method (Schmittgen and Livak, 2008).
Experiments were carried out in at least three independent biological replicates, each with
three technical replicates, and combined.
54
2.1.8.5. Statistics and curve fitting
Statistical analyses and exponential fitting were all realized with the software GraphPad
Prism 6.00 for Windows, La Jolla California USA. Two-way ANOVA was performed,
followed by the Tukey’s multiple comparisons test to compare growth and/or tannic acid
effect.
2.1.9. Acknowledgments
This work was supported by a Discovery Grant and Discovery Acceleration Supplement
from the Natural Sciences and Engineering Council of Canada [326810, 412288 to V.B.];
V.B. holds a Canada Research Chair in molecular bacterial genetics. J.P.B. holds a
Canada Research Chair in terrestrial biogeochemistry. T.W. was supported by the
Collaborative Research Centre 1127 (ChemBioSys) of the Deutsche Forschungs-
gemeinschaft (DFG) and the German Academic Exchange Service (DAAD 56040395,
PPP with Canada). We are thankful to R. Gagnon, D. Matteau for their technical
assistance as well as, E. Bordeleau, N. Carraro, S. Delage, J. Letowski, D. Poulin-Laprade
and S. Rodrigue for helpful discussions and critical reading of the manuscript.
The authors declare no conflict of interest.
55
2.1.10. References
Abdel-Gawad, F.M. and Issa, R.M. (1986) Spectrometric determination of vanadium (V)
with tannic acid and its application to biological fluids. Ind. J. Chem. 25: 701-702.
Ind. J. Chem. 25: 701–702.
Ahmad, F., Ahmad, I., and Khan, M.S. (2008) Screening of free-living rhizospheric
bacteria for their multiple plant growth promoting activities. Microbiol. Res. 163:
173–81.
Ahmed, E. and Holmström, S.J.M. (2014) Siderophores in environmental research: roles
and applications. Microb. Biotechnol. 7: 196–208.
Alloway, B. (2013) Heavy metals in soils Third. Alloway,B.J. (ed).
Austin, S. and Lambert, J. (1994) Purification and in vitro activity of a truncated form of
ANFA. Transcriptional activator protein of alternative nitrogenase from Azotobacter
vinelandii. J. Biol. Chem. 269: 18141–8.
Baars, O., Zhang, X., Morel, F.M.M., and Seyedsayamdost, M.R. (2016) The Siderophore
Metabolome of Azotobacter vinelandii. Appl. Environ. Microbiol. 82: 27–39.
Bageshwar, U.K., Choudhury, N.R., and Das, H.K. (1998) Analysis of upstream
activation of the vnfH promoter of Azotobacter vinelandii - ProQuest. Can. J.
Microbiol. 44.:
Barrett, J., Ray, P., Sobczyk, A., Little, R., and Dixon, R. (2001) Concerted inhibition of
the transcriptional activation functions of the enhancer-binding protein NIFA by the
anti-activator NIFL. Mol. Microbiol. 39: 480–93.
Barron, A.R., Wurzburger, N., Bellenger, J.P., Wright, S.J., Kraepiel, A.M.L., and Hedin,
L.O. (2009) Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest
soils. Nat. Geosci. 2: 42–45.
Baumgartner, J. and Faivre, D. (2015) Iron solubility, colloids and their impact on iron
(oxyhydr)oxide formation from solution. Earth-Science Rev. 150: 520–530.
Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J.M., et al.
(2000) Vanadium interferes with siderophore-mediated iron uptake in Pseudomonas
aeruginosa. Microbiology 146 ( Pt 1: 2425–34.
Bellenger, J.-P., Arnaud-Neu, F., Asfari, Z., Myneni, S.C.B., Stiefel, E.I., and Kraepiel,
A.M.L. (2007) Complexation of oxoanions and cationic metals by the biscatecholate
siderophore azotochelin. J. Biol. Inorg. Chem. JBIC a Publ. Soc. Biol. Inorg. Chem.
12: 367–376.
56
Bellenger, J.P., Wichard, T., and Kraepiel, A.M.L. (2008) Vanadium requirements and
uptake kinetics in the dinitrogen-fixing bacterium Azotobacter vinelandii. Appl.
Environ. Microbiol. 74: 1478–1484.
Bellenger, J.P., Wichard, T., Kustka, A.B., and Kraepiel, A.M.L. (2008) Uptake of
molybdenum and vanadium by a nitrogen-fixing soil bacterium using siderophores.
Nat. Geosci. 1: 243–246.
Bellenger, J.-P., Wichard, T., Xu, Y., and Kraepiel, A.M.L. (2011) Essential metals for
nitrogen fixation in a free-living N2-fixing bacterium: chelation, homeostasis and
high use efficiency. Environ. Microbiol. 13: 1395–411.
Bennett, L.T., Cannon, F., and Dean, D.R. (1988) Nucleotide sequence and mutagenesis
of the nifA gene from Azotobacter vinelandii. Mol. Microbiol. 2: 315–21.
Betancourt, D.A., Loveless, T.M., Brown, J.W., and Bishop, P.E. (2008) Characterization
of Diazotrophs Containing Mo-Independent Nitrogenases, Isolated from Diverse
Natural Environments. Appl. Environ. Microbiol. 74: 3471–3480.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1980) Evidence for an alternative
nitrogen fixation system in Azotobacter vinelandii. Proc. Natl. Acad. Sci. U. S. A. 77:
7342–7346.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1982) Expression of an alternative
nitrogen fixation system in Azotobacter vinelandii. J. Bacteriol. 150: 1244–1251.
Blanco, G., Drummond, M., Woodley, P., and Kennedy, C. (1993) Sequence and
molecular analysis of the nifL gene of Azotobacter vinelandii. Mol. Microbiol. 9:
869–79.
Boison, G., Steingen, C., Stal, L.J., and Bothe, H. (2006) The rice field cyanobacteria
Anabaena azotica and Anabaena sp. CH1 express vanadium-dependent nitrogenase.
Arch. Microbiol. 186: 367–76.
Bothe, H., Schmitz, O., Yates, M.G., and Newton, W.E. (2010) Nitrogen fixation and
hydrogen metabolism in cyanobacteria. Microbiol. Mol. Biol. Rev. 74: 529–51.
Boyd, E.S., Hamilton, T.L., and Peters, J.W. (2011) An alternative path for the evolution
of biological nitrogen fixation. Front. Microbiol. 2: 205.
Branca, M., Micera, G., Sanna, D., and Dessì, A. (1990) Complexation of
oxovanadium(IV) by humic and tannic acids. J. Inorg. Biochem. 39: 109–115.
Brenchley, J.E., Prival, M.J., and Magasanik, B. (1973) Regulation of the synthesis of
enzymes responsible for glutamate formation in Klebsiella aerogenes. J. Biol. Chem.
248: 6122–8.
Brigle, K.E., Newton, W.E., and Dean, D.R. (1985) Complete nucleotide sequence of the
57
Azotobacter vinelandii nitrogenase structural gene cluster. Gene 37: 37–44.
Burgess, B.K. and Lowe, D.J. (1996) Mechanism of Molybdenum Nitrogenase. Chem.
Rev. 96: 2983–3012.
Burns, R.C. and Hardy, R.W.F. (2012) Nitrogen Fixation in Bacteria and Higher Plants
Springer Science & Business Media.
Cech, T. V. (2010) Principles of Water Resources: History, Development, Management,
and Policy John Wiley & Sons.
Chatterjee, R., Allen, R.M., Ludden, P.W., and Shah, V.K. (1997) In vitro synthesis of the
iron-molybdenum cofactor and maturation of the nif-encoded apodinitrogenase.
Effect of substitution of VNFH for NIFH. J. Biol. Chem. 272: 21604–21608.
Chisnell, J.R., Premakumar, R., and Bishop, P.E. (1988) Purification of a second
alternative nitrogenase from a nifHDK deletion strain of Azotobacter vinelandii. J.
Bacteriol. 170: 27–33.
Cornell, R.M. and Schwertmann, U. (2006) The Iron Oxides: Structure, Properties,
Reactions, Occurrences and Uses John Wiley & Sons.
Cornish, A. and Page, W. (1995) Production of the triacetecholate siderophore
protochelin by Azotobacter vinelandii. Biometals 8: 332–338.
Cornish, A.S. and Page, W.J. (2000) Role of molybdate and other transition metals in the
accumulation of protochelin by Azotobacter vinelandii. Appl. Environ. Microbiol.
66: 1580–1586.
Cornish, A.S. and Page, W.J. (1998) The catecholate siderophores of Azotobacter
vinelandii: their affinity for iron and role in oxygen stress management.
Microbiology 144: 1747–1754.
Crowley, D.E., Wang, Y.C., Reid, C.P.P., and Szaniszlo, P.J. (1991) Mechanisms of iron
acquisition from siderophores by microorganisms and plants. Plant Soil 130: 179–
198.
Daccord, A., Mursell, M., Poulin-Laprade, D., and Burrus, V. (2012) Dynamics of the
SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by
Integrating Conjugative Elements of the SXT/R391 Family. J. Bacteriol. 194: 5794–
5802.
Darnajoux, R., Constantin, J., Miadlikowska, J., Lutzoni, F., and Bellenger, J.-P. (2014) Is
vanadium a biometal for boreal cyanolichens? New Phytol. 202: 765–71.
Darnajoux, R., Zhang, X., McRose, D.L., Miadlikowska, J., Lutzoni, F., Kraepiel,
A.M.L., and Bellenger, J.-P. (2016) Biological nitrogen fixation by alternative
nitrogenases in boreal cyanolichens: importance of molybdenum availability and
58
implications for current biological nitrogen fixation estimates. New Phytol.
Deicke, M., Bellenger, J.-P., and Wichard, T. (2013) Direct quantification of bacterial
molybdenum and iron metallophores with ultra-high-performance liquid
chromatography coupled to time-of-flight mass spectrometry. J. Chromatogr. A
1298: 50–60.
Deicke, M., Mohr, J.F., Bellenger, J.-P., and Wichard, T. (2014) Metallophore mapping in
complex matrices by metal isotope coded profiling of organic ligands. Analyst 139:
6096–9.
Dilworth, M.J., Eady, R.R., Robson, R.L., and Miller, R.W. (1987) Ethane formation
from acetylene as a potential test for vanadium nitrogenase in vivo. Nature 327:
167–168.
Dixon, R. (1998) The oxygen-responsive NIFL-NIFA complex: a novel two-component
regulatory system controlling nitrogenase synthesis in gamma-proteobacteria. Arch.
Microbiol. 169: 371–80.
Djibaoui, D. and Bensoltane, A. (2005) Effect of iron and growth inhibitors on
siderophores production by Pseudomonas fluorescens. African J. Biotechnol. 4: 697–
702.
Drummond, M., Walmsley, J., and Kennedy, C. (1996) Expression from the nifB
promoter of Azotobacter vinelandii can be activated by NifA, VnfA, or AnfA
transcriptional activators. J. Bacteriol. 178: 788–92.
Duhme, A.-K., Dauter, Z., Hider, R.C., and Pohl, S. (1996) Complexation of
Molybdenum by Siderophores: Synthesis and Structure of the Double-Helical cis -
Dioxomolybdenum(VI) Complex of a Bis(catecholamide) Siderophore Analogue.
Inorg. Chem. 35: 3059–3061.
Duhme, A.-K., Hider, R.C., and Khodr, H.H. (1997) Synthesis and Iron-Binding
Properties of Protochelin, the Tris (catecholamide) Siderophore ofAzotobacter
vinelandii. Chem. Ber. 130: 969–973.
Duhme, A.-K., Hider, R.C., Naldrett, M.J., and Pau, R.N. (1998) The stability of the
molybdenum-azotochelin complex and its effect on siderophore production in
Azotobacter vinelandii. J. Biol. Inorg. Chem. 3: 520–526.
Duhme-Klair, A.-K. (2009) From siderophores and self-assembly to luminescent sensors:
the binding of molybdenum by catecholamides. Eur. J. Inorg. Chem. 2009: 3689–
3701.
Dyer, J.A., Trivedi, P., Scrivner, N.C., and Sparks, D.L. (2003) Lead sorpion onto
ferrihydrite. 2. Surface complexation modeling. Environ. Sci. Technol. 37: 915–22.
59
Eady, R.R. (1996) Structure−Function Relationships of Alternative Nitrogenases. Chem.
Rev. 96: 3013–3030.
Eady, R.R., Robson, R.L., Richardson, T.H., Miller, R.W., and Hawkins, M. (1987) The
vanadium nitrogenase of Azotobacter chroococcum . Purification and properties of
the VFe protein. Biochem. J. 244: 197–207.
Einsle, O. (2014) Nitrogenase FeMo cofactor: an atomic structure in three simple steps. J.
Biol. Inorg. Chem. 19: 737–45.
Elser, J.J., Bracken, M.E.S., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., et
al. (2007) Global analysis of nitrogen and phosphorus limitation of primary
producers in freshwater, marine and terrestrial ecosystems. Ecol. Lett. 10: 1135–42.
Fenske, D., Gnida, M., Schneider, K., Meyer-Klaucke, W., Schemberg, J., Henschel, V.,
et al. (2005) A new type of metalloprotein: The Mo storage protein from Azotobacter
vinelandii contains a polynuclear molybdenum-oxide cluster. Chembiochem 6: 405–
413.
Frise, E., Green, A., and Drummond, M. (1994) Chimeric transcriptional activators
generated in vivo from VnfA and AnfA of Azotobacter vinelandii: N-terminal
domain of AnfA is responsible for dependence on nitrogenase Fe protein. J.
Bacteriol. 176: 6545–9.
Galloway, J.N., Dentener, F.J., Capone, D.G., Boyer, E.W., Howarth, R.W., Seitzinger,
S.P., et al. (2004) Nitrogen cycles: past, present, and future. Biogeochemistry 70:
153–226.
Glass, J.B., Axler, R.P., Chandra, S., and Goldman, C.R. (2012) Molybdenum limitation
of microbial nitrogen assimilation in aquatic ecosystems and pure cultures. Front.
Microbiol. 3: 331.
Goldberg, S. and Forster, H.S. (1998) FACTORS AFFECTING MOLYBDENUM
ADSORPTION BY SOILS AND MINERALS. Soil Sci. 163: 109–114.
Goldberg, S., Forster, H.S., and Godfrey, C.L. (1996) Molybdenum Adsorption on
Oxides, Clay Minerals, and Soils. Soil Sci. Soc. Am. J. 60: 425.
Gu, B., Chang, J., Min, Y., Ge, Y., Zhu, Q., Galloway, J.N., et al. (2013) The role of
industrial nitrogen in the global nitrogen biogeochemical cycle. Sci. Rep. 3: 636–
639.
Hales, B.J., Langosch, D.J., and Case, E.E. (1986) Isolation and characterization of a
second nitrogenase Fe-protein from Azotobacter vinelandii. J. Biol. Chem. 261:
15301–15306.
Hänsch, R. and Mendel, R.R. (2009) Physiological functions of mineral micronutrients
60
(Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr. Opin. Plant Biol. 12: 259–266.
Hättenschwiler, S. and Vitousek, P. (2000) The role of polyphenols in terrestrial
ecosystem nutrient cycling. Trends Ecol. Evol. 15: 238–243.
Hemingway, R.W., Karchesy, J.J., and Branham, S.J. (1989) Chemistry and Significance
of Condensed Tannins Plenum Pre. Hemingway,R.W., Karchesy,J.J., and
Branham,S.J. (eds) Springer US, New York.
Hill, S., Austin, S., Eydmann, T., Jones, T., and Dixon, R. (1996) Azotobacter vinelandii
NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation
genes via a redox-sensitive switch. Proc. Natl. Acad. Sci. U. S. A. 93: 2143–8.
Hinnemann, B. and Nørskov, J.K. (2004) Chemical activity of the nitrogenase FeMo
cofactor with a central nitrogen ligand: density functional study. J. Am. Chem. Soc.
126: 3920–7.
Hirschman, J., Wong, P.K., Sei, K., Keener, J., and Kustu, S. (1985) Products of nitrogen
regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in
vitro: evidence that the ntrA product is a sigma factor. Proc. Natl. Acad. Sci. U. S. A.
82: 7525–9.
Hodkinson, B.P., Allen, J.L., Forrest, L.L., Goffinet, B., Sérusiaux, E., Andrésson, Ó.S.,
et al. (2014) Lichen-symbiotic cyanobacteria associated with Peltigera have an
alternative vanadium-dependent nitrogen fixation system. Eur. J. Phycol. 49: 11–19.
Hooper, D.U. and Johnson, L. (1999) Nitrogen limitation in dryland ecosystems:
Responses to geographical and temporal variation in precipitation. Biogeochemistry
46: 247–293.
Howard, J.B. and Rees, D.C. (2006) How many metals does it take to fix N2? A
mechanistic overview of biological nitrogen fixation. Proc. Natl. Acad. Sci. U. S. A.
103: 17088–93.
Howard, J.B. and Rees, D.C. (1996) Structural Basis of Biological Nitrogen Fixation.
Chem. Rev. 96: 2965–2982.
Hu, Y. and Ribbe, M.W. (2011) Biosynthesis of the Metalloclusters of Molybdenum
Nitrogenase. Microbiol. Mol. Biol. Rev. 75: 664–677.
Imperial, J., Hadi, M., and Amy, N.K. (1998) Molybdate binding by ModA, the
periplasmic component of the Escherichia coli mod molybdate transport system.
Biochim. Biophys. Acta 1370: 337–46.
Jacob, J. and Drummond, M. (1993) Construction of chimeric proteins from the ?; N -
associated transcriptional activators VnfA and AnfA of Azotobacter vinelandii
shows that the determinants of promoter specificity lie outside the’recognition'helix
61
of the HTH motif in the C-terminal . Mol. Microbiol. 10: 813–821.
Jacobitz, S. and Bishop, P.E. (1992) Regulation of nitrogenase-2 in Azotobacter
vinelandii by ammonium, molybdenum, and vanadium. J. Bacteriol. 174: 3884–
3888.
Jacobson, M.R., Brigle, K.E., Bennett, L.T., Setterquist, R.A., Wilson, M.S., Cash, V.L.,
et al. (1989) Physical and genetic map of the major nif gene cluster from Azotobacter
vinelandii. J. Bacteriol. 171: 1017–1027.
Jacobson, M.R., Premakumar, R., and Bishop, P.E. (1986) Transcriptional regulation of
nitrogen fixation by molybdenum in Azotobacter vinelandii. J. Bacteriol. 167: 480–
6.
Jean, M.-E., Phalyvong, K., Forest-Drolet, J., and Bellenger, J.-P. (2013) Molybdenum
and phosphorus limitation of asymbiotic nitrogen fixation in forests of Eastern
Canada: Influence of vegetative cover and seasonal variability. Soil Biol. Biochem.
67: 140–146.
Jiang, H.-B., Lou, W.-J., Ke, W.-T., Song, W.-Y., Price, N.M., and Qiu, B.-S. (2015)
New insights into iron acquisition by cyanobacteria: an essential role for ExbB-
ExbD complex in inorganic iron uptake. ISME J. 9: 297–309.
Joerger, R.D., Jacobson, M.R., and Bishop, P.E. (1989) Two nifA-like genes required for
expression of alternative nitrogenases by Azotobacter vinelandii. J. Bacteriol. 171:
3258–67.
Joerger, R.D., Jacobson, M.R., Premakumar, R., Wolfinger, E.D., and Bishop, P.E. (1989)
Nucleotide sequence and mutational analysis of the structural genes (anfHDGK) for
the second alternative nitrogenase from Azotobacter vinelandii. J. Bacteriol. 171:
1075–1086.
Joerger, R.D., Loveless, T.M., Pau, R.N., Mitchenall, L.A., Simon, B.H., and Bishop, P.E.
(1990) Nucleotide sequences and mutational analysis of the structural genes for
nitrogenase 2 of Azotobacter vinelandii. J. Bacteriol. 172: 3400–8.
Jouogo Noumsi, C., Pourhassan, N., Darnajoux, R., Deicke, M., Wichard, T., Burrus, V.,
and Bellenger, J.-P. (2016) Effect of organic matter on nitrogenase metal cofactors
homeostasis in Azotobacter vinelandii under diazotrophic conditions. Environ.
Microbiol. Rep. 8: 76–84.
Kabata-Pendias, A. (2010) Trace Elements in Soils and Plants, Fourth Edition CRC Press.
Keller, R.J., Coulombe, R.A., Sharma, R.P., Grover, T.A., and Piette, L.H. (1989)
Importance of hydroxyl radical in the vanadium-stimulated oxidation of NADH.
Free Radic. Biol. Med. 6: 15–22.
62
Kennedy, C. and Dean, D. (1992) The nifU, nifS and nifV gene products are required for
activity of all three nitrogenases of Azotobacter vinelandii. Mol. Gen. Genet. 231:
494–8.
Kirn, J. and Rees, D.C. (1992) Crystallographic structure and functional implications of
the nitrogenase molybdenum–iron protein from Azotobacter vinelandii. Nature 360:
553–560.
Kooner, Z.S. (1993) Comparative study of adsorption behavior of copper, lead, and zinc
onto goethite in aqueous systems. Environ. Geol. 21: 242–250.
Kraemer, S.M. (2004) Iron oxide dissolution and solubility in the presence of
siderophores. Aquat. Sci. - Res. Across Boundaries 66: 3–18.
Kraemer, S.M., Duckworth, O.W., Harrington, J.M., and Schenkeveld, W.D.C. (2015)
Metallophores and Trace Metal Biogeochemistry. Aquat. Geochemistry 21: 159–195.
Kraepiel, A.M.L., Bellenger, J.P., Wichard, T., and Morel, F.M.M. (2009) Multiple roles
of siderophores in free-living nitrogen-fixing bacteria. Biometals an Int. J. role Met.
ions Biol. Biochem. Med. 22: 573–581.
Kraus, T.E.C., Dahlgren, R.A., and Zasoski, R.J. (2003) Tannins in nutrient dynamics of
forest ecosystems - a review. Plant Soil 256: 41–66.
Kuiters, A.T. (1990) Role of phenolic substances from decomposing forest litter in plant-
soil interactions. Acta Bot. Neerl. 39: 329–348.
Lancaster, K.M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M.W., Neese, F., et al.
(2011) X-ray emission spectroscopy evidences a central carbon in the nitrogenase
iron-molybdenum cofactor. Science 334: 974–7.
Lane, T.W. and Morel, F.M. (2000) A biological function for cadmium in marine
diatoms. Proc. Natl. Acad. Sci. U. S. A. 97: 4627–31.
LeBauer, D.S. and Treseder, K.K. (2008) Nitrogen limitation of net primary productivity
in terrestrial ecosytems is globally distributed. Ecology 89: 371–379.
Lee, C.C., Hu, Y., and Ribbe, M.W. (2009) Unique features of the nitrogenase VFe
protein from Azotobacter vinelandii. Proc. Natl. Acad. Sci. 106: 9209–9214.
Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W.C., and Dixon, R. (2000)
Signal transduction to the Azotobacter vinelandii NIFL-NIFA regulatory system is
influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein.
EMBO J. 19: 6041–50.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San
Diego Calif 25: 402–408.
63
Loveless, T.M. and Bishop, P.E. (1999) Identification of genes unique to Mo-independent
nitrogenase systems in diverse diazotrophs. Can. J. Microbiol. 45: 312–317.
Loveless, T.M., Saah, J.R., and Bishop, P.E. (1999) Isolation of nitrogen-fixing bacteria
containing molybdenum-independent nitrogenases from natural environments. Appl.
Environ. Microbiol. 65: 4223–4226.
Lowe, D.J., Fisher, K., and Thorneley, R.N. (1993) Klebsiella pneumoniae nitrogenase:
pre-steady-state absorbance changes show that redox changes occur in the MoFe
protein that depend on substrate and component protein ratio; a role for P-centres in
reducing dinitrogen? Biochem. J. 292: 93–98.
Lu, X., Johnson, W.D., and Hook, J. (1998) Reaction of vanadate with aquatic humic
substances: an ESR and 51 V NMR study. Environ. Sci. Technol. 32: 2257–2263.
Luque, F., Mitchenall, L.A., Chapman, M., Christine, R., and Pau, R.N. (1993)
Characterization of genes involved in molybdenum transport in Azotobacter
vinelandii. Mol. Microbiol. 7: 447–59.
Luque, F. and Pau, R.N. (1991) Transcriptional regulation by metals of structural genes
for Azotobacter vinelandii nitrogenases. Mol. Gen. Genet. 227: 481–7.
Macaluso, A., Best, E.A., and Bender, R.A. (1990) Role of the nac gene product in the
nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes. J.
Bacteriol. 172: 7249–55.
Mackenzie, F.T., Ver, L.M., Sabine, C., Lane, M., and Lerman, A. (2013) Interactions of
C, N, P and S Biogeochemical Cycles and Global Change Roland,W.,
Mackenzie,F.T., and Chou,L. (eds) Springer Science & Business Media.
Marks, J.A., Perakis, S.S., King, E.K., and Pett-Ridge, J. (2015) Soil organic matter
regulates molybdenum storage and mobility in forests. Biogeochemistry 125: 167–
183.
Martell, A.E. and Smith, R.M. (1989) Critical stability constants. Plenum Press, New
York.
Masepohl, B., Schneider, K., Drepper, T., Muller, A., and Klipp, W. (2002) Nitrogen
fixation at the millennium G.J.,L. (ed) Elsevier.
Masukawa, H., Zhang, X., Yamazaki, E., Iwata, S., Nakamura, K., Mochimaru, M., et al.
(2009) Survey of the distribution of different types of nitrogenases and hydrogenases
in heterocyst-forming cyanobacteria. Mar. Biotechnol. (NY). 11: 397–409.
May, H.D. and Dean, R.D. (1991) Altered nitrogenase MoFe proteins from Azotobacter
vinelandii. Analysis of MoFe proteins having amino acid substitutions for the
conserved cysteine residues within the beta-subunit. Biochem. J. 277 (Pt 2): 457–64.
64
Meletzus, D., Rudnick, P., Doetsch, N., Green, A., and Kennedy, C. (1998)
Characterization of the glnK-amtB Operon of Azotobacter vinelandii. J. Bacteriol.
180: 3260–3264.
Merrick, M., Gibbins, J., and Toukdarian, A. (1987) The nucleotide sequence of the
sigma factor gene ntrA (rpoN) of Azotobacter vinelandii: analysis of conserved
sequences in NtrA proteins. Mol. Gen. Genet. 210: 323–30.
Merrick, M., Hill, S., Hennecke, H., Hahn, M., Dixon, R., and Kennedy, C. (1982)
Repressor properties of the nifL gene product in Klebsiella pneumoniae. MGG Mol.
Gen. Genet. 185: 75–81.
Merrick, M.J. and Gibbins, J.R. (1985) The nucleotide sequence of the nitrogen-
regulation gene ntrA of Klebsiella pneumoniae and comparison with conserved
features in bacterial RNA polymerase sigma factors. Nucleic Acids Res. 13: 7607–
20.
Miller, R.W. and Eady, R.R. (1988) Molybdenum and vanadium nitrogenases of
Azotobacter chroococcum. Low temperature favours N2 reduction by vanadium
nitrogenase. Biochem. J. 256: 429–432.
Monteiro, R.A., Souza, E.M., Yates, M.G., Pedrosa, F.O., and Chubatsu, L.S. (1999) In-
trans regulation of the N-truncated-NIFA protein of Herbaspirillum seropedicae by
the N-terminal domain. FEMS Microbiol. Lett. 180: 157–61.
Morrison, C.N., Hoy, J.A., Zhang, L., Einsle, O., and Rees, D.C. (2015) Substrate
pathways in the nitrogenase MoFe protein by experimental identification of small
molecule binding sites. Biochemistry 54: 2052–60.
Moshiri, F., Kim, J.W., Fu, C., and Maier, R.J. (1994) The FeSII protein of Azotobacter
vinelandii is not essential for aerobic nitrogen fixation, but confers significant
protection to oxygen-mediated inactivation of nitrogenase in vitro and in vivo. Mol.
Microbiol. 14: 101–114.
Mouncey, N.J., Mitchenall, L.A., and Pau, R.N. (1995) Mutational analysis of genes of
the mod locus involved in molybdenum transport, homeostasis, and processing in
Azotobacter vinelandii. J. Bacteriol. 177: 5294–302.
Moure, V.R., Costa, F.F., Cruz, L.M., Pedrosa, F.O., Souza, E.M., Li, X.-D., et al. (2015)
Regulation of nitrogenase by reversible mono-ADP-ribosylation. Curr. Top.
Microbiol. Immunol. 384: 89–106.
Nakajima, H., Takatani, N., Yoshimitsu, K., Itoh, M., Aono, S., Takahashi, Y., and
Watanabe, Y. (2010) The role of the Fe-S cluster in the sensory domain of
nitrogenase transcriptional activator VnfA from Azotobacter vinelandii. FEBS J.
277: 817–32.
65
Noar, J.D. and Bruno-Bárcena, J.M. (2013) Complete Genome Sequences of Azotobacter
vinelandii Wild-Type Strain CA and Tungsten-Tolerant Mutant Strain CA6. Genome
Announc. 1: e00313–13.
Nordlund, S. and Högbom, M. (2013) ADP-ribosylation, a mechanism regulating
nitrogenase activity. FEBS J. 280: 3484–90.
Nosheen, A., Bano, A., Ullah, F., Farooq, U., Yasmin, H., and Hussain, I. (2013) Effect
of plant growth promoting rhizobacteria on root morphology of Safflower (
Carthamus tinctorius L.). African J. Biotechnol. 10: 12638–12649.
Oda, Y., Samanta, S.K., Rey, F.E., Wu, L., Liu, X., Yan, T., et al. (2005) Functional
genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium
Rhodopseudomonas palustris. J. Bacteriol. 187: 7784–94.
Oelze, J. (2000) Respiratory protection of nitrogenase in Azotobacter species: is a widely
held hypothesis unequivocally supported by experimental evidence? FEMS
Microbiol. Rev. 24: 321–333.
Page, W.J. and Huyer, M. (1984) Derepression of the Azotobacter vinelandii siderophore
system, using iron-containing minerals to limit iron repletion. J. Bacteriol. 158: 496–
502.
Page, W.J. and von Tigerstrom, M. (1982) Iron- and molybdenum-repressible outer
membrane proteins in competent Azotobacter vinelandii. J. Bacteriol. 151: 237–42.
Pau, R.N. (1989) Nitrogenases without molybdenum. Trends Biochem. Sci. 14: 183–6.
Peacock, C.L. and Sherman, D.M. (2004) Vanadium(V) adsorption onto goethite (α-
FeOOH) at pH 1.5 to 12: a surface complexation model based on ab initio molecular
geometries and EXAFS spectroscopy. Geochim. Cosmochim. Acta 68: 1723–1733.
Peters, J.W., Fisher, K., Newton, W.E., and Dean, D.R. (1995) Involvement of the P
Cluster in Intramolecular Electron Transfer within the Nitrogenase MoFe Protein. J.
Biol. Chem. 270: 27007–27013.
Pienkos, P.T. and Brill, W.J. (1981) Molybdenum accumulation and storage in Klebsiella
pneumoniae and Azotobacter vinelandii. J. Bacteriol. 145: 743–51.
Poledniok, J. (2003) Speciation of vanadium in soil. Talanta 59: 1–8.
Poulin-Laprade, D. and Burrus, V. (2015) A λ Cro-like repressor is essential for the
induction of conjugative transfer of SXT/R391 elements in response to DNA
damage. J. Bacteriol.
Pratte, B.S., Eplin, K., and Thiel, T. (2006) Cross-functionality of nitrogenase
components NifH1 and VnfH in Anabaena variabilis. J. Bacteriol. 188: 5806–5811.
66
Pratte, B.S., Sheridan, R., James, J.A., and Thiel, T. (2013) Regulation of V-nitrogenase
genes in Anabaena variabilis by RNA processing and by dual repressors. Mol.
Microbiol. 88: 413–24.
Pratte, B.S. and Thiel, T. (2006) High-Affinity Vanadate Transport System in the
Cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol. 188: 464–468.
Premakumar, R., Loveless, T.M., and Bishop, P.E. (1994) Effect of amino acid
substitutions in a potential metal-binding site of AnfA on expression from the anfH
promoter in Azotobacter vinelandii. J. Bacteriol. 176: 6139–42.
Premakumar, R., Pau, R.N., Mitchenall, L.A., Easo, M., and Bishop, P.E. (1998)
Regulation of the transcriptional activators AnfA and VnfA by metals and
ammonium in Azotobacter vinelandii. FEMS Microbiol. Lett. 164: 63–68.
Raymond, J., Siefert, J.L., Staples, C.R., and Blankenship, R.E. (2004) The natural
history of nitrogen fixation. Mol. Biol. Evol. 21: 541–54.
Reddy, K.J. and Gloss, S.P. (1993) Geochemical speciation as related to the mobility of F,
Mo and Se in soil leachates. Appl. Geochemistry 8: 159–163.
Reed, S.C., Cleveland, C.C., and Townsend, A.R. (2011) Functional ecology of free-
living nitrogen fixation: a contemporary perspective. Annu. Rev. Ecol. Evol. Syst. 42:
489–512.
