Embed Size (px)
Citation preview
1
KlAft, the Kluyveromyces lactis ortholog of Aft1 and Aft2, mediates activation of iron-1
responsive transcription through the PuCACCC Aft-type sequence 2
3
Natalia Conde e Silva1, Isabelle R. Gonçalves2,3, Marc Lemaire4, Emmanuel Lesuisse1, 4
Jean Michel Camadro1 and Pierre Louis Blaiseau1,5* 5
1 Ingéniérie des Protéines et Contrôle Métabolique, UMR 7592 Institut Jacques Monod, 6
CNRS - Univ Paris Diderot, F-75205 Paris cedex 13, France 7
2 UPMC Univ Paris 06, Atelier de Bioinformatique, F-75005, Paris cedex 05, France 8
3 Génétique et Evolution, UMR 7138 Systématique, Adaptation, Evolution, CNRS-UPMC 9
Univ Paris 06-MNHN-IRD, F-75005, Paris cedex 05, France 10
4 Génétique moléculaire des levures, UMR 5240 Microbiologie, Adaptation et Pathogénie, 11
Université de Lyon, Lyon, F-69003, France; Université Lyon 1, Lyon, F-69003, France; 12
CNRS, Villeurbanne, F-69622, France; INSA de Lyon, Villeurbanne, F-69621, France 13
5 UPMC Univ Paris 06, UFR 927 Sciences De la Vie, F-75005, Paris cedex 05, France 14
15
16
Genetics: Published Articles Ahead of Print, published on July 6, 2009 as 10.1534/genetics.109.104364
2
* Corresponding author: Pierre Louis Blaiseau 1
Ingéniérie des Protéines et Contrôle Métabolique, UMR 7592 Institut Jacques Monod, CNRS 2
- Univ Paris Diderot, 15 rue Hélène Brion, 75205 Paris cedex 13 France 3
E-mail: [email protected] 4
Tel: (33) 1 44 27 47 41 and (33) 1 57 27 80 30; Fax: (33) 1 44 27 57 16 5
6
Running title: Iron regulation in K. lactis 7
Keywords: Iron homeostasis, Kluyveromyces lactis, iron-responsive transcription factor, Aft-8
type regulator, electrophoretic mobility shift assays. 9
10
3
ABSTRACT 1
Iron homeostasis in fungi is regulated at the transcriptional level by two different 2
mechanisms. It is mediated by a conserved GATA-type repressor in most fungi except in the 3
yeast Saccharomyces cerevisiae where it is controlled by the transcription activators Aft1 and 4
Aft2. These activators are encoded by the paralogous genes, AFT1 and AFT2, which result 5
from the whole genome duplication. Here, we explore regulation of iron homeostasis in the 6
yeast Kluyveromyces lactis that diverged from S. cerevisiae before this event. We identify an 7
ortholog of AFT1/AFT2, designated KlAFT, whose deletion leads to the inability to grow 8
under iron limitation. We show with quantitative real-time PCR analysis that KlAft activates 9
the transcription of all homologs of the Aft1-target genes involved in the iron transport at the 10
cell surface in response to iron limitation. However, homologs of Aft2-specific target genes 11
encoding intracellular iron transporters are regulated neither by KlAft nor by iron. Both 12
bioinformatic and DNA binding and transcription analyses demonstrate that KlAft activates 13
iron-responsive gene expression through the PuCACCC Aft-type sequence. Thus, K. lactis is 14
the first documented species with a positive iron-transcriptional control mediated by only one 15
copy of the Aft-type regulator. This indicates that this function was acquired before the whole 16
genome duplication and was then diversified into two regulators in S. cerevisiae. 17
18
19
20
4
INTRODUCTION 1
Iron is an essential nutrient. However, despite its abundance in the earth’s crust, iron 2
assimilation poses two significant challenges for most organisms. First, the bioavailability of 3
iron is extremely low in aerobic environments because it is mostly present as highly insoluble 4
ferric hydroxides. Second, iron accumulation may be cytotoxic (HALLIWELL and GUTTERIDGE 5
1984). Therefore, organisms have developed tightly regulated systems for the acquisition and 6
utilization of iron (HENTZE et al. 2004). In fungi, two opposite modes of iron-dependent 7
regulation of transcription have been described. The first is mediated by a Zn-finger GATA-8
type factor that functions by repressing the transcription of genes involved in iron assimilation 9
under iron-replete conditions (VOISARD et al. 1993). This negative regulatory mechanism of 10
iron homeostasis is conserved in most fungi (HAAS et al. 2008). The second iron-regulatory 11
pathway has only been characterized in the yeast Saccharomyces cerevisiae. It is mediated by 12
two transcription factors, Aft1 and Aft2, which activate gene expression under iron limitation 13
(YAMAGUCHI-IWAI et al. 1995; BLAISEAU et al. 2001; RUTHERFORD et al. 2001). 14
15
Aft1 and Aft2 are encoded by the AFT1/AFT2 paralogous genes, which arose from a single 16
ancestral gene after the whole-genome duplication (WGD) event (WOLFE and SHIELDS 1997; 17
KELLIS et al. 2004). Aft1 and Aft2 have overlapping but not redundant functions (BLAISEAU 18
et al. 2001; RUTHERFORD et al. 2001; RUTHERFORD et al. 2003; COUREL et al. 2005). Strains 19
with single deletions for either AFT1 or AFT2 exhibit clear phenotypic differences: the 20
aft2Δ strain displays no mutant phenotype whereas the aft1Δ strain grows poorly in low-iron 21
conditions. However, consistent with the functional similarity of Aft1 and Aft2, the double 22
aft1Δaft2Δ mutant is more sensitive to iron deprivation than a single aft1Δ mutant (BLAISEAU 23
et al. 2001; RUTHERFORD et al. 2001). Aft1 activates the transcription of all the genes 24
involved in iron acquisition at the cell surface. These include genes that are involved in both 25
5
the reductive and siderophore-mediated high affinity iron transport systems, such as FET3, 1
FTR1, ATX1, CCC2, FRE1-2 and ARN1-4, FIT1-3, FRE3, respectively (PHILPOTT and 2
PROTCHENKO 2008). In addition to genes involved in iron uptake, Aft1 activates the 3
transcription of genes involved in metabolic adaptation to conditions of low iron. Such genes 4
include CTH1 and CTH2, which encode conserved mRNA-binding protein involved in the 5
post-transcription control of iron homeostasis (SHAKOURY-ELIZEH et al. 2004; PUIG et al. 6
2005; PUIG et al. 2008) and HMX1, which encodes a yeast heme oxygenase (PROTCHENKO 7
and PHILPOTT 2003; SHAKOURY-ELIZEH et al. 2004). Aft2 controls the transcription of some 8
of the Aft1 target genes (e.g., FTR1, CTH1, CTH2) (COUREL et al. 2005; PUIG et al. 2005; 9
PUIG et al. 2008) but it also activates the transcription of genes that are not Aft1 target genes, 10
including SMF3 and MRS4, involved in vacuolar and mitochondrial iron transport, 11
respectively (RUTHERFORD et al. 2003; COUREL et al. 2005). Promoter sequence examination 12
and in vivo DNA binding analyses showed that Aft1 and Aft2 recognize similar, but distinct, 13
DNA sequences: TGCACCC and PuCACCC, respectively (COUREL et al. 2005). These 14
various observations suggest that Aft1 and Aft2 have become specialized during evolution. 15
16
S. cerevisiae serves as a paradigm for iron transport and regulation in hemiascomycete yeasts 17
(KOSMAN 2003). However, the mechanisms underlying the regulation of the high-affinity iron 18
uptake systems appear to be strikingly different between S. cerevisiae and other 19
hemiascomycete species such as the human yeast pathogen Candida albicans or the 20
methylotrophic yeast Pichia pastoris. The iron-responsive regulator characterized in these 21
other yeasts is the GATA-type transcription repressor conserved in most fungi (LAN et al. 22
2004; MIELE et al. 2007). To elucidate the mechanisms regulating iron homeostasis in 23
hemiascomycetes, we investigated iron regulation in Kluyveromyces lactis. K. lactis is 24
Crabtree-negative and displays a respiratory lifestyle, which is more typical of eukaryotic 25
6
organisms than the S. cerevisiae fermentative lifestyle (MERICO et al. 2007). K. lactis is 1
phylogenetically close to S. cerevisiae but a major difference between K. lactis and S. 2
cerevisiae is that the former diverged before the WGD and the later diverged after this event 3
(FITZPATRICK et al. 2006). Consequently, K. lactis exhibits much less overall gene 4
redundancy facilitating genetic studies of metabolic and regulatory pathways and allowing a 5
better understanding of their evolution. In this study, we identify the KlAFT gene as the K. 6
lactis ortholog of AFT1/AFT2. A combination of bioinformatics and experimental analyses 7
allowed us to demonstrate that KlAft regulates iron-regulated genes through an Aft-type 8
DNA-binding sequence. This indicates that the Aft iron-regulatory function was acquired 9
before the WGD. Moreover, consistent with specialization of Aft1 and Aft2 after the WGD, 10
we show that KlAft regulates the homologs of Aft1-target genes but not those of genes only 11
regulated by Aft2. 12
13
7
MATERIALS AND METHODS 1
K. lactis and S. cerevisiae strains: The K. lactis strains used in this study were PM6-7A 2
(MATa uraA1-1 adeT-600), MW270-7B (MATa uraA1-1 leu2 metA1-1), MLK53 (MATa 3
