Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
1
THESE DE DOCTORAT DE L’UNIVERSITE PIERRE ET MARIE CURIE
Spécialité: IMMUNOLOGIE
(Ecole Doctorale N° 394 : Physiologie et Physiopathologie)
Présentée par: M Olivier Thaunat
Pour obtenir le grade de DOCTEUR de l’UNIVERSITE PIERRE ET MARIE CURIE
NEOGENESE LYMPHOIDE AU COURS DU REJET D’ALLOGREFFE: MECANISMES INITIATEURS, RÔLE PHYSIOPATHOLOGIQUE
ET PISTES THERAPEUTIQUES
Soutenue le 8 Décembre 2008
Devant le jury composé de: M le Professeur Antonino Nicoletti Directeur de thèse M le Docteur Jean-Baptiste Michel Co-directeur de thèse M le Professeur Pierre-André Cazenave Président M le Professeur Yvon Lebranchu Rapporteur M le Professeur Jean-Paul Soulillou Rapporteur M le Professeur Pierre Cochat Examinateur M le Professeur Michel Goldman Examinateur
Université Pierre & Marie Curie – Paris 6 15 rue de l’école de médecine
75270 PARIS CEDEX 06
2
« Rejette l'opinion et tu seras sauvé » Marc-Aurèle
(Pensées pour moi-même)
« Face au réel, ce qu'on croit savoir clairement
offusque ce qu'on devrait savoir » Gaston Bachelard
(La Formation de l’esprit scientifique)
3
Remerciements
Mes remerciements vont d’abord à Myriam, pour son soutien et sa patience
sans faille…
Merci à Tony et à Jean-Bapt. Acceptez ce travail comme un témoignage de
gratitude pour tout ce que vous m’avez appris et plus encore, pour la façon
dont vous l’avez fait.
Merci à Blanche, Liliane et Anne-Christine pour avoir guidé mes premiers pas
au laboratoire et à Stéphanie qui a pris le relais.
Merci à tous les membres (et ex-membres !) de l’équipe 16 de l’UMRS872
aux Cordeliers, ex-U681, ex-U430. Trop nombreux pour être tous cités ici,
vous avez fait le quotidien de ces 4 ans avec ses petits drames et ses
grandes joies. Cette thèse est aussi la vôtre.
Merci à Philippe Lang, Henri Kreis et Emmanuel Morelon, vous qui m’avez
transmis le virus de la Transplantation.
Merci aux membres du jury qui ont accepté de juger ce travail.
4
Résumé L’incapacité à éliminer les antigènes cibles, provoque le passage à la
chronicité de la réponse inflammatoire et transforme cette composante
essentielle de la défense de l’organisme en un processus pathologique
impliqué dans un grand nombre de situations cliniques.
Le présent travail porte sur le rejet d’allogreffe qui a été choisi comme
prototype des pathologies inflammatoires chroniques. Les hypothèses
formulées dans le modèle murin expérimental d’interposition aortique ont été
vérifiées sur des échantillons de tissus provenant de greffons humains
explantés pour un rejet arrivé au stade terminal.
Nous montrons qu’avec le temps, l’infiltrat inflammatoire au sein du tissu cible
s’organise en un tissu lymphoïde ectopique dont la microarchitecture
reproduit celle des organes lymphoïdes secondaires. Ce processus connu
sous le nom de néogenèse lymphoïde i) pourrait être initié par un défaut de
drainage lymphatique provoquant la déconnection du tissu agressé avec les
organes lymphoïdes secondaires et ii) dépend de la récapitulation du
programme biologique mis en place chez l’embryon lors de l’ontogénie des
organes lymphoïdes secondaires (l’organogenèse lymphoïde).
La récapitulation complète du programme aboutit à la formation de centres
germinatifs ectopiques fonctionnels qui sont le siège d’une réponse
immunitaire locale autonome contribuant à la destruction du tissu.
Le développement de stratégies thérapeutiques ciblant la néogenèse
lymphoïde pourrait être une piste pour contrôler l’inflammation chronique. Nos
résultats préliminaires suggèrent i) qu’il est plus difficile de cibler les
effecteurs immunitaires dans le tissu lymphoïde ectopique car ces derniers
sont protégés par le microenvironnement inflammatoire et ii) que cet objectif
pourrait nécessiter l’utilisation de stratégies « composites » associant
immunosuppresseurs classiques et molécules ciblant les processus
impliqués dans la mise en place du tissu lymphoïde ectopique (par exemple
l’angiogenèse).
Mots clés Transplantation, rejet d’allogreffe, inflammation chronique, néogenèse lymphoïde
5
Abstract The persistence of the immuno-inflammatory process turns this critical
component of the body’s natural defenses into a destructive mechanism
involved in a wide range of diseases.
In the present work, allograft rejection epitomized chronic inflammatory
conditions. Hypothesis put forward in the experimental murine aortic
interposition model were further tested on human samples obtained from
grafts explanted for terminal failure.
We observed that the inflammatory infiltrate organizes itself into an ectopic
lymphoid tissue displaying the same microarchitecture as secondary lymphoid
organs. This process, named lymphoid neogenesis, i) might be triggered by a
defective lymphatic drainage of the diseased tissue resulting in its
disconnection from the secondary lymphoid organs, and ii) depends upon the
stepwise recapitulation of the biological pathways recently identified in murine
embryos during the ontogeny of secondary lymphoid organs (lymphoid
organogenesis).
Whenever this recapitulation was complete, it resulted in the development of
fully functional ectopic germinal centers supporting a local autonomous
immune response that participates in tissue destruction.
These results pave the way for innovative therapeutic strategies that would
block lymphoid neogenesis to control chronic inflammation. Our preliminary
findings suggest that i) targeting immune effectors within ectopic lymphoid
tissue could be more difficult because they are protected by the inflammatory
microenvironment, and ii) “composite” strategies associating
immunosuppressive regimen with molecules targeting key processes for the
development of ectopic lymphoid tissues (such as angiogenesis) could be
effective.
Key words Transplantation, allograft rejection, chronic inflammation, lymphoid
neogenesis
6
Table des matières
Résumé .......................................................................................................... 4
Abstract.......................................................................................................... 5
Liste des tables et des figures ..................................................................... 9
Liste alphabétique des abréviations.......................................................... 11
1 Avant Propos.......................................................................................... 13
2 Introduction ............................................................................................ 15
2.1 La réponse inflammatoire..........................................................................15 2.1.1 Définition et généralités ...........................................................................................15 2.1.2 Physiologie de la réponse inflammatoire................................................................16
2.1.2.1 Inducteurs et senseurs de l’inflammation ..........................................................16 2.1.1.1.1 Inducteurs exogènes.................................................................................17 2.1.2.1.2 Inducteurs endogènes..............................................................................18
2.1.1.2 Médiateurs de l’inflammation ...........................................................................21 2.1.1.2.1 Amines vasoactives...................................................................................21 2.1.1.2.2 Peptides vasoactifs ...................................................................................21 2.1.1.2.3 Fragments du complément .......................................................................21 2.1.1.2.4 Médiateurs lipidiques ................................................................................22 2.1.1.2.5 Cytokines pro-inflammatoires ...................................................................23 2.1.1.2.6 Chémokines ...............................................................................................23 2.1.1.2.7 Enzymes protéolytiques............................................................................27 2.1.1.2.8 Remarques ................................................................................................27
2.1.1.3 Dynamique de la réponse inflammatoire aiguë ..............................................27 2.1.1.3.1 Phénomènes locaux initiaux.....................................................................28 2.1.1.3.2 Recrutement des effecteurs cellulaires de l’immunité innée au foyer
inflammatoire .............................................................................................29 2.1.1.3.3 Mise en place secondaire de la réponse immunitaire adaptative ..........35 2.1.1.3.4 Résolution de l’inflammation.....................................................................36
2.1.2 L’inflammation chronique.........................................................................................40 2.1.2.1 Définitions..........................................................................................................40 2.1.2.2 Caractéristiques histologiques définissant l’inflammation chronique............41
2.1.2.2.1 Enrichissement en effecteurs de l’immunité adaptative .........................41 2.1.2.2.2 Organisation spatiale de l’infiltrat inflammatoire : la néogenèse
lymphoïde...................................................................................................41 2.1.2.2.3 Remodelage tissulaire : la fibrogenèse....................................................42 2.1.2.2.4 Remodelages vasculaires.........................................................................44
7
2.1.2.3 Mécanismes induisant la chronicisation de l’inflammation ............................49 2.1.2.3.1 Déficit du tonus anti-inflammatoire...........................................................49 2.1.2.3.2 Persistance du stimulus agressif..............................................................52 2.1.2.3.3 Défaut de résolution de l’inflammation.....................................................53
2.1.2.4 Inflammation chronique : la problématique clinique .......................................56
2.2 Le rejet d’allogreffe en transplantation: un modèle de pathologie
inflammatoire chronique....................................................................................56 2.2.1 La transplantation d’organe : généralités ...............................................................56
2.2.1.1 Bref historique ...................................................................................................56 2.2.1.2 Résultats et limites actuelles............................................................................60
2.2.2 Le rejet d’allogreffe...................................................................................................63 2.2.2.1 Classification clinique des rejets......................................................................63 2.2.2.2 La réponse alloimmune ....................................................................................65
2.2.2.2.1 Phase de sensibilisation ...........................................................................65 2.2.2.2.2 Phase effectrice.........................................................................................78
2.2.2.3 Modélisation du rejet d’allogreffe : l’exemple du modèle d’interposition
aortique ...............................................................................................................80 2.2.2.3.1 Présentation du modèle d’interposition aortique.....................................80 2.2.2.3.2 Etat des connaissances ............................................................................81
2.3 Objectifs du travail de thèse .....................................................................84
3 Résultats................................................................................................. 86
3.1 Le rejet d’allogreffe aortique expérimental intègre les différentes phases
de la réponse alloimmune .........................................................................86
3.2 Néogenèse lymphoïde au cours du rejet d’allogreffe aortique
expérimental : mise en évidence d’une réponse alloimmune locale ....103
3.3 Validation des données expérimentales dans le contexte clinique......111
3.4 Identification des mécanismes induisant la néogenèse lymphoïde.....117 3.4.1 Rôle initiateur potentiel d’un défaut de drainage lymphatique ............................117 3.4.2 Détournement d’un programme génétique embryonnaire par la réponse
inflammatoire chronique ........................................................................................124
3.5 Cibler la réponse immunitaire locale lors des pathologies
inflammatoires chroniques : pistes thérapeutiques ......................................173 3.5.1 Limiter l’infiltration du tissu cible par une stratégie anti-angiogénique ...............173 3.5.2 Le microenvironnement inflammatoire protège les lymphocytes B des centres
germinatifs ectopiques de la déplétion induite par le rituximab ..........................185
8
4 Discussion............................................................................................ 194
4.1 Synthèse de nos principaux résultats ....................................................194
4.2 Gouvernance de la réponse immunitaire locale ....................................196
4.3 Evolution du système immunitaire et néogenèse lymphoïde ...............197
4.4 La néogenèse lymphoïde comme cible thérapeutique pour contrôler
l’inflammation chronique .........................................................................199
5 Conclusions et perspectives............................................................... 203
5.1 Conclusions .............................................................................................203
5.2 Perspectives.............................................................................................204
6 Références bibliographiques.............................................................. 206
9
Liste des tables et des figures Figure 1 Page 17
Classification des principaux inducteurs de l’inflammation
Table 1 Page 24 Nomenclatures des chémokines et de leurs récepteurs
Table 2 Page 26
Classification des chémokines et profil d’expression de leurs récepteurs
Figure 2 Page 28 Dynamique des interactions précoce au cours de la réponse inflammatoire
Table 3 Page 32
Contenu des granules et des vésicules sécrétoires des polynucléaires
neutrophiles
Figure 3 Page 48 Mécanismes impliqués dans la lymphangiogenèse
Table 4 Page 51 Liste des gènes dont l’invalidation ou la mutation s’accompagne d’un état
inflammatoire Figure 4 Page 53
Interaction entre le système immunitaire et les tumeurs Figure 5 Page 55 Paramètres régulant la taille de l’infiltrat inflammatoire Figure 6 Page 59
Bref historique illustré de la transplantation d’organe Figure 7 Page 61 Evolution de la balance entre l’offre et la demande en transplantation
d’organe au cours des 5 dernières années en France Figure 8 Page 63 Facteurs impliqués dans la physiopathologie de la dysfonction chronique du
greffon renal Figure 9 Page 68
Molécules du CMH de classe I et II : structure, polymorphisme et interaction
avec le récepteur T des lymphocytes
10
Figure 10 Page 69 Présentation schématique des deux modes d’alloreconnaissances
Figure 11 Page 72
Bases moléculaires de l’alloreconnaissance directe : présentation des 2
modèles et contribution respective selon l’homologie HLA du couple
donneur/receveur
Figure 12 Page 77
Illustration des étapes d’une réponse humorale T dépendante Figure 13 Page 125 Principales étapes de l’ontogénie des organes lymphoïdes secondaires :
l’organogenèse lymphoïde
11
Liste alphabétique des abréviations ADCC : antibody-dependent cell-mediated cytotoxicity
AGEs : advanced glycation end-products
AICD : activation induced cell death
AID : activation-induced cytidine deaminase
APRIL : a proliferation-inducing ligand
AVC : accident vasculaire cérébral
BAFF : B Cell-Activating Factor of the TNF family
BCR : B-cell receptor
BMP : bone morphogenic protein
CDR : complementary determining region
CLEVER : common lymphatic endothelial and vascular receptor
CMH : complexe majeur dhistocompatibilité
CML : cellules musculaires lisses
COX : cyclo-oxygénase
CPA : cellule présentatrice de l’antigène
EGF : epidermal growth factor
EMT : epithelial-mesenchymal transition
eNOS : endothelial NO synthase
FGF : fibroblast growth factor
G-CSF : granulocyte colony stimulating factor
HEV : high endothelial venule
HLA : human leukocyte antigens
HMGB1 : high-mobility group box 1 protein
HSP : heat shock protein
HTA : hypertension artérielle
ICAM : intercellular adhesion molecule
IFN : interféron
IGF : insulin growth factor
IL : interleukine
L’inflammasome NALP3 : NACHT-leucine-rich-repeat-and pyrin-domain-
containing protein
LPS : lipopolysaccharide
LTα1β2 : lymphotoxine α1β2
12
LTβR : récepteur β de la lymphotoxine
LTIC : lymphoid tissu inducer cells
MCP : monocyte chemoattractant protein
MEC : matrice extra-cellulaire
MMP : matrix metalloproteinase
NADPH oxydase : nicotidamide adenine dinucleotide phosphate oxydase
NLR : nucleotid-binding oligomerization-domain protein-like receptor
NO : nitric oxide
PAF : platelet activating factor
PAR : protease-activated receptor
PDGF : platelet derived growth factor
PECAM : platelet endothelial cell adhesion molecule (CD31)
PGE2 : prostaglandine E2
PNAd : peripheral lymph node addressin
PRR : pattern-recognition receptor
RAGE : advanced glycation end-product-specific receptor
sIL-6R : récepteur soluble à l’IL-6
RORγt : isoforme thymique du « retinoid-related orphan receptor γ»
ROS : reactive oxygen species
S1P : sphingosine 1 phosphate
SLPI : secretory leucocyte protease inhibitor
TCR : T cell receptor
TLR : toll-like receptor
TLT : tertiary lymphoid tissue
TNF : tumor necrosis factor
TSP : thrombospondine
VCAM : vascular cell adhesion molecule
VEGF : vascular endothelial growth factor
VLA : very late activation antigen
13
1 Avant Propos L’inflammation, célèbre tétrade « rubor, calor, dolor, tumor » décrite par
Celsus dès l’an 40, constitue encore de nos jours un défi médical et
scientifique de premier plan. C’est également un marché qui pèse plusieurs
millions de dollars et qui mobilise les forces vives de l’industrie
pharmaceutique. En dépit de cette recherche intensive, les progrès
thérapeutiques sont restés relativement modestes et les traitements
disponibles ne soulagent les symptômes que lorsqu’ils sont pris au long cours
et au prix d’effets indésirables préoccupants.