Rees, D.C., Akif Tezcan, F., Haynes, C.A., Walton, M.Y., Andrade, S., Einsle, O., and
Howard, J.B. (2005) Structural basis of biological nitrogen fixation. Philos. Trans.
A. Math. Phys. Eng. Sci. 363: 971–84; discussion 1035–40.
Rees, D.C. and Howard, J.B. (2000) Nitrogenase: standing at the crossroads. Curr. Opin.
Chem. Biol. 4: 559–566.
Rehder, D. (2000) Vanadium nitrogenase. J. Inorg. Biochem. 80: 133–136.
Robin, A., Vansuyt, G., Hinsinger, P., Meyer, J.M., Briat, J.F., and Lemanceau, P. (2008)
Chapter 4 Iron Dynamics in the Rhizosphere: Consequences for Plant Health and
Nutrition. Adv. Agron. 99: 183–225.
Robson, R.L., Eady, R.R., Richardson, T.H., Miller, R.W., Hawkins, M., and Postgate,
J.R. (1986) The alternative nitrogenase of Azotobacter chroococcum is a vanadium
enzyme. Nature 322: 388–390.
Robson, R.L. and Postgate, J.R. (1980) Oxygen and hydrogen in biological nitrogen
fixation. Annu. Rev. Microbiol. 34: 183–207.
Rose, A.L. and Waite, T.D. (2003) Kinetics of Hydrolysis and Precipitation of Ferric Iron
in Seawater. Environ. Sci. Technol. 37: 3897–3903.
67
Rubio, L.M. and Ludden, P.W. (2005) Maturation of nitrogenase: a biochemical puzzle.
J. Bacteriol. 187: 405–414.
Sandy, M. and Butler, A. (2009) Microbial iron acquisition: marine and terrestrial
siderophores. Chem. Rev. 109: 4580–95.
Dos Santos, P.C. and Dean, D.R. (2014) Iron-Sulfur Clusters in Chemistry and Biology
Rouault,T. (ed) Walter de Gruyter GmbH & Co KG, 2014.
Savli, H., Karadenizli, A., Kolayli, F., Gundes, S., Ozbek, U., and Vahaboglu, H. (2003)
Expression stability of six housekeeping genes: a proposal for resistance gene
quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-
PCR. J. Med. Microbiol. 52: 403–408.
Sayyed, R.Z., Badgujar, M.D., Sonawane, H.M., Mhaske, M.M., and Chincholkar, S.B.
(2005) Production of microbial iron chelators (siderophores) by fluorescent
Pseudomonads. IJBT Vol.4(4) [October 2005].
Schlesinger, W.H. and Bernhardt, E.S. (2013) Biogeochemistry: An Analysis of Global
Change Academic Press.
Schmittgen, T.D. and Livak, K.J. (2008) Analyzing real-time PCR data by the
comparative CT method. Nat. Protoc. 3: 1101–1108.
Schmitz, R.A., Klopprogge, K., and Grabbe, R. (2002) Regulation of nitrogen fixation in
Klebsiella pneumoniae and Azotobacter vinelandii: NifL, transducing two
environmental signals to the nif transcriptional activator NifA. J. Mol. Microbiol.
Biotechnol. 4: 235–242.
Schneider, K., Müller, A., Schramm, U., and Klipp, W. (1991) Demonstration of a
molybdenum- and vanadium-independent nitrogenase in a nifHDK-deletion mutant
of Rhodobacter capsulatus. Eur. J. Biochem. 195: 653–661.
Schwacha, A. and Bender, R.A. (1993) The nac (nitrogen assimilation control) gene from
Klebsiella aerogenes. J. Bacteriol. 175: 2107–15.
Seefeldt, L.C., Hoffman, B.M., and Dean, D.R. (2009) Mechanism of Mo-dependent
nitrogenase. Annu. Rev. Biochem. 78: 701–22.
Self, W.T., Grunden, A.M., Hasona, A., and Shanmugam, K.T. (2001) Molybdate
transport. Res. Microbiol. 152: 311–321.
Setubal, J.C., dos Santos, P., Goldman, B.S., Ertesvåg, H., Espin, G., Rubio, L.M., et al.
(2009) Genome sequence of Azotobacter vinelandii, an obligate aerobe specialized
to support diverse anaerobic metabolic processes. J. Bacteriol. 191: 4534–4545.
Shailendra Singh, G.G. (2015) Plant Growth Promoting Rhizobacteria (PGPR): Current
and Future Prospects for Development of Sustainable Agriculture. J. Microb.
68
Biochem. Technol. 07.:
Shieh, C. and Duedall, I.W. (1988) Role of amorphous ferric oxyhydroxide in removal of
anthropogenic vanadium from seawater. Mar. Chem. 25: 121–139.
Silvester, W. (1989) Molybdenum limitation of asymbiotic nitrogen fixation in forests of
Pacific Northwest America. Soil Biol. Biochem. 21: 283–289.
Slabbert, N. (2012) Plant Polyphenols: Synthesis, Properties, Significance. Complexation
of condensed tannins with metal ions. Hemingway,R.W. and Laks,P.E. (eds)
Springer Science & Business Media.
Souza, E.M., Pedrosa, F.O., Drummond, M., Rigo, L.U., and Yates, M.G. (1999) Control
of Herbaspirillum seropedicae NifA activity by ammonium ions and oxygen. J.
Bacteriol. 181: 681–4.
Steenhoudt, O. and Vanderleyden, J. (2000) Azospirillum, a free-living nitrogen-fixing
bacterium closely associated with grasses: genetic, biochemical and ecological
aspects. FEMS Microbiol. Rev. 24: 487–506.
Stefánsson, A. (2007) Iron(III) Hydrolysis and Solubility at 25 °C. Environ. Sci. Technol.
41: 6117–6123.
Stevenson, F.J. and Cole, M.A. (Michael A.. (1999) Cycles of soil : carbon, nitrogen,
phosphorus, sulfur, micronutrients Wiley.
Stintzi, A., Barnes, C., Xu, J., and Raymond, K.N. (2000) Microbial iron transport via a
siderophore shuttle: a membrane ion transport paradigm. Proc. Natl. Acad. Sci. U. S.
A. 97: 10691–6.
Tang, D. and Morel, F.M.M. (2006) Distinguishing between cellular and Fe-oxide-
associated trace elements in phytoplankton. Mar. Chem. 98: 18–30.
Thiel, T. (1993) Characterization of genes for an alternative nitrogenase in the
cyanobacterium Anabaena variabilis. J. Bacteriol. 175: 6276–6286.
Thiel, T. and Pratte, B.S. (2013) Alternative nitrogenases in Anabaena variabilis: the role
of molybdate and vanadate in nitrogenase gene. Adv. Microbiol. 03: 87–95.
Thöny, B. and Hennecke, H. (1989) The -24/-12 promoter comes of age. FEMS
Microbiol. Rev. 5: 341–57.
Tindale, A.E., Mehrotra, M., Ottem, D., and Page, W.J. (2000) Dual regulation of
catecholate siderophore biosynthesis in Azotobacter vinelandii by iron and oxidative
stress. Microbiology 146 ( Pt 7: 1617–26.
Toukdarian, A. and Kennedy, C. (1986) Regulation of nitrogen metabolism in
Azotobacter vinelandii: isolation of ntr and glnA genes and construction of ntr
69
mutants. EMBO J. 5: 399–407.
Villa, J.A., Ray, E.E., and Barney, B.M. (2014) Azotobacter vinelandii siderophore can
provide nitrogen to support the culture of the green algae Neochloris oleoabundans
and Scenedesmus sp. BA032. FEMS Microbiol. Lett. 351: 70–77.
Vitousek, P.M. and Howarth, R.W. (1991) Nitrogen limitation on land and in the sea :
How can it occur? Biogeochemistry 13: 87–115.
Völker, C. and Wolf-Gladrow, D.A. (1999) Physical limits on iron uptake mediated by
siderophores or surface reductases. Mar. Chem. 65: 227–244.
Walmsley, J. and Kennedy, C. (1991) Temperature-Dependent Regulation by
Molybdenum and Vanadium of Expression of the Structural Genes Encoding Three
Nitrogenases in Azotobacter vinelandii. Appl. Environ. Microbiol. 57: 622–4.
Walmsley, J., Toukdarian, A., and Kennedy, C. (1994) The role of regulatory genes nifA,
vnfA, anfA, nfrX, ntrC, and rpoN in expression of genes encoding the three
nitrogenases of Azotobacter vinelandii. Arch. Microbiol. 162: 422–9.
Wanty, R.B. and Goldhaber, M.B. (1992) Thermodynamics and kinetics of reactions
involving vanadium in natural systems: Accumulation of vanadium in sedimentary
rocks. Geochim. Cosmochim. Acta 56: 1471–1483.
Wedepohl, K.H. (1995) The composition of the continental crust. Geochim. Cosmochim.
Acta 59: 1217–1232.
Wichard, T., Bellenger, J.-P., Morel, F.M.M., and Kraepiel, A.M.L. (2009) Role of the
siderophore azotobactin in the bacterial acquisition of nitrogenase metal cofactors.
Environ. Sci. Technol. 43: 7218–7224.
Wichard, T., Mishra, B., Myneni, S.C.B., Bellenger, J.-P., and Kraepiel, A.M.L. (2009)
Storage and bioavailability of molybdenum in soils increased by organic matter
complexation. Nat. Geosci. 2: 625–629.
Wilhelm, S.W. and Trick, C.G. (1994) Iron-limited growth of cyanobacteria: Multiple
siderophore production is a common response. Limnol. Oceanogr. 39: 1979–1984.
Woodley, P., Buck, M., and Kennedy, C. (1996) Identification of sequences important for
recognition of vnf genes by the VnfA transcriptional activator in Azotobacter
vinelandii. FEMS Microbiol. Lett. 135: 213–21.
Xu, N., Christodoulatos, C., and Braida, W. (2006) Adsorption of molybdate and
tetrathiomolybdate onto pyrite and goethite: effect of pH and competitive anions.
Chemosphere 62: 1726–35.
Xu, Y., Feng, L., Jeffrey, P.D., Shi, Y., and Morel, F.M.M. (2008) Structure and metal
exchange in the cadmium carbonic anhydrase of marine diatoms. Nature 452: 56–61.
70
Yoshimitsu, K., Takatani, N., Miura, Y., Watanabe, Y., and Nakajima, H. (2011) The role
of the GAF and central domains of the transcriptional activator VnfA in Azotobacter
vinelandii. FEBS J. 278: 3287–97.
Zhang, X., McRose, D.L., Darnajoux, R., Bellenger, J.P., Morel, F.M.M., and Kraepiel,
A.M.L. (2016) Alternative nitrogenase activity in the environment and nitrogen
cycle implications. Biogeochemistry 127: 189–198.
71
2.1.11. Supporting information
Effect of organic matter on nitrogenase metal cofactors homeostasis in Azotobacter
vinelandii under diazotrophic conditions
Christelle Jouogo Noumsi 1,2
, Nina Pourhassan1, Romain Darnajoux
1, Michael Deicke
3,
Thomas Wichard3, Vincent Burrus
2, Jean-Philippe Bellenger
1.
1Département de chimie, Faculté des sciences, Université de Sherbrooke;
2Laboratory of bacterial molecular genetics, Département de biologie, Faculté des
sciences, Université de Sherbrooke, Sherbrooke (Québec), Canada.
3Friedrich Schiller University Jena, Institute for Inorganic and Analytical Chemistry, Jena
School for Microbial Communication, Lessingstr. 8, 07743 Jena, Germany.
Corresponding author: Jean-Philippe Bellenger
2500 Boulevard de l’université, J1K 2R1, Sherbrooke (Québec), Canada
Phone number: 819 821-7014. Fax number: 819 821-8017
Jean-Philippe.Bellenger@usherbrooke.ca
Running Title: Tannic acid modulates metal use in A. vinelandii
72
Content:
1. Supporting information 1: Effect of tannic acids on growth, metallophore production,
metal cellular quotas and nitrogenase genes expression in a medium containing equimolar
concentration of Mo and V (Mo:V = 1:1, 10-7
M)
2. Supporting information 2: Metal complexation by tannic acid
3. Supporting information 3: Results of statistical tests realized on cellular metal quotas
4. Supporting information 4: Vanadium uptake rates
5. Supporting information 5: Acetylene reduction assay along the exponential phase with
the 1:1 [Mo]:[V] ratio
6. Supporting information 6: primers list
7. Supporting information 7: supplementary methods
73
Supporting information 1: Effect of tannic acids on growth, metallophore
production, metal cellular quotas and nitrogenase genes expression in a medium
containing equimolar concentration of Mo and V (Mo:V = 1:1, 10-7
M)
Figure S1: Growth curves of Azotobacter vinelandii. Absorbance at 620 nm was plotted versus
time for the three tested conditions. The inset shows curve fitting of growth by a nonlinear
regression (exponential growth) and the growth rate values obtained for each condition at the
exponential phase. Values represent the mean ± SD; n = 3. Ctrl: control. TA: tannic acid.
74
Figure S2: Metallophores production by Azotobacter vinelandii along the growth. A.
Protochelin and B. Azotochelin concentrations in supernatants of A. vinelandii cultures at OD
0.05, 0.1, 0.2, 0.4, 0.6 and 0.8. Ctrl: control. TA: tannic acid. Values represent the mean ± SE; n =
3. A two-way ANOVA with a Tukey’s multiple comparisons test was used to compare each
metallophore concentrations per and between conditions along the growth and at each OD.
Similar letters indicate no significant difference (P > 0.05).
75
Figure S3: Evolution of cellular metal to phosphorus quotas in Azotobacter vinelandii. Metals
content was measured at OD = 0.05, 0.1, 0.2, 0.4, 0.6 and 0.8. Iron A, molybdenum B and
vanadium C quotas. Zones between grey lines represent the optimum quota ranges expected with
our cultures’ instantaneous growth rates. Opened circles represent control conditions, opened and
closed triangles represent tannic acids at 1×10-5
M and tannic acids at 5×10-5
M, respectively. Ctrl:
control. TA: tannic acid. Values represent the mean ± SD; n = 3. A two-way ANOVA with a
Tukey’s multiple comparisons test was used to compare the metal quotas between conditions
(Results of statistical test are presented in table S1 of supporting informations).
76
Figure S4: Relative expression of nifD, vnfD and anfD during the exponential growth phase.
Gene expression was measured by RT-qPCR; the housekeeping gene used for normalization was
rpoD; and we obtained relative expressions with 2-ΔCt calculations. Ctrl: control. TA: tannic
acid. Values represent the mean ± SD; n = 3 or 4. A two-way ANOVA with a Tukey’s multiple
comparisons test was used to compare the mRNA levels between conditions and along the
growth. Asterisks indicate significant differences between the same genes in different conditions
(* = P < 0.05, ** = P < 0.01, *** = P < 0.001).
77
Supporting information 2: Metal complexation by tannic acid
Experimental procedure: Absorption spectra were recorded in quartz glass cuvettes
between 200 and 800 nm, after additions of aliquots of a 1×10–3
M stock solution of Mo
or V to a 1×10-4
M TA solution. Mo and V bound to tannic acids and formed colored
complexes with maximal absorbance at specific wavelengths (429 nm and 582 nm for
Mo-tannic acids and V-tannic acids respectively)
Fig. S5: A. Tannic acid-molybdenum complexation spectra, B. Tannic acid-vanadium
complexation spectra. Complexation was realized in a phosphate buffer at pH 6.56. C. Job’s plot
for Mo and V with tannic acid and for Mo with the metallophore protochelin. Normalized
absorbance plotted against metals/ligands ratios at wavelengths corresponding to complexes
formation.
78
Supporting information 3: Results of statistical tests realized on cellular metal
quotas
Table S1: Statistics analysesa of cellular metal quotas ratio Mo:V = 1:1
OD620nm 0.05 0.1 0.2 0.4 0.6 0.8
QFe TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2
Ctrl *** ns ns ns ns ns ns ns ns ns ns ns
TA 1 / * / ns / ns / ns / ns / ns
QMo Ctrl *** *** ns *** ns ** ns ns ns ns ns ns
TA 1 / *** / *** / ** / ns / ns / ns
QV
Ctrl *** ** **** ns *** ns *** ns *** ns *** *
TA 1 / *** / *** / ** / *** / ** / ns
Table S2: Statistics analysesa of cellular metal quotas ratio Mo:V = 1:4
OD620nm 0.05 0.1 0.2 0.4 0.6 0.8
QFe TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2 TA 1 TA 2
Ctrl * ns ns ns ns ns ns ns ns ns ns ns
TA 1 / ns / ns / ns / ns / ns / ns
QMo Ctrl ns ns ns ns ns * ns ns ns ns ns ns
TA 1 / ns / ns / ns / ns / ns / ns
QV
Ctrl *** *** *** *** *** ** ** ns *** ns * ns
TA 1 / *** / *** / ns / ns / ns / ns
aTwo-way ANOVA with a Tukey’s multiple comparisons test was used to compare each metal
quota between conditions and along the growth. ns, no significant difference; *, P < 0.05; **, P <
0.01; ***, P < 0.001.
Abbreviations: Ctrl, control; TA 1, [TA] = 1×10-5 M; TA 2, [TA] = 5×10
-5 M. QFe, iron quotas;
QMo, molybdenum quotas; QV, vanadium quotas.
79
Supporting information 4: Vanadium uptake rates
Fig. S6: Vanadium uptake rates between sampling times. The V uptake can be quantified
between sampling points using equations from Bellenger et al., 2011. V cellular quotas (molV
molP-1
) were transformed in V contents per cell through the relation between cell number and P
content (1 cell = 1.8×10-15
molP). The relation between optical density and cell number (1 OD =
1.16×108 cellules mL-1) allows to obtain V content in mol mL-1 and the number of cells formed
between sampling times. From a sampling point to the next, we thus can calculate the V acquired
per cell per time unit:ρ(molV cell-1
min-1
). Values represent the mean ± SD; n = 3. A two-way
ANOVA with a Tukey’s multiple comparisons test was used to compare V uptake rates between
conditions.
80
Supporting information 5: Acetylene reduction assay (ARA) along the exponential
phase with the 1:1 Mo:V ratio
Experimental procedure: ARA was realized by replacing 10% (v/v) of air by acetylene
(C2H2) in a jar (250 mL) containing 10 mL of bacterial cultures along the exponential
phase. Aliquots of air samples were collected after regular time interval and analyzed by
gas chromatography (GC-8A, Shimadzu, Kyoto, Japan) to quantify ethylene (C2H4) and
ethane (C2H6) formed.
Fig. S7: ARA (left axis) and instantaneous growth rates (right axis) along the exponential
phase. Bars represent ethylene formed at different points of the log phase (early: OD = 0.1 and
0.2; mid: OD = 0.4 and 0.6; late: 0.8) for each condition. No significant ethane was detected in
samples. Ctrl: control. TA: tannic acid. Values represent the mean ± SD; n = 3. A two-way
ANOVA with a Tukey’s multiple comparisons test was used to compare the amount of ethylene
formed between conditions and along the log phase. Similar letters indicate that there was no
significant difference between treatments. Symbols are instantaneous growth rates calculated for
each sampling point. Values represent the mean ± SD; n = 3. Circles represent control conditions;
down and up triangles represent TA (1×10-5 M) and TA (5×10
-5 M) respectively.
81
Supporting information 6: primers list
Table S3: primers used in quantitative PCR (5’-3’)
Target Forward Reverse Origin
nifD CGACGACTATGACCGGACCAT AGCCTGCAGTTTCTTCCAGCA (Bellenger et al., 2011)
vnfD GGAAGACTTCGAGAAGGTCAT TATCCACGGCGGCCAGGTGGC
anfD GTGCCAAGCACGTTATCGGG TCGTCTCCGATCAGCGCC This study
rpoD GGGCGAAGAAGGAAATGGTC CAGGTGGCGTAGGTGGAGAA (Savli et al., 2003)
82
Supporting information 7: supplementary methods
Cellular metal quotas
Cells were digested in 500 μL of concentrated nitric acid (trace-metal grade) and 100 μL
H2O2 with the DigiPREP Jr digester (SCP SCIENCE, Baie d’Urfé, Canada) at 65˚C for
30 minutes. Samples were diluted with MilliQ® water to obtain 2% HNO3, spiked with
internal standard (Rhodium) and analyzed for their elemental contents (phosphorus (P),
Fe, Mo and V) by ICP-MS (XSeries® II, Thermofisher).
Metallophores quantification
Metallophores were separated on a reversed phase UHPLC column (Waters, BEH C18,
2.1 × 50 mm, 1.7 μm) with a binary gradient system with water/acetonitrile modified with
1 mmol / L ammonium acetate at pH 6.6 applied at a flow rate of 0.5 mL / min and the
column temperature was set to 30°C. Metallophores were extracted from the supernatant
culture filtrates by solid-phase extraction using an HLB-cartridge (Oasis HLB Plus, 225
mg sorbent per cartridge, 60 μm particle size, Waters, Milford, USA). Cartridges were
preconditioned with 5 mL of MeOH (Optima LC/MS, Fisher scientific), and equilibrated
with 5 mL of distilled water (Optima LC/MS, Fisher scientific). Cell-free growth media
(10 mL) was loaded on the cartridge at 1 mL / min. Cartridges were rinsed with 5 mL of
distilled water to remove the excess of salts. Then, the analytes were eluted with 5 mL of
MeOH. Finally, the extracts were concentrated under a flow of N2 to a volume of 500 µL.
The injection volume was 5 μL for the samples and calibration standards. Measurements
were performed on maXis 3 high resolution MS (Bruker, Germany), equipped with the
Nexera LC, (Shimadzu, Japan) and the software Data Analysis (Bruker, Germany) was
used for data acquisition and analysis.
83
Quantitative PCR assays
Reaction mixtures contained 2 μL of cDNA template and 1 μM of primers. PCR
conditions were (i) 95°C for 5 min, followed by (ii) 40 cycles at 95°C for 10 s and 55°C
for 30 s. Melting curves were carried out on the final reaction products (178-281 bp) to
verify that amplification was specific to targets. Primer pairs exhibited efficiencies of
90% for nifD F2/R2, 95% for vnfD F2/R2, 88% for anfD F4/R4, and 103% for rpoD
Fw/Rev.
84
2.2. Les oxydes de fer modulent l’acquisition et l’utilisation des métaux essentiels pour la
croissance diazotrophe d’Azotobacter vinelandii
2.2.1. Présentation de l’article
Les bactéries du genre Azotobacter, dans leurs habitats, sont fortement exposées à la
matière minérale dans les couches profondes du sol. En effet, ces organismes font partie
d’un ensemble nommé Plant Growth Promoting Rhizobacteria (PGPR), regroupant les
microorganismes vivant à proximité ou associés aux racines de plantes, et participant à la
croissance de ces dernières. Ils agissent à diverses fins telles que la lutte antifongique, la
solubilisation des phosphates, la production de sidérophores, la fixation d’azote (Ahmad
et al., 2008; Nosheen et al., 2013; Shailendra Singh, 2015). A. vinelandii est donc amenée
à devoir gérer la présence de matière minérale dans cette couche du sol, matière qui
affecte l’accès aux métaux essentiels Mo, V et Fe pour la fixation d’azote (Goldberg
1996, 1998, Meunier 1994). Comme pour le projet précédent, peu d’études avaient
jusqu’à lors été menées pour déterminer les conséquences découlant de ce stress minéral,
notamment en termes d’homéostasie des métaux essentiels et leur utilisation par les
nitrogénases.
Grâce aux résultats issus du projet précédent, nous savions qu’intégrer aux conditions
classiques de culture en laboratoire un paramètre environnemental représentatif de
l’habitat naturel d’A. vinelandii avait pour effet de modifier l’homéostasie métallique et
suggérer la contribution des isoformes alternatives des nitrogénases à la diazotrophie.
L’objectif de cette deuxième étude était cette fois de suivre les paramètres de croissance
diazotrophe d’A. vinelandii en présence de matière minérale, afin de mieux comprendre la
gestion et l’utilisation des métaux cofacteurs des Nases dans la couche minérale des sols.
Afin de simuler la matière minérale, nous avons choisi un groupe abondant dans le sol, les
oxydes de fer. Nous avons pu mettre en évidence une adsorption de V sur les oxydes de
fer formés en solution par ajout de FeCl3, et montré que la réponse d’A. vinelandii est
85
variable selon l’ampleur du stress imputé. En effet, lorsque 55 µM de FeCl3 sont ajoutés,
la bactérie acquiert simultanément V et Mo, bien que ce dernier ne soit pas encore
limitant dans le milieu. En suivant l’évolution des niveaux de transcrits des gènes
spécifiques des nitrogénases nifD et vnfD, nous avons observé une diminution des
transcrits de nifD conjointement à une augmentation du niveau de transcrits de vnfD,
suggérant une contribution plus marquée de l’isoforme au V pour la fixation de N2. Ces
adaptations ont permis de maintenir un taux de croissance optimal. Par contre, lorsque
505 µM de FeCl3 sont ajoutés (environ 80% de précipitation théorique du fer), Mo et V
sont internalisés simultanément, mais à moindre échelle pour le V (par rapport à 55 µM
de FeCl3). Les niveaux de transcrits de nifD et vnfD sont tous les deux significatifs, mais
généralement plus faibles. Cela suggère une activité diazotrophe plus faible résultant in
fine à un taux de croissance inférieur à l’optimal. Dans tous les cas de figure, nous avons
montré qu’en présence d’oxydes de fer, A. vinelandii module son acquisition de métaux
essentiels, particulièrement en acquérant activement Mo et V. La moindre production des
métallophores suggère que l’acquisition de Mo et V est moins dépendante de ces ligands,
habituellement majoritairement impliqués dans l’acquisition de ces deux métaux, ou que
l’acquisition est plus efficace et nécessite moins de métallophores. Alternativement, ceci
pourrait également indiquer une production de luxe des métallophores dans les conditions
traditionnelles de culture peu stressantes, comparativement aux conditions en présence
d’oxydes de Fe. Ainsi, dans l’environnement, la matière minérale induirait une gestion
spécifique non conventionnelle des métaux cofacteurs des nitrogénases (pour l’acquisition
de Mo et V), ce qui pourrait donner un avantage sélectif aux diazotrophes possédant les
nitrogénases alternatives.
Les résultats de cette étude sont présentés dans l’article qui suit :
86
2.2.2 Contribution à l’article
L’approche expérimentale a été définie avec Jean-Philippe Bellenger et Vincent Burrus.
J’ai effectué les expériences de culture, les analyses du contenu intracellulaire en métaux
et l’expression des gènes. L’analyse des métallophores a été faite avec le support de
Raphael Cassoulet et Oliver Baars. Les données théoriques de pourcentage de fer
précipité ont été calculées par Anne Kraepiel. J’ai rédigé le manuscrit et généré les
figures, et tout cela a été révisé par tous les co-auteurs.
87
2.2.3. Page titre
Iron oxides modulate nitrogenase metal cofactors homeostasis in Azotobacter
vinelandii under diazotrophic conditions
Christelle Jouogo Noumsi 1,2
, Raphael Cassoulet1, Oliver Baars
3, Vincent Burrus
2, Jean-
Philippe Bellenger1.
1Département de chimie, Faculté des sciences, Université de Sherbrooke;
2Laboratory of bacterial molecular genetics, Département de biologie, Faculté des
sciences, Université de Sherbrooke, Sherbrooke (Québec), Canada.
3Department of Geosciences, Princeton University, New Jersey, USA
Corresponding author: Jean-Philippe Bellenger
2500 Boulevard de l’université, J1K 2R1, Sherbrooke (Québec), Canada
Phone number: 819 821-7014. Fax number: 819 821-8017
Jean-Philippe.Bellenger@usherbrooke.ca
Running Title: Iron oxides affect nitrogenase heterogeneity use in A. vinelandii
88
2.2.4. Summary
Biological nitrogen fixation can be catalyzed by three isozymes of the enzyme
nitrogenase: Mo-nitrogenase, V-nitrogenase and Fe-nitrogenase. The dynamic use of
these isozymes relies on metal cofactors (i.e. Mo, V and Fe) availability. Here, we show
how iron oxides (natural mineral matter) can impact essential metal bioavailability, and
thus modulate the use of the nitrogenase isozymes by the soil bacterium Azotobacter
vinelandii. The presence of iron oxides, strongly affect nitrogenase metal cofactors
homeostasis, nitrogenase gene expression and metallophores production profile. The
production of metallophores was significantly impeded in the presence of iron oxides. A.
vinelandii actively acquired both Mo and V, and decreased its nifD expression and
increased vnfD expression suggesting an active use of the alternative V nitrogenase under
intracellular Mo conditions usually not considered as limiting. Considering the
importance of iron oxides on Mo and V chemistry and availability in soil, these results
suggest that nitrogenase diversity plays an important role on the ability of A. vinelandii to
sustain diazotrophic growth under adverse metal availability conditions in soil.
Keywords: Azotobacter vinelandii, nitrogen fixation, iron oxides, metal
bioavailability, molybdenum, vanadium, alternative nitrogenase
2.2.5. Introduction
Nitrogen (N) is, with phosphorus, the most limiting nutrient for primary production
worldwide (Galloway et al., 2004; Elser et al., 2007; LeBauer and Treseder, 2008).
Biological nitrogen fixation (BNF) is a key reaction of the N cycle that transforms
atmospheric dinitrogen (N2) into bioavailable ammonia (NH3). Actors of BNF are few
prokaryote species living in association with plants, mosses and fungi, or living freely. To
89
catalyze this reaction they use the metalloprotein nitrogenase, for which three isoforms
have been identified: the molybdenum nitrogenase (Mo-Nase), the vanadium nitrogenase
(V-Nase) and the iron-only nitrogenase (Fe-Nase) (Bishop et al., 1980, 1982; Hales et al.,
1986; Robson et al., 1986; Chisnell et al., 1988; Schneider et al., 1991; Rehder, 2000;
Masukawa et al., 2009). The Mo-Nase is found in all N2 fixers and achieves the highest
efficiency at room temperature. The alternative V-Nase and Fe-Nase are found in a more
limited number of species and their activation is believed to be controlled by Mo. This
hierarchy in the use of Nase isozymes mostly result from laboratory studies in which Mo
and V are provided as molybdate and vanadate, two highly available forms (Glass 2012,
Thiel 2002, Pratte 2006 et al., Bellenger 2011). Under such conditions, V is acquired and
used to fix N only after Mo has been depleted from the medium. As a result, BNF is often
considered to primarily rely on Mo.
Molybdate and vanadate are indeed the predominant forms of Mo and V in oxic soil
solutions (Wanty and Goldhaber, 1992; Poledniok, 2003; Kabata-Pendias, 2010; Alloway,
2013). However, in soil, molybdate and vanadate availability is strongly affected by the
presence of organic matter and oxides (Wichard et al., 2009a; Marks et al., 2015). While
complexation of Mo and V with the soil matrix has been hypothesized to be beneficial to
N2 fixers by limiting Mo and V leaching (Wichard et al., 2009a), it can limit their
availability to bacteria. Recently, the presence of natural organic matter was reported to
significantly affect metal acquisition strategy and Nase gene expression (Jouogo Noumsi
et al., 2016) in A. vinelandii; V is acquired and V-Nase gene expressed under cellular Mo
concentrations that are usually considered to repress V uptake and use. This strongly
suggested that in organic matter rich habitats (i.e. leaf litter, top soil) alternative Nases
could contribute in a more important manner to BNF than previously thought.
Iron, the fourth most abundant element in the Earth crust, can form up to 16 iron oxides
(i.e. oxides, hydroxides or oxyhydroxides) in oxic aqueous solutions (Cornell and
Schwertmann, 2006). These oxides result from hydrolysis and precipitation reactions,
leading to highly insoluble and, hence, low bioavailable products (Rose and Waite, 2003;
Stefánsson, 2007; Baumgartner and Faivre, 2015). In addition, Fe oxides can adsorb
90
many trace metals (Kooner, 1993; Dyer et al., 2003), including Mo and V (Shieh and
Duedall, 1988; Goldberg and Forster, 1998; Xu et al., 2006) thus influencing their
availability. Azotobacter species are members of Plant Growth Promoting Rhizobacteria
(PGPR), and are known to contribute to anti-fungal activity, phosphate solubilization, and
asymbiotic N2 fixation among others (Ahmad et al., 2008; Nosheen et al., 2013;
Shailendra Singh, 2015). In deeper soil layers, organic matter is significantly less
abundant than in the leaf litter and top soil. Fe oxides likely represent the main reservoir
of Mo and V for these N2 fixing bacteria associated to plants rhizosphere. A. vinelandii is
known to produce metallophores, low molecular weight organic ligands, to improve metal
(i.e. Fe, Mo and V) uptake and is likely able to access this pool of Nase metal cofactor
(Baars et al., 2016). To what extent the presence of Fe oxides affects Nase metal cofactor
acquisition and use by A. vinelandii remains undescribed. We hypothesized that, as
previously observed with organic matter (Jouogo Noumsi et al., 2016), the complex
interactions between metallophores and oxides significantly affect Mo and V acquisition
strategy and V-Nase use.