uraA1-1 adeT-600 Klaft::KanMX4) and MLK131 (MATa uraA1-1 adeT-600 lac4::URA3). 4
The MLK53 Klaft∆ mutant was constructed by one-step gene deletion, integrating kanMX4 at 5
the KlAFT locus in PM6-7A, as described in (WACH 1996). The primers used for the 6
Klaft∆::kanMX4 cassette were P5’ KlAFT 5’-GATTATTCTCGCTCTCTGTA-3’, P5’L 7
KlAFT 5’-8
GGGATCCGTCGACCTGCAGCGTACGCATTCAGAAAATAGACAAAATCTC-3’, P3’L 9
KlAFT 5’-10
AAACGAGCTCGAATTCATCGATGATATGAGATTTTAGCAGTGGAAAAAAGTCT-3’ 11
and P3’ KlAFT 5’-CAAAGTCATTCCCGTTCTGT-3’. Kanamycin-resistant clones were 12
selected on YPD plates containing 200 µg/ml of G418. Among 52 G418R transformants, only 13
one (MLK43) displayed a typical aft∆ mutant phenotype, a growth deficiency on YPD plates 14
supplemented with BPS (200 μM). PCR and meiotic analyses confirmed that the KlAFT gene 15
was disrupted by kanMX4 in MLK43 and that the aft∆ phenotype was genetically linked to 16
G418 resistance. The MLK131 lac4∆ mutant was constructed as described in (NEIL et al. 17
2007) The S. cerevisiae strains used in this study were BY4742 (MATα; his3Δ1; leu2Δ0; 18
lys2Δ0; ura3Δ0), Y14438 (MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; aft1::kanMX4) and 19
SCMC01 (MATα; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; aft1::kanMX4; aft2::kanMX4). 20
21
Plasmids construction: Genomic DNA from K. lactis strain MW270-7B was used as 22
template for PCR to amplify a 4400-bp fragment containing KlAFT with both upstream and 23
downstream sequences. Genomic DNA from S. cerevisiae strain BY4742 was used as 24
template for PCR to amplify 3757-bp and 2860-bp fragments containing AFT1 and AFT2 with 25
8
both upstream and downstream sequences, respectively. The KlAFT, AFT1 and AFT2 PCR 1
products were first inserted into the vector pCR-2.1-TOPO® (Invitrogen) and then transferred 2
into the low-copy number K. lactis vector pCXJ18 (CHEN 1996), yielding the pCXJ18-KlAFT, 3
pCXJ18-AFT1 and pCXJ18-AFT2 plasmids. The PCR products were also ligated into the S. 4
cerevisiae/K. lactis shuttle vector pCXJ22 (CHEN 1996), yielding the pCXJ22-KlAFT, 5
pCXJ22-AFT1 and pCXJ22-AFT2 plasmids. The plasmid pCXJ22-KlAFT-13Myc carrying 13 6
tandem copies of the c-myc-encoded Myc epitope at the very carboxy terminus of the KlAft 7
protein was constructed by in vivo recombination in S. cerevisiae. The Myc epitope tag for 8
KlAFT was amplified from the template pFA6a-13Myc-HIS3MX6 as described previously 9
(LONGTINE et al. 1998). The primers used were: 5’-10
CCACAAATGCTTTGGGATGAACCTCACGGCTTTTTTCAACGGATCCCCGGGTTAA11
TTAA-3’and 5’-12
GTGTTGTACTAAATGAAAGACTTTTTTCCACTGCTAAAATCGAATTCGAGCTCGTT13
TAAAC-3’. The KLAFT-13Myc PCR product was transformed into SCMC01 aft1∆aft2∆ 14
mutant containing pCXJ22-KlAFT. The plasmids contained in His+ transformants were 15
rescued in Escherichia coli for molecular analysis. The plasmid pXW3, a K. lactis URA3 16
multicopy vector carrying the promoter-less lacZ operon (CHEN et al. 1992), was used to 17
construct a transcriptional KLLA0E14652g-lacZ fusion. The 590-bp fragment of 18
KLLA0E14652g (from –585 to +5 with respect to the start codon) was amplified by PCR and 19
inserted between the BamHI and HindIII sites of pXW3, yielding pKLLA0E14652g-WT-20
lacZ. The primers used were 5’-CTCAAGCTTGCTTGAATCCTAGTTCATC-3’ and 5’-21
TCGAAGCTTTCCATTGATTAATGTTCTAGATCG-3’. pKLLA0E14652g-WT-lacZ was 22
used as a PCR template for the QuikChange Mutagenesis Kit (Stratagene) according to the 23
manufacturer instructions. The primers used were 5’-24
GTTTAAAGTGGGAAGTCTTGATCTGGGAAGTTTTTATCCGTTGTC-3’ and its 25
9
complement for M1 substitutions, 5’-1
GAAATCGTCATTTCACAGGGAACTATTTTGCTTTTTTTCTAGTAG-3’ and its 2
complement for M3 substitutions, 5’-3
GGAAGATTGGAAAAAAAAAATGACACCCAAGAAATATTTGGTTAC-3’ and its 4
complement for M4 substitutions. Nucleotides that deviate from the KLLA0E14652g 5
sequence are underlined. All PCR-generated sequences were confirmed by DNA sequencing. 6
All yeast transformations were performed by the lithium acetate method. 7
8
Media, growth conditions and plate assays: Rich YPD medium contained 1% yeast extract, 9
2% peptone and 2% glucose. Minimal YNB medium contained 0.67% yeast nitrogen base 10
(Difco), 0.5% ammonium sulfate, 2% glucose and the required amino acids and bases. Iron- 11
and copper-limiting yeast nitrogen base medium (Bio101 minus iron and copper) contained 12
0.17% yeast nitrogen base without iron and copper (Bio101#4027-122), 0.5% ammonium 13
sulfate, 2% glucose and the required amino acids and bases. For RNA isolation, the wild-type 14
and Klaft∆ mutant cells were pre-grown at 30°C in Bio101 minus iron and copper 15
supplemented with 1 µM ferric ammonium sulfate. For comparison of KlAFT and Klaft∆, the 16
wild-type and Klaft∆ mutant cultures were then grown in Bio101 minus iron and copper. For 17
comparison KlAFT with and without Fe, the wild-type cultures were then grown in Bio101 18
minus iron and copper with (+Fe) or without (-Fe) 100 µM ferric ammonium sulfate. All the 19
cultures were grown exponentially to an OD600 = 1 and total RNA was then extracted. For ß-20
galactosidase assays, cultures were grown in Bio101 minus iron and copper with (+Fe) or 21
without (-Fe) 100 µM ferric ammonium sulfate. For plate assays, cells were pre-grown on 22
YPD medium supplemented with 100 μM ferric ammonium sulfate. Cells were suspended in 23
water at 2 x 106 cells/ml, plated in serial 10-fold dilutions onto YPD agar plates, with or 24
without 200 μM BPS and incubated at 30°C for 3-4 days prior to imaging. 25
10
1
RNA isolation and quantitative real-time PCR analysis: For analyses of mRNA 2
abundance, total RNA was extracted by the hot phenol method and reverse transcribed using 3
AMV Reverse Transcriptase (Roche Applied Science) following the manufacter’s 4
instructions. The amounts of resulting cDNA were evaluated by quantitative real-time PCR 5
with the Mx3000PTM system (Stratagene) and normalized to the K. lactis KLLA0D05357g 6
gene, a putative ortholog of the S. cerevisiae ACT1 gene. Values reported represent the 7
average of two independent experiments, each performed in duplicate. Standard deviations 8
were lower than 10%. Primers for quantitative real-time PCR (see Supporting Information 9
Table S1) were designed with the Primer3 program. 10
11
β-galactosidase assay: β-Galactosidase was assayed using o-nitrophenyl-D-12
galactopyranoside as described previously (GUARENTE 1983). 13
14
Electrophoretic mobility shift assays: The cell extracts were prepared as described 15
previously (KURAS et al. 1996) with the following modifications. Strains were grown at 30°C 16
in 250 ml of minimal YNB medium supplemented to meet the auxotrophic requirements, until 17
the optical density at 600 nm was ≈ 1.5. The following procedures were performed at 4°C 18
with ice-cold buffer. Cells were harvested by centrifugation, and the cell pellet was washed 19
with 15 ml of extraction buffer (100 mM Tris pH 87.5, 1 mM EDTA, 10 mM MgCl2, 10% 20
glycerol, 10 mM ß-mercaptoethanol and 1 mM PMSF). After centrifugation, the cell pellet 21
was resuspended in 1 ml of extraction buffer and the cells were disrupted in a “One Shot” 22
Cell Disrupter (Constant Systems LDT, Daventry, UK) at a pressure of 2 kbars. The resulting 23
lysate was cleared by a first centrifugation for 30 min at 12 000g and a second for 20 min at 24
13 000g. Aliquots were stored at -80°C. For the mobility shift assays, the binding reaction 25
11
mixtures (20 µ1) contained 25 mM HEPES pH 7.6, 60 mM KCI, 7.5% glycerol, 0.1 mM 1
EDTA, 1 mM dithiothreitol, 5 mM MgCl2. 20-40 µg of cell-extract and 0.5-0.75µg of 2
poly(dIdC)2 were used. DNA probes were prepared by PCR amplification. For 3
KLLA0E14652g, the primers 5’-TTCATCATCTAGTAGTGAAG-3’ and 5’-4
CTTGCATTAAGATCTAACC-3’ were used to produce a DNA fragment containing the –5
530 ACACCC sequence and the primers 5’-AAAGGGCCTTTCGTG-3’ and 5’-6
ACTTTAAACTTAATAGTAACC-3’ to produce a DNA fragment containing the –288 7
ACACCC sequence. For KLLA0E26400g, the primers 5’-AAAGGGCCTTTCGTG-3’ and 8
5’-ACTTTAAACTTAATAGTAACC-3’ were used to produce a fragment containing the –9
571 ACACCC sequence. Probes were P-end-labeled with [γ-32P] dATP. Approximately 10 10
000 c.p.m. of probe (1.7 ng) was used in each binding mixture. Samples were incubated for 11
30 min at room temperature. Competition assays were performed by adding double-stranded 12
DNA fragments made with unlabeled oligonucleotides to the reaction mixtures for another 30 13
min. To test the specificity of the complex formation with respect to the ACACCC element, 14
competition experiments were performed with 5, 10 and 15 pmoles of oligonucleotides 15
centered on wild type ACACCC (WT) or mutated ACAGGG (M) sequences. The 16