Une meilleure connaissance des mécanismes biologiques se mettant en
place lors d’une réponse inflammatoire chronique pourrait nous permettre de
comprendre comment cette pièce maîtresse de la défense de notre
organisme peut se muer en un processus destructeur.
Au cours de notre travail de thèse, nous avons mené une recherche
translationnelle choisissant le rejet d’allogreffe comme modèle représentatif
des pathologies inflammatoires chroniques. Les observations faites dans le
modèle de l’interposition aortique chez le rat nous ont permis d’élaborer des
hypothèses dont la validité a été testée en clinique. Les pistes thérapeutiques
suggérées par l’analyse des tissus humains ont été évaluées dans notre
modèle expérimental.
L’introduction débute par une présentation succincte de l’état des
connaissances concernant la réponse inflammatoire. La réponse anti-
infectieuse, de loin la mieux connue, nous servira de modèle. Dans une
seconde partie, nous introduirons la transplantation d’organe et ses
particularités immunologiques. Nous verrons que le rejet d’allogreffe présente
de nombreux points communs avec les autres pathologies inflammatoires
chroniques et qu’il offre de nombreux avantages pour disséquer la
physiopathologie de l’inflammation chronique.
Dans la section suivante, rassemblant nos résultats, nous verrons que
l’infiltrat inflammatoire s’organise au cours du temps pour constituer un tissu
lymphoïde ectopique fonctionnel. Ce processus, connu sous le nom de
néogenèse lymphoïde, sera analysé dans des greffons aortiques rejetés de
rat puis dans des greffons humains détransplantés. Nous nous interrogerons
sur les mécanismes initiateurs et les voies biologiques impliquées dans la
14
néogenèse lymphoïde. Des résultats préliminaires d’intervention
thérapeutiques ciblant la néogenèse lymphoïde serons présentés à la fin de
ce chapitre.
La discussion sera l’occasion de spéculer sur la gouvernance (tissulaire
versus immunitaire) de la néogenèse lymphoïde et des raisons pour
lesquelles le processus évolutif, qui a conduit à la sélection des organes
lymphoïdes secondaires, a maintenu ce dispositif biologique (à quelles fins ?
à quel prix ?).
15
2 Introduction
2.1 La réponse inflammatoire
2.1.1 Définition et généralités
Par le terme « inflammation », on désigne la réponse adaptative déclenchée
par des stimuli agressifs de nature très variable. Indépendamment de sa
cause, la réponse inflammatoire implique la mise en place coordonnée d’un
grand nombre de processus biologiques afin de faire disparaître (ou de
restreindre) la cause de l’agression et de restaurer l’homéostasie du tissu.
Après sa première description par Cornelius Celsus au premier siècle de
notre ère, l’inflammation resta longtemps considérée comme un processus
purement pathologique. Ce n’est qu’à la fin du XVIIIème siècle, avec la
publication des travaux de John Hunter (1), qu’émerge le concept d’une
réponse inflammatoire bénéfique, i.e. participant à la défense de l’organisme.
Le XIXème siècle marque le début des efforts scientifiques pour disséquer les
processus cellulaires et moléculaires impliqués dans la réponse
inflammatoire : premières descriptions microscopiques des tissus inflammés
par Julius Cohnheim (2), description du rôle des anticorps par Paul Ehrlich et
de la phagocytose par Elie Metchnikoff qui leur vaudra le prix Nobel en 1908.
Malgré son caractère galvaudé, l’image de l’épée à double tranchant est
particulièrement illustrative du rôle de la réponse inflammatoire dans les
organismes complexes. Il est en effet impossible d’en distinguer les éléments
bénéfiques et délétères : les mêmes mécanismes cruciaux dans le maintien
de l’intégrité de l’organisme face au risque infectieux sont responsables du
développement des lésions tissulaires dans diverses pathologies.
Cette dualité, qui caractérise la réponse inflammatoire, n’est pas inconciliable
avec sa sélection lors du processus évolutif (3). On admet qu’un trait est
sélectionné par l’évolution lorsqu’il fournit un avantage à l’organisme pour
s’adapter aux conditions dans lesquelles le processus de sélection s’est
effectué. Lorsque ces conditions changent, l’avantage adaptatif est modifié et
le trait peu devenir défavorable. Il est largement admis que la réponse
inflammatoire a été sélectionnée par le processus évolutif en raison du
bénéfice qu’elle procure aux organismes exposés au risque infectieux. Pour
16
s’en convaincre, il suffit de rappeler les risques majeurs d’infections mortelles
auxquels sont confrontés les patients présentant un déficit dans les
composant de l’inflammation. Par exemple : l’incapacité de mobiliser les
leucocytes au site de pénétration du pathogène chez les patients atteints d’un
déficit d’adhérence leucocytaire conduit le plus souvent au décès du
patient (4); un défaut de production de certaines protéines du complément
prédispose aux infections par le méningocoque (5)… Les modifications
rapides de nos conditions de vie (en particulier dans les pays développés) ont
réduit le risque infectieux et modifié la balance avantage/désavantage
caractérisant la réponse inflammatoire. L’importance croissante des
pathologies inflammatoires telles que l’allergie, les maladies auto-immunes,
l’obésité, les maladies cardiovasculaires (6) ne doit cependant pas nous faire
oublier la menace vitale que continue à représenter le risque infectieux et le
fait que la manipulation de la réponse inflammatoire est une piste
thérapeutique pour lutter contre le cancer (7).
2.1.2 Physiologie de la réponse inflammatoire
La réponse inflammatoire peut être définie comme un réseau complexe de
processus biologiques dont la dissection est rendue plus aisée par la
catégorisation proposée récemment par Medzhitov (8). Les inducteurs initient
la réponse inflammatoire par l’activation de senseurs spécialisés. En réponse
à l’activation des senseurs, des médiateurs sont produits et agissent sur les
effecteurs afin de modifier l’état fonctionnel du tissu pour l’adapter à la
situation pathologique.
2.1.2.1 Inducteurs et senseurs de l’inflammation
Les inducteurs de l’inflammation peuvent être exogènes ou
endogènes (Figure 1).
17
Figure 1 Classification des principaux inducteurs de l’inflammation (Adapté de Medzhitov, Nature (2008), p428-435)
2.1.1.1.1 Inducteurs exogènes
Les inducteurs exogènes se divisent en inducteurs microbiens et non-
microbiens.
Au sein des inducteurs microbiens, on distingue les PAMPs (pathogen-
associated molecular patterns) et les facteurs de virulence. Contrairement à
ce que laisse supposer leur nom, les PAMPs désignent des motifs
moléculaires conservés portés par tous les micro-organismes d’une classe
donnée (qu’ils soient pathogènes ou commensaux) (9). Ces motifs sont
reconnus par des récepteurs particuliers : les PRR (pattern-recognition
receptors) divisés en plusieurs familles dont les plus célèbres sont les TLRs
(Toll-like receptors) et les NLRs (nucleotid-binding oligomerization-domain
protein-like receptors) (pour une revue récente concernant ces récepteurs voir
: (10-12)). La seconde classe d’inducteur microbien est représentée par les
facteurs de virulence (portés seulement par les pathogènes). Contrairement
18
aux PAMPs, les facteurs de virulence ne sont pas détectés par des senseurs
particuliers mais ils déclenchent la réponse inflammatoire indirectement via
les dégâts tissulaires qu’ils provoquent. Par exemple : les exotoxines des
bactéries Gram positives sont détectées par l’inflammasome NALP3 (NACHT-
, leucine-rich-repeat-and pyrin-domain-containing protein), sensible à l’efflux
d’ions K+ à travers les pores qu’elles ont provoqués dans la membrane
cellulaire (13). Une autre façon encore plus indirecte de déclencher la
réponse inflammatoire pour les facteurs de virulence est leur capacité à
provoquer la mort cellulaire. Dans ce cas, les inducteurs de la réponse
inflammatoire seront en fait les inducteurs endogènes.
Les inducteurs exogènes non-microbiens sont représentés par les allergènes,
les toxiques et les corps étrangers (par exemple les fibres d’amiante où les
particules de silice). Les senseurs des allergènes et des toxiques restent très
mal connus. Les corps étrangers sont phagocytés par les macrophages,
notamment du fait de l’absence de CD47 à leur surface. Le CD47,
normalement présent à la surface des cellules autologues, engage des
récepteurs inhibiteurs de la phagocytose (14). La grande taille des corps
étrangers et/ou les dégâts qu’ils provoquent à la membrane phagosomale font
avorter la phagocytose et activent l’inflammasome NALP3 (15).
2.1.2.1.2. Inducteurs endogènes
Les inducteurs endogènes de l’inflammation sont les signaux produits par les
cellules du tissu agressé. L’identité de ces signaux est imparfaitement
connue, mais on peut penser qu’ils varient en fonction de la nature et de
l’importance de l’anomalie dont ils sont les témoins.
La rupture de confinement, i.e. la mise en contact d’éléments maintenus
séparés en conditions physiologiques, est un phénomène quasiment
universel lors d’une agression cellulaire ou tissulaire. Durant la mort cellulaire
par nécrose, la rupture de la membrane plasmique, conduit au relargage dans
le milieu extra-cellulaire de certains constituants cellulaires : ATP, ions K+,
acide urique, HMGB1 (high-mobility group box 1 protein), les protéines HSP
(heat shock protein), et des membres de la famille des S100 calcium-binding
protein (16). L’ATP se lie aux purinoceptors à la surface des macrophages
provoquant un efflux d’ions K+ qui coopèrent avec d’autres signaux pour
activer l’inflammasome NALP3 (13). L’ATP active également les nocicepteurs
19
qui signalent au système nerveux l’agression tissulaire (17). HMGB1 et
S100A12 engagent les récepteurs RAGE (advanced glycation end-product-
specific receptor) qui coopèrent avec les TLR pour promouvoir la réponse
inflammatoire (18, 19). Les protéines S100A8 et S100A9 se lient directement
au TLR4.
Une donnée nouvelle doit ici être soulignée. Tandis qu’on pensait que le
passage des constituants cellulaires dans le milieu extracellulaire se faisait
exclusivement de manière passive lors de la rupture de la membrane
plasmique accompagnant la nécrose, des travaux récents suggèrent que ces
molécules peuvent aussi être activement sécrétées via une voie non-
canonique (indépendante du réticulum endoplasmique et du Golgi),
dépendante de la caspase 1 et régulée par les inflammasomes, dans des
cellules non nécrotiques (20). Par exemple, HMGB1 est activement sécrétée
(sans nécrose cellulaire) lorsque des macrophages sont stimulés par la
liaison du LPS (lipopolysaccharide) au TLR4 (21). Dans les tissus intacts, les
cellules épithéliales sont normalement séparées des cellules
mésenchymateuses par la membrane basale. La rupture de ce confinement
conduit à la mise en place d’interaction épithélium/mésenchyme indiquant un
dégât tissulaire et déclenchant les mécanismes de réparation tissulaire. La
nature moléculaire de ces signaux reste toutefois encore mal déterminée.
Dans certains organes, tel que le tube digestif, l’épithélium sépare le milieu
extérieur (septique) du milieu intérieur (stérile). La rupture de la barrière
épithéliale, en permettant le passage des germes commensaux dans le milieu
intérieur, conduit à l’activation des macrophages résidents de la lamina
propria via leur TLR (22). Pour d’autres organes bordés par un épithélium,
c’est la rupture de confinement de certains éléments non-microbiens
(normalement localisés dans la lumière) qui pourrait jouer un rôle similaire.
Par exemple dans l’épithélium respiratoire, le facteur de croissance heregulin
est physiologiquement confiné à distance de ses récepteurs (ERB2, ERB3 et
ERB4) par les jonctions serrées. En cas d’agression, l’heregulin peut accéder
aux récepteurs et déclencher la réponse réparatrice (23). Enfin, les dégâts
causés à l’endothélium permettent l’accès des protéines plasmatiques et des
plaquettes à l’espace extra-vasculaire. Le facteur XII (aussi connu sous le
nom de facteur de Hageman) s’active au contact des constituants de la
matrice extra-cellulaire (notamment le collagène) et joue le rôle de senseur.
20
Son activation conduit à l’initiation de 4 cascades protéolytiques générant des
médiateurs de l’inflammation : la cascade kinine-kallicréine, celle de la
coagulation, celle de la fibrinolyse et la cascade du complément (24). Les
plaquettes s’activant au contact du collagène relarguent également une
grande quantité de médiateurs de l’inflammation, notamment le thromboxane
et la sérotonine (24).
D’autres inducteurs endogènes, ne dépendant pas d’une rupture de
confinement, ont été identifiés. Certains agissent de manière similaire aux
corps étrangers exogènes (par exemple les cristaux d’urate de sodium et de
pyrophosphate de calcium). Les AGEs (advanced glycation end-products)
sont les produits de la glycation non-enzymatique de protéines de longue
durée de vie (comme le collagène) (25). Les AGEs s’accumulent lors des
situations prolongées d’hyperglycémie ou de stress oxydatif (telles que le
diabète ou le vieillissement). Ces glycations conduisent à la mise en place de
liaisons anormales entre les protéines altérant progressivement leur fonction.
Les AGEs, reconnus par des senseurs spécifiques : les récepteurs RAGE,
declenchent la réponse inflammatoire directement (18) ou en synergie avec
les TLR (26). Les ROS (reactive oxygen species), produits par les
phagocytes, transforment les lipoprotéines en signal pro-inflammatoire en les
oxydant (27). Les fragments de matrice extra-cellulaire générés par les
dégâts tissulaires peuvent également jouer le rôle d’inducteurs de
l’inflammation. Le mieux étudié est le cas du glycosaminoglycane
hyaluronate. En situation physiologique, le hyaluronate est présent sous
forme d’un polymère inerte de haut poids moléculaire. L’agression tissulaire
provoque son morcellement en fragments de faible poids moléculaire qui se
lient au TLR4 pour déclencher la réparation tissulaire (28). Cette
fragmentation peut aussi être déclenchée par les ROS (29).
La liste des inducteurs endogènes s’allonge régulièrement, mais la littérature
comporte de nombreux résultats contradictoires. Ces derniers s’expliquent
facilement si on considère : i) la difficulté technique que suppose l’obtention
de préparations totalement dépourvues de contaminants bactériens (capables
de stimuler les TLR et les NLR), ii) la possibilité que certains inducteurs
n’agissent in vivo que sous certaines conditions pathologiques difficiles à
reproduire in vitro. Par exemple, l’ischémie du tissu agressé, connue pour
augmenter les concentrations de ROS et de fragments de matrice extra-
21
cellulaire, n’est pratiquement jamais prise en compte lors des expériences de
culture qui se déroulent majoritairement dans des conditions d’oxygénation et
de nutrition supra-physiologiques.
2.1.1.2 Médiateurs de l’inflammation
Les médiateurs de l’inflammation peuvent dériver de protéines plasmatiques
ou être sécrétés par des cellules (que ce soit les cellules résidentes du tissu
agressé ou des leucocytes spécialisés) (24). Les médiateurs de l’inflammation
se divisent en 7 groupes selon leurs caractéristiques biochimiques.
2.1.1.2.1 Amines vasoactives
L’histamine et la sérotonine sont préformées et stockées sous forme
directement active dans les granules des mastocytes et des plaquettes. Leur
libération se fait sur le mode « tout ou rien ». Elles ont un effet très complexe
sur l’arbre vasculaire (causant vasodilatation ou vasoconstriction) dépendant
du contexte. La dégranulation des mastocytes est le substratum biologique
d’une situation pathologique gravissime : le choc anaphylactique.
2.1.1.2.2 Peptides vasoactifs
Les peptides vasoactifs sont, soit stockés sous forme active dans des
vésicules sécrétoires (comme la substance P), soit générés par clivage
protéolytique de précurseurs inactifs présents dans le fluide extra-cellulaire
(comme les kinines, les fibrinopeptides A et B et les produits de dégradation
de la fibrine). La substance P, libérée par les neurones sensitifs, peut à son
tour provoquer la dégranulation des mastocytes. D’autres peptides vasoactifs
sont générés par protéolyse par le facteur XII, la thrombine ou la plasmine.
Les peptides vasoactifs provoquent une vasodilatation et augmentent la
perméabilité vasculaire (directement ou en provoquant la libération
d’histamine par les mastocytes).