Here, we tested this hypothesis by evaluating the effect of iron oxides on Mo and V
acquisition, metallophore production as well as the expression of Nases genes in A.
vinelandii. We compared metal (i.e. Mo and V) homeostasis in cultures with and without
Fe oxides. We measured (i) bacterial growth, (ii) Fe, Mo and V cellular quotas, (iii)
metallophore production and (iv) relative expression of three target genes nifD, vnfD and
anfD encoding the α subunits of Mo-Nase, V-Nase, and Fe-Nase, respectively (Rubio and
Ludden, 2005). Our experimental conditions mimicked the relative abundance of Mo and
V in soil by providing V in excess ([Mo] = 5×10-8
M; [V] = 2×10-7
M). Iron was provided
as FeCl3 at 5 µM, 55 µM or 505 µM final concentration.
91
2.2.6. Result and Discussion
In order to simulate a gradient in Fe oxide concentration in solution, we increased FeCl3
concentration in the culture medium from 5 to 505 µM (EDTA = 10-4
M). According to
equilibrium calculation (MINEQL), 0 and 80% of the added Fe at 5 µM and 505 µM
FeCl3 respectively, is not bound to EDTA.
We assumed that this pool of non-complexed Fe in solution quickly precipitated (e.g. iron
oxides, hydroxides) due to hydrolysis and precipitation reactions (Stefánsson, 2007). V
availability in solution was not significantly affected by 55 µM FeCl3 but was reduced by
half in presence of high FeCl3 concentration (505 µM, Table 1). Mo availability in
solution was not significantly affected even at high FeCl3, which is consistent with Mo
being known to be easily exchangeable when adsorbed on freshly precipitated Fe oxides
(Alloway, 2013). The limited adsorption of V and Mo on Fe oxides could also result from
the high concentration of phosphates in the culture medium that can compete with Mo
and V for adsorption sites (Xu et al., 2006). While the precise types of iron oxides formed
in solution and the adsorption constants of Mo and V on oxides were not determined
under our experimental conditions, our data show that increasing the concentration of
FeCl3 (Fe oxides) induced a stress on the bacterium growth, metal homeostasis and
nitrogenase genes expression.
92
Table 1 Molybdenum and vanadium remaining in solution after addition of 55 µM and 505
µM FeCl3. Metal concentrations were measured by ICP-MS in supernatants after centrifugation
of media at each time point.
Molybdenum (ppb) Vanadium (ppb)
Incubation time FeCl3 (55 µM)
0h 4.850 ± 0.000 11.725 ± 0.011
4h 4.675 ± 0.001 10.775 ± 0.022
8h 4.850 ± 0.000 11.450 ± 0.001
16h 4.600 ± 0.003 11.550 ± 0.004
24h 4.550 ± 0.000 11.450 ± 0.008
FeCl3 (505 µM)
0h 4.450 ± 0.000 11.475 ± 0.005
4h 4.125 ± 0.004 6.375 ± 0.008
8h 3.925 ± 0.005 5.775 ± 0.013
16h 4.150 ± 0.004 7.950 ± 0.001
24h 4.225 ± 0.005 8.350 ± 0.004
Growth of A. vinelandii in the presence of 55 µM FeCl3 was similar (0.19 OD h-1
) to the
control (5 µM FeCl3, 0.19 OD h-1
), whereas it decreased (0.16 OD h-1
) at 505 µM with an
exponential phase delayed by ~6 hours (see the inset of Fig. 1). As shown in Fig. S1, this
delay in bacterial growth can be, at least in part, attributed to a slight acidification of the
medium resulting from high FeCl3 (505 µM) (pH = 6.0 versus 6.4 for 5 µM and 55 µM
FeCl3).
93
Figure 1. Growth curves of A. vinelandii.
Absorbance at 620 nm was plotted versus time for the three tested conditions. The inset shows
curve fitting of growth by a non-linear regression (exponential growth) and the growth rate values
obtained for each condition at the exponential phase. Values represent the mean ± SD; n = 3.
Opened circles represent control conditions with 5 µM FeCl3 added; opened and closed triangles
represent 55 µM and 505 µM FeCl3 added, respectively.
Increasing FeCl3 concentration in the medium had contrasted effect on metal cellular
quotas. Fe and Mo cellular quotas (QFe and QMo) were not significantly affected by
increasing FeCl3 concentration. QFe remained constant (~1×10-2
molFe molP-1
) and within
the optimal range required to sustain diazotrophic growth= (31 ± 16) × QFe – 0.2,
Bellenger et al., 2011) under all FeCl3 conditions (Fig. 2A). This shows that increasing
FeCl3 concentrations did not significantly affect the ability of A. vinelandii to acquire iron
This result was predictable, as a large pool of easily available, soluble Fe was supplied as
Fe-EDTA (stability constant log = 25.7) (Martell and Smith, 1989). As observed for Fe,
Mo acquisition was not affected by increasing FeCl3 concentrations (Fig. 2B). In early
growth phase (up to OD620 = 0.4), Mo cellular quotas (QMo) decreased with cell division
94
(from ~2×10-3
molMo molP-1
to ~2×10-4
molMo molP-1
). After OD620 = 0.4, the decrease in
QMo was decoupled from cell division and remained within the optimal range required to
sustain optimal diazotrophic growth in A. vinelandii = (607 ± 188) × QMo, Bellenger et
al., 2011), thereby suggesting active Mo uptake. Unlike Fe and Mo, V cellular quotas
were differentially affected by rising FeCl3 concentrations. First QV decreased with cell
division (up to OD620 = 0.2 to 0.4), then QV stabilized and increased suggesting an active
internalization of V. The acquisition of V started earlier (Fig 2C) and was more active
(instantaneous uptake rate up to 20 times higher, Fig S2) at high FeCl3 concentrations. At
the end of the exponential phase, QV in cultures supplied with 55 and 505 µM FeCl3 were
close to the optimum V cellular concentration required to sustain diazotrophic growth
with the V-Nase isoform alone (V = (521 ± 94) × QV, Bellenger et al., 2011).
95
Figure 2. Evolution of cellular metal to phosphorus quotas in A. vinelandii.
Metal content was measured at OD = 0.05, 0.1, 0.2, 0.4, 0.6 and 0.8. Iron (A), molybdenum (B)
and vanadium (C) cellular quotas. Zones between grey lines represent the range of optimum metal
(i.e. Fe, Mo, V) cellular quotas required to sustain diazotrophic growth with our cultures
instantaneous growth rates (Bellenger et al., 2011). Opened circles represent control conditions,
opened and closed triangles represent 55 µM and 505 µM FeCl3 added respectively. Values
represent the mean ± SD; n = 3. A two-way ANOVA with a Tukey’s multiple comparisons test
was used to compare the metal quotas between conditions. Results of statistical tests are presented
in Table S1).
96
A similar induction of early acquisition of V under conditions traditionally considered as
not Mo limiting was recently reported in the presence of organic matter (Jouogo Noumsi
et al., 2016). This phenomenon was interpreted as the result of a higher cost of metal
acquisition, likely due to enhanced metallophore production in the presence of tannic
acid. For this reason, we evaluated the effect of increasing FeCl3 concentration on
metallophore production. In the presence of 55 and 505 µM FeCl3, production of all
known A. vinelandii metallophores (DHBA, aminochelin, azotochelin, protochelin and
the recently described vibrioferrin (Baars et al., 2016)) was drastically reduced by 4 to 70
times (Fig 3).
97
Figure 3. Metallophore production by A. vinelandii during growth.
Protochelin, azotochelin, vibrioferrin, dihydroxybenzoic acid (DHBA) and aminochelin
concentrations in supernatants of A. vinelandii cultures at optical density (OD) 0.05, 0.1, 0.2, 0.4,
0.6 and 0.8. Opened bars represent control conditions, light grey and dark grey bars represent 55
µM and 505 µM FeCl3 added respectively. . n.d.: not detected. Values represent the mean ± SE; n
= 3. A one-way ANOVA with a Tukey’s multiple comparisons test was used to compare
metallophore concentrations between conditions. Identical letters indicate no significant
difference (P > 0.05)
98
Adsorption of metallophores by oxides (Kraemer et al., 2015) in solution and on cell
surface was tested using organic extraction and oxalate-EDTA washing of culture pellets.
This failed to explain the absence of metallophores in solution. A replicated experiment
conducted in the absence of light also excluded the possibility of the photodegradation of
metallophores. An increased amount of iron in the culture medium has been reported to
shutdown metallophores production (Page and Huyer, 1984; Cornish and Page, 1998;
Tindale et al., 2000; Djibaoui and Bensoltane, 2005; Sayyed et al., 2005). However, the
well-controlled acquisition of Mo and V at low concentration of metallophores is
surprising. Metallophores, especially azotochelin and protochelin, have been shown to
play a major role in Mo and V homeostasis in A. vinelandii (Bellenger et al., 2008).
However, metallophores are usually produced in large excess (see control cultures) as
compared to free metal concentrations in the medium (i.e. Mo, V). At 55 and 505 µM
FeCl3, metallophores are present in the medium at concentration similar to Mo and V
(~10-8
-10-7
M). The high affinity constants of metallophores (i.e. protochelin and
azotochelin) for Mo and V suggest that low concentrations of metallophores are sufficient
to insure metal complexation and controlled uptake. In the lights of the recent
identification of new metallophores in A. vinelandii (Deicke et al., 2014; Baars et al.,
2016), the contribution of yet unknown metallophores to Mo and V acquisition under
these unusual laboratory growth conditions (high concentration of non-complexed Fe)
cannot be ruled out.
Nonetheless, increasing FeCl3 concentration in the medium resulted in early acquisition
of V. Unlike Mo that can be stored (Pienkos & Brill, 1981; Fenske et al., 2005), the
accumulation of V in cells can rapidly become toxic if not bound to nitrogenase (Keller et
al., 1989; Baysse et al., 2000; Bellenger et al., 2011). The higher acquisition of V at high
FeCl3 suggests a significant change in nitrogenase use with an increased participation of
the V-Nase to diazotrophic growth. This hypothesis was confirmed by nitrogenase gene
expression data. The expression of anfD remained below the limit of detection in all
conditions (Fig. S3). Regarding nifD and vnfD, their expression achieved opposite trends
in control conditions (5 µM FeCl3), with nifD expression decreasing 4 fold along
99
exponential growth, while vnfD expression significantly increased (Fig. 4). These patterns
are in accordance with QMo and Qv trends (Fig 2A and 2B) and published data (Bellenger
et al., 2011) showing that in Fe oxides free media, A. vinelandii supports diazotrophic
growth with the Mo isoform alone until depletion of Mo from the medium, at which point
V uptake begins to produce the V-Nase and sustain growth.
Figure 4. Relative expression of nifD and vnfD in control conditions during the exponential
growth phase.
Gene expression was measured by RT-qPCR. nifD relative expression values (opened bars) were
plot on the left Y axis. vnfD relative expression values (hatched bars) were plot on the right Y
axis. Values represent the mean ± SD; n = 3. A one-way ANOVA with a Tukey’s multiple
comparisons test was used to compare the mRNA levels between log phases (statistical analysis
were performed with ΔCt values). Identical letters indicate no significant difference (P > 0.05).
The presence of 55 and 505 µM FeCl3 (iron oxides) altered this response in various
manner depending on the FeCl3 concentration. In the presence of 55 µM FeCl3, nifD
mRNA levels followed a similar decrease as in control (Fig. 5A), but vnfD mRNA levels
100
showed a greater increase (3 fold at mid log phase and 1.7 fold at end log phase) as
compared to the control (Fig. 5B).
Figure 5. Relative expression of nifD and vnfD during the exponential growth phase.
Gene expression was measured by RT-qPCR. Relative genes expression was normalized to the
control condition. Opened bars represent control conditions, light grey and dark grey bars
represent 55 µM and 505 µM FeCl3 added respectively. Values represent the mean ± SD; n = 3. A
two-way ANOVA with a Tukey’s multiple comparisons test was used to compare the mRNA
levels between conditions and along the growth (statistical analysis were performed with ΔCt
values). Similar letters indicate no significant difference between conditions (P > 0.05).
101
This and data from Fig. 2, suggests an earlier and a greater participation of V-Nase,
concomitant with Mo-Nase, to growth. In the presence of 505 µM FeCl3, nifD mRNA
levels were slightly lower than in control (0.6 fold lower at early and end log phases),
while vnfD mRNA levels were not significantly affected as compared to the control (Fig.
5A and 5B). Furthermore A. vinelandii growth was negatively affected (Fig. 1) showing
that acquisition and possible use of V, in addition to Mo, for N fixation is not sufficient to
sustain optimal growth. Nonetheless, gene expression data show that high FeCl3
concentrations not only affect metallophore production and V acquisition, but also
enhance V-Nase gene expression and likely contribution to diazotrophic growth.
2.2.7. Conclusion
This study shows that the presence of natural complexing agents (i.e. oxides) significantly
affects the acquisition and use of nitrogenase metal cofactor by A. vinelandii. This further
supports previous observations made in the presence of organic matter (Jouogo Noumsi et
al., 2016) that A. vinelandii can adapt to metal stress by adjusting nitrogenase isoform
expression. Unlike many observations made in laboratory studies, in natural habitats
nitrogenases are likely not use in cascade, one after the other depending on Mo and V
availability, but can be used simultaneously to optimize growth in response to metal
stress. In natural habitats, where organic matter and oxides significantly affect Mo and V
availability, alternative nitrogenases are likely more important for N2 fixation than
previously recognized.
102
2.2.8. Experimental procedure
2.2.8.1. Bacterial strain, Culture medium and growth conditions
The bacterium Azotobacter vinelandii strain OP (ATCC 13705) was grown aerobically
under diazotrophic conditions at 25˚ C, 210 rpm in a liquid medium as described by
Bellenger et al., 2011. Vanadium, molybdenum, and iron concentrations were adjusted by
additions of NaVO3, Na2MoO4 and FeCl3 respectively, to reach [V] = 2×10-7
M, [Mo] =
5×10-8
M and [Fe] = 5 µM for control medium or [Fe] = 55 µM and [Fe] = 505 µM for
treated media. EDTA was kept at 1×10-4
M in all conditions to prevent iron limitation. All
products were purchased from Sigma-Aldrich (Saint Louis, MI, USA) and used as is.
The inoculum was grown in a Mo and V free medium to avoid any significant Mo and V
pre-supply, and any Mo storage. Before inoculation of A. vinelandii, the media were left
in growth conditions for 24 hours to insure both iron oxides formation and stable
equilibrium between iron oxides and metals.
2.2.8.2. Growth curves and growth rates
Bacterial growth was monitored by measuring the optical density (OD) at 620 nm in a 1
cm polystyrene cuvette on a Genesys 20 spectrophotometer (Thermo Scientific). Growth
curves were obtained by plotting the OD measurements versus time. Growth rates ()
were determined by using the slope of growth curves [plotted as ln (OD) versus time] in
the exponential phase.
103
2.2.8.3. Cellular metal quotas
Aliquots of cultures were taken at OD values of 0.05, 0.1, 0.2, 0.4, 0.6 and 0.8,
representing the end of the lag phase and the exponential growth phase. Aliquot volumes
were adjusted to insure enough biomass for analysis. Samples were centrifuged for 15
minutes at 4400 rpm. Cell pellets were then washed 3 times for 5 minutes with 5 mL of a
oxalate-EDTA solution (0.1 M – 0.05 M) (Tang and Morel, 2006). Samples were prepared
for metals analysis as described by Bellenger et al., 2011 with some modifications.
Briefly, cells were digested in 1 mL of concentrated nitric acid (trace-metal grade) with
the DigiPREP Jr digester (SCP SCIENCE, Baie d’Urfé, Canada) at 65˚C for 30 minutes.
Samples were diluted with MilliQ® water to obtain 2% HNO3, spiked with internal
standard (Rhodium) and analyzed for their elemental contents (phosphorus (P), Fe, Mo
and V) by ICP-MS (XSeries® II, Thermofisher).
2.2.8.4. Quantification of metallophores
Culture aliquots of 2 mL were filtered through 0.22 µm syringe filters (Millex-GP) and
acidified with 0.1% formic acid and 0.1% acetic acid. A 100 µL sample aliquot was then
injected onto a C18 column (Agilent Eclipse Plus C18 3.5 µm, 4.6 by 100 mm) equipped
with a matching guard column. Separation proceeded with a gradient of A and B solutions
(solution A consisted of water, 0.1% formic acid, and 0.1% acetic acid; solution B
consisted of acetonitrile, 0.1% formic acid, and 0.1% acetic acid; gradient, 0 to 100% B;
flow rate, 0.8 ml/min). Using a 6-port valve, the column outflow was diverted to waste for
the first 5.25 min, ensuring that the sample was desalted before introduction into the mass
spectrometer. Peaks for previously reported A. vinelandii metallophores were assigned
using their characteristic retention times, mass-to-charge ratios and UV-vis spectra (Baars
et al, 2016). LC-MS and UV-vis peak areas were determined using MassHunter software
(Agilent). Peak areas were converted to concentrations by calibration with standards of
104
vibrioferrin, 2,3-dihydroxybenzoic acid (DHBA), azotochelin, protochelin, and
azotobactin (Baars et al, 2016).
2.2.8.5. RNA isolation and cDNA synthesis
Total RNA extractions were performed on culture aliquots collected throughout
exponential phases (OD620 = 0.2, 0.4 and 0.8) using an RNeasy minikit (Qiagen)
following the manufacturer's instructions, with lysozyme used to digest cell membranes.
In addition, to ensure that there was no contamination by genomic DNA, RNA samples
were treated with Turbo DNase (Ambion) following the manufacturer's instructions. RNA
purity and concentration were evaluated with the spectrophotometer ND-1000
(Nanodrop). RNA samples were stored at -80°C.
cDNAs were prepared using the SuperScript II reverse transcriptase (Invitrogen),
following the manufacturer's instructions. 50 ng of random hexamer primers (Integrated
DNA Technologies) and 500 ng of total bacterial RNA were used in each reaction. After
cDNA synthesis, template RNA was digested by alkaline hydrolysis with 10 L NaOH 1
M, 10 L EDTA 0.5 M and 10 L H2O, 15 min at 65˚C. The hydrolysis reaction was
stopped by adding 25 L HEPES 1 M. cDNA sample mixtures were purified with the
PCR Purification Kit (Qiagen) and stored at -80°C. A control reaction in the absence of
reverse transcriptase (no-RT reaction) was performed.
2.2.8.6. Quantitative PCR assays
Quantitative PCR reactions were performed with Quantifast SYBR Green PCR master
mix (Qiagen) using a CFX Connect Real-Time PCR detection system (BioRad) for data
acquisition and analysis. Reaction mixtures contained 2 L of cDNA template and 1 M
of primers (Jouogo Noumsi et al., 2016). The PCR conditions were (i) 95°C for 5 min,
105
followed by (ii) 40 cycles at 95°C for 10 s and 55°C for 30 s. Melting curves were carried
out on the final reaction products (178-281 bp) to verify that amplification was specific to
targets. Primer pairs showed different efficiencies: 90% for nifD F2/R2, 95% for vnfD
F2/R2, 88% for anfD F4/R4, and 103% for rpoD Fw/Rev (data not shown). For
normalization, the RNA polymerase σ70 subunit gene rpoD was used (Savli et al., 2003)
and results presented as relative expression based on the ΔCt calculation method or ΔΔCt
calculation method (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008).
Experiments were carried out in three independent biological replicates, each with three
technical replicates, and combined.
2.2.8.7. Statistics and curve fitting
Statistical analyses and exponential fitting were all realized with the software GraphPad
Prism 7.00 for Windows, La Jolla California USA, www.graphpad.com.
2.2.9. Acknowledgments
This work was supported by a Discovery Grant and Discovery Acceleration Supplement
from the Natural Sciences and Engineering Council of Canada [326810-2011 and 2016-
04365 to V.B.]; V.B. holds a Canada Research Chair in molecular bacterial genetics.
J.P.B. holds a Canada Research Chair in terrestrial biogeochemistry We also thank the
Grand Challenge Program of the Princeton Environmental Institute (O.B.) for financial
support of this work.
We are thankful to Anne Kraepiel for calculations of theoretical iron precipitation, to
Adrien Rizzi for his technical assistance for ICP-MS analysis.
The authors declare no conflict of interest
106
2.2.10. References
Abdel-Gawad, F.M. and Issa, R.M. (1986) Spectrometric determination of vanadium (V)
with tannic acid and its application to biological fluids. Ind. J. Chem. 25: 701-702.
Ind. J. Chem. 25: 701–702.
Ahmad, F., Ahmad, I., and Khan, M.S. (2008) Screening of free-living rhizospheric
bacteria for their multiple plant growth promoting activities. Microbiol. Res. 163:
173–81.
Ahmed, E. and Holmström, S.J.M. (2014) Siderophores in environmental research: roles
and applications. Microb. Biotechnol. 7: 196–208.
Alloway, B. (2013) Heavy metals in soils Third. Alloway,B.J. (ed).
Austin, S. and Lambert, J. (1994) Purification and in vitro activity of a truncated form of
ANFA. Transcriptional activator protein of alternative nitrogenase from Azotobacter
vinelandii. J. Biol. Chem. 269: 18141–8.
Baars, O., Zhang, X., Morel, F.M.M., and Seyedsayamdost, M.R. (2016) The Siderophore
Metabolome of Azotobacter vinelandii. Appl. Environ. Microbiol. 82: 27–39.
Bageshwar, U.K., Choudhury, N.R., and Das, H.K. (1998) Analysis of upstream
activation of the vnfH promoter of Azotobacter vinelandii - ProQuest. Can. J.
Microbiol. 44.:
Barrett, J., Ray, P., Sobczyk, A., Little, R., and Dixon, R. (2001) Concerted inhibition of
the transcriptional activation functions of the enhancer-binding protein NIFA by the
anti-activator NIFL. Mol. Microbiol. 39: 480–93.
Barron, A.R., Wurzburger, N., Bellenger, J.P., Wright, S.J., Kraepiel, A.M.L., and Hedin,
L.O. (2009) Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest
soils. Nat. Geosci. 2: 42–45.
Baumgartner, J. and Faivre, D. (2015) Iron solubility, colloids and their impact on iron
(oxyhydr)oxide formation from solution. Earth-Science Rev. 150: 520–530.
Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J.M., et al.
(2000) Vanadium interferes with siderophore-mediated iron uptake in Pseudomonas
aeruginosa. Microbiology 146 ( Pt 1: 2425–34.
Bellenger, J.-P., Arnaud-Neu, F., Asfari, Z., Myneni, S.C.B., Stiefel, E.I., and Kraepiel,
A.M.L. (2007) Complexation of oxoanions and cationic metals by the biscatecholate
siderophore azotochelin. J. Biol. Inorg. Chem. JBIC a Publ. Soc. Biol. Inorg. Chem.
12: 367–376.
107
Bellenger, J.P., Wichard, T., and Kraepiel, A.M.L. (2008) Vanadium requirements and
uptake kinetics in the dinitrogen-fixing bacterium Azotobacter vinelandii. Appl.
Environ. Microbiol. 74: 1478–1484.
Bellenger, J.P., Wichard, T., Kustka, A.B., and Kraepiel, A.M.L. (2008) Uptake of
molybdenum and vanadium by a nitrogen-fixing soil bacterium using siderophores.
Nat. Geosci. 1: 243–246.
Bellenger, J.-P., Wichard, T., Xu, Y., and Kraepiel, A.M.L. (2011) Essential metals for
nitrogen fixation in a free-living N2-fixing bacterium: chelation, homeostasis and
high use efficiency. Environ. Microbiol. 13: 1395–411.
Bennett, L.T., Cannon, F., and Dean, D.R. (1988) Nucleotide sequence and mutagenesis
of the nifA gene from Azotobacter vinelandii. Mol. Microbiol. 2: 315–21.
Betancourt, D.A., Loveless, T.M., Brown, J.W., and Bishop, P.E. (2008) Characterization
of Diazotrophs Containing Mo-Independent Nitrogenases, Isolated from Diverse
Natural Environments. Appl. Environ. Microbiol. 74: 3471–3480.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1980) Evidence for an alternative
nitrogen fixation system in Azotobacter vinelandii. Proc. Natl. Acad. Sci. U. S. A. 77:
7342–7346.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1982) Expression of an alternative
nitrogen fixation system in Azotobacter vinelandii. J. Bacteriol. 150: 1244–1251.
Blanco, G., Drummond, M., Woodley, P., and Kennedy, C. (1993) Sequence and
molecular analysis of the nifL gene of Azotobacter vinelandii. Mol. Microbiol. 9:
869–79.
Boison, G., Steingen, C., Stal, L.J., and Bothe, H. (2006) The rice field cyanobacteria
Anabaena azotica and Anabaena sp. CH1 express vanadium-dependent nitrogenase.
Arch. Microbiol. 186: 367–76.
Bothe, H., Schmitz, O., Yates, M.G., and Newton, W.E. (2010) Nitrogen fixation and
hydrogen metabolism in cyanobacteria. Microbiol. Mol. Biol. Rev. 74: 529–51.
Boyd, E.S., Hamilton, T.L., and Peters, J.W. (2011) An alternative path for the evolution
of biological nitrogen fixation. Front. Microbiol. 2: 205.
Branca, M., Micera, G., Sanna, D., and Dessì, A. (1990) Complexation of
oxovanadium(IV) by humic and tannic acids. J. Inorg. Biochem. 39: 109–115.
Brenchley, J.E., Prival, M.J., and Magasanik, B. (1973) Regulation of the synthesis of
enzymes responsible for glutamate formation in Klebsiella aerogenes. J. Biol. Chem.
248: 6122–8.
Brigle, K.E., Newton, W.E., and Dean, D.R. (1985) Complete nucleotide sequence of the
108
Azotobacter vinelandii nitrogenase structural gene cluster. Gene 37: 37–44.
Burgess, B.K. and Lowe, D.J. (1996) Mechanism of Molybdenum Nitrogenase. Chem.
Rev. 96: 2983–3012.
Burns, R.C. and Hardy, R.W.F. (2012) Nitrogen Fixation in Bacteria and Higher Plants
Springer Science & Business Media.
Cech, T. V. (2010) Principles of Water Resources: History, Development, Management,
and Policy John Wiley & Sons.
Chatterjee, R., Allen, R.M., Ludden, P.W., and Shah, V.K. (1997) In vitro synthesis of the
iron-molybdenum cofactor and maturation of the nif-encoded apodinitrogenase.
Effect of substitution of VNFH for NIFH. J. Biol. Chem. 272: 21604–21608.
Chisnell, J.R., Premakumar, R., and Bishop, P.E. (1988) Purification of a second
alternative nitrogenase from a nifHDK deletion strain of Azotobacter vinelandii. J.
Bacteriol. 170: 27–33.
Cornell, R.M. and Schwertmann, U. (2006) The Iron Oxides: Structure, Properties,
Reactions, Occurrences and Uses John Wiley & Sons.
Cornish, A. and Page, W. (1995) Production of the triacetecholate siderophore
protochelin by Azotobacter vinelandii. Biometals 8: 332–338.
Cornish, A.S. and Page, W.J. (2000) Role of molybdate and other transition metals in the
accumulation of protochelin by Azotobacter vinelandii. Appl. Environ. Microbiol.
66: 1580–1586.
Cornish, A.S. and Page, W.J. (1998) The catecholate siderophores of Azotobacter
vinelandii: their affinity for iron and role in oxygen stress management.
Microbiology 144: 1747–1754.
Crowley, D.E., Wang, Y.C., Reid, C.P.P., and Szaniszlo, P.J. (1991) Mechanisms of iron
acquisition from siderophores by microorganisms and plants. Plant Soil 130: 179–
198.
Daccord, A., Mursell, M., Poulin-Laprade, D., and Burrus, V. (2012) Dynamics of the
SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by
Integrating Conjugative Elements of the SXT/R391 Family. J. Bacteriol. 194: 5794–
5802.
Darnajoux, R., Constantin, J., Miadlikowska, J., Lutzoni, F., and Bellenger, J.-P. (2014) Is
vanadium a biometal for boreal cyanolichens? New Phytol. 202: 765–71.
Darnajoux, R., Zhang, X., McRose, D.L., Miadlikowska, J., Lutzoni, F., Kraepiel,
A.M.L., and Bellenger, J.-P. (2016) Biological nitrogen fixation by alternative
nitrogenases in boreal cyanolichens: importance of molybdenum availability and
109
implications for current biological nitrogen fixation estimates. New Phytol.
Deicke, M., Bellenger, J.-P., and Wichard, T. (2013) Direct quantification of bacterial
molybdenum and iron metallophores with ultra-high-performance liquid
chromatography coupled to time-of-flight mass spectrometry. J. Chromatogr. A
1298: 50–60.
Deicke, M., Mohr, J.F., Bellenger, J.-P., and Wichard, T. (2014) Metallophore mapping in
complex matrices by metal isotope coded profiling of organic ligands. Analyst 139:
6096–9.
Dilworth, M.J., Eady, R.R., Robson, R.L., and Miller, R.W. (1987) Ethane formation
from acetylene as a potential test for vanadium nitrogenase in vivo. Nature 327:
167–168.
Dixon, R. (1998) The oxygen-responsive NIFL-NIFA complex: a novel two-component
regulatory system controlling nitrogenase synthesis in gamma-proteobacteria. Arch.
Microbiol. 169: 371–80.
Djibaoui, D. and Bensoltane, A. (2005) Effect of iron and growth inhibitors on
siderophores production by Pseudomonas fluorescens. African J. Biotechnol. 4: 697–
702.
Drummond, M., Walmsley, J., and Kennedy, C. (1996) Expression from the nifB
promoter of Azotobacter vinelandii can be activated by NifA, VnfA, or AnfA
transcriptional activators. J. Bacteriol. 178: 788–92.
Duhme, A.-K., Dauter, Z., Hider, R.C., and Pohl, S. (1996) Complexation of
Molybdenum by Siderophores: Synthesis and Structure of the Double-Helical cis -
Dioxomolybdenum(VI) Complex of a Bis(catecholamide) Siderophore Analogue.
Inorg. Chem. 35: 3059–3061.
Duhme, A.-K., Hider, R.C., and Khodr, H.H. (1997) Synthesis and Iron-Binding
Properties of Protochelin, the Tris (catecholamide) Siderophore ofAzotobacter
vinelandii. Chem. Ber. 130: 969–973.
Duhme, A.-K., Hider, R.C., Naldrett, M.J., and Pau, R.N. (1998) The stability of the
molybdenum-azotochelin complex and its effect on siderophore production in
Azotobacter vinelandii. J. Biol. Inorg. Chem. 3: 520–526.
Duhme-Klair, A.-K. (2009) From siderophores and self-assembly to luminescent sensors:
the binding of molybdenum by catecholamides. Eur. J. Inorg. Chem. 2009: 3689–
3701.
Dyer, J.A., Trivedi, P., Scrivner, N.C., and Sparks, D.L. (2003) Lead sorpion onto
ferrihydrite. 2. Surface complexation modeling. Environ. Sci. Technol. 37: 915–22.
110
Eady, R.R. (1996) Structure−Function Relationships of Alternative Nitrogenases. Chem.
Rev. 96: 3013–3030.
Eady, R.R., Robson, R.L., Richardson, T.H., Miller, R.W., and Hawkins, M. (1987) The
vanadium nitrogenase of Azotobacter chroococcum . Purification and properties of
the VFe protein. Biochem. J. 244: 197–207.
Einsle, O. (2014) Nitrogenase FeMo cofactor: an atomic structure in three simple steps. J.
Biol. Inorg. Chem. 19: 737–45.
Elser, J.J., Bracken, M.E.S., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., et
al. (2007) Global analysis of nitrogen and phosphorus limitation of primary
producers in freshwater, marine and terrestrial ecosystems. Ecol. Lett. 10: 1135–42.
Fenske, D., Gnida, M., Schneider, K., Meyer-Klaucke, W., Schemberg, J., Henschel, V.,
et al. (2005) A new type of metalloprotein: The Mo storage protein from Azotobacter
vinelandii contains a polynuclear molybdenum-oxide cluster. Chembiochem 6: 405–
413.
Frise, E., Green, A., and Drummond, M. (1994) Chimeric transcriptional activators
generated in vivo from VnfA and AnfA of Azotobacter vinelandii: N-terminal
domain of AnfA is responsible for dependence on nitrogenase Fe protein. J.
Bacteriol. 176: 6545–9.
Galloway, J.N., Dentener, F.J., Capone, D.G., Boyer, E.W., Howarth, R.W., Seitzinger,
S.P., et al. (2004) Nitrogen cycles: past, present, and future. Biogeochemistry 70:
153–226.
Glass, J.B., Axler, R.P., Chandra, S., and Goldman, C.R. (2012) Molybdenum limitation
of microbial nitrogen assimilation in aquatic ecosystems and pure cultures. Front.
Microbiol. 3: 331.
Goldberg, S. and Forster, H.S. (1998) FACTORS AFFECTING MOLYBDENUM
ADSORPTION BY SOILS AND MINERALS. Soil Sci. 163: 109–114.
Goldberg, S., Forster, H.S., and Godfrey, C.L. (1996) Molybdenum Adsorption on
Oxides, Clay Minerals, and Soils. Soil Sci. Soc. Am. J. 60: 425.