oligonucleotides 5’-AAAAATGACACCCAAGAAAT-3’ and 5’-17
TCATTTCACACCCAACTATT-3’ were used for the –530 ACACCC and –288 ACACCC 18
sequences of KLLA0E14652g, respectively and the oligonucleotide 5’-19
GTAAAAAGAAATCGTCATTTCACACCCAACTATTTTGCTTTTTTTCTAGTAG-3’ for 20
the –571 ACACCC sequence of KLLA0E26400g. To test the specificity of the complex 21
formation with respect to the nucleotide-type at the position +1 of the –571 ACACCC 22
sequence of KLLA0E26400g, competition experiments were performed with 25 pmoles of 23
the oligonucleotide 5’-24
GTAAAAAGAAATCGTCATTTCXCACCCAACTATTTTGCTTTTTTTCTAGTAG-3’ 25
12
with X = A, C, G or T. Samples were loaded onto a 5% polyacrylamide gel in 0.25 X TBE 1
(22 mM Tris pH 8.3, 22 mM boric acid, 0.6 mM EDTA) and electrophoresed at 15 V/cm at 2
7°C. Gels were pre-electrophoresed for 1 h at 7.5 V/cm at 7°C. Gels were run for 4 h, dried 3
and autoradiographed for 16 h with an intensifying screen. 4
5
Genome and protein sequences, CDS annotations, detection of orthology and homology: 6
Data on Saccharomyces cerevisiae (strain S288C) and Kluyveromyces lactis (strain CLIB210; 7
release 93) were taken from the Saccharomyces Genome Database (SGD; 8
www.yeastgenome.org) and the Genolevures Consortium site (SHERMAN et al. 2009) 9
respectively. Protein sequences were downloaded from http://www.genolevures.org for 10
Candida glabrata, Debaryomyces hansenii, Kluyveromyces thermotolerans, Saccharomyces 11
kluyveri, Yarrowia lipolytica and Zygosaccharomyces rouxii, http://wolfe.gen.tcd.ie/ygob/ for 12
Saccharomyces bayanus, Saccharomyces castellii, Kluyveromyces waltii and Kluyveromyces 13
polysporus, http://www.ebi.ac.uk/integr8 for Ustilago maydis, Neurospora crassa, 14
Schizosaccharomyces pombe, Ashbya gossypii, http://www.candidagenome.org for Candida 15
albicans, http://genome.jgi-psf.org for Pichia stipitis, and http://www.broad.mit.edu for 16
Aspergillus nidulans. 17
To find orthologs of Aft1/Aft2 iron-regulated genes in the K. lactis genome, we used the 18
Yeast Gene Order Browser (YGOB ; BYRNE and WOLFE 2006) which considers both 19
sequence similarity and genomic context (synteny). This also allowed identification of S. 20
cerevisiae ohnologs, corresponding to paralogous genes that remained as duplicates after the 21
whole genome duplication. When no K. lactis ortholog was assigned to a S. cerevisiae gene in 22
YGOB, we chose, when existing, the reciprocal best hit using BLASTP (ALTSCHUL et al. 23
1997). Reciprocal BLASTP searches between all S. cerevisiae and K. lactis proteins were 24
perfomed using the scoring matrix BLOSUM62, a lower coverage limit of 50% and a score 25
13
cutoff of 50 bits. When orthologous relations were too difficult to infer, for the siderophore 1
transporter- and metalloreductase-encoding gene families, the K. lactis homologs were 2
selected using BLASTP with an arbitrary E value cutoff of 1e-50. The other genomes were 3
searched for homologs of Aft-type activator encoding genes by similarity with the Pfam (FINN 4
et al. 2008) transcription factor Aft domain (PF08731), using the Conserved Domain 5
Database (MARCHLER-BAUER et al. 2009) and RPS-BLAST, a variant of the Psi-BLAST 6
algorithm (ALTSCHUL et al. 1997), with 1e-6 as the E value cutoff. We also searched for iron-7
responsive Zn-finger GATA-type transcription repressor homologs in the genomes. All 8
known repressors have three conserved domains that distinguishes them from all other fungal 9
GATA-factors: two zinc fingers separated by a conserved intervening cysteine-rich region 10
(HAAS 2003). We used previous alignments of each of the three conserved domains (LAN et 11
al. 2004) to build Position-Specific Scoring Matrices (PSSM) with the MEME program 12
(BAILEY and ELKAN 1994). The PSSM obtained for the 28 amino acid residues of the 13
cysteine-rich domain was the most specific of the repressor family (data not shown) and it 14
was used with the MAST program (BAILEY and GRIBSKOV 1998) and 1e-6 as the E-value 15
cutoff to identify the proteins with the corresponding motif in proteomes. 16
17
Identification and enrichment of regulatory patterns: The 23 homologs of the Aft1 and 18
Aft2-regulated S. cerevisiae genes identified in the K.lactis genome were considered as a 19
regulon, possibly regulated by KlAft. We analyzed the sequences between coordinates –1 and 20
–800, upstream from the start of the CDS of the 23 K. lactis genes. We used two different 21
approaches to find elements in this set of sequences. First, the oligo-analysis (words) pattern 22
discovery program (VAN HELDEN et al. 1998), from the Regulatory Sequence Analysis Tools 23
(RSAT) website, was used to detect over-represented oligonucleotides within our set of 24
sequences. All regions upstream from K. lactis CDS, allowing overlap with upstream CDS, 25
14
were used as the background model. The significance of over-representation of an 1
oligonucleotide was based on the observed frequency in the sequences of the background 2
model, our sequence set size and a binomial formula. This program was used for words of 3
between six and eight nucleotides. Second, the MEME program (BAILEY and ELKAN 1994) 4
was used to find highly conserved elements in our set of sequences. This program was used 5
with the anr model allowing zero or multiple occurrences of an element per sequence. In this 6
program, the statistical significance of an element is based on its log likelihood ratio, its width 7
and number of occurrences, the background nucleotide frequencies and the size of the training 8
set. Here, the background model used was the letter frequencies in the set itself. For each 9
identified element, the number of genes in the K.lactis genome, with at least one occurrence 10
of this element in the upstream sequence of its promoter, was computed using regular 11
expressions in a Python script. 12
13
15
RESULTS 1
The K. lactis genome contains an ortholog of S.cerevisiae AFT1/AFT2: We searched the 2
K. lactis genome for orthologs of genes coding for known transcriptional regulators of iron 3
homeostasis. We were unable to identify a gene encoding a GATA-type iron transcription 4
repressor in K. lactis by searching for the conserved domain of this repressor family (see 5
Materials and Methods). However, analysis of the K. lactis genome with Yeast Gene Order 6
Browser (BYRNE and WOLFE 2005) revealed one region on chromosome D that contains the 7
KlAFT gene (ORF KLLA0D03256g), an ortholog of AFT1 and AFT2. KlAft, the predicted 8
product of KlAFT, is very similar in sequence to Aft1 (70% identity) and Aft2 (58% identity) 9
between residues 86 and 325, gaps excluded (Figure 1 and File S1.fst). This homologous 10
region includes the Aft1 and Aft2 N-terminal DNA binding domains and the Cys-Asp-Cys 11
element that confers iron sensitivity (YAMAGUCHI-IWAI et al. 1995; RUTHERFORD et al. 12
2001). This region contains two other conserved Cys residues, which have been suggested in 13
recent sequences comparison studies to participate in a zinc finger domain with two 14
conserved His residues (Figure 1 and (BABU et al. 2006)). Interestingly, KlAft and Aft1, but 15
not Aft2, have additional segments of 72 and 49 aa, respectively, in the region between these 16
two conserved Cys. The N-terminal region of KlAft contains also two conserved leucine 17
residues found in a nuclear export signal (NES)-like sequence. These residues have been 18
demonstrated to be critical for the iron-dependent export of Aft1 from the nucleus to the 19
cytoplasm (YAMAGUCHI-IWAI et al. 2002). The C-terminal end sequences of KlAft and Aft1 20
contain a glutamine-rich region (57.8% of residues 723-767 in KlAft and 34.1% of residues 21
617-657 in Aft1 are Gln). This glutamine-rich region is not present in Aft2, this protein being 22
shorter (416 amino acids) than Aft1 or KlAft (690 and 823 amino acids, respectively). The 23
high degree of identity of KlAft with Aft1/Aft2 in the N-terminal region, notably the 24
16
conservation of the Cys-Asp-Cys and NES-like motifs, led us to test the possibility that KlAft 1
is an iron transcription regulator. 2
3
The KlaftΔ deletion mutant is unable to grow under low-iron conditions: To determine 4
wether KlAft plays a role in iron homeostasis, we deleted the KlAFT gene from the PM6-7A 5
K. lactis wild-type strain and compared the growth of this mutant to that of the isogenic wild-6
type strain grown under low-iron conditions. Growth was completely abolished in the KlaftΔ 7
mutant under iron-deficient conditions (Figure 2A). The growth of the KlaftΔ mutant was also 8
compared with the growth of the S. cerevisiae strains with either a single deletion of AFT1, or 9
the double deletion of both AFT1 and AFT2. The aft1Δaft2Δ strain exhibits a more severe 10
