Endonucleases: tools to correct the dystrophin gene

  • Published on
    11-Jun-2016

  • View
    217

  • Download
    1

Embed Size (px)

Transcript

<ul><li><p>Endonucleases: tools to correct thedystrophin gene</p><p>Joel Rousseau1</p><p>Pierre Chapdelaine1</p><p>Sbastien Boisvert2,3</p><p>Luciana P. Almeida4</p><p>Jacques Corbeil3</p><p>Alexandre Montpetit5</p><p>Jacques P. Tremblay1,3*</p><p>1Unit de recherche de recherche enGntique Humaine, Centre derecherche de CHUL, CHUQ, Facult demdecine, Universit Laval, Qubec,Canada2Centre de recherche en infectiologie,Centre Hospitalier Universitaire deQubec (CHUQ), Pavillon CHUL,Qubec, Canada3Facult de mdecine, PavillonFerdinand-Vandry, 1050, avenue de laMdecine, Universit Laval, Qubec,Canada4Department of Biochemistry andImmunology, School of Medicine ofRibeiro Preto, University of SoPaulo, SP, Brazil5McGill University and GenomeQuebec Innovation Centre, Montreal,Canada</p><p>*Correspondence to: J. P. Tremblay,Unit de recherche de recherche enGntique Humaine, Centre derecherche de CHUL, CHUQ, Facultde mdecine, Universit Laval,Qubec, Canada.E-mail: jacques-p.tremblay@crchul.ulaval.ca</p><p>Abstract</p><p>Background Various endonucleases can be engineered to induce double-strand breaks (DSBs) in chosen DNA sequences. These DSBs are spontaneouslyrepaired by nonhomologous-end-joining, resulting in micro-insertions or micro-deletions (INDELs). We detected, characterized and quantied the frequency ofINDELs produced by one meganuclease (MGN) targeting the RAG1 gene, sixMGNs targeting three introns of the human dystrophin gene and one pair of zincnger nucleases (ZFNs) targeting exon 50 of the human dystrophin gene. Theexperiments were performed in human cells (i.e. 293T cells, myoblasts andmyotubes).</p><p>Methods To analyse the INDELs produced by the endonucleases the targetedregion was polymerase chain reaction amplied and the amplicons weredigested with the Surveyor enzyme, cloned in bacteria or deep sequenced.</p><p>Results Endonucleases targeting the dystrophin gene produced INDELs ofdifferent sizes but there were clear peaks in the size distributions. Thepositions of these peaks were similar for MGNs but not for ZFNs in 293T cellsand in myoblasts. The size of the INDELs produced by these endonucleases inthe dystrophin gene would have permitted a change in the reading frame. In asubsequent experiment, we observed that the frequency of INDELs wasincreased by re-exposition of the cells to the same endonuclease.</p><p>Conclusions Endonucleases are able to: (i) restore the normal reading of agene with a frame shift mutation; (ii) delete a nonsense codon; and (iii) knock-out a gene. Endonucleases could thus be used to treat Duchenne musculardystrophy and other hereditary diseases that are the result of a nonsensecodon or a frame shift mutation. Copyright 2011 John Wiley &amp; Sons, Ltd.</p><p>Keywords Duchenne muscular dystrophy; dystrophin; endonuclease; meganu-clease; micro-deletion; micro-insertion; reading frame correction; zinc ngernuclease</p><p>Introduction</p><p>Many hereditary diseases, including Duchenne muscular dystrophy (DMD) arecaused by mutations, which lead to a premature termination of protein trans-lation as a result of the presence of a nonsense mutation or a frame shift mu-tation, which results in a premature stop codon. Internally deleted dystrophinproteins have been shown to have a normal or quasi-normal role because theycan integrate into the dystrophin complex and give rise either to asymptomaticsubjects or to Becker muscular dystrophy with a milder phenotype [13].Gene targeting is the ultimate tool for genetic modications for eventually</p><p>treating a variety of genetic diseases, but its use is often limited by its low</p><p>RESEARCH ARTICLE</p><p>Received: 4 July 2011Revised: 23 August 2011Accepted: 15 September 2011</p><p>Copyright 2011 John Wiley &amp; Sons, Ltd.