Gu, B., Chang, J., Min, Y., Ge, Y., Zhu, Q., Galloway, J.N., et al. (2013) The role of
industrial nitrogen in the global nitrogen biogeochemical cycle. Sci. Rep. 3: 636–
639.
Hales, B.J., Langosch, D.J., and Case, E.E. (1986) Isolation and characterization of a
second nitrogenase Fe-protein from Azotobacter vinelandii. J. Biol. Chem. 261:
15301–15306.
Hänsch, R. and Mendel, R.R. (2009) Physiological functions of mineral micronutrients
111
(Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr. Opin. Plant Biol. 12: 259–266.
Hättenschwiler, S. and Vitousek, P. (2000) The role of polyphenols in terrestrial
ecosystem nutrient cycling. Trends Ecol. Evol. 15: 238–243.
Hemingway, R.W., Karchesy, J.J., and Branham, S.J. (1989) Chemistry and Significance
of Condensed Tannins Plenum Pre. Hemingway,R.W., Karchesy,J.J., and
Branham,S.J. (eds) Springer US, New York.
Hill, S., Austin, S., Eydmann, T., Jones, T., and Dixon, R. (1996) Azotobacter vinelandii
NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation
genes via a redox-sensitive switch. Proc. Natl. Acad. Sci. U. S. A. 93: 2143–8.
Hinnemann, B. and Nørskov, J.K. (2004) Chemical activity of the nitrogenase FeMo
cofactor with a central nitrogen ligand: density functional study. J. Am. Chem. Soc.
126: 3920–7.
Hirschman, J., Wong, P.K., Sei, K., Keener, J., and Kustu, S. (1985) Products of nitrogen
regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in
vitro: evidence that the ntrA product is a sigma factor. Proc. Natl. Acad. Sci. U. S. A.
82: 7525–9.
Hodkinson, B.P., Allen, J.L., Forrest, L.L., Goffinet, B., Sérusiaux, E., Andrésson, Ó.S.,
et al. (2014) Lichen-symbiotic cyanobacteria associated with Peltigera have an
alternative vanadium-dependent nitrogen fixation system. Eur. J. Phycol. 49: 11–19.
Hooper, D.U. and Johnson, L. (1999) Nitrogen limitation in dryland ecosystems:
Responses to geographical and temporal variation in precipitation. Biogeochemistry
46: 247–293.
Howard, J.B. and Rees, D.C. (2006) How many metals does it take to fix N2? A
mechanistic overview of biological nitrogen fixation. Proc. Natl. Acad. Sci. U. S. A.
103: 17088–93.
Howard, J.B. and Rees, D.C. (1996) Structural Basis of Biological Nitrogen Fixation.
Chem. Rev. 96: 2965–2982.
Hu, Y. and Ribbe, M.W. (2011) Biosynthesis of the Metalloclusters of Molybdenum
Nitrogenase. Microbiol. Mol. Biol. Rev. 75: 664–677.
Imperial, J., Hadi, M., and Amy, N.K. (1998) Molybdate binding by ModA, the
periplasmic component of the Escherichia coli mod molybdate transport system.
Biochim. Biophys. Acta 1370: 337–46.
Jacob, J. and Drummond, M. (1993) Construction of chimeric proteins from the ?; N -
associated transcriptional activators VnfA and AnfA of Azotobacter vinelandii
shows that the determinants of promoter specificity lie outside the’recognition'helix
112
of the HTH motif in the C-terminal . Mol. Microbiol. 10: 813–821.
Jacobitz, S. and Bishop, P.E. (1992) Regulation of nitrogenase-2 in Azotobacter
vinelandii by ammonium, molybdenum, and vanadium. J. Bacteriol. 174: 3884–
3888.
Jacobson, M.R., Brigle, K.E., Bennett, L.T., Setterquist, R.A., Wilson, M.S., Cash, V.L.,
et al. (1989) Physical and genetic map of the major nif gene cluster from Azotobacter
vinelandii. J. Bacteriol. 171: 1017–1027.
Jacobson, M.R., Premakumar, R., and Bishop, P.E. (1986) Transcriptional regulation of
nitrogen fixation by molybdenum in Azotobacter vinelandii. J. Bacteriol. 167: 480–
6.
Jean, M.-E., Phalyvong, K., Forest-Drolet, J., and Bellenger, J.-P. (2013) Molybdenum
and phosphorus limitation of asymbiotic nitrogen fixation in forests of Eastern
Canada: Influence of vegetative cover and seasonal variability. Soil Biol. Biochem.
67: 140–146.
Jiang, H.-B., Lou, W.-J., Ke, W.-T., Song, W.-Y., Price, N.M., and Qiu, B.-S. (2015)
New insights into iron acquisition by cyanobacteria: an essential role for ExbB-
ExbD complex in inorganic iron uptake. ISME J. 9: 297–309.
Joerger, R.D., Jacobson, M.R., and Bishop, P.E. (1989) Two nifA-like genes required for
expression of alternative nitrogenases by Azotobacter vinelandii. J. Bacteriol. 171:
3258–67.
Joerger, R.D., Jacobson, M.R., Premakumar, R., Wolfinger, E.D., and Bishop, P.E. (1989)
Nucleotide sequence and mutational analysis of the structural genes (anfHDGK) for
the second alternative nitrogenase from Azotobacter vinelandii. J. Bacteriol. 171:
1075–1086.
Joerger, R.D., Loveless, T.M., Pau, R.N., Mitchenall, L.A., Simon, B.H., and Bishop, P.E.
(1990) Nucleotide sequences and mutational analysis of the structural genes for
nitrogenase 2 of Azotobacter vinelandii. J. Bacteriol. 172: 3400–8.
Jouogo Noumsi, C., Pourhassan, N., Darnajoux, R., Deicke, M., Wichard, T., Burrus, V.,
and Bellenger, J.-P. (2016) Effect of organic matter on nitrogenase metal cofactors
homeostasis in Azotobacter vinelandii under diazotrophic conditions. Environ.
Microbiol. Rep. 8: 76–84.
Kabata-Pendias, A. (2010) Trace Elements in Soils and Plants, Fourth Edition CRC Press.
Keller, R.J., Coulombe, R.A., Sharma, R.P., Grover, T.A., and Piette, L.H. (1989)
Importance of hydroxyl radical in the vanadium-stimulated oxidation of NADH.
Free Radic. Biol. Med. 6: 15–22.
113
Kennedy, C. and Dean, D. (1992) The nifU, nifS and nifV gene products are required for
activity of all three nitrogenases of Azotobacter vinelandii. Mol. Gen. Genet. 231:
494–8.
Kirn, J. and Rees, D.C. (1992) Crystallographic structure and functional implications of
the nitrogenase molybdenum–iron protein from Azotobacter vinelandii. Nature 360:
553–560.
Kooner, Z.S. (1993) Comparative study of adsorption behavior of copper, lead, and zinc
onto goethite in aqueous systems. Environ. Geol. 21: 242–250.
Kraemer, S.M. (2004) Iron oxide dissolution and solubility in the presence of
siderophores. Aquat. Sci. - Res. Across Boundaries 66: 3–18.
Kraemer, S.M., Duckworth, O.W., Harrington, J.M., and Schenkeveld, W.D.C. (2015)
Metallophores and Trace Metal Biogeochemistry. Aquat. Geochemistry 21: 159–195.
Kraepiel, A.M.L., Bellenger, J.P., Wichard, T., and Morel, F.M.M. (2009) Multiple roles
of siderophores in free-living nitrogen-fixing bacteria. Biometals an Int. J. role Met.
ions Biol. Biochem. Med. 22: 573–581.
Kraus, T.E.C., Dahlgren, R.A., and Zasoski, R.J. (2003) Tannins in nutrient dynamics of
forest ecosystems - a review. Plant Soil 256: 41–66.
Kuiters, A.T. (1990) Role of phenolic substances from decomposing forest litter in plant-
soil interactions. Acta Bot. Neerl. 39: 329–348.
Lancaster, K.M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M.W., Neese, F., et al.
(2011) X-ray emission spectroscopy evidences a central carbon in the nitrogenase
iron-molybdenum cofactor. Science 334: 974–7.
Lane, T.W. and Morel, F.M. (2000) A biological function for cadmium in marine
diatoms. Proc. Natl. Acad. Sci. U. S. A. 97: 4627–31.
LeBauer, D.S. and Treseder, K.K. (2008) Nitrogen limitation of net primary productivity
in terrestrial ecosytems is globally distributed. Ecology 89: 371–379.
Lee, C.C., Hu, Y., and Ribbe, M.W. (2009) Unique features of the nitrogenase VFe
protein from Azotobacter vinelandii. Proc. Natl. Acad. Sci. 106: 9209–9214.
Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W.C., and Dixon, R. (2000)
Signal transduction to the Azotobacter vinelandii NIFL-NIFA regulatory system is
influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein.
EMBO J. 19: 6041–50.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San
Diego Calif 25: 402–408.
114
Loveless, T.M. and Bishop, P.E. (1999) Identification of genes unique to Mo-independent
nitrogenase systems in diverse diazotrophs. Can. J. Microbiol. 45: 312–317.
Loveless, T.M., Saah, J.R., and Bishop, P.E. (1999) Isolation of nitrogen-fixing bacteria
containing molybdenum-independent nitrogenases from natural environments. Appl.
Environ. Microbiol. 65: 4223–4226.
Lowe, D.J., Fisher, K., and Thorneley, R.N. (1993) Klebsiella pneumoniae nitrogenase:
pre-steady-state absorbance changes show that redox changes occur in the MoFe
protein that depend on substrate and component protein ratio; a role for P-centres in
reducing dinitrogen? Biochem. J. 292: 93–98.
Lu, X., Johnson, W.D., and Hook, J. (1998) Reaction of vanadate with aquatic humic
substances: an ESR and 51 V NMR study. Environ. Sci. Technol. 32: 2257–2263.
Luque, F., Mitchenall, L.A., Chapman, M., Christine, R., and Pau, R.N. (1993)
Characterization of genes involved in molybdenum transport in Azotobacter
vinelandii. Mol. Microbiol. 7: 447–59.
Luque, F. and Pau, R.N. (1991) Transcriptional regulation by metals of structural genes
for Azotobacter vinelandii nitrogenases. Mol. Gen. Genet. 227: 481–7.
Macaluso, A., Best, E.A., and Bender, R.A. (1990) Role of the nac gene product in the
nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes. J.
Bacteriol. 172: 7249–55.
Mackenzie, F.T., Ver, L.M., Sabine, C., Lane, M., and Lerman, A. (2013) Interactions of
C, N, P and S Biogeochemical Cycles and Global Change Roland,W.,
Mackenzie,F.T., and Chou,L. (eds) Springer Science & Business Media.
Marks, J.A., Perakis, S.S., King, E.K., and Pett-Ridge, J. (2015) Soil organic matter
regulates molybdenum storage and mobility in forests. Biogeochemistry 125: 167–
183.
Martell, A.E. and Smith, R.M. (1989) Critical stability constants. Plenum Press, New
York.
Masepohl, B., Schneider, K., Drepper, T., Muller, A., and Klipp, W. (2002) Nitrogen
fixation at the millennium G.J.,L. (ed) Elsevier.
Masukawa, H., Zhang, X., Yamazaki, E., Iwata, S., Nakamura, K., Mochimaru, M., et al.
(2009) Survey of the distribution of different types of nitrogenases and hydrogenases
in heterocyst-forming cyanobacteria. Mar. Biotechnol. (NY). 11: 397–409.
May, H.D. and Dean, R.D. (1991) Altered nitrogenase MoFe proteins from Azotobacter
vinelandii. Analysis of MoFe proteins having amino acid substitutions for the
conserved cysteine residues within the beta-subunit. Biochem. J. 277 (Pt 2): 457–64.
115
Meletzus, D., Rudnick, P., Doetsch, N., Green, A., and Kennedy, C. (1998)
Characterization of the glnK-amtB Operon of Azotobacter vinelandii. J. Bacteriol.
180: 3260–3264.
Merrick, M., Gibbins, J., and Toukdarian, A. (1987) The nucleotide sequence of the
sigma factor gene ntrA (rpoN) of Azotobacter vinelandii: analysis of conserved
sequences in NtrA proteins. Mol. Gen. Genet. 210: 323–30.
Merrick, M., Hill, S., Hennecke, H., Hahn, M., Dixon, R., and Kennedy, C. (1982)
Repressor properties of the nifL gene product in Klebsiella pneumoniae. MGG Mol.
Gen. Genet. 185: 75–81.
Merrick, M.J. and Gibbins, J.R. (1985) The nucleotide sequence of the nitrogen-
regulation gene ntrA of Klebsiella pneumoniae and comparison with conserved
features in bacterial RNA polymerase sigma factors. Nucleic Acids Res. 13: 7607–
20.
Miller, R.W. and Eady, R.R. (1988) Molybdenum and vanadium nitrogenases of
Azotobacter chroococcum. Low temperature favours N2 reduction by vanadium
nitrogenase. Biochem. J. 256: 429–432.
Monteiro, R.A., Souza, E.M., Yates, M.G., Pedrosa, F.O., and Chubatsu, L.S. (1999) In-
trans regulation of the N-truncated-NIFA protein of Herbaspirillum seropedicae by
the N-terminal domain. FEMS Microbiol. Lett. 180: 157–61.
Morrison, C.N., Hoy, J.A., Zhang, L., Einsle, O., and Rees, D.C. (2015) Substrate
pathways in the nitrogenase MoFe protein by experimental identification of small
molecule binding sites. Biochemistry 54: 2052–60.
Moshiri, F., Kim, J.W., Fu, C., and Maier, R.J. (1994) The FeSII protein of Azotobacter
vinelandii is not essential for aerobic nitrogen fixation, but confers significant
protection to oxygen-mediated inactivation of nitrogenase in vitro and in vivo. Mol.
Microbiol. 14: 101–114.
Mouncey, N.J., Mitchenall, L.A., and Pau, R.N. (1995) Mutational analysis of genes of
the mod locus involved in molybdenum transport, homeostasis, and processing in
Azotobacter vinelandii. J. Bacteriol. 177: 5294–302.
Moure, V.R., Costa, F.F., Cruz, L.M., Pedrosa, F.O., Souza, E.M., Li, X.-D., et al. (2015)
Regulation of nitrogenase by reversible mono-ADP-ribosylation. Curr. Top.
Microbiol. Immunol. 384: 89–106.
Nakajima, H., Takatani, N., Yoshimitsu, K., Itoh, M., Aono, S., Takahashi, Y., and
Watanabe, Y. (2010) The role of the Fe-S cluster in the sensory domain of
nitrogenase transcriptional activator VnfA from Azotobacter vinelandii. FEBS J.
277: 817–32.
116
Noar, J.D. and Bruno-Bárcena, J.M. (2013) Complete Genome Sequences of Azotobacter
vinelandii Wild-Type Strain CA and Tungsten-Tolerant Mutant Strain CA6. Genome
Announc. 1: e00313–13.
Nordlund, S. and Högbom, M. (2013) ADP-ribosylation, a mechanism regulating
nitrogenase activity. FEBS J. 280: 3484–90.
Nosheen, A., Bano, A., Ullah, F., Farooq, U., Yasmin, H., and Hussain, I. (2013) Effect
of plant growth promoting rhizobacteria on root morphology of Safflower (
Carthamus tinctorius L.). African J. Biotechnol. 10: 12638–12649.
Oda, Y., Samanta, S.K., Rey, F.E., Wu, L., Liu, X., Yan, T., et al. (2005) Functional
genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium
Rhodopseudomonas palustris. J. Bacteriol. 187: 7784–94.
Oelze, J. (2000) Respiratory protection of nitrogenase in Azotobacter species: is a widely
held hypothesis unequivocally supported by experimental evidence? FEMS
Microbiol. Rev. 24: 321–333.
Page, W.J. and Huyer, M. (1984) Derepression of the Azotobacter vinelandii siderophore
system, using iron-containing minerals to limit iron repletion. J. Bacteriol. 158: 496–
502.
Page, W.J. and von Tigerstrom, M. (1982) Iron- and molybdenum-repressible outer
membrane proteins in competent Azotobacter vinelandii. J. Bacteriol. 151: 237–42.
Pau, R.N. (1989) Nitrogenases without molybdenum. Trends Biochem. Sci. 14: 183–6.
Peacock, C.L. and Sherman, D.M. (2004) Vanadium(V) adsorption onto goethite (α-
FeOOH) at pH 1.5 to 12: a surface complexation model based on ab initio molecular
geometries and EXAFS spectroscopy. Geochim. Cosmochim. Acta 68: 1723–1733.
Peters, J.W., Fisher, K., Newton, W.E., and Dean, D.R. (1995) Involvement of the P
Cluster in Intramolecular Electron Transfer within the Nitrogenase MoFe Protein. J.
Biol. Chem. 270: 27007–27013.
Pienkos, P.T. and Brill, W.J. (1981) Molybdenum accumulation and storage in Klebsiella
pneumoniae and Azotobacter vinelandii. J. Bacteriol. 145: 743–51.
Poledniok, J. (2003) Speciation of vanadium in soil. Talanta 59: 1–8.
Poulin-Laprade, D. and Burrus, V. (2015) A λ Cro-like repressor is essential for the
induction of conjugative transfer of SXT/R391 elements in response to DNA
damage. J. Bacteriol.
Pratte, B.S., Eplin, K., and Thiel, T. (2006) Cross-functionality of nitrogenase
components NifH1 and VnfH in Anabaena variabilis. J. Bacteriol. 188: 5806–5811.
117
Pratte, B.S., Sheridan, R., James, J.A., and Thiel, T. (2013) Regulation of V-nitrogenase
genes in Anabaena variabilis by RNA processing and by dual repressors. Mol.
Microbiol. 88: 413–24.
Pratte, B.S. and Thiel, T. (2006) High-Affinity Vanadate Transport System in the
Cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol. 188: 464–468.
Premakumar, R., Loveless, T.M., and Bishop, P.E. (1994) Effect of amino acid
substitutions in a potential metal-binding site of AnfA on expression from the anfH
promoter in Azotobacter vinelandii. J. Bacteriol. 176: 6139–42.
Premakumar, R., Pau, R.N., Mitchenall, L.A., Easo, M., and Bishop, P.E. (1998)
Regulation of the transcriptional activators AnfA and VnfA by metals and
ammonium in Azotobacter vinelandii. FEMS Microbiol. Lett. 164: 63–68.
Raymond, J., Siefert, J.L., Staples, C.R., and Blankenship, R.E. (2004) The natural
history of nitrogen fixation. Mol. Biol. Evol. 21: 541–54.
Reddy, K.J. and Gloss, S.P. (1993) Geochemical speciation as related to the mobility of F,
Mo and Se in soil leachates. Appl. Geochemistry 8: 159–163.
Reed, S.C., Cleveland, C.C., and Townsend, A.R. (2011) Functional ecology of free-
living nitrogen fixation: a contemporary perspective. Annu. Rev. Ecol. Evol. Syst. 42:
489–512.
Rees, D.C., Akif Tezcan, F., Haynes, C.A., Walton, M.Y., Andrade, S., Einsle, O., and
Howard, J.B. (2005) Structural basis of biological nitrogen fixation. Philos. Trans.
A. Math. Phys. Eng. Sci. 363: 971–84; discussion 1035–40.
Rees, D.C. and Howard, J.B. (2000) Nitrogenase: standing at the crossroads. Curr. Opin.
Chem. Biol. 4: 559–566.
Rehder, D. (2000) Vanadium nitrogenase. J. Inorg. Biochem. 80: 133–136.
Robin, A., Vansuyt, G., Hinsinger, P., Meyer, J.M., Briat, J.F., and Lemanceau, P. (2008)
Chapter 4 Iron Dynamics in the Rhizosphere: Consequences for Plant Health and
Nutrition. Adv. Agron. 99: 183–225.
Robson, R.L., Eady, R.R., Richardson, T.H., Miller, R.W., Hawkins, M., and Postgate,
J.R. (1986) The alternative nitrogenase of Azotobacter chroococcum is a vanadium
enzyme. Nature 322: 388–390.
Robson, R.L. and Postgate, J.R. (1980) Oxygen and hydrogen in biological nitrogen
fixation. Annu. Rev. Microbiol. 34: 183–207.
Rose, A.L. and Waite, T.D. (2003) Kinetics of Hydrolysis and Precipitation of Ferric Iron
in Seawater. Environ. Sci. Technol. 37: 3897–3903.
118
Rubio, L.M. and Ludden, P.W. (2005) Maturation of nitrogenase: a biochemical puzzle.
J. Bacteriol. 187: 405–414.
Sandy, M. and Butler, A. (2009) Microbial iron acquisition: marine and terrestrial
siderophores. Chem. Rev. 109: 4580–95.
Dos Santos, P.C. and Dean, D.R. (2014) Iron-Sulfur Clusters in Chemistry and Biology
Rouault,T. (ed) Walter de Gruyter GmbH & Co KG, 2014.
Savli, H., Karadenizli, A., Kolayli, F., Gundes, S., Ozbek, U., and Vahaboglu, H. (2003)
Expression stability of six housekeeping genes: a proposal for resistance gene
quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-
PCR. J. Med. Microbiol. 52: 403–408.
Sayyed, R.Z., Badgujar, M.D., Sonawane, H.M., Mhaske, M.M., and Chincholkar, S.B.
(2005) Production of microbial iron chelators (siderophores) by fluorescent
Pseudomonads. IJBT Vol.4(4) [October 2005].
Schlesinger, W.H. and Bernhardt, E.S. (2013) Biogeochemistry: An Analysis of Global
Change Academic Press.
Schmittgen, T.D. and Livak, K.J. (2008) Analyzing real-time PCR data by the
comparative CT method. Nat. Protoc. 3: 1101–1108.
Schmitz, R.A., Klopprogge, K., and Grabbe, R. (2002) Regulation of nitrogen fixation in
Klebsiella pneumoniae and Azotobacter vinelandii: NifL, transducing two
environmental signals to the nif transcriptional activator NifA. J. Mol. Microbiol.
Biotechnol. 4: 235–242.
Schneider, K., Müller, A., Schramm, U., and Klipp, W. (1991) Demonstration of a
molybdenum- and vanadium-independent nitrogenase in a nifHDK-deletion mutant
of Rhodobacter capsulatus. Eur. J. Biochem. 195: 653–661.
Schwacha, A. and Bender, R.A. (1993) The nac (nitrogen assimilation control) gene from
Klebsiella aerogenes. J. Bacteriol. 175: 2107–15.
Seefeldt, L.C., Hoffman, B.M., and Dean, D.R. (2009) Mechanism of Mo-dependent
nitrogenase. Annu. Rev. Biochem. 78: 701–22.
Self, W.T., Grunden, A.M., Hasona, A., and Shanmugam, K.T. (2001) Molybdate
transport. Res. Microbiol. 152: 311–321.
Setubal, J.C., dos Santos, P., Goldman, B.S., Ertesvåg, H., Espin, G., Rubio, L.M., et al.
(2009) Genome sequence of Azotobacter vinelandii, an obligate aerobe specialized
to support diverse anaerobic metabolic processes. J. Bacteriol. 191: 4534–4545.
Shailendra Singh, G.G. (2015) Plant Growth Promoting Rhizobacteria (PGPR): Current
and Future Prospects for Development of Sustainable Agriculture. J. Microb.
119
Biochem. Technol. 07.:
Shieh, C. and Duedall, I.W. (1988) Role of amorphous ferric oxyhydroxide in removal of
anthropogenic vanadium from seawater. Mar. Chem. 25: 121–139.
Silvester, W. (1989) Molybdenum limitation of asymbiotic nitrogen fixation in forests of
Pacific Northwest America. Soil Biol. Biochem. 21: 283–289.
Slabbert, N. (2012) Plant Polyphenols: Synthesis, Properties, Significance. Complexation
of condensed tannins with metal ions. Hemingway,R.W. and Laks,P.E. (eds)
Springer Science & Business Media.
Souza, E.M., Pedrosa, F.O., Drummond, M., Rigo, L.U., and Yates, M.G. (1999) Control
of Herbaspirillum seropedicae NifA activity by ammonium ions and oxygen. J.
Bacteriol. 181: 681–4.
Steenhoudt, O. and Vanderleyden, J. (2000) Azospirillum, a free-living nitrogen-fixing
bacterium closely associated with grasses: genetic, biochemical and ecological
aspects. FEMS Microbiol. Rev. 24: 487–506.
Stefánsson, A. (2007) Iron(III) Hydrolysis and Solubility at 25 °C. Environ. Sci. Technol.
41: 6117–6123.
Stevenson, F.J. and Cole, M.A. (Michael A.. (1999) Cycles of soil : carbon, nitrogen,
phosphorus, sulfur, micronutrients Wiley.
Stintzi, A., Barnes, C., Xu, J., and Raymond, K.N. (2000) Microbial iron transport via a
siderophore shuttle: a membrane ion transport paradigm. Proc. Natl. Acad. Sci. U. S.
A. 97: 10691–6.
Tang, D. and Morel, F.M.M. (2006) Distinguishing between cellular and Fe-oxide-
associated trace elements in phytoplankton. Mar. Chem. 98: 18–30.
Thiel, T. (1993) Characterization of genes for an alternative nitrogenase in the
cyanobacterium Anabaena variabilis. J. Bacteriol. 175: 6276–6286.
Thiel, T. and Pratte, B.S. (2013) Alternative nitrogenases in Anabaena variabilis: the role
of molybdate and vanadate in nitrogenase gene. Adv. Microbiol. 03: 87–95.
Thöny, B. and Hennecke, H. (1989) The -24/-12 promoter comes of age. FEMS
Microbiol. Rev. 5: 341–57.
Tindale, A.E., Mehrotra, M., Ottem, D., and Page, W.J. (2000) Dual regulation of
catecholate siderophore biosynthesis in Azotobacter vinelandii by iron and oxidative
stress. Microbiology 146 ( Pt 7: 1617–26.
Toukdarian, A. and Kennedy, C. (1986) Regulation of nitrogen metabolism in
Azotobacter vinelandii: isolation of ntr and glnA genes and construction of ntr
120
mutants. EMBO J. 5: 399–407.
Villa, J.A., Ray, E.E., and Barney, B.M. (2014) Azotobacter vinelandii siderophore can
provide nitrogen to support the culture of the green algae Neochloris oleoabundans
and Scenedesmus sp. BA032. FEMS Microbiol. Lett. 351: 70–77.
Vitousek, P.M. and Howarth, R.W. (1991) Nitrogen limitation on land and in the sea :
How can it occur? Biogeochemistry 13: 87–115.
Völker, C. and Wolf-Gladrow, D.A. (1999) Physical limits on iron uptake mediated by
siderophores or surface reductases. Mar. Chem. 65: 227–244.
Walmsley, J. and Kennedy, C. (1991) Temperature-Dependent Regulation by
Molybdenum and Vanadium of Expression of the Structural Genes Encoding Three
Nitrogenases in Azotobacter vinelandii. Appl. Environ. Microbiol. 57: 622–4.
Walmsley, J., Toukdarian, A., and Kennedy, C. (1994) The role of regulatory genes nifA,
vnfA, anfA, nfrX, ntrC, and rpoN in expression of genes encoding the three
nitrogenases of Azotobacter vinelandii. Arch. Microbiol. 162: 422–9.
Wanty, R.B. and Goldhaber, M.B. (1992) Thermodynamics and kinetics of reactions
involving vanadium in natural systems: Accumulation of vanadium in sedimentary
rocks. Geochim. Cosmochim. Acta 56: 1471–1483.
Wedepohl, K.H. (1995) The composition of the continental crust. Geochim. Cosmochim.
Acta 59: 1217–1232.
Wichard, T., Bellenger, J.-P., Morel, F.M.M., and Kraepiel, A.M.L. (2009) Role of the
siderophore azotobactin in the bacterial acquisition of nitrogenase metal cofactors.
Environ. Sci. Technol. 43: 7218–7224.
Wichard, T., Mishra, B., Myneni, S.C.B., Bellenger, J.-P., and Kraepiel, A.M.L. (2009)
Storage and bioavailability of molybdenum in soils increased by organic matter
complexation. Nat. Geosci. 2: 625–629.
Wilhelm, S.W. and Trick, C.G. (1994) Iron-limited growth of cyanobacteria: Multiple
siderophore production is a common response. Limnol. Oceanogr. 39: 1979–1984.
Woodley, P., Buck, M., and Kennedy, C. (1996) Identification of sequences important for
recognition of vnf genes by the VnfA transcriptional activator in Azotobacter
vinelandii. FEMS Microbiol. Lett. 135: 213–21.
Xu, N., Christodoulatos, C., and Braida, W. (2006) Adsorption of molybdate and
tetrathiomolybdate onto pyrite and goethite: effect of pH and competitive anions.
Chemosphere 62: 1726–35.
Xu, Y., Feng, L., Jeffrey, P.D., Shi, Y., and Morel, F.M.M. (2008) Structure and metal
exchange in the cadmium carbonic anhydrase of marine diatoms. Nature 452: 56–61.
121
Yoshimitsu, K., Takatani, N., Miura, Y., Watanabe, Y., and Nakajima, H. (2011) The role
of the GAF and central domains of the transcriptional activator VnfA in Azotobacter
vinelandii. FEBS J. 278: 3287–97.
Zhang, X., McRose, D.L., Darnajoux, R., Bellenger, J.P., Morel, F.M.M., and Kraepiel,
A.M.L. (2016) Alternative nitrogenase activity in the environment and nitrogen
cycle implications. Biogeochemistry 127: 189–198.
122
2.2.11. Supporting information
Iron oxides modulate nitrogenase metal cofactors homeostasis in Azotobacter
vinelandii under diazotrophic conditions
Christelle Jouogo Noumsi 1,2
, Raphael Cassoulet1, Oliver Baars
3, Vincent Burrus
2, Jean-
Philippe Bellenger1.
1Département de chimie, Faculté des sciences, Université de Sherbrooke;
2Laboratory of bacterial molecular genetics, Département de biologie, Faculté des
sciences, Université de Sherbrooke, Sherbrooke (Québec), Canada.
3Department of Geosciences, Princeton University, New Jersey, USA
Corresponding author: Jean-Philippe Bellenger
2500 Boulevard de l’université, J1K 2R1, Sherbrooke (Québec), Canada
Phone number: 819 821-7014. Fax number: 819 821-8017
Jean-Philippe.Bellenger@usherbrooke.ca
Running Title: Iron oxides affect nitrogenase heterogeneity use in A. vinelandii
123
Figure S1. Growth curves of A. vinelandii at two pH values.
Absorbance at 620 nm was plotted versus time for the two tested conditions. The inset shows
curve fitting of growth by a non-linear regression (exponential growth). Values represent the
mean ± SD; n = 3. Opened circles represent control conditions with 5 µM FeCl3 added (pH = 6.4).
Closed circles represent the same control conditions acidified with HCl (pH = 6.0).
124
Figure S2. Vanadium uptake rates between sampling times.
The V uptake can be quantified between sampling points using equations from Bellenger et al.,
2011. V cellular quotas (molV molP-1
) were transformed in V contents per cell through the relation
between cell number and P content (1 cell = 1.8×10-15
molP). The relation between optical density
and cell number (1 OD = 1.16×108 cellules mL
-1) allows to obtain V content in mol mL
-1 and the
number of cells formed between sampling times. From a sampling point to the next, we thus can
calculate the V acquired per cell per time unit:ρ (molV cell-1
min-1
). Values represent the mean ±
SD; n = 3. A two-way ANOVA with a Tukey’s multiple comparisons test was used to compare V
uptake rates between conditions.
125
Figure S3. Relative expression of anfD during the exponential growth phase.
Gene expression was measured by RT-qPCR. Opened bars represent control conditions, light grey
and dark grey bars represent 55 µM and 505 µM FeCl3 added respectively. The dashed line
represents the threshold value for anfD expression. Values represent the mean ± SD; n = 3.
126
Table S1. Statistical analysesa of cellular metal quotas
0.8
505
µM
**
*
***
***
55
µM
***
0.6
505
µM
ns
ns ns
ns *
***
55
µM
ns ns
***
0.4
50
5
µM
ns
ns ns
ns ns
**
55
µM
ns ns
***
0.2
50
5
µM
ns * ns
ns ns
ns
55
µM
ns ns ns
0.1
50
5
µM
ns
ns ns
ns ns
ns
55
µM
ns ns *
0.0
5 50
5
µM
ns
ns ns
***
ns
ns
55
µM
ns
***
ns
OD
62
0n
m
QF
e
5 µ
M
55 µ
M
QM
o
5 µ
M
55 µ
M
QV
5 µ
M
55 µ
M
aTwo-way ANOVA with a Tukey’s multiple comparisons test was used to compare each
metal quota between conditions (added FeCl3) and along the growth (OD620nm). ns, no
significant difference; *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Abbreviations: QFe, iron quotas; QMo, molybdenum quotas; QV, vanadium quotas.