mutant phenotype than the aft1Δ strain under low-iron conditions (BLAISEAU et al. 2001; 11
RUTHERFORD et al. 2001). The KlaftΔ mutant phenotype is similar to that of the 12
aft1Δaft2Δ mutant (Figure 2A). These findings showed that KlAft is essential for the growth 13
of K. lactis under low-iron conditions. Next, we performed cross-complementation 14
experiments. The S. cerevisiae aft1Δaft2Δ mutant was transformed with plasmids containing 15
either the KlAFT, AFT1 or AFT2 gene (Figure 2B, upper panel). While the growth defect of 16
the aft1Δaft2Δ strain under low-iron conditions was totally reversed with a plasmid 17
containing AFT1, it was only partially suppressed with plasmids containing either KlAFT or 18
AFT2. The same results were obtained with a single aft1Δ deleted mutant (data not shown). In 19
contrast with the results described above in S. cerevisiae, the growth defect of the K. lactis 20
KlaftΔ mutant was totally suppressed with a plasmid containing AFT1 (Figure 2B, lower 21
panel). 22
23
KlAft activates the transcription of iron-regulated genes: We performed transcription 24
analyses to determine whether KlAft functions as a regulator of genes involved in iron 25
17
homeostasis. We identified a set of 23 K. lactis homologs of the S. cerevisiae genes involved 1
in iron homeostasis and regulated by Aft1 and Aft2 (RUTHERFORD et al. 2003; SHAKOURY-2
ELIZEH et al. 2004; COUREL et al. 2005). A putative K. lactis ortholog was assigned to most S. 3
cerevisiae Aft1/Aft2 iron-regulated genes. For the genes belonging to the iron-siderophore 4
transporter (ARN) or the metalloreductase (FRE) families, we could not identify orthologous 5
genes but did identify homologous genes (Table 1). For each of the 23 K. lactis genes 6
selected, we used quantitative real-time PCR to assay their mRNAs in wild-type and the 7
KlaftΔ mutant strains, both grown in a low-iron medium. We also compared mRNA levels in 8
the wild-type strain grown in an iron-depleted or iron-replete media. The mRNAs of 15 of the 9
23 genes analyzed were 2.3 to 70-fold more abundant in the wild-type strain than in the 10
KlaftΔ mutant; for 12 of these genes the mRNAs were 2 to 27-fold more abundant in iron-11
depleted than in iron-replete conditions (Figure 3A). As shown in Figure 3B, the transcription 12
profiles obtained for the two comparisons were strongly correlated. The group of 12 genes 13
activated under iron-deprivation conditions in a KlAft-dependent manner includes all 14
homologs of the S. cerevisiae genes encoding iron transporters at the plasma membrane and 15
the ortholog of the post-transcription iron regulators CTH1 and CTH2. In contrast, there was 16
no difference or little difference (< 2-fold change) in mRNA abundance between the wild-17
type strain and the KlaftΔ mutant or between iron-depleted and iron-repleted conditions for 18
eight genes. This group of genes included all the orthologs of genes involved in the vacuolar 19
or mitochondrial iron transport (SMF3, FET5, FTH1, and MRS4), orthologs of ATX1, FIT1 20
and two homologs of the FRE metalloreductase-encoding genes. These results indicated that 21
KlAft activates the transcription of homologs of genes specifically involved in cell surface 22
iron transport under iron limitation, but not the transcription of genes encoding intracellular 23
iron transporters. 24
25
18
Sequence analyses were performed to identify potential regulatory sequences between the 1
start codon and 800 bp upstream from the 23 analyzed genes. Two consensus sequences, 2
PuCACCC and Pu[TA]GCCAAG, were identified independently by different approaches 3
using the MEME (BAILEY and ELKAN 1994) and the RSAT (VAN HELDEN et al. 1998) 4
programs. The PuCACCC sequence corresponds to the core Aft1/Aft2 DNA-binding 5
sequence (YAMAGUCHI-IWAI et al. 1996; RUTHERFORD et al. 2003; COUREL et al. 2005). The 6
Pu[TA]GCCAAG sequence was predicted by the MYBS program (TSAI et al. 2007) to be a 7
DNA-binding site for PacC/Rim101, a C2H2 Zn finger transcription factor involved in the 8
alkaline pH response in fungi (PENALVA and ARST 2004; PENALVA et al. 2008). Of the 23 9
genes that were analyzed, 18 contained at least one copy of the PuCACCC sequence and 13 10
contained at least one copy of the Pu[TA]GCCAAG sequence in either orientation (Table 2 11
and Table S2). Thus, PuCACCC was present in 78% and Pu[TA]GCCAAG was present in 12
57% of the 5’ regions upstream from the analyzed genes; in comparison, these sequences are 13
found in 22.5% and 9.8%, respectively, of the 5’ regions upstream from all open reading 14
frames in the K. lactis genome. We then examined the PuCACCC and Pu[TA]GCCAAG 15
sequences in the 5’ regions upstream from the 23 analyzed genes and the effect of KlAft on 16
their transcription. The frequency of the PuCACCC Aft-type sequence among the 15 genes 17
exhibiting higher mRNAs levels (at least 2-fold) in the wild-type than in KlaftΔ mutant strain 18
was 2.5 times higher (p-value<0.05; Chi-squared test) than that among the eight other genes. 19
The ACACCC sequence was 1.8-times more frequent than the GCACCC sequence (Table 2). 20
The putative PacC/Rim101 DNA-binding sequence Pu[TA]GCCAAG was 4.8 times more 21
frequent (p-value<0.02; Chi squared test) among the 15 KlAft-regulated genes than among 22
the eight other genes (Table 2). These results suggest that the PuCACCC or/and 23
Pu[TA]GCCAAG sequences are potential iron-regulatory elements. 24
25
19
The ACACCC sequence is an iron-responsive activating sequence in K. lactis: To test this 1
prediction, we performed transcription analysis with a fusion of the 5’ upstream region of 2
KLLA0E14652g with the lacZ reporter gene. KLLA0E14652g is a homolog of the 3
siderophore transporter family genes. It exhibits the highest sensitivity to iron, its mRNAs 4
being 27-fold more abundant in iron-depleted than iron-replete conditions (Figure 3A). There 5
are two ACACCC sequences of the Aft-type (positions –530 and –288) and two TGCCAAG 6
sequences of the PacC/Rim101-type (positions –252 and –237) within the 800 bp 5’-region of 7
KLLA0E14652g (Table 2 and Table S2). To test if the ACACCC and/or TGCCAAG 8
sequences are involved the iron-regulated expression of KLLA0E14652g, we constructed 9
plasmids containing KLLA0E14652-lacZ fusions from the wild-type and mutated versions of 10
these sequences (Figure 4A). The plasmids were used to transform the MLK131 strain 11
isogenic to PM6-A and inactivated for the K. lactis LAC4 gene coding for ß-galactosidase. ß-12
galactosidase activity was 30-fold higher with pWT-lacZ in iron-depleted than iron-replete 13
conditions indicating that it retains fully iron-regulated expression (Figure 4B). In pM1-lacZ 14
the two PacC/Rim101-type TGCCAAG sequences were changed to the TGGGAAG 15
sequences; ß-galactosidase activity was strongly induced from this plasmid in iron-depleted 16
conditions. Interestingly, the mutations introduced conferred a slight increase of ß-17
galactosidase activity (1.5-fold) under iron-limitation conditions (Figure 4B). Unlike pM1-18
lacZ, no ß-galactosidase activity was detected with pM2-lacZ in which the two Aft-type 19
ACACCC sequences were changed to the sequence ACAGGG. These results indicate that 20
ACACCC but not TGGGAAG sequences are required for activation of KLLA0E14652g 21
transcription in our experimental conditions. To study the role of the –530 ACACCC and –22
288 ACACCC sequences, each was individually changed to the sequence ACAGGG yielding 23
the plasmids pM3-lacZ and pM4-lacZ, respectively (Figure 4A): under iron-limitation 24
conditions pM4-lacZ expressed no ß-galactosidase activity whereas expression from pM3-25
20
lacZ was only 1.7-fold lower (Figure 4B). These results indicate that the –288 ACACCC 1
sequence is required for activation of KLLA0E14652g transcription in iron-depleted 2
conditions. The decreased ß-galactosidase activity observed with a mutated version of the –3
530 ACACCC sequence suggests that this sequence may amplify the induction mediated by 4
the –288 ACACCC sequence. The identification of ACACCC as an iron-responsive 5
activating sequence and the conservation of the N-terminal DNA-binding domain in KlAft 6
and Aft1/Aft2, strongly suggest that KlAft binds to the PuCACCC sequence found as a 7
consensus in the 5’ region upstream from KlAft and iron-regulated genes. 8
9
KlAft binds to the PuCACCC Aft-type sequence: We performed electrophoretic mobility 10
shift assays with probes corresponding to promoter regions of KlAft-regulated genes and 11
extracts from KlaftΔ cells expressing the KlAft-13Myc fusion protein which was shown to be 12
fully functional (Figure S1). First, we used a probe with the sequence of nucleotides –382 to –13