2.1.1.2.3 Fragments du complément
Le système du complément tire son nom de l’observation que ce groupe de
protéines plasmatiques étaient capables de « complémenter » l’activité
bactéricide des anticorps.
Les constituants du complément sont activés par une cascade de clivages
protéolytiques pouvant être déclenchés par liaison aux complexes immuns
22
(voie classique), à la MBP (mannose binding protein ; voie des lectines) ou
aux constituants de la paroi bactérienne (voie alterne).
Les rôles joués par le complément durant la réponse inflammatoire sont
divers et incluent : i) la destruction des agents infectieux par la formation de
pores dans leur membrane via la formation complexe d’attaque membranaire
ou par l’opsonisation favorisant leur phagocytose ; ii) l’élimination rapide des
complexes immuns et des corps apoptotiques, iii) certains fragments du
complément jouent le rôle d’inducteur de l’inflammation, en particulier le C3a,
le C4a et le C5a (aussi connus sous le nom d’anaphylatoxines). Produits par
l’activation des différentes voies de la cascade du complément, ils
promeuvent le recrutement des granulocytes et des monocytes et la
dégranulation des mastocytes. Ces effets sont directement déclenchés par la
liaison des fragments du complément aux récepteurs spécifiques exprimés à
la surface des effecteurs cellulaires.
2.1.1.2.4 Médiateurs lipidiques
Ils sont représentés par les eicosanoides et les PAFs (platelet activating
factors). L’afflux d’ions Ca2+ dans le milieu intra-cellulaire provoque
l’activation de la phospholipase A2 cytosolique. Cette dernière utilise comme
substrat les phospholipides (notamment la phosphatidylcholine) présents à la
face interne des membranes cellulaires, pour générer de l’acide
arachidonique et de l’acide lyso-phosphatidique, les précurseurs des deux
classes de médiateurs lipidiques.
Lors la biosynthèse des eicosanoides, l’acide arachidonique est métabolisé,
soit par les cyclo-oxygenases (qui génèrent les prostaglandines et les
thromboxanes), soit par les lipo-oxygenases (qui génèrent les leukotriènes et
les lipoxines) (30). Les prostaglandines sont vasodilatatrices et (pour la
PGE2) peuvent aussi déclencher douleur et fièvre (31). Les lipoxines, de
même que les resolvines (dérivant des acides gras ω 3) et les protectines,
participent à la résolution de la réponse inflammatoire et initient les
mécanismes de réparation tissulaire (32).
La seconde classe des médiateurs lipidiques sont les PAFs, qui découlent de
l’acétylation de l’acide lysophosphatidique. Ils sont à l’origine de nombreux
phénomènes caractéristiques de la réponse inflammatoire parmi lesquels : le
23
recrutement des leucocytes, la modification du tonus et de la perméabilité
vasculaire et l’activation des plaquettes (24, 30).
2.1.1.2.5 Cytokines pro-inflammatoires
L’identification et la caractérisation de ces médiateurs solubles
polypeptidiques comptent parmi les champs les plus actifs de la recherche sur
l’inflammation. Les progrès réalisés dans ce domaine ont généré une telle
masse de données (plus de 53000 références indexées dans PubMed)
qu’une description individuelle de chacune des cytokines pourrait faire l’objet
d’une thèse. Nous nous contenterons donc de rappeler que les principales
cytokines pro-inflammatoires sont le TNF (tumor necrosis factor)-α, l’IL
(interleukine)-1, l’IL-6 et que ces molécules, produites par divers types
cellulaires (parmi lesquels les macrophages et les mastocytes), jouent des
rôles extrêmement variés incluant l’activation de l’endothélium, celles des
leucocytes, l’induction de la synthèse des protéines de la phase aiguë de
l’inflammation ou de la fièvre.
Pour une revue détaillée du rôle des cytokines lors de la réponse
inflammatoire, le lecteur pourra se reporter aux références : (33-35).
2.1.1.2.6 Chémokines
Comme les cytokines, les chémokines ont fait l’objet de recherches trop
vastes pour être résumées convenablement ici. La revue récente publiée par
Rot et al (36) fournit un excellent résumé de ces travaux.
Les chémokines constituent une superfamille de protéines aux propriétés
structurelles communes que l’on peut diviser en 4 sous-familles selon
l’organisation des résidus cystéines en position N terminale (C, CC, CXC et
C3XC respectivement) (Table 1).
24
Table 1 Nomenclatures des chémokines et de leurs récepteurs (Adapté de Douglas et al, Exp Rev Mol Med (2002), p1-18)
25
Les chémokines assurent le rôle de signal d’adressage en se liant à des
récepteurs à 7 domaines transmembranaires couplés aux protéines G. La
spécifité du couple chémokine/récepteur est très variable. Certaines
chémokines se lient à un récepteur, d’autres à plusieurs. De même, certains
récepteurs ne lient qu’une chémokine tandis que d’autres en lient un grand
nombre (Table 1). Les chémokines permettent aux cellules porteuses du
récepteur correspondant de migrer en direction de la source de production en
remontant le gradient de concentration (recrutement des effecteurs au foyer
inflammatoire ou migration centrifuge vers les organes lymphoïdes
secondaires drainant) et assurent ensuite leur rétention dans le tissu.
Le rôle des chémokines dans l’inflammation est connu depuis longtemps mais
des travaux récents ont également soulignés leur participation au maintien de
l’homéostasie : développement des organes lymphoïdes, circulation des
lymphocytes, ségrégation T/B… (37). Ces observations ont conduit à
proposer une classification fonctionnelle des chémokines en « inflammatoires
» (ou inductibles) et « homéostatiques » (ou constitutives) (38). Les premières
sont produites après contact avec les produits microbiens ou après
stimulation par les cytokines pro-inflammatoires et provoquent le recrutement
des effecteurs (neutrophiles, monocytes, lymphocytes selon le type). Les
suivantes sont exprimées constitutivement par certains tissus et assurent la
circulation des effecteurs lymphoïdes indispensables au maintien de
l’homéostasie du système immunitaire adaptatif (39) (Table 2). Bien entendu,
cette distinction conceptuellement utile n’est pas absolue et nous verrons plus
tard que plusieurs chémokines peuvent appartenir à l’une où à l’autre famille
selon les circonstances considérées.
26
Table 2 Classification des chémokines et profil d’expression de leurs récepteurs (Tiré de Sallusto et al, Immunol Today (1998), p568-574)
Les récepteurs sont groupés selon leur spécificité pour les chémokines inflammatoires (cases rouges) ou constitutives (cases bleu). Leur profil d’expression cellulaire est indiqué par les cases vertes. Certains récepteurs ou chémokines, ont un profil mixte (cases rouges/bleu). Lorsque le récepteur n’est exprimé que par une sous-population de cellule, la case verte est n’est remplie qu’à moitié.
27
2.1.1.2.7 Enzymes protéolytiques De nombreuses enzymes protéolytiques, parmi lesquelles l’élastase, les
cathepsines et les MMPs (matrix metalloproteinases), participent à la réponse
inflammatoire en dégradant les protéines de la matrice extra-cellulaire. Elles
favorisent ainsi la migration des leucocytes et participent au remodelage
tissulaire.
2.1.1.2.8 Remarques
La plupart des médiateurs ont, non seulement des effets directs sur le tissu
agressé, mais sont aussi capables de se comporter comme des inducteurs,
i.e. de déclencher la production d’autres médiateurs créant une réaction en
chaîne permettant une amplification rapide de la réponse inflammatoire.
Bien que non démontré formellement, il est concevable que la nature du
stimulus inflammatoire influe sur celle des médiateurs produits en réponse (et
donc sur le type de réponse inflammatoire).
2.1.1.3 Dynamique de la réponse inflammatoire aiguë
Les effecteurs de la réponse inflammatoire sont les tissus et les cellules dont
l’état fonctionnel est modifié par les médiateurs cités ci-dessus. Certains
médiateurs (notamment le TNF-α ou l’IL1) ont un impact quasi universel (sur
tout l’organisme) même si les effets diffèrent selon le type cellulaire ou le tissu
considéré.
La réponse inflammatoire doit être envisagée comme un réseau complexe
d’interaction entre les effecteurs. Plutôt que d’établir la liste de ces effecteurs
nous souhaitons ici insister davantage sur la dynamique de leurs
interactions. (Figure 2).
28
Figure 2 Dynamique des interactions précoce au cours de la réponse inflammatoire (Tiré de Nathan, Nature (2008), p846-852)
Les interactions précoces entraînant le développement d’une réponse inflammatoire après un traumatisme septique sont présentées. Les interactions entre les leucocytes, l’endothélium activé, les plaquettes et les facteurs de la coagulation ne sont pas montrées pour ne pas complexifier la figure. Le schéma ne fait pas non plus apparaître les étapes plus tardives de régulation et de transition vers la réparation tissulaire.
2.1.1.3.1 Phénomènes locaux initiaux
La mise en place d’une réponse rapide au stimulus agressif nécessite la
présence de cellules sentinelles pré-stationnées dans le tissu. Ce rôle est
rempli par les macrophages résidents et les mastocytes. La contribution de
ces derniers, de découverte plus récente, a été traitée dans une revue
centrée sur les pathologies auto-immunes (40). En réponse aux inducteurs,
les sentinelles de l’inflammation libèrent des médiateurs parmi lesquels : de
l’histamine, des eicosanoides, des cytokines (notamment le TNF préformé),
des chémokines et des protéases. Il en résulte une vasodilatation, qui débute
au niveau des artérioles avant de toucher le lit capillaire, et qui est
responsable de la « rougeur » et de la « chaleur » du tissu inflammé.
29
L’augmentation du flux sanguin s’accompagne d’une plus grande perméabilité
vasculaire qui est la conséquence de la rétraction des cellules endothéliales
veinulaires et de l’élargissement des espaces intercellulaires (ou de la
nécrose des cellules endothéliales en cas de lésions plus sévères). Cette
augmentation de la perméabilité vasculaire permet une extravasation du
plasma dans le tissu (« œdème »).
Simultanément, la tryptase des mastocytes, les sérines protéases circulantes
(comme les facteurs de la coagulation qui peuvent maintenant accéder au
tissu) ou d’autres protéases, clivent une famille de récepteurs couplés aux
protéines G : les PARs (protease-activated receptors) localisés à la surface
des mastocytes, des terminaisons des neurones sensitifs (« douleur » (41)),
des cellules endothéliales et des neutrophiles. L’activation des PARs
(principalement PAR 2) amplifie l’activation des mastocytes, rend
l’endothélium plus perméable et plus adhésif pour les leucocytes (42) et
stimule la libération de PAF par les leucocytes.
2.1.1.3.2 Recrutement des effecteurs cellulaires de l’immunité innée au foyer inflammatoire
2.1.1.3.2.1 Bases moléculaires du homing des effecteurs cellulaires au foyer
inflammatoire
Pour participer à la réponse inflammatoire, les leucocytes doivent quitter le
courant sanguin et migrer vers le site inflammatoire. Les interactions
complexes entre leucocytes et endothélium ne seront pas discutées ici en
détail faute de place (mais le lecteur pourra en trouver un résumé dans les
références suivantes :(43, 44)).
Nous nous contenterons de rappeler que le processus complexe fait intervenir
de manière séquentielle des étapes de chémoattraction, d’adhérence et de
signalisation cellulaire que nous résumerons brièvement de la manière
suivante: i) les macrophages et les mastocytes ainsi que les cellules
stromales libèrent des chemokines, ii) les sélectines et les sucres exprimés à
la surface des cellules endothéliales et des leucoytes activés établissent des
liaisons de faible affinité qui sont responsables d’un ralentissement des
leucocytes (qui remontent le gradient de chemoattraction) qui adhèrent à
l’endothélium et se mettent à rouler à sa surface (étape de « rolling »), iii)
l’expression des chemokines par l’endothélium du tissu lésé induit
30
l’expression de molécules de la famille des intégrines à la surface du
leucocyte. Les intégrines sont des hétérodimères constitués de deux chaînes
polypeptidiques α et β, capables de mettre en place des liaisons de forte
affinité avec leur ligand spécifique à la surface de l’endothélium permettant
d’arrêter les leucocytes (« adhésion ferme »). L’affinité des intégrines pour
leur ligand est renforcée par la signalisation en aval des récepteurs des
chemokines, iv) les leucocytes quittent le courant sanguin par une étape de
migration transendothéliale (ou diapédèse) faisant intervenir notamment
PECAM (platelet endothelial cell adhesion molecule)-1 (ou CD31) et
l’interaction VCAM (vascular cell adhesion molecule)-1/VLA (very late
activation antigen)-4, v) les leucocytes migrent à l’intérieur du tissu en
direction du foyer inflammatoire. Cette étape est favorisée par l’action des
enzymes protéolytiques (cf paragraphe 2.1.1.2.7) qui dégradent la matrice
extra-cellulaire du tissu et par l’afflux des protéines plasmatiques qui
constituent une néo-matrice à laquelle elles adhèrent.
2.1.1.3.2.2 Les neutrophiles
Les polynucléaires neutrophiles représentent 40 à 70% de la totalité des
leucocytes circulants. Il sont les premiers leucocytes à migrer vers le foyer
inflammatoire (45) sous l’inflence notamment de l’IL-8 (ou CXCL8) (46).
En condition physiologique, les neutrophiles matures circulent dans un état
quiescent. Leur activation est un processus à deux étapes débutant par un «
priming ». Les données récentes concernant les bases moléculaires du «
priming » soulignent l’importance de certains médiateurs (leucotriènes et
TNF-α) produits par les mastocytes. Le priming des neutrophiles conduit au
relargage d’élastase qui les débarrasse du manteau anti-adhésif de
leukosialine (CD43) favorisant la liaison de leur intégrines de surface aux
molécules de la matrice extra cellulaire néoformée par l’afflux des protéines
plasmatiques (47).
Quand les neutrophiles atteignent le site inflammatoire, sous l’influence de
divers signaux incluant entre autres : l’engagement des TLRs, les cytokines
(notamment le TNF-α) et le C5a, ils achèvent de s’activer afin d’exercer leurs
effets notamment : i) la phagocytose du matériel étranger (ou du soi altéré),
en particulier lorsque ce dernier est opsonisé par des immunoglobulines et/ou
des fragments du complément (notamment le C3bi), ii) la dégranulation, iii) la
31
formation d’anions superoxydes (« burst oxydatif »), iv) la libération de
matériel génétique complexé à des molécules bactéricides issues des
granules : les NETs (Neutrophil Extracellular Traps) dont la génération suit un
programme de mort cellulaire distinct de l’apoptose et de la nécrose et
dépendant de la NADPH (nicotidamide adenine dinucleotide phosphate)
oxydase (48).
Les neutrophiles possèdent 4 types de granules caractérisés par leurs
contenus différents (pour un tableau récapitulatif voir Table 3). Les granules
primaires (ou azurophiles) sont rarement sécrétés à l’extérieur de la cellule.
Ils fusionnent plutôt avec le phagosome (la vacuole cytoplasmique résultant
de la phagocytose), mettant directement en contact le matériel ingéré avec
les protéines effectrices : les lysozymes digérant les peptidoglycanes des
parois bactériennes, les protéases (telles que la cathepsine G, la protéinase
3), les élastases, les protéines antibiotiques (telles que le « bacterial
permeability increasing factor »), les défensines, les serpocidines (et leur
homologue : l’azurocidine) et la myéloperoxydase capable de convertir le
peroxyde d’hydrogène produit par la NADPH oxydase en acide hypochloreux.
32
Table 3 Contenu des granules et des vésicules sécrétoires des polynucléaires neutrophiles (Tiré de Faurschou et al, Microbes Infect (2003), p1317-1327)
33
Les granules secondaires (ou spécifiques) ne contiennent pas de
myéloperoxydase, mais sont riches en substances antimicrobiennes libérées
dans le milieu extra-celulaire. Les granules tertiaires (ou gélatinase) servent à
entreposer les enzymes participant à la dégradation de la matrice extra-
cellulaire et les récepteurs membranaires utiles lors de la migration du
neutrophile. Ils jouent un rôle clef dans les étapes de migration vers le site
inflammatoire. Les vésicules sécrétoires sont en fait les premières à être
libérées en réponse aux stimuli inflammatoires. Elles contiennent des
récepteurs membranaires servant lors des étapes initiales de l’activation du
neutrophile et de l’adhérence ferme à l’endothélium activé.