127
CHAPITRE 3
DISCUSSION GÉNÉRALE ET CONCLUSION
Ce projet de doctorat a permis de mettre en lumière une modulation méconnue de
l’acquisition des métaux essentiels Mo et V pour la fixation d’azote chez Azotobacter
vinelandii, en réponse à la présence d’agents complexants naturels. Cette modulation se
caractérise d’une part par une modulation de la quantité des métallophores, et d’autre part
par une acquisition active et simultanée des métaux Mo et V. L’acquisition active de V
survient sans que l’on soit en conditions limitantes en Mo, critère jusqu’à lors reconnu
nécessaire pour l’acquisition de ce métal. L’implication des métallophores dans le
contrôle de l’acquisition des métaux cofacteurs en présence d’oxydes de fer reste encore à
confirmer. La conséquence de cette acquisition non préférentielle des métaux est une
modification des niveaux d’expression des gènes des isoformes des Nases suggérant
fortement l’utilisation simultanée et significative des deux isoformes Mo-Nase et V-Nase
pour assurer la fixation d’azote.
Ces résultats questionnent la vision traditionnelle de la hiérarchisation des Nases et
amènent à s’interroger sur la pertinence des conditions expérimentales d’étude des Nases
et de ses cofacteurs en laboratoire. Enfin ces résultats apportent des éclaircissements sur
le débat concernant les conditions dans lesquelles les Nases alternatives contribuent à
l’apport en azote en milieu naturel.
128
3.1. Perspectives d’amélioration du projet de recherche : présence et activité des
nitrogénases
Les résultats obtenus au cours de ce doctorat nous permettent seulement de suggérer
l’utilisation des isoformes des Nases. L’expression des gènes nifD et vnfD ne sont pas une
garantie que les protéines associées ont été produites. Et si elles sont produites, nous ne
pouvions au moment des expériences, confirmer distinctement leur utilisation effective
pour la fixation d’azote.
Pour ce qui est de la présence des isoformes des protéines, un seul anticorps commercial,
anticorps anti nifH, était disponible lors de nos travaux. Sa spécificité n’aurait pas permis
de conclure avec certitude sur la production de la V-Nase. Un autre moyen permettant de
suivre distinctement la production des Nases est la construction d’un mutant d’A.
vinelandii permettant de quantifier les Nases produites. L’un des projets connexe de ce
doctorat était de construire ce mutant. Le but était d’effectuer des fusions traductionnelles
de chaque isoforme avec une protéine fluorescente, et le suivi de l’intensité de
fluorescence de chaque fluorophore aurait été un indicateur de l’abondance des isoformes
des Nases. Malheureusement, ce projet s’est heurté à la difficulté d’insérer les gènes des
fluorophores dans le génome d’A. vinelandii et n’a pas abouti à la production de mutants.
Une autre approche, reposant sur la mesure de l’activité de la Nase, permet de discriminer
les activités des différentes isoformes. Cette méthode, ISARA (isotopic acetylene
reduction assay) (Zhang et al., 2016), repose sur le fractionnement isotopique différentiel
du carbone lors de la réduction d’acétylène en éthylène. L’ISARA s’est montrée fiable
lors d’essais avec des cultures pures avec et sans Nases alternatives, ainsi qu’avec des
échantillons naturels. Cette nouvelle méthode récemment publiée, et non disponible lors
de la réalisation du projet, est la mieux adaptée à l’heure actuelle pour évaluer la
contribution des différentes Nases à la fixation d’azote, et devrait être mise à profit lors de
futures travaux sur l’utilisation des Nases.
129
3.2. La nitrogénase au vanadium : véritable avantage?
Afin de confirmer que la V-Nase constitue effectivement un atout dans les conditions
stressantes testées lors de ces études, des expériences complémentaires seraient
intéressantes à mener. Le suivi d’un mutant d’A. vinelandii déficient en V-Nase dans ces
conditions de stress métallique permettrait d’évaluer l’importance de cette isoforme pour
la diazotrophie. Si notre hypothèse selon laquelle l’acquisition et l’utilisation simultanées
de Mo et V servent à maintenir une croissance optimale est vraie, nous devrions observer
un effet non négligeable du stress métallique sur la croissance de ce mutant. Une baisse
du taux de croissance serait par exemple un bon indicateur de la plus-value de la V-Nase.
Cela conforterait notre vision des Nases alternatives comme avantage considérable en
conditions naturelles pour les diazotrophes qui les possèdent.
3.3. La hiérarchie des nitrogénases : un concept révolu?
L’utilisation en cascade des Nases a été décrite chez de nombreux diazotrophes tels qu’A.
vinelandii, Anabaena variabilis, Rhodopseudomonas palustris, ou encore Rhodobacter
capsulatus (Bishop et al., 1982; Hales et al., 1986; Robson et al., 1986; Chisnell et al.,
1988; Joerger, Jacobson, Premakumar, et al., 1989; Schneider et al., 1991; Thiel, 1993;
Oda et al., 2005). Ces observations sont en accord avec les efficacités relatives des
isoformes de la Nase et ont mené à une généralisation du concept de hiérarchie : Mo-Nase
> V-Nase > Fe-Nase. Cependant, ce concept de hiérarchie dans l’acquisition et
l’utilisation des métaux cofacteurs de la Nase, repose principalement sur des expériences
de laboratoire effectuées dans des conditions simples, température > 15˚C et métaux
cofacteurs fournis sous forme inorganique et biodisponible.
Lors de ce projet de doctorat nous avons testé la robustesse de la hiérarchie dans des
conditions se rapprochant des conditions naturelles en incluant des agents complexants
130
naturels de métaux. Les résultats de cette thèse montrent que le concept de hiérarchie telle
qu’acceptée jusqu’à lors, ne s’applique sans doute pas, du moins directement, aux milieux
naturels. Ceci illustre à quel point simplifier les conditions expérimentales peut conduire à
l’établissement d’un concept peu ou pas transposable aux milieux naturels. La présence
des agents complexants testés ici ne sont à mon avis que quelques exemples pouvant
mener à une stratégie d’acquisition et d’utilisation des métaux cofacteurs divergeant de la
hiérarchie telle qu’acceptée aujourd’hui. De nombreuses avenues sont alors envisageables
afin d’améliorer nos pratiques d’étude en laboratoire et ainsi mieux cerner le rôle de la
diversité des Nases dans la gestion des stress environnementaux, en particulier la
biodisponibilité des métaux cofacteurs.
Au-delà des effets de la présence d’agents complexants, d’autres facteurs abiotiques
méritent une attention accrue. Par exemple, l’effet de la température sur la régulation des
Nases alternatives par Mo est connu de longue date. À une température inférieure à 15°C,
les Nases au Mo et V présentent des efficacités similaires et le Mo ne régule plus
l’activation de la V-Nase (Miller and Eady, 1988; Walmsley and Kennedy, 1991;
Darnajoux et al., en préparation). Cependant, la grande majorité des études sur la
régulation de l’utilisation des Nases sont réalisées dans des conditions de laboratoire entre
25˚C et 30˚C pour A. vinelandii, correspondant à une plage optimale de températures pour
la croissance. Ces études à températures optimales ont sans doute contribué à
l’établissement du concept de hiérarchie des Nases. Les variations de température des
habitats naturels sont rarement prises en compte dans les expériences de laboratoire. La
température est pourtant un facteur important à prendre en compte, considérant que la
température moyenne annuelle de la terre est de 14°C. Il est donc envisageable qu’à basse
température l’acquisition préférentielle du Mo ne soit plus avantageuse pour les
diazotrophes. Étudier l’homéostasie de Mo et V à basse température (< 15˚C) permettrait
de vérifier l’hypothèse d’une contribution simultanée de ceux-ci pour maximiser la
fixation d’azote. Cela concorderait avec les résultats obtenus ici, et appuierait cette
nouvelle vision de la diversité des Nases.
131
3.4. Les métallophores : clef de voute de la régulation de l’utilisation des nitrogénases en
milieu naturel?
3.4.1. Les métallophores, système d’acquisition versatile de contrôle du stress métallique
La diversité de métallophores que peut produire A. vinelandii témoigne de l’importance
accordée à l’acquisition de métaux (Baars et al., 2016). En effet, dans les horizons O et A
(couches organique et organo-minérale) des sols très riches en matières organique et
minérale, Mo et V sont complexés par de nombreuses molécules organiques et des oxydes
divers, augmentant ainsi le défi de les récupérer (Alloway, 2013). Disposer d’un arsenal
de métallophores de natures diverses est sans doute un avantage important pour
l’acquisition des métaux. Cependant, nos connaissances sur la manière dont A. vinelandii
exploite cette diversité de ligands afin de répondre à divers stress d’acquisition restent
limitées. De nombreux travaux se sont penchés sur l’importance de la disponibilité du Fe
sur la production des métallophores (Page and Huyer, 1984; Crowley et al., 1991;
Wilhelm and Trick, 1994; Duhme et al., 1997; Cornish and Page, 1998; Tindale et al.,
2000; Kraemer, 2004; Sandy and Butler, 2009; Jiang et al., 2015; Baars et al., 2016). Un
nombre nettement plus restreint d’études s’est intéressé au rôle d’autres métaux tels que
Mo, V et W (Duhme et al., 1998; Baysse et al., 2000; Cornish and Page, 2000; Bellenger
et al., 2007; J P Bellenger et al., 2008; Kraepiel et al., 2009). Cependant toutes ces études
ont souvent été réalisées en conditions relativement simples en termes de stress
métallique. Les résultats de ce projet doctoral illustrent comment A. vinelandii peut tirer
profit de la diversité de ses métallophores afin de gérer un stress métallique. A. vinelandii
peut jouer sur la quantité des métallophores produits afin d’optimiser sa croissance. Bien
que nos conditions de travail se rapprochent de conditions plus réalistes, la réponse que
nous avons observée ici en culture pure et en présence d’un seul agent complexant est
sans doute loin d’être représentative des conditions réelles. Notamment, il n’est pas exclu
que les métallophores contribuant le plus à l’acquisition et donc ultimement au contrôle
de l’activité des isoformes de la Nase en milieu naturel soient très différents (en quantité
132
et qualité) de ceux généralement étudiés en conditions de laboratoire; protochéline,
azotochéline et azotobactine chez A. vinelandii. La récente découverte de la vibrioferrine
chez A. vinelandii suggère que des métallophores d’importance environnementale
pourraient ne pas avoir encore été caractérisés chez nos organismes modèles.
Le rôle de la diversité des métallophores peut également se discuter dans le contexte
d’interaction interspécifique. La coopération existant au sein des communautés
microbiennes permet une utilisation de toutes les molécules extracellulaires pour le bien-
être individuel (Ahmad et al., 2008; Villa et al., 2014). Cet aspect peut autant constituer
un avantage qu’un inconvénient selon qui sont les organismes producteurs de
métallophores et qui sont les pirates du système. Il n’est pas exclu, que la quantité ainsi
que la qualité des métallophores supportant l’acquisition de métaux en milieu naturel
soient très différentes de celles observées avec des cultures pures. Il serait possible de
tester l’investissement d’A. vinelandii dans une situation où sa production de
métallophores est piratée par un autre organisme. Par exemple, la souche de Bacillus
subtilis 3610 ΔdhbA-F (incapable de produire ses propres métallophores) peut utiliser
l’azotochéline comme sidérophore/métallophore et former un biofilm (travaux en cours
d’Adrien Rizzi, étudiant au doctorat du laboratoire Bellenger). Dans une expérience de
co-culture de ces organismes, il sera intéressant de voir jusqu’à quel point A. vinelandii
peut modifier sa production de métallophores, et même quels métaux vont dans cette
situation être privilégiés pour sa propre croissance diazotrophe. Cela pourrait avoir des
conséquences non négligeables sur l’utilisation de chacun des métaux cofacteurs des
Nases.
133
3.4.2. Le coût d’acquisition des métaux
Malgré l’importance des métallophores dans les processus d’acquisition de métaux
essentiels, le coût associé à la production de métallophores et au transport des complexes
est rarement considéré. Le cout de production et de récupération des métallophores est
sans doute un facteur important dans le contrôle de l’expression des isoformes de la Nase
qui demeure peu, voire non étudié (Völker and Wolf-Gladrow, 1999). En effet, le fait de
se tourner vers une production plus abondante de métallophores produits en réponse à un
stress métallique implique un investissement énergétique important pour la bactérie qui
influence sans doute la stratégie d’acquisition et d’utilisation des métaux. Les voies
métaboliques du chélome d’A. vinelandii, résumées dans les travaux de Baars et al. en
2016, montrent bien que de tels changements de stratégies impliquent un certain coût en
termes d’énergie, de carbone, et des voies de synthèse mis en jeu. Par exemple, la
production de protochéline et d’azotochéline augmentée jusqu’à 28 fois en présence
d’acide tannique reflète un investissement important. Ce dernier est d’une certaine
manière rentabilisé par l’internalisation simultanée de Mo et V. En effet, la moindre
efficacité de la V-Nase par rapport à la Mo-Nase (environ 20%) (Lee et al., 2009) devient
sans doute un paramètre moins important guidant la stratégie d’utilisation des isoformes
de la Nase par A. vinelandii dans ces conditions de stress. Il semble donc que la principale
adaptation de cette bactérie à la présence des agents complexants est l’augmentation du
coût d’acquisition des métaux. Après avoir augmenté celui-ci, privilégier un métal
cofacteur (Mo) par rapport à un autre (V) ne serait plus primordial pour les besoins de la
fixation d’azote. Ces travaux nous permettent d’entrevoir l’entrée en jeu des Nases
alternatives pour la FBA non plus comme une mise à profit de celles-ci lorsque le Mo est
limitant, mais plutôt comme le résultat d’un investissement important requis pour
l’acquisition des métaux cofacteurs via les métallophores. Le véritable défi pour les
diazotrophes en environnement naturel serait-il le coût d’acquisition des métaux? Cette
hypothèse est à tester en étudiant l’homéostasie des métaux cofacteurs et le chélome
d’autres diazotrophes possédant les Nases alternatives en présence d’agents complexants.
134
Comme mentionné par Kraemer et al. (2015), entre l’étape du relargage des
métallophores et l’acquisition des complexes avec les métaux, différents phénomènes
interviennent : dégradation, adsorption, compétition et piratage. En milieu naturel où les
sources de métaux sont très variées et où de nombreux organismes sont en compétition
pour des ressources limitées, le coût associé à l’acquisition de métaux via les
métallophores est sans doute significativement supérieur à celui observé en conditions de
laboratoire.
La Nase n’est pas un cas isolé d’enzyme ayant subi le stress de l’accès aux métaux
cofacteurs, menant à une diversité d’isoformes. D’autres métalloenzymes assurent une
même réaction en diversifiant le métal cofacteur pour s’adapter aux conditions
environnementales des organismes. C’est le cas de l’anhydrase carbonique, enzyme
catalysant l’hydratation du CO2 en bicarbonate et inversement. Cette réaction est
retrouvée dans tous les règnes du vivants, avec comme métal cofacteur le zinc, à
l’exception des diatomées qui utilisent le cadmium comme métal cofacteur. Des études
ont montré que la limitation du Zn en milieux marins est à l’origine de cette
diversification, et que le Cd, élément abondant des fonds marins, substitue le Zn pour
assurer ces réactions (Lane and Morel, 2000; Xu et al., 2008).
Une prise en compte plus systématique du coût de production des métallophores et du
rendement de récupération des complexes dans la gestion, l’utilisation et la régulation de
la fixation d’azote, et dans d’autres processus biologiques, est sans doute nécessaire à
l’accroissement de notre compréhension des cycles biogéochimiques des éléments, et
donc de nos écosystèmes.
135
3.5. La régulation des nitrogénases : un consortium multifactoriel
Nos connaissances actuelles sur la régulation des Nases par les métaux ne corrèlent pas
avec les résultats d’expression des gènes que nous avons obtenus. En effet, plusieurs
travaux sur la régulation des Nases par les métaux essentiels ont montré que chez A.
vinelandii la présence de Mo inhibe la transcription des gènes vnfHDGK (Jacobitz and
Bishop, 1992) et que 25 nM et 100nM de Mo étaient suffisants pour réprimer l’expression
des activateurs vnfA et anfA respectivement, inhibant ainsi la transcription des gènes vnf
et anf qui en dépendent (Jacobson et al., 1986; Walmsley and Kennedy, 1991;
Premakumar et al., 1998). Pourtant, en présence d’acide tannique et d’oxydes de fer, nous
avons observé une expression significative de vnfD en présence de Mo. La régulation de
l’expression des gènes vnf semble donc ne pas être un système fixe qui fonctionne de la
même façon en toutes conditions. L’effet de la température sur la régulation de la V-Nase
par Mo est une parfaite illustration qu’A. vinelandii adapte ses mécanismes de régulation
en réponse à des stress environnementaux (voir article en annexe pour plus de détails sur
la régulation des Nases). De même, l’acquisition et le transport de V sont considérés
comme activés seulement en conditions limitantes en Mo. Chez la cyanobactérie
diazotrophe Anabaena variabilis par exemple, il a été démontré que la présence de Mo
réprime le système de transport actif VupABC du vanadium (Pratte and Thiel, 2006). Nos
résultats montrent pourtant une acquisition active et simultanée de ces deux métaux dans
des conditions traditionnellement considérées comme non limitantes en Mo. Ce
changement important dans le rôle régulateur de Mo sur l’acquisition de V pourrait
refléter une adaptation relative au coût accru d’acquisition (voir section 3.3).
Considérant l’importance des métallophores pour l’acquisition des métaux, ainsi que les
résultats de mes travaux, je pense que la compréhension de la régulation de l’acquisition
et du transport des métaux Mo, V et Fe ne peut pas être dissociée de celle de la régulation
des trois Nases associées. Tester les liens entre la régulation de la capacité à acquérir les
métaux essentiels (ex. production de métallophores, transporteurs membranaires,…) et la
136
régulation de l’activation et activité des isoformes de la Nase pourrait accroitre
significativement notre compréhension de la FBA en milieux naturels.
3.6. Répartition des isoformes des nitrogénases chez les diazotrophes
Comme le laissent entrevoir les résultats obtenus au cours de ce projet, les contraintes
abiotiques inhérentes aux habitats des diazotrophes semblent contribuer significativement
à l’acquisition et l’utilisation des métaux cofacteurs des Nases. Au cours de l’évolution,
ces contraintes ont pu influencer l’acquisition des gènes des Nases alternatives par les
microorganismes, dans le but de s’adapter aux conditions environnementales spécifiques
de leurs milieux, notamment à la biodisponibilité des métaux pouvant servir de cofacteurs
(Raymond et al., 2004; Boyd et al., 2011). Cela pourrait expliquer la répartition aléatoire
des isoformes des Nases telle que nous la connaissons aujourd’hui. En effet en plus de la
Mo-Nase les Nases alternatives ne sont retrouvées que chez quelques diazotrophes,
certains possédant la V-Nase, la Fe-Nase ou encore les deux. L’évolution de la chimie des
métaux dans les milieux où se sont développés ces microorganismes aurait probablement
favorisé une diversification aléatoire. L’acquisition et le maintien des gènes des Nases
alternatives résulteraient donc entre autres d’une adaptation à l’accès aux métaux. Cette
pérennité au fil de l’évolution suggère une contribution significative des Nases
alternatives à l’apport en azote dans les écosystèmes.
Dans cette logique, l’absence des Nases alternatives chez les diazotrophes en symbiose
avec les plantes supérieures s’expliquerait alors par un apport en Mo toujours suffisant
pour la FBA. Il est envisageable que les plantes supérieures, grâce au déploiement de leur
système racinaire et de leur symbiose mycorhizienne aient toujours été aptes à récupérer
assez de Mo à partir de toutes les matrices du sol pour supporter les besoins de leur
symbiontes fixateurs d’azote. Cet investissement pour assurer l’apport de ce
micronutriment essentiel peut justifier que (i) les diazotrophes associés aux plantes
n’aient pas été exposés au défi d’acquérir le métal cofacteur et n’aient donc jamais acquis
137
les gènes des Nases alternatives pour s’adapter aux stress environnementaux, ou (ii)
l’établissement de ces symbioses soient un moyen de contourner ces stress, en s’associant
à un organisme pourvoyeur de micronutriments.
Qu’importe le scénario, l’accès aux métaux, tout comme le coût d’acquisition de ceux-ci,
semblent être des éléments pertinents ayant pu contribuer à la diversité des organismes
diazotrophes.
138
ANNEXE
Alternative nitrogenases regulation in the diazotrophic bacterium Azotobacter
vinelandii
Christelle Jouogo Noumsi1,2
, Vincent Burrus2, Jean-Philippe Bellenger
1,
1Département de chimie, Faculté des sciences, Université de Sherbrooke.
2Laboratory of bacterial molecular genetics, Département de biologie, Faculté des
sciences, Université de Sherbrooke, Sherbrooke (Québec), Canada.
Corresponding author: Jean-Philippe Bellenger
2500 Boulevard de l’université, J1K 2R1, Sherbrooke (Québec), Canada
Phone number: 819 821-7014. Fax number: 819 821-8017
Jean-Philippe.Bellenger@usherbrooke.ca
139
Abstract
Nitrogenases (Nase) are the enzymes responsible of dinitrogen reduction into bioavailable
ammonia. Three isozymes have been identified so far: the molybdenum-Nase, the
vanadium-Nase and the iron-only Nase. For years, the Mo-Nase has been considered as
the canonical isozyme, responsible for the major part of biological nitrogen fixation
(BNF) worldwide. While the two alternative Nases (V- and Fe-Nases) received less
attention, they are now suggested to be more active than previously recognized. The soil-
dwelling bacterium Azotobacter vinelandii is a model organism that possesses the three
Nase isozymes and has been used for years to study BNF. Regulation of BNF in this
microorganism is thus primordial to ensure an optimal, low energy-consumption nitrogen
fixation. In this review, we highlight the molecular mechanisms involved in regulation of
alternative Nases compared to the canonical Mo-Nase in A. vinelandii. Recent discoveries
suggest more complex systems explaining alternative Nase contribution to BNF in this
bacterium. This highlights the need for experimental designs more representative of
natural conditions to better understand the dynamic use of alternative Nases.
140
Introduction
Biological nitrogen fixation (BNF) is a key reaction of the nitrogen cycle that converts
atmospheric dinitrogen (N2) into bioavailable ammonia (NH3). This reaction is a major
input of nitrogen in unmanaged ecosystems. Several studies have highlighted a limitation
of net primary productivity due to a lack of fixed nitrogen in diverse ecosystems. This
lack of bioavailable nitrogen is the result of a BNF limitation (Vitousek & Howarth,
1991; Elser et al., 2007; LeBauer & Treseder, 2008). BNF relies on a few number of
prokaryotes called diazotrophs. These microorganisms can be involved in symbiotic
associations with higher plants, mosses and fungi or live freely. They use the enzyme
nitrogenase (Nase), a metalloprotein to catalyze the dinitrogen reduction. Three isoforms
of nitrogenase have been identified so far: the molybdenum-Nase (Mo-Nase), the
vanadium-Nase and the iron-only Nase (V- and Fe-Nases). The Mo-Nase is found in all
diazotrophs, and is the most efficient isoform in theory (it needs fewer electrons and less
energy to reduce 1 mole of N2). V- and Fe-Nases are found only in some diazotrophs
(alone or together), in addition to Mo-Nase, and are in theory less efficient to reduce N2
compared to Mo-Nase (equations [1], [2] and [3]) (Masepohl 2002, Bothe 2010). For
these reasons, V- and Fe-Nase are called alternative nitrogenases.
N2 + 8H+ + 8e
− + 16ATP → 2NH3 + H2 + 16ADP + 16Pi [1]
N2 + 12H+ + 12e
− + 24ATP → 2NH3 + 3H2 + 24ADP + 24Pi [2]
N2 + 21H+ + 21e
− + 42ATP → 2NH3 + 7.5H2 + 42ADP + 42Pi [3]
The so-called alternative Nases are however present in many aquatic and terrestrial
ecosystems suggesting an important input in BNF (Loveless 1999, Betancourt 2008,
Hodkinson 2014). Their contribution to global N fixation need to be reevaluated in order
to have a better overview of BNF (Reed et al., 2011).
141
The ubiquitous bacterium Azotobacter vinelandii is a good model to study BNF used for
years. This aerobic Gram negative Gammaproteobacteria grows as free-living organism in
soils. It has the advantage to possess the three isozymes of Nase (Bishop et al., 1980,
1982; Chisnell et al., 1988), allowing the study of all isoforms within the same
microorganism. A specific nomenclature to distinguish isoform genes was established:
nif, vnf and anf code for the Mo-, V- and Fe-Nases respectively (Fig. 1). Nitrogenase
structure is well known and made of two major metalloproteins working in tandem: the
dinitrogenase reductase (60 kDa) that acts as an electron acceptor and transfer them to the
dinitrogenase (230-260 kDa) that contains the active site of the protein (Howard and
Rees, 1996). The dinitrogenase reductase is a homodimer of the subunit γ encoded by
nifH (Mo-Nase), vnfH (V-Nase) and anfH (Fe-Nase) genes. The dinitrogenase is an
heterotetramer of subunits α and β, for Mo-Nase, encoded by nifDK or an heterooctomer
of subunits α, β and δ encoded by the operons vnfDGK and anfDGK for V and Fe-Nases
respectively (May and Dean, 1991; Lowe et al., 1993; Peters et al., 1995; Lee et al.,
2009).
142
Figure 1: schematic representation of gene organization in the nitrogenase isoforms clusters
of Azotobacter vinelandii. Structural genes HD(G)K are represented in grey (subunits encoded are
listed under each gene). Regulatory genes A and L are shown in green (activator) and red
(repressor) respectively. Other genes in white are involved in folding, maturation or have
unpredicted functions.
BNF is an energy consuming reaction (at least 16 ATP to reduce 1 mole of N2), and
requires microaerophilic or anaerobic conditions (Robson and Postgate, 1980). A.
vinelandii and N2 fixers in general thus have to tightly control Nases activity to efficiently
ensure their N supply at the lower cost. While almost all the mechanisms involved in BNF
regulation by Mo-Nase are well understood, there are still black boxes about alternative
V- and Fe-Nases. Now that the importance of these Nases to global N budget is increasily
evident (Reed et al., 2011, Hodkinson 2014, Zhang 2016, Zhang 2014, Bellenger 2014, ),
it will be helpful to understand deeply when alternative Nases are required and used, and
how they are regulated. The present review summarizes the current knowledge on the
mechanisms involved in alternatives Nases regulation by A. vinelandii regarding specific
143
environmental factors, and highlights the knowledge gap in our comprehension of these
systems compared to the canonical Mo-Nase.
1. Genetic actors of regulation
The universal Mo-Nase has been the most deeply studied Nase isoform for many years.
Genetic, structural, biochemical, spectroscopic aspects of this isoform have been studied,
allowing a better understanding of Mo-Nase folding, activity and regulation (Jacobson et
al., 1989; Kirn and Rees, 1992; Burgess and Lowe, 1996; Howard and Rees, 1996; Rees
and Howard, 2000; Seefeldt et al., 2009; Setubal et al., 2009; Noar and Bruno-Bárcena,
2013; Morrison et al., 2015). Genetic studies helped to understand regulation
mechanisms, in particular the role of the transcriptional activator- and repressor- encoding
genes nifA and nifL, which have been well characterized. nifA and nifL respectively
activate and indirectly repress the other genes of the nif cluster and thus the subsequent
activity of the Mo-Nase (Fig. 1).
Actors and mechanisms involved in the nif cluster regulation were then used as models to
find equivalent systems and functions for the alternative Nases. Direct repressor genes
similar to nifL have not been found for the alternative Nases, suggesting a different
pathway for these Nases repression or a role of NifL. The nifA paralogs genes vnfA and
anfA were found to code for activators of the vnf and anf clusters respectively (Fig. 1)
(Joerger, Jacobson, and Bishop, 1989).
nifA, vnfA and anfA share high nucleotide similarities, and are all preceded by a ntrA-
dependent promoter, suggesting a regulation by the level of fixed nitrogen (Hirschman et
al., 1985; Merrick and Gibbins, 1985; Merrick et al., 1987). Amino acids alignments
show that NifA has only 40% identity with VnfA and AnfA, while these last two share
144
63% identity. The half-protein C-terminal sequence of the 3 activators contains an ATP
binding site and a DNA binding domain (helix-turn-helix motif). The central domain
contains interaction sites with the alternative sigma54 transcription factor, RNA-
polymerase, or both. Finally the N-terminal region contains cysteine rich motifs possibly
implied in interaction with metals and oxygen sensing. This region is thought to be the
regulatory domain of the activators (Fig. 2) (Joerger, Jacobson, and Bishop, 1989; Frise et
al., 1994; Premakumar et al., 1994; Yoshimitsu et al., 2011).
Figure 2. Essential domains in nitrogenase activators NifA, VnfA and AnfA. 3 major domains
are involved in activators activity: the N-terminal regulatory domain (sensor of environmental
factors), the central domain (interaction with σ factor-RNA polymerase and NTPase activity) and
the C-terminal domain (DNA-binding site for target genes to regulate).
Divergence between the 3 activators are mainly localized in regions corresponding to
DNA-binding sites (Joerger, Jacobson, and Bishop, 1989), probably to confer specificity
to each activator for the appropriate genes to regulate (Jacob and Drummond, 1993), and
in the N-terminal part, allowing differential regulation of activators by various signals like
metals, O2 or reactive oxygen species (ROS) (Jacob and Drummond, 1993; Frise et al.,
1994; Nakajima et al., 2010; Yoshimitsu et al., 2011).
145
vnfA and anfA encode proteins of about 520 amino acids which likely bind to specific
sequences upstream of the genes they regulate. While these sequences have been studied
in detail for the V-Nase regulation, studies have been more scarce for the regulation of the
Fe-Nase. Austin and Lambert (1994) showed using in vitro experiments that AnfA protein
binding sites are located between 200 and 300 bp upstream of the anfH promoter. VnfA
target sequences are better characterized. The intergenic region between the activator
vnfA and the vnf clusters extends from 228 bp to 15 kb (228 bp for the vnfEN cluster, 8.8
kb for the vnfHFd, 11 kb for the vnfDGK cluster), implying a large set of 15 to 17 genes
to regulate (and more if we take in account other clusters like the nifBUSVM gene,
essential for V-Nase expression as shown by Drummond et al., in 1996). These promoter
regions contain a characteristic activator recognition motif, the upstream activator
sequence (UAS), which is a 4 bp inverted repeat sequence separated by 6 variable
nucleotides (GTAC-N6-GTAC). This motif is duplicated in promoters of structural V-
Nase genes vnfH and vnfD (probably for the DNA-binding property of VnfA), and their
deletion abolished gene expression (Woodley et al., 1996; Bageshwar et al., 1998).
Additional studies are needed to better understand the role of the regulators VnfA and
AnfA. Moreover, since no repressor of the vnf and anf clusters has been identified, VnfA
and AnfA are likely involved in the repression of these clusters (through the regulatory
domains), or there might be a role of NifL.
146
2. Physiological cell state: regulation by cellular needs
Nitrogen fixation is an energy consuming process and needs to be tightly regulated to
prevent energy waste. Alternative nitrogenases are more ATP consuming for lower
activities (equations [1], [2] and [3]) compared to Mo-Nase, and they eventually need a
thighter control. Physiological factors known to control nitrogen fixation in A. vinelandii
are intracellular fixed-nitrogen level and dissolved oxygen.
2.1. Regulation by fixed-nitrogen: promoters of vnf and anf clusters, as well as nif cluster,
are characterized by a consensus sequence specifically ntrA-dependent, GC at position 12
and GG at position 24 upstream of the transcription initiation nucleotide (Thöny and
Hennecke, 1989). The ntr (nitrogen regulatory) system was first known to be involved in
transcriptional regulation of many genes required when the level of the preferential form
of fixed-nitrogen (ammonium) is low for enteric bacteria like Klebsiella aerogenes
(Brenchley et al., 1973; Macaluso et al., 1990; Schwacha and Bender, 1993). This system
was also found, with more or less similarities in non-enteric bacteria like N2 fixers A.
vinelandii or Klebsiella pneumoniae where it comes at play under diazotrophic
conditions. The component ntrA encodes the sigma 54 transcription factor essential for
nif, vnf and anf genes transcription by RNA polymerase (Hirschman et al., 1985; Merrick
and Gibbins, 1985; Merrick et al., 1987). In the absence or low level of fixed-nitrogen,
this protein could thus allow the expression of genes coding for the activators VnfA
and/or AnfA and consequently the expression of others vnf and/or anf genes, all having
ntrA-dependent promoters (Fig. 3). The other component of the ntr system found in some
N2 fixers such as A. vinelandii or K. pneumoniae is NtrC. Once phosphorylated, it helps
recruit sigma 54 and RNA polymerase and thus enhances transcription of ntr-dependent
genes (Fig. 3) (Martinez-Argudo 2004, Zhang 2005). NtrC phosphorylation is the end of a
cascade induced by a low level of fixed-nitrogen in cells. This has been reported by
Schmitz et al (2002) in K. pneumoniae for the nifLA operon which regulates Mo-Nase.