251 of KLLA0E14652g and containing the –288 ACACCC sequence required for its 14
transcription (see above). Mobility shift assays showed a prominent complex of high mobility 15
and a second complex of lower electrophoretic mobility (Figure 5A). To test the specificity of 16
the complex formation, we performed competition assays with addition of unlabeled 17
oligomers centered on wild type ACACCC (WT) or mutated ACAGGG (M) sequences. The 18
high mobility complex was specifically displaced by the addition of excess wild-type but not 19
mutated oligomers. Therefore, the high mobility complex was formed by specific interactions 20
with the ACACCC sequence. To determine whether KlAft-13Myc is present in the complexes 21
formed, we performed assays with addition of anti-Myc antibodies (Figure 5A). Addition of 22
anti-Myc antibodies overshifted of the higher mobility complex, in a dose-dependent manner, 23
but had no effect on the lower mobility complex. This demonstrates that KlAft-13Myc is a 24
component of the higher mobility complex formed with the –288 ACACCC sequence. Next, 25
21
electrophoretic mobility shift assays were performed with a probe corresponding to 1
nucleotides –570 to –429 of KLLA0E14652g and containing the –530 ACACCC sequence 2
involved but not required for activation of transcription under conditions of iron limitation 3
(Figure 4A). Mobility shift assays showed three mobility complexes with high intensity 4
signals (Figure 5B). The highest mobility complex was the only complex to be specifically 5
displaced by the addition of excess wild-type ACACCC oligomers. Addition of anti-Myc 6
antibodies overshifted the higher mobility complex indicating that it contained KlAft-13Myc. 7
This shows that KlAft binds to the –530 ACACCC sequence of the KLLA0E14652g 8
promoter. These results indicate that KlAft is able to bind to both ACACCC sequences 9
identified in the KLLA0E14652g promoter. 10
11
The Aft-type consensus identified in the KlAft-regulated promoters is the PuCACCC element 12
including the ACACCC and GCACCC sequences (Table 2 and Table S2). This suggests that 13
KlAft-DNA binding activity exhibits a preference for a purine rather than a pyrimidine 14
nucleotide upstream from the CACCC core sequence. To test this prediction and to 15
characterize the DNA binding specificity of KlAft, we performed further DNA binding 16
experiments with a facilitating promoter region. We chose the 5’ region of KLLA0E26400g, 17
the K. lactis ortholog of the canonical Aft1-regulated FET3 gene. KLLA0E26400g is clearly 18
regulated by KlAft and iron (Figure 3A) and contains one single copy of the Aft-type 19
consensus element: the –571 ACACCC sequence (Table 2). First, we demonstrated that KlAft 20
binds to the –571 ACACCC sequence by using a probe corresponding to nucleotides –660 to 21
–502 of KLLA0E26400g. A prominent complex of high mobility was specifically displaced 22
by the addition of excess wild-type oligomers (Figure 6A). Moreover, addition of anti-Myc 23
antibodies resulted in a dose-dependent supershift of the high mobility complex indicating the 24
presence of KlAft in the complex formed with the –571 ACACCC sequence. Then, we 25
22
performed competition assays with unlabeled oligomers differing by one nucleotide (A, C, G 1
or T) at position +1 of the –571 ACACCC sequence. Addition of oligonucleotides with either 2
A or G decreased the complex formation more strongly than those with either C or T (Figure 3
6B). This demonstrates, in perfect agreement with bioinformatic analysis, that KlAft binds 4
preferentially to a purine rather than a pyrimidine nucleotide upstream from the core CACCC 5
sequence. 6
7
23
DISCUSSION 1
In this study, we show that KlAft, the ortholog of Aft1/Aft2, mediates iron homeostasis 2
regulation in K. lactis: (1) deletion of the KlAFT gene abolished the ability of cells to grow 3
under iron-limitation conditions; (2) most homologs of Aft1-regulated genes were up-4
regulated in iron-depleted conditions and markedly down-regulated in the Klaft∆ mutant cells. 5
In addition, complementation experiments indicated that the iron-dependent growth 6
deficiency of the Klaft∆ mutant is totally suppressed by AFT1. Interestingly, the reciprocal 7
complementation experiment showed that KlAFT is not able to reverse totally the growth 8
deficiency phenotype of the S. cerevisiae aft1∆aft2∆ mutant. Several non-exclusives 9
hypothesis may explain this partial complementation by KlAFT. This may be due to some 10
defaults in expression/stability/localization of the KlAft protein in S. cerevisiae. Alternatively, 11
this may reflect some differences in the mechanisms of transcriptional activation of KlAft and 12
Aft1. Indeed, these mechanisms could have evolved since K. lactis and S. cerevisiae diverged 13
from their common ancestor. 14
15
The genes encoding homologs of the S. cerevisiae reductive and non-reductive high-affinity 16
iron-transporters at the plasma membrane (FET3, FTR1, ARN1-4) are strongly regulated by 17
both KlAft and iron (by at least 4.6-fold and 3.5-fold, respectively). All of them contain 18
between one and three copies of the PuCACCC Aft-type element in their 5’ upstream region. 19
Moreover, gel shift experiments demonstrate that KlAft binds to the Aft-type elements in the 20
promoter regions of KLLA0E14652g and KLLA0E26400g that belong to this group of genes. 21
These results indicate that KlAft regulates directly the homologs of high affinity iron-22
transporter genes in K. lactis. In contrast, KLLA0E14564g, the ortholog of the FET4 gene 23
that encodes a low affinity iron and zinc transporter, is clearly regulated by KlAft (by 13-fold) 24
but weakly by iron (by a 2-fold). Moreover, its promoter does not contain any copies of the 25
24
PuCACCC sequence. These data suggest that KLLA0E14564g is not a direct target gene of 1
KlAft and that it may be regulated by other transcription factors associated with the KlAft-2
mediated pathway. In S. cerevisiae, FET4 is controlled by zinc- and oxygen-responsive 3
regulators in addition to Aft1 (JENSEN and CULOTTA 2002; WATERS and EIDE 2002). 4
Similarly, in K. lactis, KLLA0E14564g might be under the control of numerous 5
environmental regulatory pathways which might be disturbed by KlAFT deletion. 6
7
Previous computer analyses identified the TGCACCC sequence as consensus in the 8
promoters of the Aft1-regulated genes (RUTHERFORD et al. 2003; COUREL et al. 2005). DNA-9
binding experiments and transcription analyses with promoter variants of FET3 confirmed 10
that Aft1 is specific for the TGCACCC sequence (YAMAGUCHI-IWAI et al. 1996; COUREL et 11
al. 2005). Here in K. lactis, we identify the more simple PuCACCC sequence as a consensus 12
in KlAft-regulated promoters. Only four of 28 sequences identified (14%) conformed entirely 13
to the TGCACCC sequence; the other sequences differ by one or two nucleotides at the 5’ 14
end of the TGCACCC sequence (Table S2). Moreover, electrophoretic mobility shift assays 15
confirm that KlAft does not exhibit preferential DNA binding to the TGCACCC sequence: 16
KlAft is able to bind to the GACACCC and CACACCC sequences of the KLLA0E14652g 17
promoter, and to the TACACCC sequence of KLLA0E26400g promoter. These bioinformatic 18
and experimental analyses reveal that homolog genes are controlled by KlAft and Aft1 19
through similar but distinct iron-regulatory sequences. Interestingly, Aft2 has the same 20
PuCACCC DNA binding sequence as KlAft (COUREL et al. 2005). The presence of the 21
PuCACCC sequence in both the K. lactis and S. cerevisiae lineages suggests that it 22
corresponds to an ancestral Aft-type element. This presumably subsequently evolved toward 23
the more precise TGCACCC sequence in the case of the Aft1-regulatory function. 24
25
25
In addition to the PuCACCC sequence, computer analysis identified the sequence 1
Pu[TA]GCCAAG as another consensus in the promoters of K. lactis iron-regulated genes. 2
This sequence contains the core DNA binding site GCCAAG of the PacC/Rim101 pH-3
responsive transcription factor conserved in fungi (PENALVA and ARST 2004; PENALVA et al. 4
2008). PacC/Rim101 has been shown to be required in alkaline environments for the 5
activation of genes involved in iron homeostasis (LAMB et al. 2001; BENSEN et al. 2004; 6
EISENDLE et al. 2004). In A. nidulans and C. albicans, PacC/Rim101 directly activates the 7
alkaline pH-induced genes whereas in S. cerevisiae Rim101 acts in an indirect manner 8
through repression of the transcription repressor Nrg1 (PENALVA and ARST 2004). Here, in K. 9
lactis, the presence of the GCCAAG sequence in the 5’ region of most iron-regulated genes 10
and its absence from that of KLLA0F18524g, the K. lactis ortholog of NRG1 (data not 11