</p><p>THE JOURNAL OF GENE MEDICINEJ Gene Med 2011; 13: 522537.Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/jgm.1611</p></li><li><p>efciency. Meganucleases (MGNs), also calledhomingendo-nucleases, are sequence-specic endonucleases, which recog-nize unique large (&gt; 12bp) target sites in living cells [4].Zinc nger nucleases (ZFNs) are another type ofendonucleases, which can also be engineered to targetspecic DNA sequences [512]. More recently, a third typeof endonucleases, the Tal effector nucleases (TALENs) hasalso been engineered to mutate specic DNA sequences[1318]. All three types of endonucleases induce site-specic double-strand breaks (DSBs), which stimulate therate of homologous recombination (HR) up to 10000-foldin cultured cells [19,20]. However, repair by HR requiresthe insertion in the cells of a donor DNA molecule sharinghomologies with the targeted gene. Endonuclease inducedDSB can also be repaired by nonhomologous end-joining(NHEJ), an error prone process, which frequently resultsin micro-insertions or micro-deletions (INDELs) at the siteof the break [2123]. However, NHEJ has the greatadvantage that it does not require any donor DNA and,thus, when introduced in the cells in vitro or in vivo, onlythe endonuclease protein could produce NHEJ. It is nowpossible to engineer highly specic redesigned endonu-cleases recognizing chosen sequences from almost anychromosomal locus [7,8,10,11,13,15,2429]. Thus, endonu-cleases represent universal tools to mutate the genome atspecic target sequences. Moreover, it is possible to perma-nently mutate the genome with only the transduction of anendonuclease protein, avoiding the requirement to intro-duce in the cells the DNA coding for the endonucleaseand a donor DNA.The present study describes three procedures for</p><p>characterizing and quantifying INDELs induced by endo-nucleases at a specic site within a gene. All three proce-dures include a rst step consisting in the polymerasechain reaction (PCR) amplication of a short DNAsequence surrounding the chromosomal target site,although they differ in the techniques used to characterizethe resulting amplicons. The rst procedure, the Surveyorassay, has already been described [11,28,30]. The secondprocedure, called subtractive colony hybridization (SCH),is the only one to include the cloning of an individualamplicon. PCR products were cloned in bacterial plas-mids, and products containing INDELs were detected bytwo rounds of negative in situ hybridization in bacteria,using a specic oligonucleotide radioactive probecorresponding to the MGN target. This approach permitsa semi-quantitative evaluation of INDELs produced by aMGN inside cells. The third procedure is based on basedon deep barcoded sequencing (DBS). The DBS methodhas previously been used by Meng et al. [31]. It is bothquantitative and extremely sensitive and can thus be usedto compare the efcacy of various procedures for deliver-ing the endonuclease genes or proteins not only in vitro,but also in vivo. Moreover, this procedure permits an exactdetermination of which base pairs have been added ordeleted, and thus determine whether the reading frameof the resulting mRNA has been modied. Our results alsodemonstrate that the INDELs induced by endonucleasesmodify the reading frame of the dystrophin and could</p><p>thus be used to restore the normal reading frame of adystrophin gene with an out-of-frame deletion.