However, this protein seems to be non-essential for alternative Nases genes expression in
147
A. vinelandii like ntrA product is (Toukdarian and Kennedy, 1986). Fixed-nitrogen,
ammonium (NH4+), only partially represses vnfA and anfA expression as well as
expression of the structural vnf genes (Toukdarian and Kennedy, 1986). This partial
repression (Jacobitz and Bishop, 1992) suggests a regulation at post-transcriptional or
translational level for V-Nase by NH4+ and at transcriptional level for Fe-Nase. Precise
mechanisms and actors explaining how NH4+ ions could act at transcriptional and
translational levels for alternative Nases expression remain to be determined. However,
there are some trails based on the work done on Mo-Nase regulation by NH4+ in different
diazotrophs. A. vinelandii codes for a PII-like protein which is a major actor of a nitrogen-
sensing and signal transduction cascade (Meletzus et al., 1998). Under nitrogen-sufficient
conditions, the PII-like protein is non-uridylylated and can interact with the repressor
NifL, leading to its functional activation (Little et al., 2000). NifL has been shown to
inhibit : (i) NifA transcriptional activity in vivo (Merrick et al., 1982) and (ii) the DNA
binding function of NifA (Barrett et al., 2001) (Fig. 3A). For diazothrophs that do not
belong to the Gammaproteobacteria and those that do not code for a NifL protein (e.g.
Herbaspirillum seropedicae, Azospirillum brasilense), data suggest that the PII proteins
participate in signaling the nitrogen status to the N-terminal domain of NifA (Monteiro et
al., 1999; Souza et al., 1999; Steenhoudt and Vanderleyden, 2000). This inhibitory
pathway of the activator could be possible for alternative Nases as they do not possess
NifL homologs. VnfA and AnfA could thus be targeted in their N-terminal domain by
PII-related proteins and inactivated under sufficient fixed-nitrogen conditions. However
this would only explain the low transcriptional regulation (Fig. 3B). To date, no data
explain the translational regulation observed for Vnf- and Anf-Nases. One can however
imagine protein inactivation, as observed in some diazotrophs such as Azospirillum
brasilense with the inactivation of the dinitrogenase reductase through a reversible ADP-
ribosylation (Fig. 3B) (Nordlund and Högbom, 2013; Moure et al., 2015).
148
Figure 3. Schematic pathways of Nase regulation by nitrogen level. A) Regulation of Mo-Nase
through the ntr components and the PII proteins. B) Regulation of alternative Nases. Suggested
mechanisms are presented with a question mark. Circled P and U represent phosphorylated and
uridylated forms of proteins respectively. Gray zones marked p represent ntr promoters. Dashed
line represents the partial repression of alternative gene expression
2.2. Regulation by oxygen: nitrogenase is a protein sensitive to oxygen and reactive
oxygen species (ROS), especially demonstrated in vitro, with half-life after air exposure
ranging from only 45 seconds to 8 minutes depending on bacterial species and
nitrogenase isoform (Robson and Postgate, 1980). Consequently, diazotrophs have to
perform BNF into anaerobic or microaerophilic conditions to prevent nitrogenase damage
and inactivation. While natural anaerobic or microaerophilic diazotrophs remain in near-
optimal oxygen levels, aerobic diazotrophs such as A. vinelandii have to deal with their
important need for oxygen for respiration for ATP supply, while avoiding nitrogenase
inhibition by high oxygen levels and its derivatives. Unlike cyanobacteria such as
Anabaena variabilis or Anabaena cylindrica, A. vinelandii does not form specialized cells
(such as heterocysts) that can control oxygen stress and ensure BNF (Masukawa 2009,
149
Kumar 2010). BNF has thus to be tightly regulated in this bacterium to face oxygen
damage.
Gallon (1992) well summarized mechanisms used by A. Vinelandii to mitigate the oxygen
level-N2 fixation incompatibility. Major actions used when oxygen concentrations
increase are: cells aggregation, increased respiration rate (also known as “respiratory
protection”), increased superoxide dismutase activity, all leading to a decrease in
dissolved O2 and ROS, thereby allowing the folding of a functional and active
nitrogenase. Even if the efficiency of the respiratory protection is now questioned to
decrease enough the oxygen level in cells in order to prevent Nase damage (Oelze, 2000),
it remains an important input for such aerobic organism under diazotrophic conditions. A
temporary protection of a folded nitrogenase (regardless of the isoform) from oxygen has
also been demonstrated. It is an interaction between a protein called Shethna and the
nitrogenase which confers a significant protection to oxygen-mediated inactivation; this
has been named conformational protection (Moshiri et al., 1994). This last mechanism is
transient and reversible; nitrogenases are thus not degraded but remain inactive until
oxygen concentration is lowered. This is an efficient post-translational regulation used by
A. vinelandii. Unlike the well described oxygen regulation of Mo-Nase (Blanco et al.,
1993; Hill et al., 1996; Dixon, 1998; Barrett et al., 2001; Schmitz et al., 2002) (sensing
redox ability of NifL and then its interaction with NifA in order to inhibit other nif genes
transcription), the specific effect of oxygen and ROS on alternative Nases remains
unclear. However several studies suggested that ROS, more than O2 itself, could be the
environmental factor inducing alternative Nases regulation. In the N-terminal domain
(regulatory region) of VnfA and AnfA, a Cys-rich motif (Cys-X-Cys-XXXX-Cys for
VnfA and Ser-X-Cys-XXXX-Cys for AnfA) is located upstream of the GAF domains and
likely assembles [Fe-S] clusters. When ROS level is elevated, the [Fe-S] clusters
disassemble (maybe as a consequence of a Fenton reaction), leading to a conformational
modification of VnfA and AnfA (Fig. 4). This modification makes them unable to
activate vnf and anf gene transcription (Nakajima et al., 2010; Yoshimitsu et al., 2011).
150
Figure 4. Schematic pathways of Nase regulation by oxygen level. A) Regulation of Mo-Nase
through the oxidation of the repressor NifL. Active NifL interacts with the activator NifA, thus
inhibits its activity. B) Regulation of alternative Nases by reactive oxygen species (ROS).
Suggested mechanisms are presented with a question mark. Gray zones marked p represent ntr
promoters.
3. Effect of temperature on regulation and activity
Temperature has been first shown to reduce Nase activity in an in vitro study using
purified enzymes from Azotobacter chroococcum (Miller and Eady, 1988). Mo- and V-
Nases activities were both lowered when temperature decreased from 30 to 5˚C, with a
stronger reduction of Mo-Nase activity. Furthermore, work by Darnajoux (thesis) on the
cyanobacterium Anabaena variabilis revealed a decreased activity of both Mo and V-
Nases in vivo when the temperature was lowered gradually from 35 to 7˚C. This effect
likely results from a general slowdown of the metabolic activity of the microorganism as
it is below its optimal growth temperature. The authors however noticed that the V-Nase
activity was less affected below 15˚C, suggesting that V-Nases are less sensitive to low
151
temperatures. Walmsley and Kennedy’s work revealed how temperature could affect
regulation by metal in A. vinelandii. While at optimal temperature (30˚C) Mo represses
vnfH and anfH transcription and V represses anfH transcription, the repression levels
were found to be lower or even absent at 20˚C and 14˚C. They hypothesized that this
lower repression level might be due to a less efficient acquisition of the repressing metal.
Temperature could thus be seen as a general factor regulating BNF by general slowdown
of the metabolic function and as an indirect regulator of Nase activities through the
repression of metal uptake pathways. This last suggested role requires further
investigations to better understand the molecular mechanisms of regulation by metals, in
order to decipher at which step and how temperature actually comes into play.
4. Regulation by essential metals: transcriptional level for repression, and
translational level for activation
The activity of Nase isozymes, as metalloproteins, depends on the availability of their
metal cofactors, molybdenum (Mo), vanadium (V) and iron (Fe). Because of the
theoretical efficiencies of Nases and the high energetic cost to reduce N2 ([1], [2] and [3])
(Masepohl et al., 2002), it is likely that A. vinelandii would preferentially use the Mo-
Nase, then the V-Nase and finally the Fe-Nase to ensure its N supply under diazotrophic
conditions. This theoretical hierarchy has actually been observed in laboratory
experiments with pure cultures of A. vinelandii (Bellenger et al., 2011).
The first evidence of Nase regulation by metals came with the studies describing how A.
vinelandii’s alternatives Nases have been discovered. The V-Nase was found when Mo
was absent from the growth medium and the Fe-Nase was discovered when both Mo and
V were missing in the growth medium (Bishop et al., 1980, 1982; Hales et al., 1986;
Chisnell et al., 1988; Joerger, Jacobson, Premakumar, et al., 1989; Pau, 1989). To
investigate more at which level this regulation is operating, structural subunits genes of
different Nases were tested using transcriptional lacZ fusions, and their expression
152
quantified in different conditions. Jacobitz and Bishop (1992) showed that the presence of
Mo inhibits the transcription of the vnfHDGK cluster that codes for the structural subunits
of V-Nase. In the absence of Mo, transcription of these genes was observed, even in the
absence of V in the medium. However, translation of these mRNA transcripts is V-
dependent. Minimal Mo concentrations necessary to repress vnfA and anfA transcription
are 25 nM and 100 nM, respectively (Jacobson et al., 1986; Premakumar et al., 1998).
Repression of Fe-Nase at the transcriptional level by Mo and V was also demonstrated,
and the presence of each metal was sufficient to repress anfH transcription (a structural
gene of Fe-Nase) (Walmsley and Kennedy, 1991). However, temperature was shown to
significantly decrease the level of repression (see above). There are less data about
repression of Fe-Nase expression by Mo and V compared to V-Nase, and almost all
studies focus on anfH transcription, with few data on the other genes of the anfHDGK
operon. As it has been demonstrated in vitro and in vivo that the γ subunit of one Nase
isozyme (encoded by nifH, vnfH and anfH) can be used with the other subunits of another
isozyme (α, β, δ) to form an active Nase (Chatterjee et al., 1997; Pratte et al., 2006), it
would be interesting to systematically assess the mRNA transcript levels of all these
structural genes to confirm the regulation of a Nase by a specific metal cofactor.
Premakumar et al., (1998) well resumed and explained alternative Nases gene regulation
by showing that the presence of metals actually represses the expression of the
transcriptional activators VnfA (by Mo) and AnfA (by Mo and V), thereby leading to the
lack of V- and Fe-Nase subunits. Unfortunately, precise molecular mechanisms by which
this repression by metals occurs remain unknown. Interestingly, AnfA also has a putative
metal-binding site in its N-terminal sequence, and requires a dinitrogenase protein
(regardless of its provenance, nifH or vnfH) to be functional (Frise et al., 1994;
Premakumar et al., 1994). The N-terminal regulatory domains of VnfA and AnfA,
through the Cys-rich motifs, could be involved in this regulation. This highlights a
potential more specific pathway of regulation by metal which remains to be characterized.
Taken together, these information help to understand the hierarchy suggested by the
theoretical isozymes efficiencies and demonstrated by Bellenger et al., (2011) in A.
153
vinelandii (Mo-Nase, V-Nase and Fe-Nase). This study showed that when the three
essential metals are bioavailable, the bacterium first takes up Mo and expresses the nifD
gene that codes for a structural subunit. Additionally, internalized Mo could thus repress
the expression of V and Fe-Nases as demonstrated above. Then intracellular Mo reached
the threshold to ensure N fixation with Mo-Nase only (2×10-4
molMo/molP), V-Nase
mRNA transcripts are thus generated, and translated when the bacterium has acquired
enough V. Meanwhile Fe-Nase remains repressed (this repression results from sufficient
NH4+ amount and the presence of Mo and V). Only when intracellular V threshold is
reached, the Fe-Nase can be activated and used to fix nitrogen. This suggests that there
are 2 intermediary phases, corresponding to the depletion of Mo and V. During these
periods, does A. vinelandii stop fix dinitrogen? Some studies have shown that repression
by metals is not a strict bistable “on/off” switch, and that as demonstrated for Mo, there
are minimal concentrations of metals required to exert the repression (Jacobson 1986).
This leads to two possibilities during the above mentioned intermediary phases: (i)
simultaneous use of 2 Nases as suggested by Bellenger (2011) or (ii) no N2 fixation if we
assume that the bacteria have fixed enough N2 to bypass this transition. A recent study
investigating the effect of natural organic matter on diazotrophic growth of A. vinelandii
questioned about metal regulation (Jouogo Noumsi et al., 2016). In the presence of
dissolved organic concomitant high Mo and V contents were observed with nif and vnf
gene expression. This work showed that regulation of V-Nase by Mo is more complex
than previously thought and can be Mo-independent. Thus regulation by essential metals
seems not to be an undiverted procedure, and could probably be more versatile in natural
habitats. Other factors can be involved in Nase regulation, such as metal uptake,
metallophores production. Further studies are needed to understand how they can affect
Nase regulation at genetic level.
154
Conclusion
Alternative nitrogenases have been discovered in the soil-dwelling bacterium
A. vinelandii 30 years ago. Since then, comprehension of their structure, function and
specificities compared to the canonical molybdenum-nitrogenase has shown important
progress. However, several gaps need to be filled to understand all of the regulatory
aspects and complete the story of N2 fixation. Major actors of regulation have been
characterized (activators, repressors, sensor proteins and their domains), yet we know a
lot less about how these actors actually interact with their targets, and at the end lead to
transcriptional and/or translational regulation. More precise and temporal analyses are
necessary to understand (i) what is going on during the switch between one nitrogenase to
another and (ii) how the bacterium can stop its repression mechanisms and allows
simultaneous expression of different isoforms. We highlighted here a decrease of quantity,
precision and relevance of knowledge regarding regulatory mechanisms when we go from
the most efficient Mo-Nase to the less efficient isoform Fe-Nase. Our knowledge likely
follows the hierarchy efficiency of nitrogenase isoforms in A. vinelandii. There are
increasing evidence of the under-estimation of the role of alternative nitrogenases in the
global nitrogen budget, and recent findings have shown that V-Nase expression can
escape the Mo regulation. It is thus primordial to build experiments under more realistic
conditions to better understand the link between metal acquisition and alternative Nase
regulation. A better understanding the overall system of BNF and correct assignment,
without doubt, of which isoform is active and when will help us to better predict and
estimate nitrogen inputs in ecosystems.
155
References
Abdel-Gawad, F.M. and Issa, R.M. (1986) Spectrometric determination of vanadium (V)
with tannic acid and its application to biological fluids. Ind. J. Chem. 25: 701-702.
Ind. J. Chem. 25: 701–702.
Ahmad, F., Ahmad, I., and Khan, M.S. (2008) Screening of free-living rhizospheric
bacteria for their multiple plant growth promoting activities. Microbiol. Res. 163:
173–81.
Ahmed, E. and Holmström, S.J.M. (2014) Siderophores in environmental research: roles
and applications. Microb. Biotechnol. 7: 196–208.
Alloway, B. (2013) Heavy metals in soils Third. Alloway,B.J. (ed).
Austin, S. and Lambert, J. (1994) Purification and in vitro activity of a truncated form of
ANFA. Transcriptional activator protein of alternative nitrogenase from Azotobacter
vinelandii. J. Biol. Chem. 269: 18141–8.
Baars, O., Zhang, X., Morel, F.M.M., and Seyedsayamdost, M.R. (2016) The Siderophore
Metabolome of Azotobacter vinelandii. Appl. Environ. Microbiol. 82: 27–39.
Bageshwar, U.K., Choudhury, N.R., and Das, H.K. (1998) Analysis of upstream
activation of the vnfH promoter of Azotobacter vinelandii - ProQuest. Can. J.
Microbiol. 44.:
Barrett, J., Ray, P., Sobczyk, A., Little, R., and Dixon, R. (2001) Concerted inhibition of
the transcriptional activation functions of the enhancer-binding protein NIFA by the
anti-activator NIFL. Mol. Microbiol. 39: 480–93.
Barron, A.R., Wurzburger, N., Bellenger, J.P., Wright, S.J., Kraepiel, A.M.L., and Hedin,
L.O. (2009) Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest
soils. Nat. Geosci. 2: 42–45.
Baumgartner, J. and Faivre, D. (2015) Iron solubility, colloids and their impact on iron
(oxyhydr)oxide formation from solution. Earth-Science Rev. 150: 520–530.
Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J.M., et al.
(2000) Vanadium interferes with siderophore-mediated iron uptake in Pseudomonas
aeruginosa. Microbiology 146 ( Pt 1: 2425–34.
Bellenger, J.-P., Arnaud-Neu, F., Asfari, Z., Myneni, S.C.B., Stiefel, E.I., and Kraepiel,
A.M.L. (2007) Complexation of oxoanions and cationic metals by the biscatecholate
siderophore azotochelin. J. Biol. Inorg. Chem. JBIC a Publ. Soc. Biol. Inorg. Chem.
12: 367–376.
156
Bellenger, J.P., Wichard, T., and Kraepiel, A.M.L. (2008) Vanadium requirements and
uptake kinetics in the dinitrogen-fixing bacterium Azotobacter vinelandii. Appl.
Environ. Microbiol. 74: 1478–1484.
Bellenger, J.P., Wichard, T., Kustka, A.B., and Kraepiel, A.M.L. (2008) Uptake of
molybdenum and vanadium by a nitrogen-fixing soil bacterium using siderophores.
Nat. Geosci. 1: 243–246.
Bellenger, J.-P., Wichard, T., Xu, Y., and Kraepiel, A.M.L. (2011) Essential metals for
nitrogen fixation in a free-living N2-fixing bacterium: chelation, homeostasis and
high use efficiency. Environ. Microbiol. 13: 1395–411.
Bennett, L.T., Cannon, F., and Dean, D.R. (1988) Nucleotide sequence and mutagenesis
of the nifA gene from Azotobacter vinelandii. Mol. Microbiol. 2: 315–21.
Betancourt, D.A., Loveless, T.M., Brown, J.W., and Bishop, P.E. (2008) Characterization
of Diazotrophs Containing Mo-Independent Nitrogenases, Isolated from Diverse
Natural Environments. Appl. Environ. Microbiol. 74: 3471–3480.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1980) Evidence for an alternative
nitrogen fixation system in Azotobacter vinelandii. Proc. Natl. Acad. Sci. U. S. A. 77:
7342–7346.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1982) Expression of an alternative
nitrogen fixation system in Azotobacter vinelandii. J. Bacteriol. 150: 1244–1251.
Blanco, G., Drummond, M., Woodley, P., and Kennedy, C. (1993) Sequence and
molecular analysis of the nifL gene of Azotobacter vinelandii. Mol. Microbiol. 9:
869–79.
Boison, G., Steingen, C., Stal, L.J., and Bothe, H. (2006) The rice field cyanobacteria
Anabaena azotica and Anabaena sp. CH1 express vanadium-dependent nitrogenase.
Arch. Microbiol. 186: 367–76.
Bothe, H., Schmitz, O., Yates, M.G., and Newton, W.E. (2010) Nitrogen fixation and
hydrogen metabolism in cyanobacteria. Microbiol. Mol. Biol. Rev. 74: 529–51.
Boyd, E.S., Hamilton, T.L., and Peters, J.W. (2011) An alternative path for the evolution
of biological nitrogen fixation. Front. Microbiol. 2: 205.
Branca, M., Micera, G., Sanna, D., and Dessì, A. (1990) Complexation of
oxovanadium(IV) by humic and tannic acids. J. Inorg. Biochem. 39: 109–115.
Brenchley, J.E., Prival, M.J., and Magasanik, B. (1973) Regulation of the synthesis of
enzymes responsible for glutamate formation in Klebsiella aerogenes. J. Biol. Chem.
248: 6122–8.
Brigle, K.E., Newton, W.E., and Dean, D.R. (1985) Complete nucleotide sequence of the
157
Azotobacter vinelandii nitrogenase structural gene cluster. Gene 37: 37–44.
Burgess, B.K. and Lowe, D.J. (1996) Mechanism of Molybdenum Nitrogenase. Chem.
Rev. 96: 2983–3012.
Burns, R.C. and Hardy, R.W.F. (2012) Nitrogen Fixation in Bacteria and Higher Plants
Springer Science & Business Media.
Cech, T. V. (2010) Principles of Water Resources: History, Development, Management,
and Policy John Wiley & Sons.
Chatterjee, R., Allen, R.M., Ludden, P.W., and Shah, V.K. (1997) In vitro synthesis of the
iron-molybdenum cofactor and maturation of the nif-encoded apodinitrogenase.
Effect of substitution of VNFH for NIFH. J. Biol. Chem. 272: 21604–21608.
Chisnell, J.R., Premakumar, R., and Bishop, P.E. (1988) Purification of a second
alternative nitrogenase from a nifHDK deletion strain of Azotobacter vinelandii. J.
Bacteriol. 170: 27–33.
Cornell, R.M. and Schwertmann, U. (2006) The Iron Oxides: Structure, Properties,
Reactions, Occurrences and Uses John Wiley & Sons.
Cornish, A. and Page, W. (1995) Production of the triacetecholate siderophore
protochelin by Azotobacter vinelandii. Biometals 8: 332–338.
Cornish, A.S. and Page, W.J. (2000) Role of molybdate and other transition metals in the
accumulation of protochelin by Azotobacter vinelandii. Appl. Environ. Microbiol.
66: 1580–1586.
Cornish, A.S. and Page, W.J. (1998) The catecholate siderophores of Azotobacter
vinelandii: their affinity for iron and role in oxygen stress management.
Microbiology 144: 1747–1754.
Crowley, D.E., Wang, Y.C., Reid, C.P.P., and Szaniszlo, P.J. (1991) Mechanisms of iron
acquisition from siderophores by microorganisms and plants. Plant Soil 130: 179–
198.
Daccord, A., Mursell, M., Poulin-Laprade, D., and Burrus, V. (2012) Dynamics of the
SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by
Integrating Conjugative Elements of the SXT/R391 Family. J. Bacteriol. 194: 5794–
5802.
Darnajoux, R., Constantin, J., Miadlikowska, J., Lutzoni, F., and Bellenger, J.-P. (2014) Is
vanadium a biometal for boreal cyanolichens? New Phytol. 202: 765–71.
Darnajoux, R., Zhang, X., McRose, D.L., Miadlikowska, J., Lutzoni, F., Kraepiel,
A.M.L., and Bellenger, J.-P. (2016) Biological nitrogen fixation by alternative
nitrogenases in boreal cyanolichens: importance of molybdenum availability and
158
implications for current biological nitrogen fixation estimates. New Phytol.
Deicke, M., Bellenger, J.-P., and Wichard, T. (2013) Direct quantification of bacterial
molybdenum and iron metallophores with ultra-high-performance liquid
chromatography coupled to time-of-flight mass spectrometry. J. Chromatogr. A
1298: 50–60.
Deicke, M., Mohr, J.F., Bellenger, J.-P., and Wichard, T. (2014) Metallophore mapping in
complex matrices by metal isotope coded profiling of organic ligands. Analyst 139:
6096–9.
Dilworth, M.J., Eady, R.R., Robson, R.L., and Miller, R.W. (1987) Ethane formation
from acetylene as a potential test for vanadium nitrogenase in vivo. Nature 327:
167–168.
Dixon, R. (1998) The oxygen-responsive NIFL-NIFA complex: a novel two-component
regulatory system controlling nitrogenase synthesis in gamma-proteobacteria. Arch.
Microbiol. 169: 371–80.
Djibaoui, D. and Bensoltane, A. (2005) Effect of iron and growth inhibitors on
siderophores production by Pseudomonas fluorescens. African J. Biotechnol. 4: 697–
702.
Drummond, M., Walmsley, J., and Kennedy, C. (1996) Expression from the nifB
promoter of Azotobacter vinelandii can be activated by NifA, VnfA, or AnfA
transcriptional activators. J. Bacteriol. 178: 788–92.
Duhme, A.-K., Dauter, Z., Hider, R.C., and Pohl, S. (1996) Complexation of
Molybdenum by Siderophores: Synthesis and Structure of the Double-Helical cis -
Dioxomolybdenum(VI) Complex of a Bis(catecholamide) Siderophore Analogue.
Inorg. Chem. 35: 3059–3061.
Duhme, A.-K., Hider, R.C., and Khodr, H.H. (1997) Synthesis and Iron-Binding
Properties of Protochelin, the Tris (catecholamide) Siderophore ofAzotobacter
vinelandii. Chem. Ber. 130: 969–973.
Duhme, A.-K., Hider, R.C., Naldrett, M.J., and Pau, R.N. (1998) The stability of the
molybdenum-azotochelin complex and its effect on siderophore production in
Azotobacter vinelandii. J. Biol. Inorg. Chem. 3: 520–526.
Duhme-Klair, A.-K. (2009) From siderophores and self-assembly to luminescent sensors:
the binding of molybdenum by catecholamides. Eur. J. Inorg. Chem. 2009: 3689–
3701.
Dyer, J.A., Trivedi, P., Scrivner, N.C., and Sparks, D.L. (2003) Lead sorpion onto
ferrihydrite. 2. Surface complexation modeling. Environ. Sci. Technol. 37: 915–22.
159
Eady, R.R. (1996) Structure−Function Relationships of Alternative Nitrogenases. Chem.
Rev. 96: 3013–3030.
Eady, R.R., Robson, R.L., Richardson, T.H., Miller, R.W., and Hawkins, M. (1987) The
vanadium nitrogenase of Azotobacter chroococcum . Purification and properties of
the VFe protein. Biochem. J. 244: 197–207.
Einsle, O. (2014) Nitrogenase FeMo cofactor: an atomic structure in three simple steps. J.
Biol. Inorg. Chem. 19: 737–45.
Elser, J.J., Bracken, M.E.S., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., et
al. (2007) Global analysis of nitrogen and phosphorus limitation of primary
producers in freshwater, marine and terrestrial ecosystems. Ecol. Lett. 10: 1135–42.
Fenske, D., Gnida, M., Schneider, K., Meyer-Klaucke, W., Schemberg, J., Henschel, V.,
et al. (2005) A new type of metalloprotein: The Mo storage protein from Azotobacter
vinelandii contains a polynuclear molybdenum-oxide cluster. Chembiochem 6: 405–
413.
Frise, E., Green, A., and Drummond, M. (1994) Chimeric transcriptional activators
generated in vivo from VnfA and AnfA of Azotobacter vinelandii: N-terminal
domain of AnfA is responsible for dependence on nitrogenase Fe protein. J.
Bacteriol. 176: 6545–9.
Galloway, J.N., Dentener, F.J., Capone, D.G., Boyer, E.W., Howarth, R.W., Seitzinger,
S.P., et al. (2004) Nitrogen cycles: past, present, and future. Biogeochemistry 70:
153–226.
Glass, J.B., Axler, R.P., Chandra, S., and Goldman, C.R. (2012) Molybdenum limitation
of microbial nitrogen assimilation in aquatic ecosystems and pure cultures. Front.
Microbiol. 3: 331.
Goldberg, S. and Forster, H.S. (1998) FACTORS AFFECTING MOLYBDENUM
ADSORPTION BY SOILS AND MINERALS. Soil Sci. 163: 109–114.
Goldberg, S., Forster, H.S., and Godfrey, C.L. (1996) Molybdenum Adsorption on
Oxides, Clay Minerals, and Soils. Soil Sci. Soc. Am. J. 60: 425.
Gu, B., Chang, J., Min, Y., Ge, Y., Zhu, Q., Galloway, J.N., et al. (2013) The role of
industrial nitrogen in the global nitrogen biogeochemical cycle. Sci. Rep. 3: 636–
639.
Hales, B.J., Langosch, D.J., and Case, E.E. (1986) Isolation and characterization of a
second nitrogenase Fe-protein from Azotobacter vinelandii. J. Biol. Chem. 261:
15301–15306.
Hänsch, R. and Mendel, R.R. (2009) Physiological functions of mineral micronutrients
160
(Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr. Opin. Plant Biol. 12: 259–266.
Hättenschwiler, S. and Vitousek, P. (2000) The role of polyphenols in terrestrial
ecosystem nutrient cycling. Trends Ecol. Evol. 15: 238–243.
Hemingway, R.W., Karchesy, J.J., and Branham, S.J. (1989) Chemistry and Significance
of Condensed Tannins Plenum Pre. Hemingway,R.W., Karchesy,J.J., and
Branham,S.J. (eds) Springer US, New York.
Hill, S., Austin, S., Eydmann, T., Jones, T., and Dixon, R. (1996) Azotobacter vinelandii
NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation
genes via a redox-sensitive switch. Proc. Natl. Acad. Sci. U. S. A. 93: 2143–8.
Hinnemann, B. and Nørskov, J.K. (2004) Chemical activity of the nitrogenase FeMo
cofactor with a central nitrogen ligand: density functional study. J. Am. Chem. Soc.
126: 3920–7.
Hirschman, J., Wong, P.K., Sei, K., Keener, J., and Kustu, S. (1985) Products of nitrogen
regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in
vitro: evidence that the ntrA product is a sigma factor. Proc. Natl. Acad. Sci. U. S. A.
82: 7525–9.
Hodkinson, B.P., Allen, J.L., Forrest, L.L., Goffinet, B., Sérusiaux, E., Andrésson, Ó.S.,
et al. (2014) Lichen-symbiotic cyanobacteria associated with Peltigera have an
alternative vanadium-dependent nitrogen fixation system. Eur. J. Phycol. 49: 11–19.
Hooper, D.U. and Johnson, L. (1999) Nitrogen limitation in dryland ecosystems:
Responses to geographical and temporal variation in precipitation. Biogeochemistry
46: 247–293.
Howard, J.B. and Rees, D.C. (2006) How many metals does it take to fix N2? A
mechanistic overview of biological nitrogen fixation. Proc. Natl. Acad. Sci. U. S. A.
103: 17088–93.
Howard, J.B. and Rees, D.C. (1996) Structural Basis of Biological Nitrogen Fixation.
Chem. Rev. 96: 2965–2982.
Hu, Y. and Ribbe, M.W. (2011) Biosynthesis of the Metalloclusters of Molybdenum
Nitrogenase. Microbiol. Mol. Biol. Rev. 75: 664–677.
Imperial, J., Hadi, M., and Amy, N.K. (1998) Molybdate binding by ModA, the
periplasmic component of the Escherichia coli mod molybdate transport system.
Biochim. Biophys. Acta 1370: 337–46.
Jacob, J. and Drummond, M. (1993) Construction of chimeric proteins from the ?; N -
associated transcriptional activators VnfA and AnfA of Azotobacter vinelandii
shows that the determinants of promoter specificity lie outside the’recognition'helix
161
of the HTH motif in the C-terminal . Mol. Microbiol. 10: 813–821.
Jacobitz, S. and Bishop, P.E. (1992) Regulation of nitrogenase-2 in Azotobacter
vinelandii by ammonium, molybdenum, and vanadium. J. Bacteriol. 174: 3884–
3888.
Jacobson, M.R., Brigle, K.E., Bennett, L.T., Setterquist, R.A., Wilson, M.S., Cash, V.L.,
et al. (1989) Physical and genetic map of the major nif gene cluster from Azotobacter
vinelandii. J. Bacteriol. 171: 1017–1027.
Jacobson, M.R., Premakumar, R., and Bishop, P.E. (1986) Transcriptional regulation of
nitrogen fixation by molybdenum in Azotobacter vinelandii. J. Bacteriol. 167: 480–
6.
Jean, M.-E., Phalyvong, K., Forest-Drolet, J., and Bellenger, J.-P. (2013) Molybdenum
and phosphorus limitation of asymbiotic nitrogen fixation in forests of Eastern
Canada: Influence of vegetative cover and seasonal variability. Soil Biol. Biochem.
67: 140–146.
Jiang, H.-B., Lou, W.-J., Ke, W.-T., Song, W.-Y., Price, N.M., and Qiu, B.-S. (2015)
New insights into iron acquisition by cyanobacteria: an essential role for ExbB-
ExbD complex in inorganic iron uptake. ISME J. 9: 297–309.
Joerger, R.D., Jacobson, M.R., and Bishop, P.E. (1989) Two nifA-like genes required for
expression of alternative nitrogenases by Azotobacter vinelandii. J. Bacteriol. 171:
3258–67.
Joerger, R.D., Jacobson, M.R., Premakumar, R., Wolfinger, E.D., and Bishop, P.E. (1989)
Nucleotide sequence and mutational analysis of the structural genes (anfHDGK) for
the second alternative nitrogenase from Azotobacter vinelandii. J. Bacteriol. 171:
1075–1086.
Joerger, R.D., Loveless, T.M., Pau, R.N., Mitchenall, L.A., Simon, B.H., and Bishop, P.E.
(1990) Nucleotide sequences and mutational analysis of the structural genes for
nitrogenase 2 of Azotobacter vinelandii. J. Bacteriol. 172: 3400–8.
Jouogo Noumsi, C., Pourhassan, N., Darnajoux, R., Deicke, M., Wichard, T., Burrus, V.,
and Bellenger, J.-P. (2016) Effect of organic matter on nitrogenase metal cofactors
homeostasis in Azotobacter vinelandii under diazotrophic conditions. Environ.
Microbiol. Rep. 8: 76–84.
Kabata-Pendias, A. (2010) Trace Elements in Soils and Plants, Fourth Edition CRC Press.
Keller, R.J., Coulombe, R.A., Sharma, R.P., Grover, T.A., and Piette, L.H. (1989)
Importance of hydroxyl radical in the vanadium-stimulated oxidation of NADH.
Free Radic. Biol. Med. 6: 15–22.
162
Kennedy, C. and Dean, D. (1992) The nifU, nifS and nifV gene products are required for
activity of all three nitrogenases of Azotobacter vinelandii. Mol. Gen. Genet. 231:
494–8.