La génération des formes réactives de l’oxygène, l’un des principaux
mécanismes de défense du neutrophile, fait intervenir le complexe de la
NADPH oxydase. Ce complexe enzymatique s’assemble lors de l’activation
du neutrophile au niveau de la membrane plasmique à partir de deux
composants membranaires (gp91-phox et p22-phox) et trois composants
cytoplasmique (p47-phox, p67-phox et Rac) grâce à des domaines de
reconnaissance SH3 (49). Le complexe catalyse la conversion de l’oxygène
moléculaire en anion superoxyde (O2-) qui est relargué à la face externe de la
membrane (ainsi les anions peuvent agir à l’extérieur du neutrophile ou à
l’intérieur du phagosome, formé par l’invagination de cette membrane).
L’anion superoxyde est le précurseur de plusieurs formes réactives de
l’oxygène plus toxiques pour le pathogène : le peroxyde d’hydrogène (H2O2)
produit par la superoxide dismutase qui peut ensuite être converti en acide
hypochloreux (HOCl) par la myéloperoxidase des granules primaires (50). Les
oxydants activent les MMPs et inactivent les inhibiteurs des protéases (51).
Relargués dans le milieu extracellulaire ces produits aggravent les dégâts
tissulaires et renforcent la réponse inflammatoire.
2.1.1.3.2.3 Les éosinophiles
Les polynucléaires éosinophiles sont des granulocytes résidants dans les
tissus qui peuvent être recrutés au foyer inflammatoire, principalement
lorsque l’inflammation est déclenchée par un parasite ou par un allergène au
niveau du tube digestif, de la peau ou du poumon. Les éosinophiles
répondent aux signaux chémotactiques : RANTES (ou CCL5), MIP-1α (ou
CCL3), eotaxine (CCL11) et à l’IL5. Ils possèdent des granules
34
cytoplasmiques contenant des protéines oxydantes et cationiques mais
contrairement aux neutrophiles, sont incapables de phagocytose et agissent
donc en libérant le contenu de leurs granules dans le milieu.
2.1.1.3.2.4 Les monocytes
Sous l’influence de divers stimuli chémotactiques, notamment i) le MCP
(monocyte chemoattractant protein)-1 (ou CCL2) et la fractalkine (CX3CL1),
selon le sous-type de monocyte considéré, produits par les cellules du tissu
agressé (52) et ii) l’azurocidine produite par les neutrophiles (53), les
monocytes quittent le courant sanguin et migrent au site inflammatoire.
Dans le tissu inflammé, les monocytes en fonction de leur sous-type (54) et
des signaux qu’ils reçoivent via leurs récepteurs de surface, débutent un
programme de différenciation les transformant soit en macrophages soit en
l’un des sous-types de cellule dendritique (55, 56).
Les macrophages participent à l’élimination du pathogène en complémentant
l’action des neutrophiles durant les réponses inflammatoires aiguës. Comme
effecteur de l’immunité innée, ils sont capables de phagocytose et produisent
divers composants antibactériens et médiateurs pro-inflammatoires
(protéases, eicosanoides, cytokines, ROIs et RNIs). Contrairement aux
neutrophiles, les macrophages possèdent également la capacité de présenter
l’antigène aux lymphocytes T et B et se situent donc à la frontière entre
l’immunité innée et adaptative. Une autre des fonctions macrophagiques
illustrant leur position à l’interface entre les immunités inné et adaptative, est
leur rôle dans le maintien de l’homéostasie des neutrophiles. La
granulopoïèse est sous la dépendance de l’IL-17 (via son action sur le G-
CSF) produite par les lymphocytes γδ. Les travaux de Stark ont montré que la
régulation de la synthèse d’IL-17 par les lymphocytes γδ était elle-même sous
la dépendance de l’IL-23 produite par les macrophages tissulaires en réponse
à la phagocytose des corps apoptotiques des neutrophiles ayant infiltré le
tissu (57).
Des travaux récents ont montré que les monocytes pouvaient également se
trans-différencier en cellule endothéliale ou en fibroblaste (58) démontrant
qu’en plus de leur situation à l’interface entre les 2 bras de la réponse
immunitaire, les monocytes se situent également à l’interface entre tissu et
système immunitaire.
35
2.1.1.3.3 Mise en place secondaire de la réponse immunitaire adaptative
Les mécanismes moléculaires en cause dans cette transition « réponse innée
=> réponse adaptative » ont été très récemment élucidés et semblent
dépendre du couple IL-6 / récepteur soluble à l’IL-6 (sIL-6R) (59). La
production de sIL-6R par les neutrophiles aboutit à la formation de complexes
IL-6/sIL-6R qui ont la capacité d’activer des cellules dépourvues de récepteur
à l’IL-6 en se liant à la gp130 (un élément participant à la transduction du
signal des récepteurs des cytokines de la famille de l’IL-6, exprimée de
manière ubiquitaire). Cette liaison module la production des chémokines: la
production des chémokines CXC (responsables de l’afflux des neutrophiles)
induites par l’IL-1 et le TNF-α, est inhibée tandis que la production des
chemokines CC (et notamment MCP-1 (CCL2) augmente. Ceci se traduit par
une modification du profil des effecteurs recrutés en faveur des cellules
mononuclées. Comme nous l’avons vu plus haut, l’azurocidine produite par
les neutrophiles participe également à cette transition.
Sous l’influence des différents « signaux de danger » (60), les cellules
dendritiques (résidentes dans le tissu ou formées à partir de la différenciation
des monocytes) terminent leur maturation : présentation de l’antigène
phagocyté à la surface via les molécules du CMH (complexe majeur
d’histocompatibilité), expression de molécules permettant la costimulation des
lymphocytes, et migration via les lymphatiques afférents vers les ganglions
lymphatiques. Dans la zone T des organes lymphoïdes secondaires (dont le
ganglion lymphatique est le prototype), la cellule dendritique mature établit
une série d’interactions complexes avec les lymphocytes T et les lymphocytes
B conduisant à l’initiation d’une réponse immune adaptative. Les clones
lymphocytaires T CD4+ et CD8+ spécifiques de l’antigène s’activent et
s’expandent puis migrent via le lymphatique efférent et le canal thoracique
dans la circulation sanguine avant d’atteindre le foyer inflammatoire guidé par
les nombreux signaux chémotactiques. Les lymphocytes T participent à la
réponse inflammatoire en exerçant une activité cytotoxique (défense antivirale
par les lymphocytes T CD8+) et en synthétisant un grand nombre de
cytokines qui influencent la nature de la réponse (l’augmentant ou la
diminuant). Les lymphocytes B activés par la reconnaissance de l’antigène via
leur BCR (B-cell receptor) et l’aide fournie par les lymphocytes T CD4+
(notamment par l’interaction CD40-CD154), migrent à l’intérieur d’un follicule
36
primaire et le transforment en follicule secondaire en débutant la réaction du «
centre germinatif ». Dans le centre germinatif, sous l’influence de l’enzyme
AID (activation-induced cytidine deaminase (61)), le lymphocyte B mute au
hasard les gènes codants la partie variable de son immunoglobuline de
surface. Seuls les clones pour lesquels ces hypermutations somatiques ont
abouti à une augmentation de l’affinité pour l’antigène, qui leur est présenté
par les cellules dendritiques folliculaires, sont sauvés de l’apoptose et
sélectionnés pour devenir des plasmocytes ou des lymphocytes B mémoires.
Au passage, l’isotype de la chaîne lourde de l’immunoglobuline est changé
afin de conférer à l’anticorps des propriétés effectrices particulières. Les
plasmocytes quittent le follicule secondaire et gagnent la moelle osseuse d’où
ils produisent une grande quantité d’anticorps qui rejoignent le site
inflammatoire (leur rôle, notamment pour favoriser la phagocytose via
l’opsonisation a déjà été évoqué ci-dessus).
Ce très rapide rappel des étapes d’une réponse immune adaptative ne
prétend pas être exhaustif. Il permet plutôt de souligner que la réponse
adaptative est étroitement connectée à la réponse innée qui la précède et
prépare les conditions de sa mise en place. Ces deux bras du système
immunitaire participant de manière complémentaire au développement des
réponses inflammatoires. Cette vision moderne, unifiée, du système
immunitaire des vertébrés met fin à la vieille querelle débutée à la fin du
XIXème siècle opposant : « l’école allemande » de Paul Ehrlich, avançant le
rôle prépondérant des anticorps circulants et « l’école franco-russe » d’Elie
Metchnikoff tenant de la phagocytose.
2.1.1.3.4 Résolution de l’inflammation
La réponse inflammatoire peut être comparée à une réaction en chaîne visant
à réagir aussi efficacement que possible afin de limiter la diffusion du stimulus
agressif (d’un point de vue ontogénique : un germe). Cependant, les
mécanismes effecteurs mis en place pour éliminer le pathogène possèdent
des effets délétères per se sur le tissu et contribuent à aggraver les dégâts
initiaux. Pour être viable, la réponse inflammatoire doit donc nécessairement
inclure des mécanismes permettant de la contrôler et de l’arrêter dès que
l’objectif est atteint. La résolution d’une réponse inflammatoire implique
également le déclenchement terminal des processus de réparation tissulaire
37
(puisque nous avons vu plus haut qu’une dysfonction du tissu était
pourvoyeuse de signaux inducteurs endogènes entretenant l’inflammation).
2.1.1.3.4.1 Freins précoces
Par ce terme, on désigne les mécanismes participant au contrôle de la phase
d’expansion de la réponse inflammatoire. On peut en distinguer plusieurs
types présentés ci-dessous avec des exemples.
Au cours de l’inflammation, le seuil nécessaire au maintien de la réponse
augmente progressivement. Par exemple : l’acide arachidonique sert de
substrat à la 5-lipo-oxygénase des neutrophiles qui produisent les
leucotriènes (pro-inflammatoires). Au fur et à mesure que les neutrophiles
sont recrutés au foyer inflammatoire, ils libèrent une quantité croissante
d’acide arachidonique dans le tissu. Cet acide arachidonique est utilisé par
les cellules résidantes exprimant la 15-lipo-oxygénase pour produire la
lipoxine aux propriétés anti-inflammatoires (notamment en réduisant l’afflux
des neutrophiles) (62).
Certains signaux initialement pro-inflammatoires deviennent anti-
inflammatoires. Par exemple : la PGE2. La COX (cyclo-oxygénase)-2, dont la
synthèse est induite dans les macrophages par les produits bactériens et les
cytokines, transforme l’acide arachidonique en PGE2 qui augmente la
perméabilité vasculaire. Dans le même temps, la PGE2 inhibe la COX-2 et la
5-lipo-oxygénase tout en favorisant l’expression de la 15-lipo-oxygénase dans
les neutrophiles. Ce mécanisme détourne le métabolisme de l’acide
arachidonique vers la synthèse de lipoxine (62). L’aspirine en acétylant la
COX-2 reproduit un peu cet effet physiologique puisque la COX-2 acétylée
produit de la lipoxine au lieu de la PGE2.
Certaines protéines ont un rôle anti-inflammatoire. Comme nous avons décrit
plus haut des médiateurs pro-inflammatoires, il existe des médiateurs anti-
inflammatoires. Les mieux connus sont des cytokines, principalement l’IL-10
et le TGF-β. Le rôle anti-inflammatoire d’autres protéines a été récemment
illustré par des travaux expérimentaux utilisant des souris génétiquement
invalidées. Le CD39 est une ecto-nucléotidase exprimée à la surface des
effecteurs immunitaires, capable d’hydrolyser en adénosine les molécules
d’ATP et d’ADP sécrétées par les cellules activées ou relarguées par les
cellules nécrotiques dans le tissu. L’adénosine (à l’inverse de l’ATP et de
38
l’ADP pro-inflammatoires) possède des propriétés anti-inflammatoires (63).
L’absence de CD200 (une molécule de la superfamille des immunoglobulines)
s’accompagne d’une augmentation de l’afflux de macrophages se traduisant
par une forme plus sévère d’encéphalite allergique expérimentale ou d’arthrite
au collagène (64). En l’absence du récepteur aux intégrines gp49B1 à la
surface des mastocytes, ces derniers dégranulent de manière excessive en
réponse aux complexes Ag-IgE (65). Le CD163 est un récepteur scavenger
des complexes hémoglobine/haptoglobine dont la présence à la surface des
macrophages a été associée (in vitro et in vivo) à la résolution de
l’inflammation (66) via la production d’IL-10 et la stimulation de l’hème
oxygénase-1.
Le système nerveux autonome intervient dans le contrôle de la réponse
inflammatoire. Le nerf vague libère des décharges d’acétylcholine en
périphérie (au niveau du site inflammatoire). L’acétylcholine se lie au
récepteur nicotinique à la surface des macrophages pour bloquer la sécrétion
de TNF-α (67-69). Au niveau du système nerveux central, diverses cytokines
pro-inflammatoires (IL-1, IL-6, TNF-α…) stimulent l’axe hypothalamo-
hypophysaire afin qu’il libère de l’ACTH (AdrenoCorticoTrophic Hormone).
Cette hormone induit la production par le cortex surrénalien de
glucocorticoïdes ayant des effets immunosuppresseurs (70) et favorisant la
phagocytose des corps apoptotiques (71).
2.1.1.3.4.2 Signaux tardifs initiant la réparation tissulaire
Une des phases critiques lors de la résolution d’une réponse inflammatoire
est le déclenchement des processus de réparation tissulaire. Déclenchés trop
précocement, ils conduisent à un désastre (il suffit de se rappeler les
conséquences d’une fermeture cutanée au dessus d’une lésion non
stérilisée). Au contraire, si les processus de réparation ne sont pas
déclenchés à temps, les dégâts tissulaires provoqués par les effecteurs
inflammatoires entretiennent la réponse malgré la disparition du stimulus
initial.
Aussi longtemps que les stimuli pro-inflammatoires prédominent, les
macrophages continuent à produire des chemokines permettant de recruter
davantage de neutrophiles au foyer inflammatoire. Les ROIs et la
hyaluronidase produits par les macrophages et les neutrophiles fragmentent
39
l’acide hyaluronique de la matrice extra-cellulaire en morceaux de faible poids
moléculaire. Ces fragments se lient au TLR-4 des macrophages sur lesquels
ils agissent comme des inducteurs de l’inflammation. Les neutrophiles, dont
les intégrines de surface sont engagées, sont stimulés par le TNF-α libéré par
les macrophages pour relarguer de l’élastase. L’élastase et les ROIs activent
les MMPs qui dégradent le collagène, les protéoglycanes, et la fibronectine.
Les MMPs et l’élastase contribuent également à activer le TGF-β latent
provenant des macrophages. La conversion de la phase agressive vers la
phase de réparation de la réponse inflammatoire débute avec la sécrétion de
SLPI (72-74). Le SLPI (secretory leucocyte protease inhibitor) est un
inhibiteur des sérines protéases que les macrophages se mettent à exprimer
après un certain délai d’exposition aux signaux proinflammatoires. Le SLPI : i)
inhibe le relargage d’élastase et de ROIs par les neutrophiles stimulés par le
TNF-α, ii) inhibe directement l’élastase déjà relarguée, iii) prévient l’hydrolyse
du TGF-β, iv) se lie à la pro-épithéline et agit de manière synergique avec elle
pour stimuler la croissance des cellules épithéliales et inhiber l’activation des
neutrophiles. Les macrophages porteurs du récepteur au hyaluronan
(CD44) (75) éliminent les fragments de hyaluronan résiduels. L’afflux de
neutrophiles cesse et les neutrophiles encore présents entrent en apoptose.