</p><p>Material and methods</p><p>Materials</p><p>Meganuclease-coding plasmids were provided by CellectisSA Inc. (Romainville, France). The plasmid coding forRAG1, corresponds to the scV3-V2+(G19S) meganucleasedescribed in a previous study [32]. Six MGNs targetingthree dystrophin introns (MGN2874, MGN3387, MGN3631,MGN3633,MGN3326 andMGN3330)were produced basedon the same scaffold as the RAG1 meganuclease. The RAG1MGN is under the EF1a promoter, whereas the MGNstargeting dystrophin are under the cytomegalovirus (CMV)promoter. The ZFNs targeting the dystrophin gene werepurchased from Compo ZR Inc. (Oakville, ON, Canada).The ZFNs were under the control of a CMV promoter in a4129bp expression vector called pZFN. Targeted sequencesare indicated in Table 1. The plasmid vector containing thedog m-dystrophin fused to a V5-tag and containing aninsertion including the RAG1MGN target sequence has beenpreviously described [33]. Surveyor nuclease enzyme waspurchased from Transgenomic Inc. (Omaha, NE, USA) andused as in accordance with the manufacturers instructionsto detect INDELs. Phusion High-Fidelity DNA Polymerase(Finnzymes Qy Inc., Vantaa, Finland) and TAQ DNApolymerase used for PCRwere purchased fromNewEnglandBiolabs Ltd (Pickering, ON, Canada). Qiaquick gel extractionkit and Qiagen PCR cloning kit were from Qiagen Inc.(Valencia, CA, USA). The vector pLenti6/V5-D-TOPO andLipofectamine 2000 were from Invitrogen Canada Inc.(Burlington, ON, Canada).</p><p>Transfection of 293T cells withendonuclease plasmids</p><p>Half a million 293 T cells were plated in a six-wellplate. The following day, these cells were transfectedwith 4 mg of each of the seven MGN or Flag-ZFN plas-mids using Lipofectamine 2000. Three days later,the genomic DNA was extracted from the cells [34]to detect INDELs with the Surveyor enzyme, SCH orDBS procedure. The analysis of INDELs by SCH andDBS was also carried out for 293 T cells transfectedeither one or four times consecutively with MGNRAG1 at a 3-day interval using Lipofectamine 2000. Insome experiments, the proteins were also extracted fromthe cells and analyzed by western blot with a specicpolyclonal antibody developed against I-CreI MGN thatis able to detect the expression of the different MGN[33]. The expression of the Flag-ZFN was conrmed bywestern blotting using an anti-Flag monoclonal antibody(Sigma-Aldrich Canada Inc., Oakville, Canada).</p><p>Endonucleases and dystrophin gene 523</p><p>Copyright 2011 John Wiley &amp; Sons, Ltd. J Gene Med 2011; 13: 522537.DOI: 10.1002/jgm</p></li><li><p>Lentivirus constructs coding for MGNs</p><p>All the plasmids coding for different MGNs obtained fromCellectis Inc. (Romainville, France) have a similar struc-ture. A simple digestion of MGN vector with restrictionenzymes Nde1 and Age1 liberated a DNA fragment ofapproximately 1.5 kb containing a portion of CMV promoterand a complete MGN coding sequence, which was subse-quently cloned directly in the same restriction enzyme sitesof a lentiviral vector named pLenti6/V5-D-TOPO in whichthe blasticidin resistant gene had been replaced by apuromycin resistant gene. The resulting nal constructscontained a MGN coding sequence driven by a CMVpromoter already present in the lentiviral vector. Thelentiviruses coding for different MGNs were produced inthe 293T cells as described below. The supernatantcontaining the virus were then used to infect human myo-blasts. The cells were selected with 2mg/ml puromycin(2days) and propagated. Western blot analysis with aspecic polyclonal antibody to I-CreI MGN, reacting withan epitope common to all these MGNs, was carried out toconrm the expression of each MGN.</p><p>Nucleofection of human myoblasts withan endonuclease plasmid</p><p>Human myoblasts were nucleofected with 5mg of an endo-nuclease plasmid. Nucleofection solution adult (NHDF-adult, Lonza, no. CC-2511; ESBE Scientic, Markham, ON,Canada) was used and the nucleofection apparatus (AmaxaInc., Amaxa Nucleofector System, Lonza Walkersville Inc.,Walkersville, MD, USA) was set to program P-022. After thenucleofection of plasmid, the cells were grown during 3daysin MB1 medium (Hyclone Inc., Logan, UT, USA) culture me-dium followed byDNAextraction. The endonuclease-targetedregion was amplied by PCR. The resulting amplicons weretreated with the Surveyor enzyme, as described below.