shown), suggests that the ortholog of Rim101 (BUSSEREAU et al. 2006) may directly drive the 12
expression of most iron-regulated genes. Further investigations are needed to confirm this 13
prediction. 14
15
In most fungi, the iron-regulatory pathway is under the control of a conserved Zn-finger 16
GATA-type transcription repressor (HAAS et al. 2008). Because it is widespread in fungi, this 17
negative mode of iron-dependent regulation of transcription may be an ancestral mechanism 18
of regulation. In the yeast K. lactis that diverged before the WGD, we did not find any 19
ortholog of the iron-responsive GATA-binding transcription repressor (see Materials and 20
Methods and Figure 7). On the contrary, we show that, in K. lactis, iron homeostasis is 21
regulated by KlAft, a transcription activator ortholog of the S. cerevisiae Aft1/Aft2 iron-22
responsive activators. This indicates that the Aft-type iron-regulatory function was acquired 23
before the WGD event. We identified also an ortholog of Aft1/Aft2 in all pre-WGD 24
hemiascomycetes analyzed, except in the species Yarowia lipolytica (Figure 7). In contrast, 25
26
and as described previously (HAAS et al. 2008), we could not identify any ortholog of Aft1/2 1
in fungi other than hemiascomycetes. Thus, these results indicate that a transition from 2
negative to positive regulation occurred in the hemiascomycete lineage before the WGD. To 3
date, only the negative or the positive regulatory mechanism, but not both, has been identified 4
in any one species, raising the question of the existence of species with both regulatory 5
systems. Interestingly, the C. albicans genome contains an ortholog of AFT1/AFT2 in 6
addition to the SFU1 gene encoding the iron repressor (HAAS 2003; LAN et al. 2004). We also 7
identified an ortholog of AFT1/AFT2 in Debaryomyces hansenii and Pichia stipitis species 8
belonging to the same clade as C. albicans (Figure 7). Characterization of one of these 9
AFT1/AFT2 orthologous genes as an iron-responsive transcription activator would be 10
valuable to improve our understanding of the iron-regulatory mechanisms in fungi. 11
12
S. cerevisiae, a yeast that underwent the whole genome duplication, has two well-studied Aft-13
type iron-responsive transcriptional activator genes: AFT1 and AFT2. They correspond to a 14
duplicated gene pair that was created by the WGD. All post-WGD yeasts analyzed also have 15
two members of the Aft family, except Kluyveromyces polysporus, the most divergent from S. 16
cerevisiae (Figure 7). We showed in a previous study that Aft1 and Aft2 display functional 17
specialization in the control of iron homeostasis in S. cerevisiae. Aft1 specifically activates 18
the transcription of genes involved in cell-surface uptake systems, whereas Aft2 but not Aft1 19
directly activates the transcription of genes involved in vacuolar and mitochondrial iron 20
transport, such as SMF3 and MRS4 (COUREL et al. 2005). The results of transcription analysis 21
reported herein indicate that KlAft activates the transcription of most homologs of the Aft1-22
target genes but not those of specifically Aft2-target genes encoding intracellular iron 23
transporters. Additionally, SMF3 and MRS4 orthologs did not have the PuCACCC sequence 24
in their promoter regions. These results suggest that KlAft and Aft1 kept the ancestral 25
27
function of the Aft-type regulator family, which was the regulation of genes specifically 1
involved in cell surface iron transport. Thus, and in line with the theory proposed by Ohno 2
(OHNO 1970), it is tempting to speculate that the WGD event, by creating two copies of the 3
AFT1/AFT2 genes, favored the emergence of a new iron-regulatory function in the Aft-type 4
regulator family. This new function, encoded by AFT2, appears to be specialized in the iron-5
dependent transcriptional control of genes involved in vacuolar and mitochondrial transport. 6
7
We thank Eduardo Rocha, Ingrid Lafontaine, Guillaume Achaz, Pierre Netter and Micheline 8
Wésolowski-Louvel for generous help and suggestions. This work was supported by a grant 9
from the Groupement des Entreprises Françaises dans la lutte contre le Cancer. 10
11
28
REFERENCES 1
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, Z. ZHANG et al., 1997 Gapped 2 BLAST and PSI-BLAST: a new generation of protein database search programs. 3 Nucleic Acids Res 25: 3389-3402. 4
BABU, M. M., L. M. IYER, S. BALAJI and L. ARAVIND, 2006 The natural history of the 5 WRKY-GCM1 zinc fingers and the relationship between transcription factors and 6 transposons. Nucleic Acids Res 34: 6505-6520. 7
BAILEY, T. L., and C. ELKAN, 1994 Fitting a mixture model by expectation maximization to 8 discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 28-36. 9
BAILEY, T. L., and M. GRIBSKOV, 1998 Combining evidence using p-values: application to 10 sequence homology searches. Bioinformatics 14: 48-54. 11
BENSEN, E. S., S. J. MARTIN, M. LI, J. BERMAN and D. A. DAVIS, 2004 Transcriptional 12 profiling in Candida albicans reveals new adaptive responses to extracellular pH and 13 functions for Rim101p. Mol Microbiol 54: 1335-1351. 14
BLAISEAU, P. L., E. LESUISSE and J. M. CAMADRO, 2001 Aft2p, a novel iron-regulated 15 transcription activator that modulates, with Aft1p, intracellular iron use and resistance 16 to oxidative stress in yeast. J Biol Chem 276: 34221-34226. 17
BUSSEREAU, F., S. CASAREGOLA, J. F. LAFAY and M. BOLOTIN-FUKUHARA, 2006 The 18 Kluyveromyces lactis repertoire of transcriptional regulators. FEMS Yeast Res 6: 325-19 335. 20
BYRNE, K. P., and K. H. WOLFE, 2005 The Yeast Gene Order Browser: combining curated 21 homology and syntenic context reveals gene fate in polyploid species. Genome Res 22 15: 1456-1461. 23
BYRNE, K. P., and K. H. WOLFE, 2006 Visualizing syntenic relationships among the 24 hemiascomycetes with the Yeast Gene Order Browser. Nucleic Acids Res 34: D452-25 455. 26
CHEN, X. J., 1996 Low- and high-copy-number shuttle vectors for replication in the budding 27 yeast Kluyveromyces lactis. Gene 172: 131-136. 28
CHEN, X. J., M. WESOLOWSKI-LOUVEL and H. FUKUHARA, 1992 Glucose transport in the 29 yeast Kluyveromyces lactis. II. Transcriptional regulation of the glucose transporter 30 gene RAG1. Mol Gen Genet 233: 97-105. 31
COUREL, M., S. LALLET, J. M. CAMADRO and P. L. BLAISEAU, 2005 Direct activation of genes 32 involved in intracellular iron use by the yeast iron-responsive transcription factor Aft2 33 without its paralog Aft1. Mol Cell Biol 25: 6760-6771. 34
DE CASTRO, E., C. J. SIGRIST, A. GATTIKER, V. BULLIARD, P. S. LANGENDIJK-GENEVAUX et 35 al., 2006 ScanProsite: detection of PROSITE signature matches and ProRule-36 associated functional and structural residues in proteins. Nucleic Acids Res 34: W362-37 365. 38
EISENDLE, M., H. OBEREGGER, R. BUTTINGER, P. ILLMER and H. HAAS, 2004 Biosynthesis 39 and uptake of siderophores is controlled by the PacC-mediated ambient-pH 40 Regulatory system in Aspergillus nidulans. Eukaryot Cell 3: 561-563. 41
FINN, R. D., J. TATE, J. MISTRY, P. C. COGGILL, S. J. SAMMUT et al., 2008 The Pfam protein 42 families database. Nucleic Acids Res 36: D281-288. 43
FITZPATRICK, D. A., M. E. LOGUE, J. E. STAJICH and G. BUTLER, 2006 A fungal phylogeny 44 based on 42 complete genomes derived from supertree and combined gene analysis. 45 BMC Evol Biol 6: 99. 46
GALTIER, N., M. GOUY and C. GAUTIER, 1996 SEAVIEW and PHYLO_WIN: two graphic 47 tools for sequence alignment and molecular phylogeny. Comput Appl Biosci 12: 543-48 548. 49
29
GORDON, J. L., K. P. BYRNE and K. H. WOLFE, 2009 Additions, losses, and rearrangements on 1 the evolutionary route from a reconstructed ancestor to the modern Saccharomyces 2 cerevisiae genome. PLoS Genet 5: e1000485. 3
GUARENTE, L., 1983 Yeast promoters and lacZ fusions designed to study expression of cloned 4 genes in yeast. Methods Enzymol 101: 181-191. 5
HAAS, H., 2003 Molecular genetics of fungal siderophore biosynthesis and uptake: the role of 6 siderophores in iron uptake and storage. Appl Microbiol Biotechnol 62: 316-330. 7
HAAS, H., M. EISENDLE and B. G. TURGEON, 2008 Siderophores in fungal physiology and 8 virulence. Annu Rev Phytopathol 46: 149-187. 9
HALLIWELL, B., and J. M. GUTTERIDGE, 1984 Oxygen toxicity, oxygen radicals, transition 10 metals and disease. Biochem J 219: 1-14. 11
HENTZE, M. W., M. U. MUCKENTHALER and N. C. ANDREWS, 2004 Balancing acts: molecular 12 control of mammalian iron metabolism. Cell 117: 285-297. 13
JENSEN, L. T., and V. C. CULOTTA, 2002 Regulation of Saccharomyces cerevisiae FET4 by 14 oxygen and iron. J Mol Biol 318: 251-260. 15