Les corps apoptotiques expriment à leur surface un répertoire de molécules
(comme la phosphatidylsérine) favorisant leur phagocytose par les
macrophages (76). Les macrophages phagocytent les corps apoptotiques et
dégradent les produits résiduels des neutrophiles potentiellement délétères
pour le tissu. La phagocytose par les macrophages des corps apoptotiques
des neutrophiles stimule leur production d’IL-10 (anti-inflammatoire) et de
TGF-β (induisant les processus de réparation tissulaire) (77). Nous venons de
voir l’importance de l’élimination des neutrophiles du foyer inflammatoire (une
fois le stimulus initial disparu) pour éteindre l’inflammation. Cette résolution
nécessite également le départ des macrophages et des effecteurs de
l’immunité adaptative. Non seulement ces effecteurs de l’immunité adaptative
peuvent entrer en apoptose au site inflammatoire (comme les neutrophiles),
mais (contrairement aux neutrophiles) ils peuvent également quitter le tissu
par la circulation lymphatique (78). Les mécanismes qui contrôlent cette
émigration restent mal connus mais semblent faire intervenir des molécules
d’adhésion qui régulent les interactions monocyte/matrice et
40
monocyte/cellules stromales (79). Enfin, lors de la phase de résolution de
l’inflammation, le TNF-α provoque la synthèse d’IL-12 par les macrophages.
L’IL-12 stimule la synthèse d’IFN-γ par les lymphocytes et, alors que l’IFN-γ
agissait précédemment pour activer les macrophages, elle exerce à ce stade
un rôle inhibiteur. Il convient de souligner que comme pour la PGE2 (voir ci-
dessus), les rôles du TNF-α et de l’IFN-γ diffèrent diamétralement en fonction
de la phase de la réponse inflammatoire (80, 81). Ceci est également vrai
pour les ROIs (82, 83) et les RNIs (84, 85). Ces données expliquent pourquoi
les animaux déficients dans ces voies biologiques présentent un phénotype
complexe caractérisé par i) une susceptibilité accrue aux infections, ii) des
réponses inflammatoires réduites ou augmentées selon le modèle
expérimental et iii) pas de phénotype particulier en l’absence de stimulation
inflammatoire.
2.1.2 L’inflammation chronique
2.1.2.1 Définitions
Définir le caractère aigu ou chronique d’une inflammation paraît trivial à
première vue. L’inflammation aiguë (décrite jusqu’ici) est supposée limitée
dans le temps et suivie d’une résolution complète. Par opposition,
l’inflammation chronique se définit donc comme prolongée et s’accompagnant
d’un remodelage tissulaire avec néoangiogenèse et cicatrisation fibreuse. En
pratique cette ségrégation n’est pas toujours claire. La goutte, par exemple,
se manifeste par une succession de poussées aiguës sur plusieurs années
aboutissant à la destruction du tissu, tandis que l’intradermoréaction à la
tuberculine est un processus inflammatoire chronique totalement résolutif en
quelques semaines. Ces deux exemples montrent que le caractère résolutif
de l’inflammation n’est pas un bon moyen de distinguer les deux types de
situations. Une meilleure définition de la nature aiguë ou chronique de
l’inflammation est apportée par l’analyse histologique du tissu.
41
2.1.2.2 Caractéristiques histologiques définissant l’inflammation chronique
2.1.2.2.1 Enrichissement en effecteurs de l’immunité adaptative
Une des caractéristiques les plus marquantes distinguant l’inflammation aiguë
de l’inflammation chronique est la différence de composition des infiltrats
tissulaires. Comme nous l’avons vu ci-dessus, les premiers effecteurs
cellulaires à pénétrer dans le tissu inflammé sont les neutrophiles (dans
l’heure qui suit le stimulus initial). Assez logiquement, la réponse
inflammatoire aiguë est donc caractérisée par un infiltrat principalement
composée de polynucléaires neutrophiles (ou éosinophiles dans certaines
circonstances). Lorsque la réponse inflammatoire se prolonge, une transition
dans la nature des effecteurs cellulaires recrutés s’opère sous l’influence des
complexes IL-6/sIL-6R (voir plus haut, (59)) qui inhibent la production des
chémokines CXC (attirant les neutrophiles) au profit des chémokines CC
attirant les cellules mononuclées de l’immunité adaptative (monocytes puis
lymphocytes T et B).
2.1.2.2.2 Organisation spatiale de l’infiltrat inflammatoire : la néogenèse lymphoïde
Tandis que les infiltrats inflammatoires aigus ne présentent pas d’organisation
particulière, il a été rapporté depuis de nombreuses années que les infiltrats
inflammatoires chroniques pouvaient adopter une configuration spatiale
rappelant celle des organes lymphoïdes secondaires, i.e. ségrégation des
lymphocytes T et B avec formation de nodules lymphocytaires B (86, 87).
Par la suite, des travaux expérimentaux chez la souris ont contribué à faire
émerger l’idée que les processus moléculaires induisant l’organisation des
effecteurs immunitaires au cours de l’inflammation chronique étaient
similaires à ceux impliqués dans le développement et dans l’homéostasie des
organes lymphoïdes secondaires « professionnels » (pour une revue récente
voir : (88)). Les termes de « néogenèse lymphoïde » et « tissu lymphoïde
tertiaire» (ou TLt, « tertiary lymphoid tissue ») se sont donc progressivement
imposés pour désigner respectivement le phénomène responsable de
l’organisation de l’infiltrat et le tissu lymphoïde ectopique ainsi formé.
42
D’autres études ont depuis démontré le caractère fonctionnel du tissu
lymphoïde ectopique, capable de remplir les principales fonctions
caractéristiques des organes lymphoïdes secondaires (en particulier :
l’expansion clonale, la maturation d’affinité du BCR (89), la production
d’anticorps (90) et la génération d’une mémoire immunologique (91)). Ces
données ont servi de point de départ pour formuler l’hypothèse que le tissu
lymphoïde ectopique pourrait abriter une réponse immune locale
agressive (92), focalisant l’intérêt de la communauté médico-scientifique sur
la néogenèse lymphoïde. En conséquence, la liste des pathologies
inflammatoires chroniques dans lesquelles le processus a été identifié n’a
cessé de croître (pour une revue récente voir (93)). Le rôle exact rempli par
les TLOs au cours des pathologies inflammatoires chroniques reste toutefois
difficile à préciser. Répondre à cette question de façon définitive suppose en
effet de pouvoir interférer uniquement avec le processus local sans influencer
le reste de la réponse immune (alors que nous avons vu que les deux
processus ont en commun de nombreuses voies biologiques). Notre travail de
thèse s’inscrit dans cette problématique. La description du processus de
néogenèse lymphoïde et sa participation dans les pathologies inflammatoires
chroniques, sera donc plus longuement détaillée dans les sections
« Résultats » et « Discussion » de ce travail.
2.1.2.2.3 Remodelage tissulaire : la fibrogenèse
La fibrose est quasi-constante lors des processus inflammatoires chroniques.
Elle se définit comme l'augmentation des constituants fibrillaires de la matrice
extra-cellulaire (MEC) dans un tissu. La finalité de la fibrogenèse est de
maintenir l’intégrité structurale du tissu lorsque des processus de nécrose ont
fait apparaître des zones de « défect » cellulaire.
La MEC est une structure multi-moléculaire (collagène, élastine,
glycoprotéines de structure comme la fibronectine et la laminine,
mucopolysaccharides comme les glycosaminoglycanes et les protéoglycanes)
complexe organisée en un réseau tridimensionnel. Elle assure un rôle de
soutien mécanique des tissus et un rôle dans l'échange de messages via les
molécules d'adhérence cellulaire et leurs ligands dans la MEC et via les
cytokines présentes dans la MEC. La MEC est un milieu dynamique,
physiologiquement en équilibre entre les processus de synthèse, de
43
déposition dans le milieu extracellulaire, et de dégradation de ses constituants
qui sont assurés par les cellules stromales. Les cellules stromales
(notamment les fibroblastes) sont responsables simultanément de la
production des constituants de la MEC, des enzymes capables de les
dégrader (collagénases, élastases, métalloprotéinases...) et des inhibiteurs
spécifiques de ces enzymes.
Les mécanismes de la fibrogenèse au cours de l’inflammation chronique sont
imparfaitement connus mais la participation de nombreux facteurs solubles a
été démontrée. Le TGF-β est considéré comme le facteur clé de la
fibrogenèse. Il est sécrété dans la MEC ou exprimé à la surface des cellules
sous une forme inactive. Après activation par clivage protéolytique, le TGF-β :
i) stimule la prolifération et différenciation des fibroblastes et myofibroblastes,
ii) stimule la transcription des gènes des protéines de la MEC et stabilise leur
ARNm, iii) diminue la dégradation de la MEC en inhibant la sécrétion des
collagénases et en augmentant celle des inhibiteurs tissulaires des
métalloprotéinases. Les cytokines pro-inflammatoires IL-1 et TNF-α stimulent
la prolifération des fibroblastes et la synthèse des constituants de la matrice.
Certains facteurs de croissance : FGF (fibroblast growth factor), PDGF
(platelet derived growth factor), EGF (epidermal growth factor), participent
également au processus en favorisant la prolifération des fibroblastes et des
cellules musculaires lisses et leur migration vers un lieu d'agression.
Plus récemment un autre mécanisme, appelé transition épithélio-
mésenchymateuse (EMT, epithelial-mesenchymal transition), a été identifié.
L’EMT correspond à la transformation de cellules épithéliales hautement
différenciées du tissu en fibroblastes (94). Les cellules inflammatoires
produisent divers facteurs (les plus importants étant le TGF-β, l’EGF et le
FGF) qui stimulent la production de protéases (notamment les MMPs) par les
fibroblastes résidents et par les cellules épithéliales. La dégradation de la
membrane basale provoque une désorganisation de l’épithélium et un
détachement des cellules épithéliales, certaines migrant dans l’interstitium
vers le foyer inflammatoire (en suivant le gradient des chémokines et facteurs
de croissance). Sous l’influence du TGF-β et des autres facteurs de
croissance, les cellules épithéliales se différencient en fibroblastes qui
participent au processus de fibrogenèse. Le principal inhibiteur de l’EMT (au
moins dans les processus de fibrogenèse rénale) est la BMP (bone
44
morphogenic protein)-7 (95). L’EMT reste à l’heure actuelle le sujet de
polémiques concernant sa réelle implication dans les processus de
fibrogenèse post-inflammatoire chez l’adulte.
2.1.2.2.4 Remodelages vasculaires
2.1.2.2.4.1 Angiogenèse
Les capillaires sont les vaisseaux sanguins les plus fins de l’organisme.
Situés entre le réseau artériel et le réseau veineux, ils pénètrent dans les
tissus dont ils assurent la nutrition. L’angiogenèse désigne le mécanisme par
lequel de nouveaux capillaires sont formés. On sait depuis peu que deux
mécanismes distincts existent : l’angiogenèse par bourgeonnement et
l’angiogenèse par intussusception.
L’angiogenèse par intussusception ne sera pas détaillée ici. Découverte plus
récemment lors de l’examen de fœtus, elle correspond à la formation de
nouveaux vaisseaux sanguins par la division interne d’un capillaire pré-
existant. Elle se différencie de l’angiogenèse par bourgeonnement par son
faible besoin en prolifération des cellules endothéliales et semble jouer un
rôle particulièrement important lors du développement embryonnaire (96).
L’autre mécanisme conduisant au développement de nouveaux capillaires est
l’angiogenèse par bourgeonnement. Elle fait intervenir une succession
d’étapes de mieux en mieux caractérisées : i) activation du « switch »
angiogénique par la liaison de facteurs de croissance sur les récepteurs à la
surface des cellules endothéliales veineuses, ii) les cellules endothéliales
activées relarguent des protéases capables de digérer la membrane basale
permettant aux cellules endothéliales de quitter la paroi du vaisseau, iii) les
cellules endothéliales prolifèrent dans la matrice avoisinante et constituent un
bourgeon connecté au vaisseau initial, iv) le bourgeon s’étend en direction de
la source des facteurs angiogéniques (plusieurs mm par jour !).
Depuis les travaux pionnier de Folkman dans les années 1960 (97, 98), des
progrès considérables ont été réalisés dans le décryptage des bases
moléculaires de l’angiogenèse. Il s’agit d’un processus extrêmement
complexe que nous ne détaillerons pas ici. Schématiquement, de nombreux
facteurs pro- et anti-angiogéniques ont été identifiés et on considère que le
réseau vasculaire est quiescent dans les conditions basales parce que le «
45
switch » angiogénique est éteint, i.e. la balance entre les facteurs pro et anti-
angiogéniques est en faveur de ces derniers. L’allumage du « switch »
requiert la synthèse de facteurs pro-angiogéniques (99, 100) parmi lesquels le
VEGF semble jouer un rôle majeur. En se fixant sur le VEGF-R2 à la surface
des cellules endothéliales le VEGF déclenche la production de molécules
influençant : i) la perméabilité vasculaire (NO, nitric oxide ; par stimulation de
eNOS, endothelial NO synthase), ii) la prolifération et la survie des cellules
endothéliales et des cellules musculaires lisses (bFGF, basic fibroblast growth
factor), iii) la migration des cellules endothéliales et des cellules musculaires
lisses (PDGF, platelet derived growth factor ; ICAMs, inter cellular adhesion
molecules ; VCAMs, vascular cellular adhesion molecules ; MMPs), iv) la
différenciation en vaisseau sanguin mature (angiopoïétines 1 et 2).
Les liens entre angiogenèse et inflammation sont bidirectionnels et favorisent
la mise en place d’une boucle d’amplification. Les cytokines pro-
inflammatoires IL-1, IL-6, TNF-α stimulent l’expression de VEGF (101) via
l’activation de NFκB dans divers types cellulaires. D’autres médiateurs de
l’inflammation jouent le même rôle, notamment le peroxyde d’hydrogène,
COX-2, PGE2. L’angiogenèse qui résulte de la réponse inflammatoire,
participe en retour à l’exacerbation de l’inflammation. En effet, les
néovaisseaux sont autant de portes d’entrée dans le tissu inflammé pour les
effecteurs immunitaires (cf le paragraphe 2.1.2.2.4.2) et le VEGF: i) augmente
la perméabilité vasculaire (102), ii) exerce un effet chimiotactique sur les
leucocytes (103), iii) induit l’expression de molécules d’adhérence (ICAMs et
VCAMs) sur les cellules endothéliales (104), et iv) favorise la polarisation Th1
des lymphocytes ce qui augmente l’activité cytotoxique et réduit la synthèse
d’IL-10 anti-inflammatoire (105).
2.1.2.2.4.2 Modifications phénotypiques des cellules endothéliales des veinules post-capillaires
Les veinules post-capillaires constituent le site d’extravasation des effecteurs
cellulaires dans les tissus (106). Nous avons déjà vu plus haut que
l’inflammation (via certains médiateurs notamment les cytokines pro-
inflammatoires IL-1 et TNF-α) activait les cellules endothéliales des veinules
post-capillaires induisant l’expression de divers ligands (sélectines,
chémokines, ligands des intégrines) indispensables aux phénomènes
46
séquentiels aboutissant au passage des effecteurs cellulaires (cellules
activées ou mémoires), du courant sanguin au tissu. Nous avons également
déjà souligné la nécessité, pour le maintien de l’homéostasie du système
immunitaire adaptatif, d’assurer la circulation des lymphocytes naïfs de leur
site de naissance (la moëlle osseuse) à leur site de stockage (les organes
lymphoïdes secondaires). Dans ce dernier cas, l’extravasation des
lymphocytes naïfs survient au niveau des veinules post-capillaires des
organes lymphoïdes secondaires en dehors de toute inflammation. Ceci n’est
possible qu’en raison de la présence de cellules endothéliales spécialisées,
capables de recruter sélectivement et avec une grande efficacité les
lymphocytes naïfs depuis le courant sanguin. L’aspect morphologique
particulier de ces cellules (cuboïdes avec un cytoplasme riche en organelles,
envoyant des prolongements cytoplasmiques dans la lumière du capillaire) a
conduit à les baptiser HEV (high endothelial veinule) (107). Les bases
moléculaires par lesquelles les HEV sont capables de recruter les
lymphocytes naïfs ont été élucidées plus récemment. L’attachement des
lymphocytes naïfs à la surface des HEV se fait par l’interaction entre la L-
sélectine à leur surface et des ligands exprimés par l’HEV, reconnus par
l’anticorps monoclonal MECA-79 et désignés sous le terme de PNAd
(peripheral lymph node addressin) (108). Les PNAd sont constituées par une
charpente glycoprotéique de GlyCAM-1, CD34 ou sgp200 (109) modifiée au
niveau post-transcriptionnel. Les étapes de fucosylation et de sialylation de la
charpente dépendent des sulfotransférases dont l’expression est restreinte
aux HEV, notamment l’HEC-6ST (110), et permettent de générer l’épitope
sulfosialyl-LewisX (reconnu par MECA-79).