</p><p>Western blot analysis of differentendonucleases in 293T cells</p><p>Proteins were also extracted from 293T cells nucleofectedwith 5 mg of an endonuclease plasmid and analyzed bywestern blotting with a specic polyclonal antibody</p><p>developed against the I-CreI MGN able to detect the ex-pression of the different MGNs [33] or with an antibodyagainst the Flag (Sigma-Aldrich Canada Inc.) for theZFNs. An aliquot of 20 mg of protein was loaded in eachlane, resolved in 12% sodium dodecyl sulphate (SDS)-polyacrylamide gel electrophoresis (PAGE) and electro-transferred onto 0.45 mm nitrocellulose membrane. Themembrane was blocked in 5% (w/v) nonfat dry milkresuspended in phosphate-buffered saline (PBS) contain-ing 0.05% Tween-20 for 1 h and incubated overnight at4 C with a rabbit polyclonal antibody (dilution 1:5000for MGN) or monoclonal anti-FLAG (dilution 1:1500 forZFN) serum diluted at 1:5000 in PBS-Tween. Themembrane was washed for 10min in PBS with 0.05%Tween three times and incubated with goat anti-rabbit(dilution 1:10000) Ab or rabbit anti-mouse (dilution1:1500) for 1 h at room temperature. After three washesof 10min each, the membranes were incubated with anenhanced chemiluminescent reagent (Renaissancereagent, New England Nuclear Corporation, Perkin-Elmer,Waltham, MA, USA) substrate and exposed to autoradiog-raphy lm.</p><p>Surveyor enzyme procedure</p><p>The surveyor enzyme procedure is explained in Figure 1A.Briey, 100 ng of genomic DNA were PCR amplied withthe 2X Phusion mix (Finnzymes QY Inc.) in a total volumeof 50 ml, using the primers for RAG1 or for each of the dys-trophin target (Primers 114 in Table 2). PCR parameterswere: one step at 98 C for 1min followed by 30 cycles of98 C for 30 s, 60 C for 30 s and 72 C for 30 s. Ampliconswere puried with the Qiaquick gel extraction kit (QiagenInc.) in accordance with the manufacturers instructions.Puried PCR product (10ml) was submitted to the Sur-veyor enzyme protocol in accordance with the manufac-turers instructions.</p><p>SCH protocol to identify INDELs causedby endonucleases</p><p>A new ve-steps procedure, termed SCH (Figure 2A), wasdeveloped to characterize INDELs produced in thegenome of cells treated with different endonucleases.</p><p>Table 1. Nucleotide sequences targeted by the different endonucleases</p><p>MGN name Dystrophin Targetted sequence</p><p>intron/exonRag1 TTGTTCTCAGGTACCTCAGCCAGI-SceI CACGCTAGGGATAACAGGGTAATATMGN2874 Intron 38 GAAACCTCAAGTACCAAATGTAAAMGN3387 Intron 38 GAAACCTCAAGTACCAAATGTAAAMGN3631 Intron 44 AATGTCTGATGTTCAATGTGTTGAMGN3633 Intron 44 AATGTCTGATGTTCAATGTGTTGAMGN3326 Intron 42 CAAATCCTGCCTTAAAGTATCTCAMGN3330 Intron 42 CAAATCCTGCCTTAAAGTATCTCAZFNs Exon 50 CTAGCTCCTGGACTGACCactattGGAGCCTGTAAGTATACTG</p><p>Note that there are two different MGNs targeting the same dystrophin sequence.</p><p>524 J. Rousseau et al.</p><p>Copyright 2011 John Wiley &amp; Sons, Ltd. J Gene Med 2011; 13: 522537.DOI: 10.1002/jgm</p></li><li><p>The rst step: 100 ng of genomic DNA was amplied withthe Phusion High-Fidelity DNA Polymerase (New EnglandBiolabs Inc., Ipswich, MA, USA) (one cycle at 98 C for1min; 25 cycles at 98 C for 10 s, 60 C for 20 s and72 C for 30 s and nally one cycle at 72 C for 10min)using primers 114 specied in Table 2. At the end ofthe PCR reaction, 0.5ml of Taq DNA polymerase (NEB)was added to the PCR medium and brought at 72 C for10min and then loaded and electrophoresed on a 1.4%agarose gel containing ethidium bromide for DNA visuali-zation under ultraviolet (UV) light. A uorescent 600-pbband was excised from the gel (Qiagen gel extractionkit) and this amplicon was cloned in the TA cloning vectorpDrive (Qiagen PCR cloning kit). The ligation medium</p><p>(10ml: 0.5 ml pDrive (50 ng/ml), 4.5 ml PCR product, 5 ml li-gation 2X) was incubated overnight at 13 C....</p></li></ul>