KELLIS, M., B. W. BIRREN and E. S. LANDER, 2004 Proof and evolutionary analysis of ancient 16 genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624. 17
KOSMAN, D. J., 2003 Molecular mechanisms of iron uptake in fungi. Mol Microbiol 47: 1185-18 1197. 19
KURAS, L., H. CHEREST, Y. SURDIN-KERJAN and D. THOMAS, 1996 A heteromeric complex 20 containing the centromere binding factor 1 and two basic leucine zipper factors, Met4 21 and Met28, mediates the transcription activation of yeast sulfur metabolism. Embo J 22 15: 2519-2529. 23
LAMB, T. M., W. XU, A. DIAMOND and A. P. MITCHELL, 2001 Alkaline response genes of 24 Saccharomyces cerevisiae and their relationship to the RIM101 pathway. J Biol Chem 25 276: 1850-1856. 26
LAN, C. Y., G. RODARTE, L. A. MURILLO, T. JONES, R. W. DAVIS et al., 2004 Regulatory 27 networks affected by iron availability in Candida albicans. Mol Microbiol 53: 1451-28 1469. 29
LARKIN, M. A., G. BLACKSHIELDS, N. P. BROWN, R. CHENNA, P. A. MCGETTIGAN et al., 2007 30 Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948. 31
LONGTINE, M. S., A. MCKENZIE, 3RD, D. J. DEMARINI, N. G. SHAH, A. WACH et al., 1998 32 Additional modules for versatile and economical PCR-based gene deletion and 33 modification in Saccharomyces cerevisiae. Yeast 14: 953-961. 34
MARCHLER-BAUER, A., J. B. ANDERSON, F. CHITSAZ, M. K. DERBYSHIRE, C. DEWEESE-35 SCOTT et al., 2009 CDD: specific functional annotation with the Conserved Domain 36 Database. Nucleic Acids Res 37: D205-210. 37
MERICO, A., P. SULO, J. PISKUR and C. COMPAGNO, 2007 Fermentative lifestyle in yeasts 38 belonging to the Saccharomyces complex. Febs J 274: 976-989. 39
MIELE, R., D. BARRA and M. C. BONACCORSI DI PATTI, 2007 A GATA-type transcription 40 factor regulates expression of the high-affinity iron uptake system in the 41 methylotrophic yeast Pichia pastoris. Arch Biochem Biophys 465: 172-179. 42
NEIL, H., M. HNATOVA, M. WESOLOWSKI-LOUVEL, A. RYCOVSKA and M. LEMAIRE, 2007 43 Sck1 activator coordinates glucose transport and glycolysis and is controlled by Rag8 44 casein kinase I in Kluyveromyces lactis. Mol Microbiol 63: 1537-1548. 45
OHNO, S., 1970 Evolution by gene duplication. 46 PENALVA, M. A., and H. N. ARST, JR., 2004 Recent advances in the characterization of 47
ambient pH regulation of gene expression in filamentous fungi and yeasts. Annu Rev 48 Microbiol 58: 425-451. 49
30
PENALVA, M. A., J. TILBURN, E. BIGNELL and H. N. ARST, JR., 2008 Ambient pH gene 1 regulation in fungi: making connections. Trends Microbiol. 2
PHILPOTT, C. C., and O. PROTCHENKO, 2008 Response to iron deprivation in Saccharomyces 3 cerevisiae. Eukaryot Cell 7: 20-27. 4
PROTCHENKO, O., and C. C. PHILPOTT, 2003 Regulation of intracellular heme levels by 5 HMX1, a homologue of heme oxygenase, in Saccharomyces cerevisiae. J Biol Chem 6 278: 36582-36587. 7
PUIG, S., E. ASKELAND and D. J. THIELE, 2005 Coordinated remodeling of cellular 8 metabolism during iron deficiency through targeted mRNA degradation. Cell 120: 99-9 110. 10
PUIG, S., S. V. VERGARA and D. J. THIELE, 2008 Cooperation of two mRNA-binding proteins 11 drives metabolic adaptation to iron deficiency. Cell Metab 7: 555-564. 12
RUTHERFORD, J. C., S. JARON, E. RAY, P. O. BROWN and D. R. WINGE, 2001 A second iron-13 regulatory system in yeast independent of Aft1p. Proc Natl Acad Sci U S A 98: 14 14322-14327. 15
RUTHERFORD, J. C., S. JARON and D. R. WINGE, 2003 Aft1p and Aft2p mediate iron-16 responsive gene expression in yeast through related promoter elements. J Biol Chem 17 278: 27636-27643. 18
SHAKOURY-ELIZEH, M., J. TIEDEMAN, J. RASHFORD, T. FEREA, J. DEMETER et al., 2004 19 Transcriptional remodeling in response to iron deprivation in Saccharomyces 20 cerevisiae. Mol Biol Cell 15: 1233-1243. 21
SHERMAN, D. J., T. MARTIN, M. NIKOLSKI, C. CAYLA, J. L. SOUCIET et al., 2009 Genolevures: 22 protein families and synteny among complete hemiascomycetous yeast proteomes and 23 genomes. Nucleic Acids Res 37: D550-554. 24
SOUCIET, J. L., B. DUJON, C. GAILLARDIN, M. JOHNSTON, P. V. BARET et al., 2009 25 Comparative genomics of protoploid Saccharomycetaceae. Genome Res. 26
TSAI, H. K., M. Y. CHOU, C. H. SHIH, G. T. HUANG, T. H. CHANG et al., 2007 MYBS: a 27 comprehensive web server for mining transcription factor binding sites in yeast. 28 Nucleic Acids Res 35: W221-226. 29
VAN HELDEN, J., B. ANDRE and J. COLLADO-VIDES, 1998 Extracting regulatory sites from the 30 upstream region of yeast genes by computational analysis of oligonucleotide 31 frequencies. J Mol Biol 281: 827-842. 32
VOISARD, C., J. WANG, J. L. MCEVOY, P. XU and S. A. LEONG, 1993 urbs1, a gene regulating 33 siderophore biosynthesis in Ustilago maydis, encodes a protein similar to the erythroid 34 transcription factor GATA-1. Mol Cell Biol 13: 7091-7100. 35
WACH, A., 1996 PCR-synthesis of marker cassettes with long flanking homology regions for 36 gene disruptions in S. cerevisiae. Yeast 12: 259-265. 37
WATERS, B. M., and D. J. EIDE, 2002 Combinatorial control of yeast FET4 gene expression by 38 iron, zinc, and oxygen. J Biol Chem 277: 33749-33757. 39
WOLFE, K. H., and D. C. SHIELDS, 1997 Molecular evidence for an ancient duplication of the 40 entire yeast genome. Nature 387: 708-713. 41
YAMAGUCHI-IWAI, Y., A. DANCIS and R. D. KLAUSNER, 1995 AFT1: a mediator of iron 42 regulated transcriptional control in Saccharomyces cerevisiae. Embo J 14: 1231-1239. 43
YAMAGUCHI-IWAI, Y., R. STEARMAN, A. DANCIS and R. D. KLAUSNER, 1996 Iron-regulated 44 DNA binding by the AFT1 protein controls the iron regulon in yeast. Embo J 15: 45 3377-3384. 46
YAMAGUCHI-IWAI, Y., R. UETA, A. FUKUNAKA and R. SASAKI, 2002 Subcellular localization 47 of Aft1 transcription factor responds to iron status in Saccharomyces cerevisiae. J Biol 48 Chem 277: 18914-18918. 49
50 51
31
TABLE 1. Putative K. lactis orthologs or homologs of the S. cerevisiae Aft1/Aft2 iron-1
regulated genes. The first three columns contain the S. cerevisiae gene names, ORF names 2
and the associated protein functions according to the S. cerevisiae Genome Database. Aft2-3
specific target genes (COUREL et al. 2005) are marked with an asterisk. When possible, for 4
each of the S. cerevisiae genes, a putative ortholog in the K.lactis genome is inferred (see 5
Materials and Methods and File S1.fst). If the putative ortholog is syntenic with the S. 6
cerevisiae gene, there is an (s) alongside the K.lactis gene name. For each 7
S.cerevisiae/K.lactis gene pair, the identity and similarity between the two genes are 8
indicated. They were computed with the High Scoring Pairs of BLASTP, gaps excluded. 9
Paralog pairs are indicated one above the other with their names separated by a dashed line. 10
11
32
TABLE 2. Aft- and PacC/Rim101-type elements identified in the upstream sequences of 1
the K. lactis orthologs or homologs of S. cerevisiae Aft1/Aft2 iron-regulated genes. Two 2
elements were identified using the MEME element finder in sequences located between the 3
coordinates –1 and –800 upstream from the start of the CDS of the 23 K. lactis genes listed in 4
Table 1. The K. lactis genes are sorted as indicated in Figure 3A and the gene name of the 5
putative S.cerevisiae ortholog or homolog is indicated in brackets. The group of genes for 6
which the mRNA is at least twice as abundant in the wild type as in the Klaft∆ mutant is 7
underlined by a dashed line. The second and third columns contain the numbers of Aft-type 8
ACACCC and GCACCC sequences found in the 5’ upstream region of each gene. The fourth 9
column contains the number of Pu[TA]GCCAAG PacC/Rim101-type sequence (Table S2). 10
11 12
33
FIGURE LEGENDS 1
FIGURE 1. Sequence comparison of KlAft, Aft1 and Aft2. The amino-acid sequences of KlAft, Aft1 and 2
Aft2 were aligned using the Clustalw program (LARKIN et al. 2007). This alignment was then manually 3
refined with the Seaview program (GALTIER et al. 1996). The NES-like sequence of Aft1 (YAMAGUCHI-4
IWAI et al. 2002) and the homologous regions in Aft2 and KlAft are boxed. The conserved leucine 5
critical for nuclear export of Aft1 are in bold. Conserved cysteine and histidine residues predicted to 6
participate in a Zn-finger domain (BABU et al. 2006) are in bold. Conserved cysteines involved in the 7
CDC element are in bold and this element is boxed. Glutamine-rich region were detected with the 8
ScanProsite tool (DE CASTRO et al. 2006). 9
10
FIGURE 2. Growth of the Klaft∆, aft1Δ and aft1Δaft2Δ mutants under low-iron conditions and cross-11
complementation analysis. (A) K. lactis and S. cerevisiae wild-type, Klaft∆, aft1Δ and aft1Δaft2Δ cells 12
were suspended in water and plated onto rich medium YPD agar plates with BPS (200 μM). (B) The 13
aft1Δaft2Δ cells harboring the S. cerevisiae low-copy number plasmid pCXJ22 (empty vector) or 14