Lors de l’inflammation chronique, les cellules endothéliales des veinules post
capillaires périphériques changent de morphologie (111) et acquièrent le
phénotype des HEV (112). Elles deviennent ainsi capables de recruter au
niveau du tissu inflammé des lymphocytes naïfs (tandis qu’en situation
d’inflammation aiguë, l’infiltrat est principalement composé de lymphocytes
mémoires ou activés) ce qui pourrait favoriser le phénomène d’« épitope
spreading » (113).
47
2.1.2.2.4.3 Lymphangiogenèse
La pression hydrostatique dans les vaisseaux sanguins est reponsable d’une
fuite de liquide et de protéines des capillaires vers l’interstitium permettant
d’assurer la nutrition des tissus. Un réseau de vaisseaux lymphatiques
collecte la lymphe à ce niveau et la retourne à la circulation sanguine via le
canal thoracique. Le réseau lymphatique assure un autre rôle fondamental : il
sert de voie de communication au système immunitaire en assurant la
connexion entre les tissus périphériques et les organes lymphoïdes
(notamment les ganglions drainants). Les cellules dendritiques patrouillent en
permanence dans les tissus où elles échantillonnent les antigènes présents
avant de gagner les ganglions lymphatiques (via les lymphatiques afférents)
pour y présenter les antigènes aux clones lymphocytaires T et B
quiescents (114).
Les premières observations liant inflammation et prolifération des vaisseaux
lymphatiques remontent aux années 30. Les mécanismes moléculaires mis
en jeu sont de compréhension plus récente. Les cytokines pro-inflammatoires
induisent la production de VEGF (vascular endothelial growth factor)-C par les
macrophages (115) en stimulant la transcription de ces gènes via la fixation
de NFκB au niveau des séquences promotrices (116). Le VEGF-C et le
VEGF-D sont les deux principaux facteurs de croissance des cellules
endothéliales lymphatiques. Ils agissent en se fixant à leur récepteur le
VEGF-R3 (117). La formation de nouveaux lymphatiques se fait par deux
mécanismes : bourgeonnement à partir de lymphatiques préexistants (par
division des cellules endothéliales lymphatiques) ou trans-différentiation de
macrophages exprimant le VEGF-R3 en cellules endothéliales
lymphatiques (Figure 3).
48
Figure 3 Mécanismes impliqués dans la lymphangiogenèse (Tiré de Kerjaschki, J Clin Invest (2005), p2316-2319)
Certains monocytes circulants expriment le VEGFR3 constitutivement. Ces monocytes quittent les vaisseaux sanguins et suivent deux voies distinctes conduisant à la génération de nouveaux lymphatiques dans les tissus. Voie A (flèche verte) : les monocytes, exposés au TNF-α produit par le stroma inflammé, sont convertis en macrophages producteurs de VEGF-C stimulant la prolifération des cellules endothéliales lymphatiques. Voie B (flèche rouge) : les macrophages se trans-différentient en cellules endothéliales lymphatiques en formant des agrégats cellulaires puis des vésicules qui s’intègrent aux vaisseaux lymphatiques existants.
49
La lymphangiogenèse joue un rôle important dans la régulation de la réponse
inflammatoire. L’inhibition de la lymphangiogenèse au cours de la réponse
inflammatoire exacerbe l’œdème tandis que la réaction au niveau du ganglion
lymphatique drainant est réduite, soulignant le rôle majeur du réseau
lymphatique comme voie de sortie du tissu inflammé pour les effecteurs
immunitaires et l’ultratfiltrat résultant de l’augmentation de la perméabilité
vasculaire (118). La migration centrifuge (du foyer inflammatoire vers les
ganglions) des effecteurs immunitaires est controlée par la chémokine
CCL21, exprimée à la surface des cellules endothéliales lymphatiques, et
reconnue par le récepteur CCR7 des cellules immunitaires. D’autres
molécules jouent aussi ce rôle : mannose receptor 1 (119), CLEVER
(common lymphatic endothelial and vascular receptor)-1 (120). Les cellules
lymphatiques humaines expriment également le récepteur aux chémokines
D6 qui est impliqué dans l’élimination des chémokines lors de la phase de
résolution de l’inflammation (121).
2.1.2.3 Mécanismes induisant la chronicisation de l’inflammation
2.1.2.3.1 Déficit du tonus anti-inflammatoire
Le concept le plus largement répandu à propos de l’inflammation (et que nous
avons présenté jusqu’ici) est qu’il s’agit d’une « réponse », i.e. un processus
fini (avec un début et une fin) déclenché par un stimulus agressif inhabituel.
Dans ce court paragraphe, nous voudrions rapporter l’idée proposée par Carl
Nathan (122) que l’inflammation est « un tonus ». En d’autres termes : que
l’état inflammatoire d’un tissu à un instant « t » dépend de l’intégration
continue de signaux pro- et anti-inflammatoires. Ceci sous-entend qu’il existe
perpétuellement des signaux pro-inflammatoires (tonus pro-inflammatoire) et
que le maintien d’un état basal non-inflammatoire dépend d’un processus actif
qui doit les équilibrer (tonus anti-inflammatoire).
Ce concept s’appuie sur l’observation que la perte de fonction de certains
gènes peut provoquer le développement d’une réponse inflammatoire sans
stimulus surajouté. On connaît depuis les années 70 l’association entre déficit
en C1q et lupus chez l’homme (123). Depuis, une liste de plus de 50 gènes,
dont la perte de fonction est associée à un phénotype inflammatoire, a été
établie à partir de données cliniques ou expérimentales (Table 4).
50
Ces gènes indispensables au maintien d’un tonus anti-inflammatoire peuvent
êtres divisés en plusieurs familles fonctionnelles : i) ceux qui sont impliqués
dans l’élimination des débris cellulaires et des complexes immuns ii) ceux qui
régulent les étapes d’activation, de prolifération et d’apoptose des effecteurs
cellulaires de l’immunité et iii) ceux qui préviennent le stress oxydatif.
Quelques remarques pour conclure ce paragraphe :
-certains de ces gènes « anti-inflammatoires » sont mieux connus
pour leur contribution essentielle lors du développement des
réponses inflammatoires (tels que : le TNF-R1 ou NFκB). On
retrouve ici une caractéristique déjà soulignée plus haut : la dualité
fonctionnelle de certaines molécules responsables du
développement ou de l’extinction de la réponse inflammatoire selon
le contexte et le moment.
-les phénotypes inflammatoires déclenchés par la mutation de ces
gènes sont très dépendants du terrain génétique, de l’âge, du
sexe, de l’environnement.
-les raisons pour lesquelles la perte de fonction de certains gènes
se traduit parfois par des conséquences inflammatoires pour un
tissu alors que l’expression de ce gène n’est pas restreinte à ce
tissu ne sont pas comprises.
-d’une façon générale, certains tissus semblent être plus fréquemment atteint
lors de ces mutations (peau et poumon > rein > articulations > colon et foie >
cœur > pancréas > yeux > autres organes). Ces organes sont les plus gros
(peau, poumons, colon, foie), les plus exposés aux microbes (peau,
poumons, colon, foie, yeux) ou ceux dans lesquels se déposent les
complexes immuns (peau, reins, articulations).
51
Table 4 Liste des gènes dont l’invalidation ou la mutation s’accompagne d’un état inflammatoire (Tiré de Nathan, Nature (2008), p846-852)
52
2.1.2.3.2 Persistance du stimulus agressif
Le mécanisme le plus évident provoquant le passage à la chronicité de la
réponse inflammatoire est la persistance du stimulus agressif initial.
L’incapacité du système immunitaire à supprimer le stimulus agressif peut
résulter : i) d’un défaut intrinsèque du système immunitaire (déficit
immunitaire inné ou acquis, polymorphismes), ii) de phénomènes actifs mis
en place par les pathogènes ou par les tumeurs pour échapper au système
immunitaire (mécanisme d’immuno-évasion), ou iii) peut être liée à la
reconstitution permanente du stock d’antigènes par le tissu (comme dans le
cas des tumeurs ou dans celui des pathologies auto- et allo-immunes).
Les stratégies d’immuno-évasion mises en place par les tumeurs ou les
pathogènes sont trop nombreuses pour que nous en établissions une liste
exhaustive ici. A titre d’exemples on peut rappeller brièvement ci-dessous les
principaux mécanismes identifiés dans l’échappement des cellules tumorales
au système immunitaire et qui aboutissent à la mise en place d’une
inflammation chronique (Figure 4): i) activation des cellules T sans molécules
de costimulation, induisant une anergisation des clones antitumoraux, ii)
inhibition des effecteurs lymphocytaires par le recrutement des cellules
myéloides immatures immunorégulatrices, l’expression de l’indeolamine
oxydase, et la conversion de lymphocytes T régulateurs, iii) expression de
molécules immunomodulatrices à la surface des cellules tumorales (B7-H1,
HLA-G, HLA-E) ou solubles (TGF-β, IL-10, gangliosides), iv) mutation
induisant une modification des antigènes cibles, v) expression réduite des
molécules HLA présentant l’antigène aux effecteurs, vi) résistance à la
cytotoxicité par mutation de Fas et de TRAIL receptor death receptor 5 (DR5)
et augmentation de l’expression des molécules anti-apoptotiques (FLIP, Bcl-
XL) (124).
53
Figure 4 Interaction entre le système immunitaire et les tumeurs (Tiré de Swann et al, J Clin Invest (2007), p1137-1146)
Les interactions entre le système immunitaire et les tumeurs peuvent se diviser en trois phases successives (« les 3 E de Schreiber »): i) l’élimination, au cours de laquelle les effecteurs immuns détectent et éliminent les cellules cancéreuses avant que la tumeur ne devienne cliniquement apparente ii) une phase d’équilibre dynamique, au cours de laquelle les effecteurs immuns parviennent à contrôler l’expansion tumorale iii) une phase d’échappement, au cours de laquelle les cellules cancéreuses présentent une immunogénicité réduite et/ou utilisent une large gamme de stratégies d’immnosuppressives pour échapper aux effecteurs immunitaires et permettre à la tumeur de croître.
2.1.2.3.3 Défaut de résolution de l’inflammation
Nous avons vu plus haut que l’extinction d’une réponse inflammatoire
nécessite la mise en place coordonnée de divers mécanismes. Un défaut de
ce processus peut prolonger l’inflammation malgré l’élimination du stimulus
agressif et favoriser une déviation de la réponse vers des néoantigènes
(epitope spreading) appartenant éventuellement au soi comme ceux de la
matrice extra-cellulaire (125).
54
L’équipe de Buckley (126, 127) a beaucoup étudié les mécanismes
d’entretien de la réponse inflammatoire lors de diverses pathologies auto-
immunes (syndrome de Sjögren, sclérose en plaque et polyarthrite
rhumatoïde). Leur hypothèse est que la cellule stromale des tissus cibles joue
un rôle pivot dans le maintien de l’inflammation en interférant avec les
processus de résolution de la réponse. Les cellules stromales activées par les
signaux de danger produisent, en plus des chémokines inflammatoires,
diverses chémokines homéostatiques (notamment SDF-1 ou CXCL-12,
CXCL-13, CCL-19 et CCL-21). La présence de ces chémokines
homéostatiques « mime » le micro-environnement des organes lymphoïdes
secondaires (comme les ganglions lymphatiques) et s’oppose donc à
l’émigration via les lymphatiques des effecteurs de l’immunité adaptative. (NB
: ce processus pourrait aussi jouer un rôle dans l’organisation des infiltrats
inflammatoires, cf le paragraphe 2.1.3.2.2 concernant la néogenèse
lymphoïde). Les cellules stromales participent également au maintien de
l’infiltrat inflammatoire par un autre mécanisme. Nous avons vu plus haut que
l’apoptose des effecteurs immunitaires jouait un rôle important lors de la
résolution de la réponse inflammatoire. Les cellules stromales activées
produisent de l’IFN-β qui prévient l’induction de l’apoptose médiée par Fas ou
secondaire à la déprivation en cytokines, par l’augmentation de Bcl-XL et en
s’opposant à la translocation de la PKC (protéine kinase C)-
δ (128) (Figure 5).
55
Figure 5 Paramètres régulant la taille de l’infiltrat inflammatoire (Adapté de Douglas et al, Exp Rev Mol Med (2002), p1-18)
La taille de l’infiltrat leucocytaire au foyer inflammatoire est la résultante d’une balance dynamique entre le recrutement des cellules, leur division, leur émigration et leur mort. (A) Lors de la phase terminale d’une réponse inflammatoire aiguë, l’homéostasie entre ces mécanismes est maintenue permettant la résolution de l ‘épisode. (B) La sécrétion inappropriée par le stroma de chémokines (provoquant la rétention des cellules) et d’IFN-β (aux effets anti-apoptotiques) conduit à l’accumulation des leucocytes dans le tissu cible et favorise le passage à la chronicité de l’inflammation.
56
2.1.2.4 Inflammation chronique : la problématique clinique
L’inflammation chronique est le substratum biologique de très nombreuses
situations cliniques dans lesquelles son rôle peut être bénéfique (par exemple
dans l’immunité anti-tumorale) ou délétère (par exemple les maladies auto-
immunes : polyarthrite rhumatoïde, lupus érythémateux disséminé…). En
dépit des progrès réalisés ces dernières années dans la compréhension des
bases cellulaires et moléculaires participant à la réponse inflammatoire
chronique, beaucoup d’aspects physiopathologiques restent mal compris.
Ceci explique sans doute pourquoi les avancées thérapeutiques dans le
domaine sont restées décevantes. Actuellement nous ne disposons que de
thérapeutiques coûteuses et transitoires, qui ne soulagent les symptômes
qu’au prix d’effets indésirables majeurs. Améliorer notre connaissance de la
physiopathologie de l’inflammation chronique pourrait nous permettre
d’identifier de nouvelles cibles thérapeutiques plus efficaces. Inversement,
mieux comprendre les raisons pour lesquelles le système immunitaire
maintien une réponse au long cours pourrait nous offrir des pistes pour
améliorer nos stratégies de vaccination anti-infectieuse ou anti-tumorale.
2.2 Le rejet d’allogreffe en transplantation: un modèle de
pathologie inflammatoire chronique
2.2.1 La transplantation d’organe : généralités
2.2.1.1 Bref historique
Si les débuts de la transplantation coïncident avec les premières greffes de
tissus réalisées à la fin du XIXe siècle (en 1869 à Genève, Jacques-Louis
Reverdin réalise la première greffe épidermique, et en 1914 à Prague,
Elschwig greffa la première cornée), ceux de la transplantation d’organes
furent plus tardifs du fait, principalement, de deux obstacles majeurs.
La maîtrise de la suture vasculaire, préalable technique indispensable, fut
obtenue au début du XXe siècle sous l’impulsion de l’École de chirurgie
lyonnaise conduite par Alexis Carrel (Prix Nobel de médecine 1912) et
Mathieu Jaboulay. Ce dernier peut d’ailleurs être considéré comme le père de
la transplantation d’organes puisqu’il essaya dès 1906 de transplanter un rein
de chèvre au coude d'une femme urémique (Figure 6A).
57
L’échec de cette première xénotransplantation fut suivi de multiples tentatives
infructueuses pratiquées avec des reins provenant de cadavres. Mais il faudra
attendre les années 1950 pour que les raisons de ces échecs soient enfin
comprises. Jean Hamburger réalise à l’hôpital Necker en 1952, une allogreffe
de rein chez un jeune patient en utilisant un greffon prélevé chez la mère
(transplantation HLA semi-identique) et obtient une survie jusque-là inégalée
de 21 jours (129) (Figure 6C, gauche). La technique chirurgicale mise au
point à cette occasion par René Küss, consistant à placer le rein en position
hétérotopique dans la fosse iliaque droite, est restée inchangée
depuis (Figure 6D, gauche). Peu après, John Merill et Joseph Murray (Prix
Nobel de Médecine 1990) rapportent le premier succès d’une transplantation
rénale réalisée à Boston en 1954 entre deux jumeaux homozygotes
(transplantation HLA identique) (Figure 6C, milieu et droite). Ces deux
observations conduisent à postuler que certains facteurs génétiques
contrôlent la compatibilité tissulaire entre donneur et receveur. La preuve
scientifique confirmant cette hypothèse fut apportée en 1958 par les travaux
de Jean Dausset (130), qui identifia les groupes leucocytaires caractéristiques
de chaque individu (HLA, human leukocyte antigens), homologues chez
l’homme des groupes "H2" déjà décrits par l’Américain Snell chez la
souris (131) (Prix Nobel de Médecine 1980) (Figure 6B).