Kirn, J. and Rees, D.C. (1992) Crystallographic structure and functional implications of
the nitrogenase molybdenum–iron protein from Azotobacter vinelandii. Nature 360:
553–560.
Kooner, Z.S. (1993) Comparative study of adsorption behavior of copper, lead, and zinc
onto goethite in aqueous systems. Environ. Geol. 21: 242–250.
Kraemer, S.M. (2004) Iron oxide dissolution and solubility in the presence of
siderophores. Aquat. Sci. - Res. Across Boundaries 66: 3–18.
Kraemer, S.M., Duckworth, O.W., Harrington, J.M., and Schenkeveld, W.D.C. (2015)
Metallophores and Trace Metal Biogeochemistry. Aquat. Geochemistry 21: 159–195.
Kraepiel, A.M.L., Bellenger, J.P., Wichard, T., and Morel, F.M.M. (2009) Multiple roles
of siderophores in free-living nitrogen-fixing bacteria. Biometals an Int. J. role Met.
ions Biol. Biochem. Med. 22: 573–581.
Kraus, T.E.C., Dahlgren, R.A., and Zasoski, R.J. (2003) Tannins in nutrient dynamics of
forest ecosystems - a review. Plant Soil 256: 41–66.
Kuiters, A.T. (1990) Role of phenolic substances from decomposing forest litter in plant-
soil interactions. Acta Bot. Neerl. 39: 329–348.
Lancaster, K.M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M.W., Neese, F., et al.
(2011) X-ray emission spectroscopy evidences a central carbon in the nitrogenase
iron-molybdenum cofactor. Science 334: 974–7.
Lane, T.W. and Morel, F.M. (2000) A biological function for cadmium in marine
diatoms. Proc. Natl. Acad. Sci. U. S. A. 97: 4627–31.
LeBauer, D.S. and Treseder, K.K. (2008) Nitrogen limitation of net primary productivity
in terrestrial ecosytems is globally distributed. Ecology 89: 371–379.
Lee, C.C., Hu, Y., and Ribbe, M.W. (2009) Unique features of the nitrogenase VFe
protein from Azotobacter vinelandii. Proc. Natl. Acad. Sci. 106: 9209–9214.
Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W.C., and Dixon, R. (2000)
Signal transduction to the Azotobacter vinelandii NIFL-NIFA regulatory system is
influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein.
EMBO J. 19: 6041–50.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San
Diego Calif 25: 402–408.
163
Loveless, T.M. and Bishop, P.E. (1999) Identification of genes unique to Mo-independent
nitrogenase systems in diverse diazotrophs. Can. J. Microbiol. 45: 312–317.
Loveless, T.M., Saah, J.R., and Bishop, P.E. (1999) Isolation of nitrogen-fixing bacteria
containing molybdenum-independent nitrogenases from natural environments. Appl.
Environ. Microbiol. 65: 4223–4226.
Lowe, D.J., Fisher, K., and Thorneley, R.N. (1993) Klebsiella pneumoniae nitrogenase:
pre-steady-state absorbance changes show that redox changes occur in the MoFe
protein that depend on substrate and component protein ratio; a role for P-centres in
reducing dinitrogen? Biochem. J. 292: 93–98.
Lu, X., Johnson, W.D., and Hook, J. (1998) Reaction of vanadate with aquatic humic
substances: an ESR and 51 V NMR study. Environ. Sci. Technol. 32: 2257–2263.
Luque, F., Mitchenall, L.A., Chapman, M., Christine, R., and Pau, R.N. (1993)
Characterization of genes involved in molybdenum transport in Azotobacter
vinelandii. Mol. Microbiol. 7: 447–59.
Luque, F. and Pau, R.N. (1991) Transcriptional regulation by metals of structural genes
for Azotobacter vinelandii nitrogenases. Mol. Gen. Genet. 227: 481–7.
Macaluso, A., Best, E.A., and Bender, R.A. (1990) Role of the nac gene product in the
nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes. J.
Bacteriol. 172: 7249–55.
Mackenzie, F.T., Ver, L.M., Sabine, C., Lane, M., and Lerman, A. (2013) Interactions of
C, N, P and S Biogeochemical Cycles and Global Change Roland,W.,
Mackenzie,F.T., and Chou,L. (eds) Springer Science & Business Media.
Marks, J.A., Perakis, S.S., King, E.K., and Pett-Ridge, J. (2015) Soil organic matter
regulates molybdenum storage and mobility in forests. Biogeochemistry 125: 167–
183.
Martell, A.E. and Smith, R.M. (1989) Critical stability constants. Plenum Press, New
York.
Masepohl, B., Schneider, K., Drepper, T., Muller, A., and Klipp, W. (2002) Nitrogen
fixation at the millennium G.J.,L. (ed) Elsevier.
Masukawa, H., Zhang, X., Yamazaki, E., Iwata, S., Nakamura, K., Mochimaru, M., et al.
(2009) Survey of the distribution of different types of nitrogenases and hydrogenases
in heterocyst-forming cyanobacteria. Mar. Biotechnol. (NY). 11: 397–409.
May, H.D. and Dean, R.D. (1991) Altered nitrogenase MoFe proteins from Azotobacter
vinelandii. Analysis of MoFe proteins having amino acid substitutions for the
conserved cysteine residues within the beta-subunit. Biochem. J. 277 (Pt 2): 457–64.
164
Meletzus, D., Rudnick, P., Doetsch, N., Green, A., and Kennedy, C. (1998)
Characterization of the glnK-amtB Operon of Azotobacter vinelandii. J. Bacteriol.
180: 3260–3264.
Merrick, M., Gibbins, J., and Toukdarian, A. (1987) The nucleotide sequence of the
sigma factor gene ntrA (rpoN) of Azotobacter vinelandii: analysis of conserved
sequences in NtrA proteins. Mol. Gen. Genet. 210: 323–30.
Merrick, M., Hill, S., Hennecke, H., Hahn, M., Dixon, R., and Kennedy, C. (1982)
Repressor properties of the nifL gene product in Klebsiella pneumoniae. MGG Mol.
Gen. Genet. 185: 75–81.
Merrick, M.J. and Gibbins, J.R. (1985) The nucleotide sequence of the nitrogen-
regulation gene ntrA of Klebsiella pneumoniae and comparison with conserved
features in bacterial RNA polymerase sigma factors. Nucleic Acids Res. 13: 7607–
20.
Miller, R.W. and Eady, R.R. (1988) Molybdenum and vanadium nitrogenases of
Azotobacter chroococcum. Low temperature favours N2 reduction by vanadium
nitrogenase. Biochem. J. 256: 429–432.
Monteiro, R.A., Souza, E.M., Yates, M.G., Pedrosa, F.O., and Chubatsu, L.S. (1999) In-
trans regulation of the N-truncated-NIFA protein of Herbaspirillum seropedicae by
the N-terminal domain. FEMS Microbiol. Lett. 180: 157–61.
Morrison, C.N., Hoy, J.A., Zhang, L., Einsle, O., and Rees, D.C. (2015) Substrate
pathways in the nitrogenase MoFe protein by experimental identification of small
molecule binding sites. Biochemistry 54: 2052–60.
Moshiri, F., Kim, J.W., Fu, C., and Maier, R.J. (1994) The FeSII protein of Azotobacter
vinelandii is not essential for aerobic nitrogen fixation, but confers significant
protection to oxygen-mediated inactivation of nitrogenase in vitro and in vivo. Mol.
Microbiol. 14: 101–114.
Mouncey, N.J., Mitchenall, L.A., and Pau, R.N. (1995) Mutational analysis of genes of
the mod locus involved in molybdenum transport, homeostasis, and processing in
Azotobacter vinelandii. J. Bacteriol. 177: 5294–302.
Moure, V.R., Costa, F.F., Cruz, L.M., Pedrosa, F.O., Souza, E.M., Li, X.-D., et al. (2015)
Regulation of nitrogenase by reversible mono-ADP-ribosylation. Curr. Top.
Microbiol. Immunol. 384: 89–106.
Nakajima, H., Takatani, N., Yoshimitsu, K., Itoh, M., Aono, S., Takahashi, Y., and
Watanabe, Y. (2010) The role of the Fe-S cluster in the sensory domain of
nitrogenase transcriptional activator VnfA from Azotobacter vinelandii. FEBS J.
277: 817–32.
165
Noar, J.D. and Bruno-Bárcena, J.M. (2013) Complete Genome Sequences of Azotobacter
vinelandii Wild-Type Strain CA and Tungsten-Tolerant Mutant Strain CA6. Genome
Announc. 1: e00313–13.
Nordlund, S. and Högbom, M. (2013) ADP-ribosylation, a mechanism regulating
nitrogenase activity. FEBS J. 280: 3484–90.
Nosheen, A., Bano, A., Ullah, F., Farooq, U., Yasmin, H., and Hussain, I. (2013) Effect
of plant growth promoting rhizobacteria on root morphology of Safflower (
Carthamus tinctorius L.). African J. Biotechnol. 10: 12638–12649.
Oda, Y., Samanta, S.K., Rey, F.E., Wu, L., Liu, X., Yan, T., et al. (2005) Functional
genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium
Rhodopseudomonas palustris. J. Bacteriol. 187: 7784–94.
Oelze, J. (2000) Respiratory protection of nitrogenase in Azotobacter species: is a widely
held hypothesis unequivocally supported by experimental evidence? FEMS
Microbiol. Rev. 24: 321–333.
Page, W.J. and Huyer, M. (1984) Derepression of the Azotobacter vinelandii siderophore
system, using iron-containing minerals to limit iron repletion. J. Bacteriol. 158: 496–
502.
Page, W.J. and von Tigerstrom, M. (1982) Iron- and molybdenum-repressible outer
membrane proteins in competent Azotobacter vinelandii. J. Bacteriol. 151: 237–42.
Pau, R.N. (1989) Nitrogenases without molybdenum. Trends Biochem. Sci. 14: 183–6.
Peacock, C.L. and Sherman, D.M. (2004) Vanadium(V) adsorption onto goethite (α-
FeOOH) at pH 1.5 to 12: a surface complexation model based on ab initio molecular
geometries and EXAFS spectroscopy. Geochim. Cosmochim. Acta 68: 1723–1733.
Peters, J.W., Fisher, K., Newton, W.E., and Dean, D.R. (1995) Involvement of the P
Cluster in Intramolecular Electron Transfer within the Nitrogenase MoFe Protein. J.
Biol. Chem. 270: 27007–27013.
Pienkos, P.T. and Brill, W.J. (1981) Molybdenum accumulation and storage in Klebsiella
pneumoniae and Azotobacter vinelandii. J. Bacteriol. 145: 743–51.
Poledniok, J. (2003) Speciation of vanadium in soil. Talanta 59: 1–8.
Poulin-Laprade, D. and Burrus, V. (2015) A λ Cro-like repressor is essential for the
induction of conjugative transfer of SXT/R391 elements in response to DNA
damage. J. Bacteriol.
Pratte, B.S., Eplin, K., and Thiel, T. (2006) Cross-functionality of nitrogenase
components NifH1 and VnfH in Anabaena variabilis. J. Bacteriol. 188: 5806–5811.
166
Pratte, B.S., Sheridan, R., James, J.A., and Thiel, T. (2013) Regulation of V-nitrogenase
genes in Anabaena variabilis by RNA processing and by dual repressors. Mol.
Microbiol. 88: 413–24.
Pratte, B.S. and Thiel, T. (2006) High-Affinity Vanadate Transport System in the
Cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol. 188: 464–468.
Premakumar, R., Loveless, T.M., and Bishop, P.E. (1994) Effect of amino acid
substitutions in a potential metal-binding site of AnfA on expression from the anfH
promoter in Azotobacter vinelandii. J. Bacteriol. 176: 6139–42.
Premakumar, R., Pau, R.N., Mitchenall, L.A., Easo, M., and Bishop, P.E. (1998)
Regulation of the transcriptional activators AnfA and VnfA by metals and
ammonium in Azotobacter vinelandii. FEMS Microbiol. Lett. 164: 63–68.
Raymond, J., Siefert, J.L., Staples, C.R., and Blankenship, R.E. (2004) The natural
history of nitrogen fixation. Mol. Biol. Evol. 21: 541–54.
Reddy, K.J. and Gloss, S.P. (1993) Geochemical speciation as related to the mobility of F,
Mo and Se in soil leachates. Appl. Geochemistry 8: 159–163.
Reed, S.C., Cleveland, C.C., and Townsend, A.R. (2011) Functional ecology of free-
living nitrogen fixation: a contemporary perspective. Annu. Rev. Ecol. Evol. Syst. 42:
489–512.
Rees, D.C., Akif Tezcan, F., Haynes, C.A., Walton, M.Y., Andrade, S., Einsle, O., and
Howard, J.B. (2005) Structural basis of biological nitrogen fixation. Philos. Trans.
A. Math. Phys. Eng. Sci. 363: 971–84; discussion 1035–40.
Rees, D.C. and Howard, J.B. (2000) Nitrogenase: standing at the crossroads. Curr. Opin.
Chem. Biol. 4: 559–566.
Rehder, D. (2000) Vanadium nitrogenase. J. Inorg. Biochem. 80: 133–136.
Robin, A., Vansuyt, G., Hinsinger, P., Meyer, J.M., Briat, J.F., and Lemanceau, P. (2008)
Chapter 4 Iron Dynamics in the Rhizosphere: Consequences for Plant Health and
Nutrition. Adv. Agron. 99: 183–225.
Robson, R.L., Eady, R.R., Richardson, T.H., Miller, R.W., Hawkins, M., and Postgate,
J.R. (1986) The alternative nitrogenase of Azotobacter chroococcum is a vanadium
enzyme. Nature 322: 388–390.
Robson, R.L. and Postgate, J.R. (1980) Oxygen and hydrogen in biological nitrogen
fixation. Annu. Rev. Microbiol. 34: 183–207.
Rose, A.L. and Waite, T.D. (2003) Kinetics of Hydrolysis and Precipitation of Ferric Iron
in Seawater. Environ. Sci. Technol. 37: 3897–3903.
167
Rubio, L.M. and Ludden, P.W. (2005) Maturation of nitrogenase: a biochemical puzzle.
J. Bacteriol. 187: 405–414.
Sandy, M. and Butler, A. (2009) Microbial iron acquisition: marine and terrestrial
siderophores. Chem. Rev. 109: 4580–95.
Dos Santos, P.C. and Dean, D.R. (2014) Iron-Sulfur Clusters in Chemistry and Biology
Rouault,T. (ed) Walter de Gruyter GmbH & Co KG, 2014.
Savli, H., Karadenizli, A., Kolayli, F., Gundes, S., Ozbek, U., and Vahaboglu, H. (2003)
Expression stability of six housekeeping genes: a proposal for resistance gene
quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-
PCR. J. Med. Microbiol. 52: 403–408.
Sayyed, R.Z., Badgujar, M.D., Sonawane, H.M., Mhaske, M.M., and Chincholkar, S.B.
(2005) Production of microbial iron chelators (siderophores) by fluorescent
Pseudomonads. IJBT Vol.4(4) [October 2005].
Schlesinger, W.H. and Bernhardt, E.S. (2013) Biogeochemistry: An Analysis of Global
Change Academic Press.
Schmittgen, T.D. and Livak, K.J. (2008) Analyzing real-time PCR data by the
comparative CT method. Nat. Protoc. 3: 1101–1108.
Schmitz, R.A., Klopprogge, K., and Grabbe, R. (2002) Regulation of nitrogen fixation in
Klebsiella pneumoniae and Azotobacter vinelandii: NifL, transducing two
environmental signals to the nif transcriptional activator NifA. J. Mol. Microbiol.
Biotechnol. 4: 235–242.
Schneider, K., Müller, A., Schramm, U., and Klipp, W. (1991) Demonstration of a
molybdenum- and vanadium-independent nitrogenase in a nifHDK-deletion mutant
of Rhodobacter capsulatus. Eur. J. Biochem. 195: 653–661.
Schwacha, A. and Bender, R.A. (1993) The nac (nitrogen assimilation control) gene from
Klebsiella aerogenes. J. Bacteriol. 175: 2107–15.
Seefeldt, L.C., Hoffman, B.M., and Dean, D.R. (2009) Mechanism of Mo-dependent
nitrogenase. Annu. Rev. Biochem. 78: 701–22.
Self, W.T., Grunden, A.M., Hasona, A., and Shanmugam, K.T. (2001) Molybdate
transport. Res. Microbiol. 152: 311–321.
Setubal, J.C., dos Santos, P., Goldman, B.S., Ertesvåg, H., Espin, G., Rubio, L.M., et al.
(2009) Genome sequence of Azotobacter vinelandii, an obligate aerobe specialized
to support diverse anaerobic metabolic processes. J. Bacteriol. 191: 4534–4545.
Shailendra Singh, G.G. (2015) Plant Growth Promoting Rhizobacteria (PGPR): Current
and Future Prospects for Development of Sustainable Agriculture. J. Microb.
168
Biochem. Technol. 07.:
Shieh, C. and Duedall, I.W. (1988) Role of amorphous ferric oxyhydroxide in removal of
anthropogenic vanadium from seawater. Mar. Chem. 25: 121–139.
Silvester, W. (1989) Molybdenum limitation of asymbiotic nitrogen fixation in forests of
Pacific Northwest America. Soil Biol. Biochem. 21: 283–289.
Slabbert, N. (2012) Plant Polyphenols: Synthesis, Properties, Significance. Complexation
of condensed tannins with metal ions. Hemingway,R.W. and Laks,P.E. (eds)
Springer Science & Business Media.
Souza, E.M., Pedrosa, F.O., Drummond, M., Rigo, L.U., and Yates, M.G. (1999) Control
of Herbaspirillum seropedicae NifA activity by ammonium ions and oxygen. J.
Bacteriol. 181: 681–4.
Steenhoudt, O. and Vanderleyden, J. (2000) Azospirillum, a free-living nitrogen-fixing
bacterium closely associated with grasses: genetic, biochemical and ecological
aspects. FEMS Microbiol. Rev. 24: 487–506.
Stefánsson, A. (2007) Iron(III) Hydrolysis and Solubility at 25 °C. Environ. Sci. Technol.
41: 6117–6123.
Stevenson, F.J. and Cole, M.A. (Michael A.. (1999) Cycles of soil : carbon, nitrogen,
phosphorus, sulfur, micronutrients Wiley.
Stintzi, A., Barnes, C., Xu, J., and Raymond, K.N. (2000) Microbial iron transport via a
siderophore shuttle: a membrane ion transport paradigm. Proc. Natl. Acad. Sci. U. S.
A. 97: 10691–6.
Tang, D. and Morel, F.M.M. (2006) Distinguishing between cellular and Fe-oxide-
associated trace elements in phytoplankton. Mar. Chem. 98: 18–30.
Thiel, T. (1993) Characterization of genes for an alternative nitrogenase in the
cyanobacterium Anabaena variabilis. J. Bacteriol. 175: 6276–6286.
Thiel, T. and Pratte, B.S. (2013) Alternative nitrogenases in Anabaena variabilis: the role
of molybdate and vanadate in nitrogenase gene. Adv. Microbiol. 03: 87–95.
Thöny, B. and Hennecke, H. (1989) The -24/-12 promoter comes of age. FEMS
Microbiol. Rev. 5: 341–57.
Tindale, A.E., Mehrotra, M., Ottem, D., and Page, W.J. (2000) Dual regulation of
catecholate siderophore biosynthesis in Azotobacter vinelandii by iron and oxidative
stress. Microbiology 146 ( Pt 7: 1617–26.
Toukdarian, A. and Kennedy, C. (1986) Regulation of nitrogen metabolism in
Azotobacter vinelandii: isolation of ntr and glnA genes and construction of ntr
169
mutants. EMBO J. 5: 399–407.
Villa, J.A., Ray, E.E., and Barney, B.M. (2014) Azotobacter vinelandii siderophore can
provide nitrogen to support the culture of the green algae Neochloris oleoabundans
and Scenedesmus sp. BA032. FEMS Microbiol. Lett. 351: 70–77.
Vitousek, P.M. and Howarth, R.W. (1991) Nitrogen limitation on land and in the sea :
How can it occur? Biogeochemistry 13: 87–115.
Völker, C. and Wolf-Gladrow, D.A. (1999) Physical limits on iron uptake mediated by
siderophores or surface reductases. Mar. Chem. 65: 227–244.
Walmsley, J. and Kennedy, C. (1991) Temperature-Dependent Regulation by
Molybdenum and Vanadium of Expression of the Structural Genes Encoding Three
Nitrogenases in Azotobacter vinelandii. Appl. Environ. Microbiol. 57: 622–4.
Walmsley, J., Toukdarian, A., and Kennedy, C. (1994) The role of regulatory genes nifA,
vnfA, anfA, nfrX, ntrC, and rpoN in expression of genes encoding the three
nitrogenases of Azotobacter vinelandii. Arch. Microbiol. 162: 422–9.
Wanty, R.B. and Goldhaber, M.B. (1992) Thermodynamics and kinetics of reactions
involving vanadium in natural systems: Accumulation of vanadium in sedimentary
rocks. Geochim. Cosmochim. Acta 56: 1471–1483.
Wedepohl, K.H. (1995) The composition of the continental crust. Geochim. Cosmochim.
Acta 59: 1217–1232.
Wichard, T., Bellenger, J.-P., Morel, F.M.M., and Kraepiel, A.M.L. (2009) Role of the
siderophore azotobactin in the bacterial acquisition of nitrogenase metal cofactors.
Environ. Sci. Technol. 43: 7218–7224.
Wichard, T., Mishra, B., Myneni, S.C.B., Bellenger, J.-P., and Kraepiel, A.M.L. (2009)
Storage and bioavailability of molybdenum in soils increased by organic matter
complexation. Nat. Geosci. 2: 625–629.
Wilhelm, S.W. and Trick, C.G. (1994) Iron-limited growth of cyanobacteria: Multiple
siderophore production is a common response. Limnol. Oceanogr. 39: 1979–1984.
Woodley, P., Buck, M., and Kennedy, C. (1996) Identification of sequences important for
recognition of vnf genes by the VnfA transcriptional activator in Azotobacter
vinelandii. FEMS Microbiol. Lett. 135: 213–21.
Xu, N., Christodoulatos, C., and Braida, W. (2006) Adsorption of molybdate and
tetrathiomolybdate onto pyrite and goethite: effect of pH and competitive anions.
Chemosphere 62: 1726–35.
Xu, Y., Feng, L., Jeffrey, P.D., Shi, Y., and Morel, F.M.M. (2008) Structure and metal
exchange in the cadmium carbonic anhydrase of marine diatoms. Nature 452: 56–61.
170
Yoshimitsu, K., Takatani, N., Miura, Y., Watanabe, Y., and Nakajima, H. (2011) The role
of the GAF and central domains of the transcriptional activator VnfA in Azotobacter
vinelandii. FEBS J. 278: 3287–97.
Zhang, X., McRose, D.L., Darnajoux, R., Bellenger, J.P., Morel, F.M.M., and Kraepiel,
A.M.L. (2016) Alternative nitrogenase activity in the environment and nitrogen
cycle implications. Biogeochemistry 127: 189–198.
171
BIBLIOGRAPHIE
Abdel-Gawad, F.M. and Issa, R.M. (1986) Spectrometric determination of vanadium (V)
with tannic acid and its application to biological fluids. Ind. J. Chem. 25: 701-702.
Ind. J. Chem. 25: 701–702.
Ahmad, F., Ahmad, I., and Khan, M.S. (2008) Screening of free-living rhizospheric
bacteria for their multiple plant growth promoting activities. Microbiol. Res. 163:
173–81.
Ahmed, E. and Holmström, S.J.M. (2014) Siderophores in environmental research: roles
and applications. Microb. Biotechnol. 7: 196–208.
Alloway, B. (2013) Heavy metals in soils Third. Alloway,B.J. (ed).
Austin, S. and Lambert, J. (1994) Purification and in vitro activity of a truncated form of
ANFA. Transcriptional activator protein of alternative nitrogenase from Azotobacter
vinelandii. J. Biol. Chem. 269: 18141–8.
Baars, O., Zhang, X., Morel, F.M.M., and Seyedsayamdost, M.R. (2016) The Siderophore
Metabolome of Azotobacter vinelandii. Appl. Environ. Microbiol. 82: 27–39.
Bageshwar, U.K., Choudhury, N.R., and Das, H.K. (1998) Analysis of upstream
activation of the vnfH promoter of Azotobacter vinelandii - ProQuest. Can. J.
Microbiol. 44.:
Barrett, J., Ray, P., Sobczyk, A., Little, R., and Dixon, R. (2001) Concerted inhibition of
the transcriptional activation functions of the enhancer-binding protein NIFA by the
anti-activator NIFL. Mol. Microbiol. 39: 480–93.
Barron, A.R., Wurzburger, N., Bellenger, J.P., Wright, S.J., Kraepiel, A.M.L., and Hedin,
L.O. (2009) Molybdenum limitation of asymbiotic nitrogen fixation in tropical forest
soils. Nat. Geosci. 2: 42–45.
Baumgartner, J. and Faivre, D. (2015) Iron solubility, colloids and their impact on iron
(oxyhydr)oxide formation from solution. Earth-Science Rev. 150: 520–530.
Baysse, C., De Vos, D., Naudet, Y., Vandermonde, A., Ochsner, U., Meyer, J.M., et al.
(2000) Vanadium interferes with siderophore-mediated iron uptake in Pseudomonas
aeruginosa. Microbiology 146 ( Pt 1: 2425–34.
Bellenger, J.-P., Arnaud-Neu, F., Asfari, Z., Myneni, S.C.B., Stiefel, E.I., and Kraepiel,
172
A.M.L. (2007) Complexation of oxoanions and cationic metals by the biscatecholate
siderophore azotochelin. J. Biol. Inorg. Chem. JBIC a Publ. Soc. Biol. Inorg. Chem.
12: 367–376.
Bellenger, J.P., Wichard, T., and Kraepiel, A.M.L. (2008) Vanadium requirements and
uptake kinetics in the dinitrogen-fixing bacterium Azotobacter vinelandii. Appl.
Environ. Microbiol. 74: 1478–1484.
Bellenger, J.P., Wichard, T., Kustka, A.B., and Kraepiel, A.M.L. (2008) Uptake of
molybdenum and vanadium by a nitrogen-fixing soil bacterium using siderophores.
Nat. Geosci. 1: 243–246.
Bellenger, J.-P., Wichard, T., Xu, Y., and Kraepiel, A.M.L. (2011) Essential metals for
nitrogen fixation in a free-living N2-fixing bacterium: chelation, homeostasis and
high use efficiency. Environ. Microbiol. 13: 1395–411.
Bennett, L.T., Cannon, F., and Dean, D.R. (1988) Nucleotide sequence and mutagenesis
of the nifA gene from Azotobacter vinelandii. Mol. Microbiol. 2: 315–21.
Betancourt, D.A., Loveless, T.M., Brown, J.W., and Bishop, P.E. (2008) Characterization
of Diazotrophs Containing Mo-Independent Nitrogenases, Isolated from Diverse
Natural Environments. Appl. Environ. Microbiol. 74: 3471–3480.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1980) Evidence for an alternative
nitrogen fixation system in Azotobacter vinelandii. Proc. Natl. Acad. Sci. U. S. A. 77:
7342–7346.
Bishop, P.E., Jarlenski, D.M., and Hetherington, D.R. (1982) Expression of an alternative
nitrogen fixation system in Azotobacter vinelandii. J. Bacteriol. 150: 1244–1251.
Blanco, G., Drummond, M., Woodley, P., and Kennedy, C. (1993) Sequence and
molecular analysis of the nifL gene of Azotobacter vinelandii. Mol. Microbiol. 9:
869–79.
Boison, G., Steingen, C., Stal, L.J., and Bothe, H. (2006) The rice field cyanobacteria
Anabaena azotica and Anabaena sp. CH1 express vanadium-dependent nitrogenase.
Arch. Microbiol. 186: 367–76.
Bothe, H., Schmitz, O., Yates, M.G., and Newton, W.E. (2010) Nitrogen fixation and
hydrogen metabolism in cyanobacteria. Microbiol. Mol. Biol. Rev. 74: 529–51.
Boyd, E.S., Hamilton, T.L., and Peters, J.W. (2011) An alternative path for the evolution
of biological nitrogen fixation. Front. Microbiol. 2: 205.
Branca, M., Micera, G., Sanna, D., and Dessì, A. (1990) Complexation of
oxovanadium(IV) by humic and tannic acids. J. Inorg. Biochem. 39: 109–115.
Brenchley, J.E., Prival, M.J., and Magasanik, B. (1973) Regulation of the synthesis of
173
enzymes responsible for glutamate formation in Klebsiella aerogenes. J. Biol. Chem.
248: 6122–8.
Brigle, K.E., Newton, W.E., and Dean, D.R. (1985) Complete nucleotide sequence of the
Azotobacter vinelandii nitrogenase structural gene cluster. Gene 37: 37–44.
Burgess, B.K. and Lowe, D.J. (1996) Mechanism of Molybdenum Nitrogenase. Chem.
Rev. 96: 2983–3012.
Burns, R.C. and Hardy, R.W.F. (2012) Nitrogen Fixation in Bacteria and Higher Plants
Springer Science & Business Media.
Cech, T. V. (2010) Principles of Water Resources: History, Development, Management,
and Policy John Wiley & Sons.
Chatterjee, R., Allen, R.M., Ludden, P.W., and Shah, V.K. (1997) In vitro synthesis of the
iron-molybdenum cofactor and maturation of the nif-encoded apodinitrogenase.
Effect of substitution of VNFH for NIFH. J. Biol. Chem. 272: 21604–21608.
Chisnell, J.R., Premakumar, R., and Bishop, P.E. (1988) Purification of a second
alternative nitrogenase from a nifHDK deletion strain of Azotobacter vinelandii. J.
Bacteriol. 170: 27–33.
Cornell, R.M. and Schwertmann, U. (2006) The Iron Oxides: Structure, Properties,
Reactions, Occurrences and Uses John Wiley & Sons.
Cornish, A. and Page, W. (1995) Production of the triacetecholate siderophore
protochelin by Azotobacter vinelandii. Biometals 8: 332–338.
Cornish, A.S. and Page, W.J. (2000) Role of molybdate and other transition metals in the
accumulation of protochelin by Azotobacter vinelandii. Appl. Environ. Microbiol.
66: 1580–1586.
Cornish, A.S. and Page, W.J. (1998) The catecholate siderophores of Azotobacter
vinelandii: their affinity for iron and role in oxygen stress management.
Microbiology 144: 1747–1754.
Crowley, D.E., Wang, Y.C., Reid, C.P.P., and Szaniszlo, P.J. (1991) Mechanisms of iron
acquisition from siderophores by microorganisms and plants. Plant Soil 130: 179–
198.
Daccord, A., Mursell, M., Poulin-Laprade, D., and Burrus, V. (2012) Dynamics of the
SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by
Integrating Conjugative Elements of the SXT/R391 Family. J. Bacteriol. 194: 5794–
5802.
Darnajoux, R., Constantin, J., Miadlikowska, J., Lutzoni, F., and Bellenger, J.-P. (2014) Is
vanadium a biometal for boreal cyanolichens? New Phytol. 202: 765–71.
174
Darnajoux, R., Zhang, X., McRose, D.L., Miadlikowska, J., Lutzoni, F., Kraepiel,
A.M.L., and Bellenger, J.-P. (2016) Biological nitrogen fixation by alternative
nitrogenases in boreal cyanolichens: importance of molybdenum availability and
implications for current biological nitrogen fixation estimates. New Phytol.
Deicke, M., Bellenger, J.-P., and Wichard, T. (2013) Direct quantification of bacterial
molybdenum and iron metallophores with ultra-high-performance liquid
chromatography coupled to time-of-flight mass spectrometry. J. Chromatogr. A
1298: 50–60.
Deicke, M., Mohr, J.F., Bellenger, J.-P., and Wichard, T. (2014) Metallophore mapping in
complex matrices by metal isotope coded profiling of organic ligands. Analyst 139:
6096–9.
Dilworth, M.J., Eady, R.R., Robson, R.L., and Miller, R.W. (1987) Ethane formation
from acetylene as a potential test for vanadium nitrogenase in vivo. Nature 327:
167–168.
Dixon, R. (1998) The oxygen-responsive NIFL-NIFA complex: a novel two-component
regulatory system controlling nitrogenase synthesis in gamma-proteobacteria. Arch.
Microbiol. 169: 371–80.
Djibaoui, D. and Bensoltane, A. (2005) Effect of iron and growth inhibitors on
siderophores production by Pseudomonas fluorescens. African J. Biotechnol. 4: 697–
702.
Drummond, M., Walmsley, J., and Kennedy, C. (1996) Expression from the nifB
promoter of Azotobacter vinelandii can be activated by NifA, VnfA, or AnfA
transcriptional activators. J. Bacteriol. 178: 788–92.
Duhme, A.-K., Dauter, Z., Hider, R.C., and Pohl, S. (1996) Complexation of
Molybdenum by Siderophores: Synthesis and Structure of the Double-Helical cis -
Dioxomolybdenum(VI) Complex of a Bis(catecholamide) Siderophore Analogue.