derived plasmids pCXJ22-AFT1, pCXJ22-KlAFT, pCXJ22-AFT2 (upper panel) and the Klaft∆ cells 15
harboring the K. lactis low-copy number plasmid pCXJ18 (empty vector) or derived plasmids pCXJ18-16
KlAFT, pCXJ18-AFT1, or pCXJ18-AFT2 (lower panel) were suspended in water and plated onto rich 17
medium YPD agar plates with BPS (200 μM). 18
19
FIGURE 3. KlAft- and iron-dependent expression of K. lactis homologs of S. cerevisiae Aft1/Aft2 iron-20
regulated genes. For the KlAFT/Klaft∆ comparison, the wild-type and Klaft∆ mutant cultures were 21
grown in Bio101 minus iron and copper. For the KlAFT (–Fe/+Fe) comparison, wild-type cultures were 22
grown in Bio101 minus iron and copper with (+Fe) or without (-Fe) ferric ammonium sulfate (100 µM). 23
Expression of K. lactis genes was assessed by quantitative real-time PCR. The values shown are the 24
KlAFT/Klaft∆ and the KlAFT (–Fe/+Fe) ratios calculated as the means of two independent 25
experiments, each performed in duplicate. Standard deviations were lower than 10 %. (A) The first 26
column contains the corresponding S. cerevisiae homolog gene or family name and the associated 27
protein function. The second column contains the ORF name for the K. lactis genes analyzed. The 28
group of genes for which the mRNA is a least twice as abundant in the wild type as in the Klaft∆ 29
mutant is underlined with a dashed line. (B) –Fe/+Fe in the wild type strain (y-axis on a logarithmic 30
34
scale) is plotted against KlAFT/Klaft∆ (x-axis on a logarithmic scale). The transcription profiles 1
obtained for the two comparisons were correlated with a Spearman’s rho coefficient = 0.83 and p-2
value <0.0001. 3
4
FIGURE 4. Mutational analysis of the KLLA0E14652g promoter. (A) pKLLA0E14652g-WT-lacZ 5
contains the upstream region of the KLLA0E14652g gene (from –585 to +5 with respect to the start 6
codon) inserted into the promoter-less lacZ operon of pXW3 (CHEN et al. 1992). pKLLA0E14652g-M1-7
lacZ is identical to pKLLA0E14652g-WT-lacZ, except that the dinucleotide CC in the TGCCAAG 8
PacC/Rim101-type sequences at positions –249/–248 and –234/–233 (full gray boxes) were replaced 9
by the dinucleotide GG (hollow gray boxes). pKLLA0E14652g-M2-lacZ is identical to 10
pKLLA0E14652g-WT-lacZ, except that the trinucleotide CCC in the ACACCC Aft-type sequences at 11
positions –527/–525 and –285/–283 (full black boxes) were replaced by the trinucleotide GGG (hollow 12
black boxes). pKLLA0E14652g-M3-lacZ and pKLLA0E14652g-M4-lacZ contain only one CCC to GGG 13
substitution in the Aft-type sequences at positions –527/–525 and –285/–283, respectively. (B) The 14
MLK131 lac4∆ mutant harboring the pKLLA0E14652g-WT-lacZ, pKLLA0E14652g-M1-lacZ, 15
pKLLA0E14652g-M2-lacZ, pKLLA0E14652g-M3-lacZ and pKLLA0E14652g-M4-lacZ (WT, M1, M2, M3 16
and M4, respectively) was grown exponentially in iron-depleted (-Fe) or iron-replete (+Fe) medium 17
(see Materials and Methods). Errors bars represent the standard deviations (less than 10%) for 18
assays performed with at least three independent transformants. 19
20
FIGURE 5. DNA binding of KlAft to the –288 ACACCC (A) and –530 ACACCC (B) sequences of the 21
KLLA0E14652g promoter. Gel-shift assays were carried out with extracts from Klaft∆ (MLK53) cells 22
expressing the KlAft-13Myc fusion protein. The radiolabeled probes used to perform the gel-shift 23
assays correspond to the sequences of positions –382 to –251 and -570 to –429 of KLLA0E14652g (A 24
and B, respectively). The arrow indicates the KlAft-containing complexes. Competitive assays were 25
performed with excess oligonucleotide centered on the wild-type (competitor WT) ACACCC sequence 26
(lanes 2, 3 and 4) and mutant (competitor M) ACAGGG sequence (lanes 5, 6 and 7). Where indicated, 27
1 µl and 2 µl of a monoclonal antibody raised against the Myc epitope was added (lanes 8 and 9, 28
respectively). 29
30
35
FIGURE 6. DNA binding of KlAft to the –571 ACACCC sequence of the KLLA0E26400g promoter (A) 1
and effect of the +1 nucleotide of the ACACCC sequence on the formation of the KlAft-DNA complex 2
(B). Gel-shift assays were carried out with extracts from Klaft∆ (MLK53) cells expressing the KlAft-3
13Myc fusion protein. The radiolabeled probes used to perform the gel-shift assays correspond to the 4
sequences of positions –660 to –502 of KLLA0E26400g. The arrow indicates the KlAft-containing 5
complexes. (A) Competitive assays were performed with oligonucleotides centered on the wild-type 6
(competitor WT) ACACCC sequence (lanes 2, 3 and 4) and mutant (competitor M) ACAGGG 7
sequence (lanes 5, 6 and 7). Where indicated, 1 µl and 2 µl of a monoclonal antibody raised against 8
the Myc epitope was added, (lanes 8 and 9, respectively). (B) Competition assay with various 9
unlabeled oligonucleotides centered on the wild-type –571 ACACCC. Nucleotides that deviate from 10
the KLLA0E14652g promoter sequence are underlined. 11
12
FIGURE 7. Evolution of iron-responsive transcription regulators in ascomycota. The species tree of 13
ascomycota with the basidiomycota Ustilago maydis as the outgroup was adapted from FITZPATRICK et 14
al. 2006 and SOUCIET et al. 2009. The S. castellii location in the tree (outgroup to the clade containing 15
C. glabrata and S.cerevisiae) is supported by shared rearrangement data (GORDON et al. 2009). The 16
whole genome duplication is indicated with a red oval. The numbers in the table correspond to the 17
number of homologs of iron-responsive transcription regulator-encoding genes per genome. The Aft-18
type proteins were identified by similarity with the Pfam transcription factor Aft domain (PF08731) and 19
the GATA-type proteins were identified with the cysteine-rich domain of the Zn-finger GATA-type 20
repressors (see Material and Methods and Files S2.fst and S3.fst). 21
22
23
24
25 26
AS. cerevisiae gene and function K. lactis gene KlAFT/Klaft∆ KlAFT
-Fe/+FeARN Siderophore transporter KLLA0E14652g 70 27FRE Metalloreductase KLLA0E14542g 31 20FET4 Low affinity iron permease KLLA0E14564g 13 2ARN Siderophore transporter KLLA0C19272g 11 5.8CTH mRNA degradation KLLA0D16610g 10 4.1ARN Siderophore transporter KLLA0A10439g 8.3 6.2FRE Metalloreductase KLLA0E05852g 7.5 4.6HMX1 Heme oxygenase KLLA0D12474g 7.1 1.3FET3 Multicopper oxidase KLLA0F26400g 6.7 7.6ARN Siderophore transporter KLLA0C00220g 5.8 3.5FIT3 Cell wall protein KLLA0A04323g 4.9 3.5FTR1 High affinity iron permease KLLA0A03025g 4.6 5.5FIT2 Cell wall protein KLLA0C05016g 3.2 3.1FRE Metalloreductase KLLA0F00616g 2.4 1.2CCC2 Copper transport KLLA0F07447g 2.3 1.5FIT1 Cell wall protein KLLA0C04994g 1.8 1.7FRE Metalloreductase KLLA0C04906g 1.7 0.7SMF3 Vacuolar iron transport KLLA0F17391g 1.7 0.9FET5 Vacuolar multicopper oxidase KLLA0D05489g 1.7 1.7MRS Mitochondrial iron transport KLLA0E15532g 1.4 1.4FTH1 Vacuolar permease KLLA0F28039g 1.3 1.1FRE Metalloreductase KLLA0F04950g 1 0.5ATX1 Copper chaperone KLLA0C02673g 0.9 1
B
1
10
5
2
2030
KlAFT-Fe/+Fe
1 10 5 2 20 50 80KlAFT/Klaft∆
S. cerevisiae gene ORF Function K. lactis gene % id / % sim FET3 YMR058W Multicopper oxidase KLLA0F26400gS 66/82 FTR1 YER145C High affinity iron permease KLLA0A03025g 68/85 CCC2 YDR270W Copper transport into vesicles KLLA0F07447g 52/71 ATX1 YNL259C Copper chaperone KLLA0C02673gS 71/82 FIT1 YDR534C KLLA0C04994g 36/56 FIT2 YOR382W KLLA0C05016g 57/71 FIT3 YOR383C
Cell wall proteins KLLA0A04323g 53/72
FET4 YMR319C Low-affinity iron permease KLLA0E14564g 55/70 CTH1 YDR151C 43/59 CTH2 YLR136C
mRNA degradation KLLA0D16610gS 49/64
HMX1 YLR205C Heme oxygenase KLLA0D12474gS 61/78 FET5 YFL041W Vacuolar multicopper oxidase KLLA0D05489gS 60/77 FTH1 YBR207W Vacuolar permease KLLA0F28039g 66/79 SMF3 * YLR034C Vacuolar iron transporter KLLA0F17391gS 73/85 MRS3 YJL133W 71/85 MRS4 * YKR052C
Mitochondrial iron transport KLLA0E15532gS 71/86
ARN1 YHL040C ARN2/TAF1 YHL047C ARN3/SIT1 YEL065W ARN4/ENB1 YOL158C
Siderophore transporters
KLLA0A10439g KLLA0E14652g KLLA0C19272g KLLA0C00220g
51-64/71-80
FRE1 YLR214W FRE2 YKL220C FRE3 YOR381W FRE4 YNR060W FRE5 YOR384W FRE6 YLL051C
Metalloreductases
KLLA0F04950g KLLA0E14542g KLLA0E05852g KLLA0F00616g KLLA0C04906g
28-44/51-63
# Aft-typeK. lactis geneACACCC GCACCC
# Rim101-typePu[TA]GCCAAG
KLLA0E14652Gg (ARN) 2 0 2KLLA0E14542g (FRE) 2 1 2KLLA0E14564g (FET4) 0 0 0KLLA0C19272g (ARN) 1 1 2KLLA0D16610g (CTH) 3 1 2KLLA0A10439g (ARN) 1 1 1KLLA0E05852g (FRE) 1 0 2KLLA0D12474g (HMX1) 2 2 2KLLA0F26400g (FET3) 1 0 1KLLA0C00220g (ARN) 1 1 0KLLA0A04323g (FIT3) 1 0 0KLLA0A03025g (FTR1) 0 2 1KLLA0C05016g (FIT2) 0 1 0KLLA0F00616g (FRE) 3 0 1KLLA0F07447g (CCC2) 0 0 1KLLA0C04994g (FIT1) 0 1 0KLLA0C04906g (FRE) 2 0 0KLLA0F17391g (SMF3) 0 0 1KLLA0D05489g (FET5) 0 1 0KLLA0E15532g (MRS) 0 0 1KLLA0F28039g (FTH1) 0 1 0KLLA0F04950g (FRE) 1 0 0KLLA0C02673g (ATX1) 0 0 0