Une fois identifié, l’obstacle immunologique fut progressivement aplani grâce
aux progrès des thérapeutiques immunosuppressives : la découverte des
corticoïdes (1950), l’irradiation du receveur par les rayons X (1955), utilisation
de l’azathioprine (1960) (132). C’est finalement en 1959 que furent obtenus
les deux premiers succès d’allogreffe rénale chez l’homme, entre jumeaux
hétérozygotes, l’une à Boston, sous la direction de J. Merill (133), l’autre à
Paris sous la direction de Jean Hamburger (134). Par la suite, la
transplantation rénale fut étendue aux greffes entre non-jumeaux. Cependant,
le manque d’efficacité des thérapeutiques immunosuppressives exposait
toujours à la perte rapide des greffons par rejet aigu, et les progrès plus lents
des procédures de réanimation (notamment la lutte contre l’infection) posaient
le problème de la survie des receveurs immunosupprimés.
En 1972, Jean-François Borel (Sandoz, Bâle) découvrit les propriétés
immunosuppressives de la ciclosporine (Figure 6D, milieu et droite), capable de diminuer considérablement la fréquence et l’intensité des crises
58
de rejet aigu. Dans le même temps, les progrès des thérapeutiques anti-
infectieuses et des modalités de surveillance des transplantés permirent de
réduire la mortalité des patients, ouvrant la voie à des survies prolongées et
suscitant une explosion de programmes internationaux de transplantation
dans le domaine du foie (135), du pancréas, du coeur (136), du poumon et
plus récemment des transplantations de tissus composites (137, 138).
59
Figure 6 Bref historique illustré de la transplantation d’organe
A) Gauche: Alexis Carrel inventeur de la technique d’anastomose vasculaire présentée au milieu. Droite: Mathieu Jaboulay qui réalisa la première xenotransplantation en 1906. B) Gauche: Georges Snell découvreur du système d’histocompatibilité H2 chez la souris. Milieu: organisation du locus HLA sur le bras court du chromosome 6 chez l’homme et à droite son découvreur: Jean Dausset. C) Gauche: Jean Hamburger. Milieu: toile de Joel Balb exposée à Harvard représentant la première transplantation rénale réalisée en 1954 entre les jumeaux monozygotes Herricks par Murray et Merril en photo à droite. D) Gauche: René Küss. Milieu: Tolypocladium inflatum, champignon à partir duquel Jean Borel (à gauche) a isolé la ciclosporine.
60
2.2.1.2 Résultats et limites actuelles
Parmi les transplantations, il faut distinguer les “transplantations vitales” qui
représentent la seule alternative thérapeutique en cas de défaillance
terminale du cœur, du foie et du poumon, et les greffes de rein et/ou de
pancréas. Dans les deux derniers cas, un traitement alternatif à la
transplantation existe et permet de remplacer la fonction de l’organe défaillant
(respectivement la dialyse et l’insuline). Même lorsque la transplantation n’est
pas vitale, elle reste souvent la meilleure option thérapeutique. Dans le cas de
l’insuffisance rénale par exemple, la transplantation présente des avantages
individuels et en terme de santé publique. Sur le plan individuel, les progrès
réalisés dans la prise en charge des transplantés ont permis d’obtenir une
très faible mortalité, inférieure à celle observée chez les patients en
hémodialyse (survie à respectivement 1, 5 et 10 ans : 96%, 85% et 83%
(UNOS data report)). De plus, plusieurs études ont montré que la qualité de
vie des transplantés avec un greffon fonctionnel était largement supérieure à
celle des patients en dialyse (139, 140). En terme de santé publique, la
transplantation rénale, est beaucoup moins coûteuse que l’hémodialyse.
Passées les deux premières années, les coûts annuels de prise en charge
d’un patient transplanté sont inférieurs de 35 à 55% par rapport à ceux d’un
hémodialysé chronique (141). Concernant la dialyse péritonéale, l’avantage
financier de la transplantation rénale est moins évident, mais cette dernière se
révèle en revanche beaucoup plus performante.
Les progrès réalisés font que les indications de transplantation augmentent
rapidement (recul de l’âge limite pour une transplantation, re-transplantation,
co-morbidités plus sévères acceptées…). Les efforts consentis pour optimiser
l’activité de prélèvement ont permis d’obtenir une augmentation régulière du
nombre des patients transplantés mais ne suffisent pas à couvrir le fossé
entre offre et demande. Il en résulte un allongement des listes d’attentes,
(donc du temps passé à attendre) responsable de « décès sur liste
» (Figure 7). Cette problématique centrale dans le monde de la
transplantation d’organe ne peut être résolue qu’en travaillant dans 2
directions : augmenter le nombre des greffons disponibles et optimiser le
temps pendant lequel les organes transplantés fonctionnent.
61
Figure 7 Evolution de la balance entre l’offre et la demande en transplantation d’organe au cours des 5 dernières années en France
Les barres noires de l’histogramme indiquent le nombre de nouveaux inscrits sur liste d’attente et les barres blanches le nombre de transplantations effectuées, tous organes confondus, au cours de l’année correspondante. La courbe en dessous illustre l’évolution croissante de la taille des listes d’attente en raison d’une augmentation moins rapide du nombre de greffons disponibles par rapport au nombre de nouveaux inscrits.
62
Les initiatives visant à augmenter le nombre d’organes disponibles pour la
greffe sont nombreuses. Sur le plan médiatique, on ne compte plus les
manifestations locales ou internationales (par exemple : la journée mondiale
du don d’organe mise en place depuis 2005) pour faire connaître la greffe et
sensibiliser la population au don d’organe. Sur le plan politique, la loi du 22
décembre 1976 (« Loi Caillavet ») a introduit la notion de consentement
présumé : chaque personne n'ayant pas fait connaître son refus (en
s’inscrivant sur un registre national crée en 1998), est implicitement en faveur
du don d'organes. Cependant, même si des progrès importants restent à faire
pour optimiser le prélèvement sur donneur en mort encéphalique, cette
source sera vraisemblablement insuffisante pour mettre fin à la pénurie. On
cherche donc parallèlement à diversifier les sources d’approvisionnement :
prélèvement de donneurs cadavériques dits « marginaux » (définis comme
des donneurs de plus de 60 ans ou entre 50 et 59 ans morts d’AVC, ayant un
antécédent d’HTA ou une créatininémie > 135µmol/l), donneurs à cœur
arrêté; don vivant.
Résoudre le problème de la pénurie d’organes passe également par
l’optimisation de la durée de fonctionnement des organes transplantés. Dans
ce domaine, la marge de progression est énorme. En effet, si le
développement des nouvelles molécules immunosuppressives (et notamment
l’apparition de la ciclosporine dans les années 80), a considérablement
amélioré le devenir à court terme des greffons, le devenir à long terme a été
peu modifié (142). Au-delà de la première année, la principale cause de perte
des greffons (en dehors du décès du receveur le plus souvent d’origine
cardio-vasculaire) est la dysfonction chronique du greffon (143). Ce terme, qui
désigne le déclin progressif et irréversible de fonction de l’organe, recouvre
une physiopathologie complexe et composite dans laquelle interviennent à la
fois des facteurs non-immunologiques et immunologiques (Figure 8). Tout se
passe en fait comme si les nouvelles stratégies immunosuppressives avaient
modifié la nature clinique du rejet d’allogreffe en transformant une pathologie
aiguë en une situation inflammatoire chronique.
63
Figure 8 Facteurs impliqués dans la physiopathologie de la dysfonction chronique du greffon renal (Adapté de Pascual et al, N Engl J Med (2002), p580-590)
2.2.2 Le rejet d’allogreffe
2.2.2.1 Classification clinique des rejets
Classer les épisodes de rejet, i.e. de dysfonction du greffon d’origine
immunologique, s’est rapidement imposé comme une nécessité aux cliniciens
pionniers de la transplantation qui souhaitaient établir des groupes de patients
homogènes pour tester des stratégies thérapeutiques.
Trois types de rejets ont été individualisés sur la base de leur cinétique
d’apparition et de leur présentation clinique:
-le rejet hyperaigu. Mode de rejet à part compliquant les
transplantations d’organes faites chez des receveurs « immunisés
». La présence d’anticorps préformés contre le greffon se traduit
par une destruction immédiate des cellules endothéliales avec
thrombose extensive conduisant à la perte immédiate du greffon.
-le rejet aigu. Sa fréquence est maximale au cours des premiers
mois post-transplantation et décroît rapidement pour devenir rare
au-delà de la première année. Il se présente comme une
64
dysfonction aiguë du greffon répondant habituellement à un
traitement par corticostéroïde à forte dose.
-le rejet chronique. Sa définition a longtemps été confondue avec
celle de la dysfonction chronique du greffon. La mise en évidence
du rôle majeur des facteurs non-immunologiques (telle que la
néphrotoxicité des immunosuppresseurs et notamment des anti-
calcineurines) dans la dégradation progressive de la fonction des
greffons a conduit à réserver le terme de « rejet chronique » à la
part revenant au système immunitaire du receveur dans la
dysfonction chronique du greffon.
Cette classification clinique a profondément influencé la vision des chercheurs
travaillant sur la réponse alloimmune. En conséquence, ces derniers ont
d’abord tenté de disséquer la physiopathologie de ces trois tableaux cliniques
comme s’il s’agissait d’entités distinctes. Par la suite, les documents de
synthèse faisant le lien entre données expérimentales, histologiques et
cliniques, ont contribué à renforcer ce trait en présentant systématiquement
ces trois tableaux dans des chapitres séparés. Plusieurs exemples
démontrent le caractère artificiel et caricatural de cette vision. Des travaux
cliniques ont démontré depuis longtemps le lien entre la fréquence et
l’intensité des épisodes de rejet aigu et la survenue d’un rejet
chronique (144). D’autre part, l’immunité de la greffe a ceci de particulier que
les cellules présentatrices de l’antigène activant les lymphocytes du receveur
peuvent avoir deux origines : donneur (présentation directe) ou receveur
(présentation indirecte). Il était donc tentant de proposer qu’à chacune de ces
présentations correspondait un type de rejet (présentation directe => rejet
aigu ; présentation indirecte => rejet chronique). On sait maintenant que la
présentation indirecte participe aussi à la physiopathologie des épisodes de
rejet aigu et réciproquement (cf paragraphe 2.2.2.2.1.2). Enfin, il a longtemps
été avancé que la réponse humorale était critique dans le rejet chronique par
opposition au rejet aigu dont les mécanismes effecteurs seraient cellulaires.
La démonstration récente que les formes de rejet aigu autrefois appelées «
cortico-résistantes » sont en réalité des rejets aigus à médiation humorale
vient battre en brèche l’idée que les bras effecteurs de la réponse alloimmune
seraient différents dans les rejets aigus et chroniques.
65
Nous pensons qu’une vision moderne du rejet d’allogreffe consiste à le
considérer comme une seule entité : la réponse du système immunitaire du
receveur aux alloantigènes portés par les cellules du greffon. Cette vision
dépasse le cadre de la réponse alloimmune en incluant, en plus de cette
réponse adaptative, les effecteurs de l’immunité innée qui participent (via les
lésions d’ischémie reperfusion) à la phase initiale de sensibilisation du
système immunitaire du receveur vis-à-vis des alloantigènes cibles (145).
Cette sensibilisation est suivie d’une phase effectrice, responsable des dégâts
tissulaires et dont la présentation clinique varie (selon l’intensité de la réponse
et la nature des effecteurs recrutés) en fonction du traitement
immunosuppresseur reçu, et de nombreux autres facteurs. Parce que la
réponse alloimmune ne parvient jamais à éliminer complètement les
alloantigènes cibles (qui sont sans cesse renouvelés par le greffon), elle dure
aussi longtemps que le greffon reste en place chez le receveur. Cet angle de
vision souligne donc la grande similitude existant entre le rejet d’allogreffe et
les autres pathologies inflammatoires chroniques.
2.2.2.2 La réponse alloimmune
2.2.2.2.1 Phase de sensibilisation
2.2.2.2.1.1 L’alloreconnaissance
L’alloreconnaissance désigne la capacité du système immunitaire du
receveur, à reconnaître comme « étranger » un tissu provenant d’un donneur
de la même espèce, génétiquement différent. L’alloreconnaissance constitue
le préalable indispensable à la mise en place des réponses immunes
adaptatives responsables du rejet d’allogreffe.
2.2.2.2.1.1.1 Rappel : l’activation lymphocytaire T
Lors d’une réponse immune « classique », les lymphocytes T reconnaissent
l’épitope dont ils sont spécifiques lorsque ce dernier est présenté par les
molécules du CMH du soi (concept de restriction syngénique découvert par
Zinkernagel et Doherty en 1974) (146).
Les molécules de CMH se divisent en 2 classes. Les molécules de
classe I (Figure 9A) sont formées par l’association de la β2 microglobuline et
d’une chaîne lourde polymorphe α (α1, α2, α3). Les domaines α1 et α2
66
constituent la fente de fixation dans laquelle le peptide linéarisé (7 à 10 acides
aminés) issu de l’apprêtement par le protéasome d’un antigène cytosolique
(protéines endogènes, virales, ou bactériennes) est présenté. C’est cette
partie du complexe qui interagit avec le récepteur T (TCR, T cell receptor)
tandis que le domaine α3, invariant, est impliqué dans la liaison au co-
récepteur CD8. Les molécules de CMH-I sont elles-mêmes divisées en
molécules de classe I « classiques » (HLA-A, B et C) et « non-classiques »
dont le polymorphisme est réduit et qui exercent des fonctions variées que
nous ne détaillerons pas ici. Les molécules de classe I classiques sont
exprimées par toutes les cellules de l’organisme (à l’exception des
érythrocytes, des neurones et des cellules germinales). Les molécules de
classe II (Figure 9B) sont constituées de l’association d’une chaîne α (α1, α2)
et d’une chaîne β (β1, β2) toutes les deux polymorphes. La fente de fixation
est constituée par la réunion des régions α1 et β1. Ouverte à ses deux
extrémités, cette fente de fixation accepte des peptides plus longs (13 à 29
acides aminés) qui proviennent de l’apprêtement par le système lysosomial
de protéines exogènes ayant été phagocytées. Les molécules de CMH-II
(HLA-DP, -DQ et -DR) ne sont portées que par certaines cellules de
l’organisme. Leur expression est constitutive sur les cellules présentatrices de
l’antigène aux lymphocytes T CD4+ (cellules dendritiques, monocytes,
macrophages) et inductible après activation sur les lymphocytes T et les
cellules endothéliales. Les molécules du CMH jouent le rôle de « portoir »
pour l‘épitope qui doit être reconnu par le récepteur du lymphocyte T. Elles se
caractérisent par un nombre très élevé d’allèles différents du même gène. Ce
polymorphisme n’est pas réparti au hasard dans la molécule. Il concerne
principalement les régions impliquées dans la fixation de
l‘épitope (Figure 9C). Il en résulte que pour un antigène donné, le répertoire
des peptides (issus du découpage de la protéine) qui peut se fixer dans la
fente de la molécule du CMH (donc la structure tridimensionnelle du
complexe CMH-peptide) varie selon les individus.
Le TCR est constitué de 2 chaînes α et β (ou γ et δ) associées au complexe
hétéropentamérique CD3 (responsable de la transduction du signal) et à un
co-récepteur CD8 ou CD4 (interagissant avec la partie monomorphe des
molécules de CMH, respectivement CMH-I et -II). La partie du TCR qui
interagit avec le complexe CMH-peptide comporte 3 boucles hypervariables :
67
CDR (complementary determining region)-1, -2 et -3. La boucle CDR-3
interagit avec le peptide tandis que la boucle CDR- 2 se lie au CMH, et que
CDR-1 interagit avec les deux (Figure 9D) (147-149) . La flexibilité de la
boucle CDR-3 confère au clone lymphocytaire T une certaine polyspécificité.