Inorg. Chem. 35: 3059–3061.
Duhme, A.-K., Hider, R.C., and Khodr, H.H. (1997) Synthesis and Iron-Binding
Properties of Protochelin, the Tris (catecholamide) Siderophore ofAzotobacter
vinelandii. Chem. Ber. 130: 969–973.
Duhme, A.-K., Hider, R.C., Naldrett, M.J., and Pau, R.N. (1998) The stability of the
molybdenum-azotochelin complex and its effect on siderophore production in
Azotobacter vinelandii. J. Biol. Inorg. Chem. 3: 520–526.
Duhme-Klair, A.-K. (2009) From siderophores and self-assembly to luminescent sensors:
the binding of molybdenum by catecholamides. Eur. J. Inorg. Chem. 2009: 3689–
3701.
175
Dyer, J.A., Trivedi, P., Scrivner, N.C., and Sparks, D.L. (2003) Lead sorpion onto
ferrihydrite. 2. Surface complexation modeling. Environ. Sci. Technol. 37: 915–22.
Eady, R.R. (1996) Structure−Function Relationships of Alternative Nitrogenases. Chem.
Rev. 96: 3013–3030.
Eady, R.R., Robson, R.L., Richardson, T.H., Miller, R.W., and Hawkins, M. (1987) The
vanadium nitrogenase of Azotobacter chroococcum . Purification and properties of
the VFe protein. Biochem. J. 244: 197–207.
Einsle, O. (2014) Nitrogenase FeMo cofactor: an atomic structure in three simple steps. J.
Biol. Inorg. Chem. 19: 737–45.
Elser, J.J., Bracken, M.E.S., Cleland, E.E., Gruner, D.S., Harpole, W.S., Hillebrand, H., et
al. (2007) Global analysis of nitrogen and phosphorus limitation of primary
producers in freshwater, marine and terrestrial ecosystems. Ecol. Lett. 10: 1135–42.
Fenske, D., Gnida, M., Schneider, K., Meyer-Klaucke, W., Schemberg, J., Henschel, V.,
et al. (2005) A new type of metalloprotein: The Mo storage protein from Azotobacter
vinelandii contains a polynuclear molybdenum-oxide cluster. Chembiochem 6: 405–
413.
Frise, E., Green, A., and Drummond, M. (1994) Chimeric transcriptional activators
generated in vivo from VnfA and AnfA of Azotobacter vinelandii: N-terminal
domain of AnfA is responsible for dependence on nitrogenase Fe protein. J.
Bacteriol. 176: 6545–9.
Galloway, J.N., Dentener, F.J., Capone, D.G., Boyer, E.W., Howarth, R.W., Seitzinger,
S.P., et al. (2004) Nitrogen cycles: past, present, and future. Biogeochemistry 70:
153–226.
Glass, J.B., Axler, R.P., Chandra, S., and Goldman, C.R. (2012) Molybdenum limitation
of microbial nitrogen assimilation in aquatic ecosystems and pure cultures. Front.
Microbiol. 3: 331.
Goldberg, S. and Forster, H.S. (1998) FACTORS AFFECTING MOLYBDENUM
ADSORPTION BY SOILS AND MINERALS. Soil Sci. 163: 109–114.
Goldberg, S., Forster, H.S., and Godfrey, C.L. (1996) Molybdenum Adsorption on
Oxides, Clay Minerals, and Soils. Soil Sci. Soc. Am. J. 60: 425.
Gu, B., Chang, J., Min, Y., Ge, Y., Zhu, Q., Galloway, J.N., et al. (2013) The role of
industrial nitrogen in the global nitrogen biogeochemical cycle. Sci. Rep. 3: 636–
639.
Hales, B.J., Langosch, D.J., and Case, E.E. (1986) Isolation and characterization of a
second nitrogenase Fe-protein from Azotobacter vinelandii. J. Biol. Chem. 261:
176
15301–15306.
Hänsch, R. and Mendel, R.R. (2009) Physiological functions of mineral micronutrients
(Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr. Opin. Plant Biol. 12: 259–266.
Hättenschwiler, S. and Vitousek, P. (2000) The role of polyphenols in terrestrial
ecosystem nutrient cycling. Trends Ecol. Evol. 15: 238–243.
Hemingway, R.W., Karchesy, J.J., and Branham, S.J. (1989) Chemistry and Significance
of Condensed Tannins Plenum Pre. Hemingway,R.W., Karchesy,J.J., and
Branham,S.J. (eds) Springer US, New York.
Hill, S., Austin, S., Eydmann, T., Jones, T., and Dixon, R. (1996) Azotobacter vinelandii
NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation
genes via a redox-sensitive switch. Proc. Natl. Acad. Sci. U. S. A. 93: 2143–8.
Hinnemann, B. and Nørskov, J.K. (2004) Chemical activity of the nitrogenase FeMo
cofactor with a central nitrogen ligand: density functional study. J. Am. Chem. Soc.
126: 3920–7.
Hirschman, J., Wong, P.K., Sei, K., Keener, J., and Kustu, S. (1985) Products of nitrogen
regulatory genes ntrA and ntrC of enteric bacteria activate glnA transcription in
vitro: evidence that the ntrA product is a sigma factor. Proc. Natl. Acad. Sci. U. S. A.
82: 7525–9.
Hodkinson, B.P., Allen, J.L., Forrest, L.L., Goffinet, B., Sérusiaux, E., Andrésson, Ó.S.,
et al. (2014) Lichen-symbiotic cyanobacteria associated with Peltigera have an
alternative vanadium-dependent nitrogen fixation system. Eur. J. Phycol. 49: 11–19.
Hooper, D.U. and Johnson, L. (1999) Nitrogen limitation in dryland ecosystems:
Responses to geographical and temporal variation in precipitation. Biogeochemistry
46: 247–293.
Howard, J.B. and Rees, D.C. (2006) How many metals does it take to fix N2? A
mechanistic overview of biological nitrogen fixation. Proc. Natl. Acad. Sci. U. S. A.
103: 17088–93.
Howard, J.B. and Rees, D.C. (1996) Structural Basis of Biological Nitrogen Fixation.
Chem. Rev. 96: 2965–2982.
Hu, Y. and Ribbe, M.W. (2011) Biosynthesis of the Metalloclusters of Molybdenum
Nitrogenase. Microbiol. Mol. Biol. Rev. 75: 664–677.
Imperial, J., Hadi, M., and Amy, N.K. (1998) Molybdate binding by ModA, the
periplasmic component of the Escherichia coli mod molybdate transport system.
Biochim. Biophys. Acta 1370: 337–46.
Jacob, J. and Drummond, M. (1993) Construction of chimeric proteins from the ?; N -
177
associated transcriptional activators VnfA and AnfA of Azotobacter vinelandii
shows that the determinants of promoter specificity lie outside the’recognition'helix
of the HTH motif in the C-terminal . Mol. Microbiol. 10: 813–821.
Jacobitz, S. and Bishop, P.E. (1992) Regulation of nitrogenase-2 in Azotobacter
vinelandii by ammonium, molybdenum, and vanadium. J. Bacteriol. 174: 3884–
3888.
Jacobson, M.R., Brigle, K.E., Bennett, L.T., Setterquist, R.A., Wilson, M.S., Cash, V.L.,
et al. (1989) Physical and genetic map of the major nif gene cluster from Azotobacter
vinelandii. J. Bacteriol. 171: 1017–1027.
Jacobson, M.R., Premakumar, R., and Bishop, P.E. (1986) Transcriptional regulation of
nitrogen fixation by molybdenum in Azotobacter vinelandii. J. Bacteriol. 167: 480–
6.
Jean, M.-E., Phalyvong, K., Forest-Drolet, J., and Bellenger, J.-P. (2013) Molybdenum
and phosphorus limitation of asymbiotic nitrogen fixation in forests of Eastern
Canada: Influence of vegetative cover and seasonal variability. Soil Biol. Biochem.
67: 140–146.
Jiang, H.-B., Lou, W.-J., Ke, W.-T., Song, W.-Y., Price, N.M., and Qiu, B.-S. (2015)
New insights into iron acquisition by cyanobacteria: an essential role for ExbB-
ExbD complex in inorganic iron uptake. ISME J. 9: 297–309.
Joerger, R.D., Jacobson, M.R., and Bishop, P.E. (1989) Two nifA-like genes required for
expression of alternative nitrogenases by Azotobacter vinelandii. J. Bacteriol. 171:
3258–67.
Joerger, R.D., Jacobson, M.R., Premakumar, R., Wolfinger, E.D., and Bishop, P.E. (1989)
Nucleotide sequence and mutational analysis of the structural genes (anfHDGK) for
the second alternative nitrogenase from Azotobacter vinelandii. J. Bacteriol. 171:
1075–1086.
Joerger, R.D., Loveless, T.M., Pau, R.N., Mitchenall, L.A., Simon, B.H., and Bishop, P.E.
(1990) Nucleotide sequences and mutational analysis of the structural genes for
nitrogenase 2 of Azotobacter vinelandii. J. Bacteriol. 172: 3400–8.
Jouogo Noumsi, C., Pourhassan, N., Darnajoux, R., Deicke, M., Wichard, T., Burrus, V.,
and Bellenger, J.-P. (2016) Effect of organic matter on nitrogenase metal cofactors
homeostasis in Azotobacter vinelandii under diazotrophic conditions. Environ.
Microbiol. Rep. 8: 76–84.
Kabata-Pendias, A. (2010) Trace Elements in Soils and Plants, Fourth Edition CRC Press.
Keller, R.J., Coulombe, R.A., Sharma, R.P., Grover, T.A., and Piette, L.H. (1989)
Importance of hydroxyl radical in the vanadium-stimulated oxidation of NADH.
178
Free Radic. Biol. Med. 6: 15–22.
Kennedy, C. and Dean, D. (1992) The nifU, nifS and nifV gene products are required for
activity of all three nitrogenases of Azotobacter vinelandii. Mol. Gen. Genet. 231:
494–8.
Kirn, J. and Rees, D.C. (1992) Crystallographic structure and functional implications of
the nitrogenase molybdenum–iron protein from Azotobacter vinelandii. Nature 360:
553–560.
Kooner, Z.S. (1993) Comparative study of adsorption behavior of copper, lead, and zinc
onto goethite in aqueous systems. Environ. Geol. 21: 242–250.
Kraemer, S.M. (2004) Iron oxide dissolution and solubility in the presence of
siderophores. Aquat. Sci. - Res. Across Boundaries 66: 3–18.
Kraemer, S.M., Duckworth, O.W., Harrington, J.M., and Schenkeveld, W.D.C. (2015)
Metallophores and Trace Metal Biogeochemistry. Aquat. Geochemistry 21: 159–195.
Kraepiel, A.M.L., Bellenger, J.P., Wichard, T., and Morel, F.M.M. (2009) Multiple roles
of siderophores in free-living nitrogen-fixing bacteria. Biometals an Int. J. role Met.
ions Biol. Biochem. Med. 22: 573–581.
Kraus, T.E.C., Dahlgren, R.A., and Zasoski, R.J. (2003) Tannins in nutrient dynamics of
forest ecosystems - a review. Plant Soil 256: 41–66.
Kuiters, A.T. (1990) Role of phenolic substances from decomposing forest litter in plant-
soil interactions. Acta Bot. Neerl. 39: 329–348.
Lancaster, K.M., Roemelt, M., Ettenhuber, P., Hu, Y., Ribbe, M.W., Neese, F., et al.
(2011) X-ray emission spectroscopy evidences a central carbon in the nitrogenase
iron-molybdenum cofactor. Science 334: 974–7.
Lane, T.W. and Morel, F.M. (2000) A biological function for cadmium in marine
diatoms. Proc. Natl. Acad. Sci. U. S. A. 97: 4627–31.
LeBauer, D.S. and Treseder, K.K. (2008) Nitrogen limitation of net primary productivity
in terrestrial ecosytems is globally distributed. Ecology 89: 371–379.
Lee, C.C., Hu, Y., and Ribbe, M.W. (2009) Unique features of the nitrogenase VFe
protein from Azotobacter vinelandii. Proc. Natl. Acad. Sci. 106: 9209–9214.
Little, R., Reyes-Ramirez, F., Zhang, Y., van Heeswijk, W.C., and Dixon, R. (2000)
Signal transduction to the Azotobacter vinelandii NIFL-NIFA regulatory system is
influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein.
EMBO J. 19: 6041–50.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using
179
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San
Diego Calif 25: 402–408.
Loveless, T.M. and Bishop, P.E. (1999) Identification of genes unique to Mo-independent
nitrogenase systems in diverse diazotrophs. Can. J. Microbiol. 45: 312–317.
Loveless, T.M., Saah, J.R., and Bishop, P.E. (1999) Isolation of nitrogen-fixing bacteria
containing molybdenum-independent nitrogenases from natural environments. Appl.
Environ. Microbiol. 65: 4223–4226.
Lowe, D.J., Fisher, K., and Thorneley, R.N. (1993) Klebsiella pneumoniae nitrogenase:
pre-steady-state absorbance changes show that redox changes occur in the MoFe
protein that depend on substrate and component protein ratio; a role for P-centres in
reducing dinitrogen? Biochem. J. 292: 93–98.
Lu, X., Johnson, W.D., and Hook, J. (1998) Reaction of vanadate with aquatic humic
substances: an ESR and 51 V NMR study. Environ. Sci. Technol. 32: 2257–2263.
Luque, F., Mitchenall, L.A., Chapman, M., Christine, R., and Pau, R.N. (1993)
Characterization of genes involved in molybdenum transport in Azotobacter
vinelandii. Mol. Microbiol. 7: 447–59.
Luque, F. and Pau, R.N. (1991) Transcriptional regulation by metals of structural genes
for Azotobacter vinelandii nitrogenases. Mol. Gen. Genet. 227: 481–7.
Macaluso, A., Best, E.A., and Bender, R.A. (1990) Role of the nac gene product in the
nitrogen regulation of some NTR-regulated operons of Klebsiella aerogenes. J.
Bacteriol. 172: 7249–55.
Mackenzie, F.T., Ver, L.M., Sabine, C., Lane, M., and Lerman, A. (2013) Interactions of
C, N, P and S Biogeochemical Cycles and Global Change Roland,W.,
Mackenzie,F.T., and Chou,L. (eds) Springer Science & Business Media.
Marks, J.A., Perakis, S.S., King, E.K., and Pett-Ridge, J. (2015) Soil organic matter
regulates molybdenum storage and mobility in forests. Biogeochemistry 125: 167–
183.
Martell, A.E. and Smith, R.M. (1989) Critical stability constants. Plenum Press, New
York.
Masepohl, B., Schneider, K., Drepper, T., Muller, A., and Klipp, W. (2002) Nitrogen
fixation at the millennium G.J.,L. (ed) Elsevier.
Masukawa, H., Zhang, X., Yamazaki, E., Iwata, S., Nakamura, K., Mochimaru, M., et al.
(2009) Survey of the distribution of different types of nitrogenases and hydrogenases
in heterocyst-forming cyanobacteria. Mar. Biotechnol. (NY). 11: 397–409.
May, H.D. and Dean, R.D. (1991) Altered nitrogenase MoFe proteins from Azotobacter
180
vinelandii. Analysis of MoFe proteins having amino acid substitutions for the
conserved cysteine residues within the beta-subunit. Biochem. J. 277 (Pt 2): 457–64.
Meletzus, D., Rudnick, P., Doetsch, N., Green, A., and Kennedy, C. (1998)
Characterization of the glnK-amtB Operon of Azotobacter vinelandii. J. Bacteriol.
180: 3260–3264.
Merrick, M., Gibbins, J., and Toukdarian, A. (1987) The nucleotide sequence of the
sigma factor gene ntrA (rpoN) of Azotobacter vinelandii: analysis of conserved
sequences in NtrA proteins. Mol. Gen. Genet. 210: 323–30.
Merrick, M., Hill, S., Hennecke, H., Hahn, M., Dixon, R., and Kennedy, C. (1982)
Repressor properties of the nifL gene product in Klebsiella pneumoniae. MGG Mol.
Gen. Genet. 185: 75–81.
Merrick, M.J. and Gibbins, J.R. (1985) The nucleotide sequence of the nitrogen-
regulation gene ntrA of Klebsiella pneumoniae and comparison with conserved
features in bacterial RNA polymerase sigma factors. Nucleic Acids Res. 13: 7607–
20.
Miller, R.W. and Eady, R.R. (1988) Molybdenum and vanadium nitrogenases of
Azotobacter chroococcum. Low temperature favours N2 reduction by vanadium
nitrogenase. Biochem. J. 256: 429–432.
Monteiro, R.A., Souza, E.M., Yates, M.G., Pedrosa, F.O., and Chubatsu, L.S. (1999) In-
trans regulation of the N-truncated-NIFA protein of Herbaspirillum seropedicae by
the N-terminal domain. FEMS Microbiol. Lett. 180: 157–61.
Morrison, C.N., Hoy, J.A., Zhang, L., Einsle, O., and Rees, D.C. (2015) Substrate
pathways in the nitrogenase MoFe protein by experimental identification of small
molecule binding sites. Biochemistry 54: 2052–60.
Moshiri, F., Kim, J.W., Fu, C., and Maier, R.J. (1994) The FeSII protein of Azotobacter
vinelandii is not essential for aerobic nitrogen fixation, but confers significant
protection to oxygen-mediated inactivation of nitrogenase in vitro and in vivo. Mol.
Microbiol. 14: 101–114.
Mouncey, N.J., Mitchenall, L.A., and Pau, R.N. (1995) Mutational analysis of genes of
the mod locus involved in molybdenum transport, homeostasis, and processing in
Azotobacter vinelandii. J. Bacteriol. 177: 5294–302.
Moure, V.R., Costa, F.F., Cruz, L.M., Pedrosa, F.O., Souza, E.M., Li, X.-D., et al. (2015)
Regulation of nitrogenase by reversible mono-ADP-ribosylation. Curr. Top.
Microbiol. Immunol. 384: 89–106.
Nakajima, H., Takatani, N., Yoshimitsu, K., Itoh, M., Aono, S., Takahashi, Y., and
Watanabe, Y. (2010) The role of the Fe-S cluster in the sensory domain of
181
nitrogenase transcriptional activator VnfA from Azotobacter vinelandii. FEBS J.
277: 817–32.
Noar, J.D. and Bruno-Bárcena, J.M. (2013) Complete Genome Sequences of Azotobacter
vinelandii Wild-Type Strain CA and Tungsten-Tolerant Mutant Strain CA6. Genome
Announc. 1: e00313–13.
Nordlund, S. and Högbom, M. (2013) ADP-ribosylation, a mechanism regulating
nitrogenase activity. FEBS J. 280: 3484–90.
Nosheen, A., Bano, A., Ullah, F., Farooq, U., Yasmin, H., and Hussain, I. (2013) Effect
of plant growth promoting rhizobacteria on root morphology of Safflower (
Carthamus tinctorius L.). African J. Biotechnol. 10: 12638–12649.
Oda, Y., Samanta, S.K., Rey, F.E., Wu, L., Liu, X., Yan, T., et al. (2005) Functional
genomic analysis of three nitrogenase isozymes in the photosynthetic bacterium
Rhodopseudomonas palustris. J. Bacteriol. 187: 7784–94.
Oelze, J. (2000) Respiratory protection of nitrogenase in Azotobacter species: is a widely
held hypothesis unequivocally supported by experimental evidence? FEMS
Microbiol. Rev. 24: 321–333.
Page, W.J. and Huyer, M. (1984) Derepression of the Azotobacter vinelandii siderophore
system, using iron-containing minerals to limit iron repletion. J. Bacteriol. 158: 496–
502.
Page, W.J. and von Tigerstrom, M. (1982) Iron- and molybdenum-repressible outer
membrane proteins in competent Azotobacter vinelandii. J. Bacteriol. 151: 237–42.
Pau, R.N. (1989) Nitrogenases without molybdenum. Trends Biochem. Sci. 14: 183–6.
Peacock, C.L. and Sherman, D.M. (2004) Vanadium(V) adsorption onto goethite (α-
FeOOH) at pH 1.5 to 12: a surface complexation model based on ab initio molecular
geometries and EXAFS spectroscopy. Geochim. Cosmochim. Acta 68: 1723–1733.
Peters, J.W., Fisher, K., Newton, W.E., and Dean, D.R. (1995) Involvement of the P
Cluster in Intramolecular Electron Transfer within the Nitrogenase MoFe Protein. J.
Biol. Chem. 270: 27007–27013.
Pienkos, P.T. and Brill, W.J. (1981) Molybdenum accumulation and storage in Klebsiella
pneumoniae and Azotobacter vinelandii. J. Bacteriol. 145: 743–51.
Poledniok, J. (2003) Speciation of vanadium in soil. Talanta 59: 1–8.
Poulin-Laprade, D. and Burrus, V. (2015) A λ Cro-like repressor is essential for the
induction of conjugative transfer of SXT/R391 elements in response to DNA
damage. J. Bacteriol.
182
Pratte, B.S., Eplin, K., and Thiel, T. (2006) Cross-functionality of nitrogenase
components NifH1 and VnfH in Anabaena variabilis. J. Bacteriol. 188: 5806–5811.
Pratte, B.S., Sheridan, R., James, J.A., and Thiel, T. (2013) Regulation of V-nitrogenase
genes in Anabaena variabilis by RNA processing and by dual repressors. Mol.
Microbiol. 88: 413–24.
Pratte, B.S. and Thiel, T. (2006) High-Affinity Vanadate Transport System in the
Cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol. 188: 464–468.
Premakumar, R., Loveless, T.M., and Bishop, P.E. (1994) Effect of amino acid
substitutions in a potential metal-binding site of AnfA on expression from the anfH
promoter in Azotobacter vinelandii. J. Bacteriol. 176: 6139–42.
Premakumar, R., Pau, R.N., Mitchenall, L.A., Easo, M., and Bishop, P.E. (1998)
Regulation of the transcriptional activators AnfA and VnfA by metals and
ammonium in Azotobacter vinelandii. FEMS Microbiol. Lett. 164: 63–68.
Raymond, J., Siefert, J.L., Staples, C.R., and Blankenship, R.E. (2004) The natural
history of nitrogen fixation. Mol. Biol. Evol. 21: 541–54.
Reddy, K.J. and Gloss, S.P. (1993) Geochemical speciation as related to the mobility of F,
Mo and Se in soil leachates. Appl. Geochemistry 8: 159–163.
Reed, S.C., Cleveland, C.C., and Townsend, A.R. (2011) Functional ecology of free-
living nitrogen fixation: a contemporary perspective. Annu. Rev. Ecol. Evol. Syst. 42:
489–512.
Rees, D.C., Akif Tezcan, F., Haynes, C.A., Walton, M.Y., Andrade, S., Einsle, O., and
Howard, J.B. (2005) Structural basis of biological nitrogen fixation. Philos. Trans.
A. Math. Phys. Eng. Sci. 363: 971–84; discussion 1035–40.
Rees, D.C. and Howard, J.B. (2000) Nitrogenase: standing at the crossroads. Curr. Opin.
Chem. Biol. 4: 559–566.
Rehder, D. (2000) Vanadium nitrogenase. J. Inorg. Biochem. 80: 133–136.
Robin, A., Vansuyt, G., Hinsinger, P., Meyer, J.M., Briat, J.F., and Lemanceau, P. (2008)
Chapter 4 Iron Dynamics in the Rhizosphere: Consequences for Plant Health and
Nutrition. Adv. Agron. 99: 183–225.
Robson, R.L., Eady, R.R., Richardson, T.H., Miller, R.W., Hawkins, M., and Postgate,
J.R. (1986) The alternative nitrogenase of Azotobacter chroococcum is a vanadium
enzyme. Nature 322: 388–390.
Robson, R.L. and Postgate, J.R. (1980) Oxygen and hydrogen in biological nitrogen
fixation. Annu. Rev. Microbiol. 34: 183–207.
183
Rose, A.L. and Waite, T.D. (2003) Kinetics of Hydrolysis and Precipitation of Ferric Iron
in Seawater. Environ. Sci. Technol. 37: 3897–3903.
Rubio, L.M. and Ludden, P.W. (2005) Maturation of nitrogenase: a biochemical puzzle.
J. Bacteriol. 187: 405–414.
Sandy, M. and Butler, A. (2009) Microbial iron acquisition: marine and terrestrial
siderophores. Chem. Rev. 109: 4580–95.
Dos Santos, P.C. and Dean, D.R. (2014) Iron-Sulfur Clusters in Chemistry and Biology
Rouault,T. (ed) Walter de Gruyter GmbH & Co KG, 2014.
Savli, H., Karadenizli, A., Kolayli, F., Gundes, S., Ozbek, U., and Vahaboglu, H. (2003)
Expression stability of six housekeeping genes: a proposal for resistance gene
quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-
PCR. J. Med. Microbiol. 52: 403–408.
Sayyed, R.Z., Badgujar, M.D., Sonawane, H.M., Mhaske, M.M., and Chincholkar, S.B.
(2005) Production of microbial iron chelators (siderophores) by fluorescent
Pseudomonads. IJBT Vol.4(4) [October 2005].
Schlesinger, W.H. and Bernhardt, E.S. (2013) Biogeochemistry: An Analysis of Global
Change Academic Press.
Schmittgen, T.D. and Livak, K.J. (2008) Analyzing real-time PCR data by the
comparative CT method. Nat. Protoc. 3: 1101–1108.
Schmitz, R.A., Klopprogge, K., and Grabbe, R. (2002) Regulation of nitrogen fixation in
Klebsiella pneumoniae and Azotobacter vinelandii: NifL, transducing two
environmental signals to the nif transcriptional activator NifA. J. Mol. Microbiol.
Biotechnol. 4: 235–242.
Schneider, K., Müller, A., Schramm, U., and Klipp, W. (1991) Demonstration of a
molybdenum- and vanadium-independent nitrogenase in a nifHDK-deletion mutant
of Rhodobacter capsulatus. Eur. J. Biochem. 195: 653–661.
Schwacha, A. and Bender, R.A. (1993) The nac (nitrogen assimilation control) gene from
Klebsiella aerogenes. J. Bacteriol. 175: 2107–15.
Seefeldt, L.C., Hoffman, B.M., and Dean, D.R. (2009) Mechanism of Mo-dependent
nitrogenase. Annu. Rev. Biochem. 78: 701–22.
Self, W.T., Grunden, A.M., Hasona, A., and Shanmugam, K.T. (2001) Molybdate
transport. Res. Microbiol. 152: 311–321.
Setubal, J.C., dos Santos, P., Goldman, B.S., Ertesvåg, H., Espin, G., Rubio, L.M., et al.
(2009) Genome sequence of Azotobacter vinelandii, an obligate aerobe specialized
to support diverse anaerobic metabolic processes. J. Bacteriol. 191: 4534–4545.
184
Shailendra Singh, G.G. (2015) Plant Growth Promoting Rhizobacteria (PGPR): Current
and Future Prospects for Development of Sustainable Agriculture. J. Microb.
Biochem. Technol. 07.:
Shieh, C. and Duedall, I.W. (1988) Role of amorphous ferric oxyhydroxide in removal of
anthropogenic vanadium from seawater. Mar. Chem. 25: 121–139.
Silvester, W. (1989) Molybdenum limitation of asymbiotic nitrogen fixation in forests of
Pacific Northwest America. Soil Biol. Biochem. 21: 283–289.
Slabbert, N. (2012) Plant Polyphenols: Synthesis, Properties, Significance. Complexation
of condensed tannins with metal ions. Hemingway,R.W. and Laks,P.E. (eds)
Springer Science & Business Media.
Souza, E.M., Pedrosa, F.O., Drummond, M., Rigo, L.U., and Yates, M.G. (1999) Control
of Herbaspirillum seropedicae NifA activity by ammonium ions and oxygen. J.
Bacteriol. 181: 681–4.
Steenhoudt, O. and Vanderleyden, J. (2000) Azospirillum, a free-living nitrogen-fixing
bacterium closely associated with grasses: genetic, biochemical and ecological
aspects. FEMS Microbiol. Rev. 24: 487–506.
Stefánsson, A. (2007) Iron(III) Hydrolysis and Solubility at 25 °C. Environ. Sci. Technol.
41: 6117–6123.
Stevenson, F.J. and Cole, M.A. (Michael A.. (1999) Cycles of soil : carbon, nitrogen,
phosphorus, sulfur, micronutrients Wiley.
Stintzi, A., Barnes, C., Xu, J., and Raymond, K.N. (2000) Microbial iron transport via a
siderophore shuttle: a membrane ion transport paradigm. Proc. Natl. Acad. Sci. U. S.
A. 97: 10691–6.
Tang, D. and Morel, F.M.M. (2006) Distinguishing between cellular and Fe-oxide-
associated trace elements in phytoplankton. Mar. Chem. 98: 18–30.
Thiel, T. (1993) Characterization of genes for an alternative nitrogenase in the
cyanobacterium Anabaena variabilis. J. Bacteriol. 175: 6276–6286.
Thiel, T. and Pratte, B.S. (2013) Alternative nitrogenases in Anabaena variabilis: the role
of molybdate and vanadate in nitrogenase gene. Adv. Microbiol. 03: 87–95.
Thöny, B. and Hennecke, H. (1989) The -24/-12 promoter comes of age. FEMS
Microbiol. Rev. 5: 341–57.
Tindale, A.E., Mehrotra, M., Ottem, D., and Page, W.J. (2000) Dual regulation of
catecholate siderophore biosynthesis in Azotobacter vinelandii by iron and oxidative
stress. Microbiology 146 ( Pt 7: 1617–26.
185
Toukdarian, A. and Kennedy, C. (1986) Regulation of nitrogen metabolism in
Azotobacter vinelandii: isolation of ntr and glnA genes and construction of ntr
mutants. EMBO J. 5: 399–407.
Villa, J.A., Ray, E.E., and Barney, B.M. (2014) Azotobacter vinelandii siderophore can
provide nitrogen to support the culture of the green algae Neochloris oleoabundans
and Scenedesmus sp. BA032. FEMS Microbiol. Lett. 351: 70–77.
Vitousek, P.M. and Howarth, R.W. (1991) Nitrogen limitation on land and in the sea :
How can it occur? Biogeochemistry 13: 87–115.
Völker, C. and Wolf-Gladrow, D.A. (1999) Physical limits on iron uptake mediated by
siderophores or surface reductases. Mar. Chem. 65: 227–244.
Walmsley, J. and Kennedy, C. (1991) Temperature-Dependent Regulation by
Molybdenum and Vanadium of Expression of the Structural Genes Encoding Three
Nitrogenases in Azotobacter vinelandii. Appl. Environ. Microbiol. 57: 622–4.
Walmsley, J., Toukdarian, A., and Kennedy, C. (1994) The role of regulatory genes nifA,
vnfA, anfA, nfrX, ntrC, and rpoN in expression of genes encoding the three
nitrogenases of Azotobacter vinelandii. Arch. Microbiol. 162: 422–9.
Wanty, R.B. and Goldhaber, M.B. (1992) Thermodynamics and kinetics of reactions
involving vanadium in natural systems: Accumulation of vanadium in sedimentary
rocks. Geochim. Cosmochim. Acta 56: 1471–1483.
Wedepohl, K.H. (1995) The composition of the continental crust. Geochim. Cosmochim.
Acta 59: 1217–1232.
Wichard, T., Bellenger, J.-P., Morel, F.M.M., and Kraepiel, A.M.L. (2009) Role of the
siderophore azotobactin in the bacterial acquisition of nitrogenase metal cofactors.
Environ. Sci. Technol. 43: 7218–7224.
Wichard, T., Mishra, B., Myneni, S.C.B., Bellenger, J.-P., and Kraepiel, A.M.L. (2009)
Storage and bioavailability of molybdenum in soils increased by organic matter
complexation. Nat. Geosci. 2: 625–629.
Wilhelm, S.W. and Trick, C.G. (1994) Iron-limited growth of cyanobacteria: Multiple
siderophore production is a common response. Limnol. Oceanogr. 39: 1979–1984.
Woodley, P., Buck, M., and Kennedy, C. (1996) Identification of sequences important for
recognition of vnf genes by the VnfA transcriptional activator in Azotobacter
vinelandii. FEMS Microbiol. Lett. 135: 213–21.
Xu, N., Christodoulatos, C., and Braida, W. (2006) Adsorption of molybdate and
tetrathiomolybdate onto pyrite and goethite: effect of pH and competitive anions.
Chemosphere 62: 1726–35.
186
Xu, Y., Feng, L., Jeffrey, P.D., Shi, Y., and Morel, F.M.M. (2008) Structure and metal
exchange in the cadmium carbonic anhydrase of marine diatoms. Nature 452: 56–61.
Yoshimitsu, K., Takatani, N., Miura, Y., Watanabe, Y., and Nakajima, H. (2011) The role
of the GAF and central domains of the transcriptional activator VnfA in Azotobacter
vinelandii. FEBS J. 278: 3287–97.
Zhang, X., McRose, D.L., Darnajoux, R., Bellenger, J.P., Morel, F.M.M., and Kraepiel,
A.M.L. (2016) Alternative nitrogenase activity in the environment and nitrogen
cycle implications. Biogeochemistry 127: 189–198.
1
Recommended