On estime entre 104 et 107le nombre d’épitopes de 9 acides aminés pouvant
être reconnus par un seul TCR (150). Il faut signaler la découverte récente
que 11% des clones lymphocytaires T expriment une chaîne Vα
supplémentaire en raison d’un défaut d’exclusion allélique (151). Ces clones
expriment donc 2 récepteurs T différents (partageant la même chaîne Vβ).
Aucun travail n ’a jusqu’ici évalué l’importance de ce phénomène dans
l’alloréactivité et, à notre connaissance, il n’a pas été pris en compte dans le
calcul de la fréquence théorique des clones alloéactifs.
L’activation d’un clone lymphocytaire T, outre la reconnaissance du complexe
CMH-peptide qui constitue le « premier signal », nécessite une costimulation
(aussi appelée second signal). Le décryptage des voies de costimulation a fait
l’objet de travaux intensifs et chaque année, de nouvelles molécules sont
identifiées. Très schématiquement tous ces ligands et ces récepteurs se
répartissent dans deux superfamilles : celle du TNF/récepteur au TNF et celle
du CD28/B7. (Pour une revue récente de la littérature le lecteur pourra se
référer respectivement aux références : (152) pour la famille TNF/TNF-R
et (153) pour la superfamille CD2/B7). En l’absence de costimulation, un
lymphocyte naïf recevant un premier signal devient anergique.
68
Figure 9 Molécules du CMH de classe I et II : structure, polymorphisme et interaction avec le récepteur T des lymphocytes [Adapté de Janeway et al, Immunobiology 5ème Ed (2001) & Kuby et al, Immunology 6ème Ed (2006)]
Panneau supérieur : Structure des molécules de HLA respectivement de classe I (A) et de classe II (B). Représentation schématique (à gauche) et vue du dessus de la fente de fixation (à droite). Les points rouges figurent les acides aminés polymorphes. C) Diagramme indiquant la position et la variabilité des acides aminés dans les chaînes α du HLA I (à gauche) et β du HLA II. La variabilité allélique des molécules HLA est concentrée aux sites formant la fente de fixation. D) Modélisation de l’interaction entre la molécule HLA I et le peptide linéarisé dans la fente de fixation avec le récepteur T des lymphocytes. Vue du dessus (à gauche) et en coupe frontale (à droite).
69
2.2.2.2.1.1.2 Bases moléculaires de l’alloreconnaissance
L’immunologie de la transplantation se singularise par la double origine
possible des cellules présentatrices de l’antigène (CPA) responsables de
l’activation des lymphocytes T du receveur. Ces dernières pouvant provenir
du greffon (donc du donneur) ou du receveur. La présentation directe désigne
la reconnaissance par les cellules T du receveur des antigènes allogéniques
(complexe CMH-peptides) présentés par les CPA du donneur. La
présentation indirecte désigne la reconnaissance par les cellules T du
receveur des antigènes du donneur, apprêtés et présentés par les CPA du
receveur dans le contexte CMH restreint habituel (Figure 10).
Figure 10 Présentation schématique des deux modes d’alloreconnaissances (Adapté de Bradley et al, Nat Rev Immunol (2002), p859-871)
Au cours de la présentation directe (à gauche), les complexes formés par les molécules HLA du donneur et le peptide linéarisé présent dans la fente de fixation sont reconnus par les récepteurs T des lymphocytes du receveur. Ce mode de présentation provoque l’activation de 1 à 10% du pool lymphocytaire du receveur mais tend à diminuer avec le temps et la disparition progressive des cellules présentatrices de l’antigène (CPA) du donneur. Le second mode de reconnaissance des alloantigènes dépend de la présentation indirecte (à droite) et correspond en fait, au mode canonique de reconnaissance des antigènes par le système immunitaire. Les molécules HLA du donneur, polymorphes, sont apprêtées et présentées, dans les complexes majeurs d’histocompatibilités, par les CPA du receveur aux lymphocytes syngéniques. Ce mode de présentation ne permet d’activer qu’une fraction réduite du pool lymphocytaire (environ 1/10000) mais reste stable dans le temps.
70
2.2.2.2.1.1.2.1 Présentation directe
La présentation directe est une situation spécifique à l’immunologie de la
transplantation s’opposant en plusieurs points au dogme de l’immunologie «
classique » :
-absence de restriction syngénique
-le CMH allogénique est un antigène qui n’a pas besoin d’être
apprêté pour être reconnu par les lymphocytes T alloréactifs.
-la fréquence des lymphocytes T alloréactifs stimulés par
reconnaissance directe d’un CMH allogénique donné est de l'ordre
de 0.1 à 10% (154), comparable à la fréquence des lymphocytes T
stimulés par un superantigène. Ceci correspond à une fréquence
au moins 100 fois supérieure à celle des lymphocytes
reconnaissant un peptide antigénique restreint par leur propre
CMH (on admet qu’en moyenne cette fréquence est de l’ordre de
1/10000).
-la reconnaissance allogénique directe se caractérise par la
capacité d’activation in vitro des lymphocytes alloréactifs naïfs sans
qu’un «priming » préalable in vivo soit nécessaire (155).
De très nombreux travaux ont tenté de disséquer les phénomènes
moléculaires mis en jeu dans la reconnaissance directe pouvant expliquer ces
différences par rapport à la réponse à un antigène étranger. Dans
l’alloreconnaissance directe, comme dans la reconnaissance classique, les
récepteurs à l’antigène des lymphocytes T (TCR) CD4+ et CD8+ du receveur
interagissent avec des complexes peptides-molécules du CMH des CPA du
donneur, présentes dans le greffon (cellules dendritiques tissulaires,
endothélium vasculaire ou cellules épithéliales stimulées par l'IFNγ). Les
études cristallographiques ont montré que cette interaction directe se faisait
selon les mêmes modalités que lors d’une interaction « classique » : les
régions hypervariables CDR1 et CDR2 des chaînes α et β du TCR avec les
hélices α de la cavité de liaison du peptide et entre la région CDR3 et le
peptide complexé au CMH. Ceci explique pourquoi le répertoire des
lymphocytes T alloréactifs est contenu dans celui des lymphocytes T
reconnaissant un peptide du "non-soi" associé à une molécule du CMH du
"soi".
71
Actuellement (156) deux hypothèses sont retenues pour expliquer l’origine de
l’énergie de fixation du lymphocyte alloréactif au complexe CMH + peptide.
Cette dernière pourrait provenir :
-des peptides fixés par le CMH du donneur. Chaque CMH du
donneur est capable de fixer un grand nombre de peptides
provenant de protéines le plus souvent communes au receveur et
au donneur. Toute la différence provient de ce que chaque CMH
du donneur fixe un échantillon de peptides différents (du fait des
résidus polymorphes de la poche de fixation) de celui fixé par le
CMH syngénique. Les lymphocytes T du receveur réagissant
contre un échantillon de peptides différent de celui sur lequel ils ont
été sélectionnés négativement au niveau thymique, ils se trouvent
en très grand nombre (157). Cette alloreconnaissance « peptide-
dépendante » (ou « determinant frequency hypothesis » ou
« multiple binary complex ») explique la plus grande fréquence des
lymphocytes alloréactifs. Cependant, comme en théorie chacun de
ces clones ne rencontrent qu’un faible nombre de complexe CMH
+ peptide spécifique à la surface de la CPA du donneur, ce modèle
n’explique pas pourquoi la reconnaissance directe permet d’activer
les lymphocytes alloréactifs sans « priming »
préalable (Figure 11A). -à l’opposé, l’alloreconnaissance « peptide-indépendante » (ou
« determinant density hypothesis
») suggère que les lymphocytes T alloréactifs reconnaissent les
CMH allogéniques eux mêmes. Cette théorie est supportée par des
travaux expérimentaux apportant la preuve de la reconnaissance
de CMH allogéniques en l’absence de peptides dans la poche de
fixation (158). Dans ce cas, les lymphocytes alloréactifs trouvent
sur la CPA du donneur un nombre très élevé de cibles ce qui
explique bien pourquoi l’alloreconnaissance directe parvient à
activer des clones naïfs, mais pas la plus grande fréquence des
lymphocytes alloréactifs (Figure 11B).
72
Il est très vraisemblable que les 2 phénomènes décrits ci-dessus coexistent.
Dans une revue récente, Lechler (159) propose une hypothèse séduisante
concernant leur importance respective selon la plus ou moins grande
proximité existant entre les molécules de CMH du donneur et celle du
receveur (Figure 11C).
Figure 11 Bases moléculaires de l’alloreconnaissance directe : présentation des 2 modèles et contribution respective selon l’homologie HLA du couple donneur/receveur (Adapté de Felix et al, Nat Rev Immunol (2007), p942-53& Lechler et al, Nat Rev Immunol (2003), p147-158)
Deux modèles extrêmes sont actuellement proposés pour expliquer les bases moléculaires de l’alloreconnaissance directe. A) Le modèle « high density determinant » prédit que l’énergie de fixation du TCR du receveur au complexe allogénique (HLA du donneur + peptide) dépend principalement des molécules HLA du donneur. B) Le polymorphisme HLA étant concentré dans la fente de fixation, la librairie des peptides fixés par les molécules HLA du donneur et du receveur diffère. Le modèle « multiple binary complex » propose donc que le peptide fournisse la plus grosse partie de l’énergie de fixation du TCR du receveur au complexe allogénique porté par les cellules présentatrices du donneur. C) Une tentative de réconciliation entre ces deux modèles a été récemment proposée et suggère que leur contribution respective dépend du dégré d’homologie entre les molécules HLA du receveur et celle du donneur.
73
2.2.2.2.1.1.2.2 Présentation indirecte
C’est le mode de reconnaissance habituel des antigènes étrangers par le
système immunitaire. Elle fait intervenir les CPA du receveur. Les peptides
associés aux molécules de classe II du CMH (CMH II) proviennent des
protéines solubles et des protéines cellulaires libérées lors de la cytolyse. Les
peptides associés aux molécules de classe I du CMH (CMH I) proviennent le
plus souvent des protéines synthétisées par les cellules du greffon elles-
mêmes, mais les CPA professionnelles sont capables de « cross priming »
(fixation d’un peptide antigénique d’origine extra-cellulaire sur une molécule
de CMH I) (160).
En théorie, toutes les protéines polymorphes de l'espèce du donneur et les
protéines d'agents infectieux localisées dans le greffon (ex: Cytomégalovirus)
peuvent interagir avec les TCR de lymphocytes T du receveur. En pratique
certains travaux ont bien documenté que la plupart des peptides reconnus par
la voie indirecte par le système immunitaire du receveur provenait des
molécules du CMH du donneur (161).
Il existe une hiérarchie dans la reconnaissance des peptides allogéniques au
cours de la réponse immune. Lors de la phase initiale de sensibilisation par
voie indirecte, les cellules alloréactives sont dirigées contre un nombre limité
de peptides allogéniques immunodominants issus des régions polymorphes
des molécules de CMH du donneur (162). Malgré leur capacité à être
apprêtés, pésentés et à induire une réponse T après immunisation sous-
cutanée, certains peptides allogéniques (dits « cryptiques ») ne mobilisent
pas de cellules alloréactives durant cette phase. Par la suite les CPA du
receveur qui infiltrent le greffon en train d’être rejeté rencontrent un
environnement inflammatoire avec de nombreux néoantigènes provenant de
la destruction du tissu. On assiste alors à une extension de la réponse
alloimmune indirecte vers de nouvelles spécificités correspondants à des
peptides cryptiques issus d’autres régions hypervariables de la même
molécules de CMH (« intramolecular spreading ») ou à d’autres molécules
(« intermolecular spreading »). Ce processus pourrait aussi expliquer la
survenue d’une rupture de tolérance à certains constituants du soi entraînant
la mise en place d’une composante auto-immune participant au rejet de
l’organe transplanté. Des réponses immunes dirigées contre la
74
myosine (163), la vimentine (164), le collagène V (165) et les protéines HSP
(heat shock protein) (166) ont été caractérisées.
2.2.2.2.1.2 Topologie de la sensibilisation du système immunitaire du receveur aux alloantigènes
L’organe transplanté est initialement dépourvu de connexion avec le réseau
lymphatique du receveur. Des travaux anciens ont montré que le flux
lymphatique entre le greffon et les ganglions du receveur était rétabli entre le
10ème et le 14ème jour post transplantation (167, 168).
L’ischémie-reperfusion crée des dégâts tissulaires qui libèrent des médiateurs
capables de déclencher une réponse inflammatoire caractérisée par
l’activation de l’endothélium et un afflux précoce d’effecteurs de l’immunité
innée : neutrophiles (169) et monocytes (170).
Les ligands endogènes libérés par l’ischémie-reperfusion trouvent à la surface
des CPA résidentes du tissu (provenant du donneur) ou des CPA du receveur
qui ont infiltré le greffon attirées par les médiateurs chémotactiques, les TLRs
auxquels ils se lient (171). Les CPA stimulées présentant les alloantigènes
(directement ou indirectement) et des molécules de costimulation, migrent via
les lymphatiques vers les ganglions drainants (172) où elles stimulent les
clones lymphocytaires T (173). Les lymphocytes activés par voie directe sont
prépondérants dans les ganglions drainants dans les premiers jours qui
suivent la greffe (95 à 99% de spécificité directe versus 1 à 5% de spécificité
indirecte) (174) suggérant un rôle majeur de cette voie de présentation lors de
la phase initiale de sensibilisation. En accord avec cette hypothèse, il faut
souligner que la déplétion d’un greffon de ses CPA résidentes (aussi
désignées par le terme de « passenger leukocytes ») permettait d’en
prolonger la survie (175) ou au moins de réduire le nombre d’épisodes de
rejets aigus en transplantation rénale clinique (176).
Les ganglions ne sont pas le seul endroit où la sensibilisation peut avoir lieu.
Les CPA peuvent également gagner la rate et provoquer le rejet du
greffon (173). La route de migration des CPA vers la circulation sanguine est
moins claire : passage direct du tissu greffé dans le courant sanguin ou via la
voie lymphatique (et le canal thoracique). Cette dernière situation fournirait
une explication pour rendre compte du léger retard de la réponse allogénique
splénique (177). L’importance des organes lymphoïdes secondaires comme
75
site d’initiation de la réponse immunitaire adaptative a été soulignée par
divers travaux (178-180) et notamment ceux de l’équipe de Lakkis (173) dans
le contexte particulier du rejet d’allogreffe, défendant le concept de
« central sensitization ». D’autres travaux contestent le caractère nécessaire
des organes lymphoïdes secondaires dans le cadre du rejet d’allogreffe et
suggèrent que la sensibilisation des lymphocytes du receveur pourrait
également être assurée par les cellules endothéliales :
« peripheral sensitization » (181-185). Enfin, il semble que les organes
lymphoïdes secondaires ne soient pas « interchangeables » en terme de
fonction : les travaux de l’équipe de Bromberg ont bien souligné l’importance
du site d’initiation de la réponse alloimmune dans un modèle expérimental
murin. Les mêmes cellules dendritiques, selon qu’elles initient la réponse
dans un ganglion ou la rate pouvant induire la tolérance ou le rejet du
greffon (186).
Les cellules dendritiques du donneur étant en nombre et ayant une durée de
vie limitée, le phénomène de sensibilisation par présentation directe disparaît
petit à petit. Il faut toutefois noter qu’une activation directe des cellules
mémoires (générées lors de la phase initiale de la transplantation et qui ne
nécessitent pas de costimulation) reste encore possible au niveau des
cellules du greffon. D’autre part, si le concept de « peripheral sensitization »
(voir ci-dessus) existe, rien ne s’oppose à ce que les cellules endothéliales
activées du greffon assurent le priming de nouveaux clones lymphocytaires
naïfs par voie directe bien après la disparition des cellules dendritiques du
donneur. Enfin, l’équipe de Lechler a récemment démontré que les cellules
dendritiques du receveur « arrachent » aux cellules du greffon des fragments
de membranes porteur des molécules HLA-I du donneur lors de leur migration
dans le tissu. Cette voie de présentation baptisée « semi-directe » peut, elle
aussi, assurer l’activation de nouveau clones alloréactif de spécificité directe
après disparition des CPA du donneur (187). Ces trois mécanismes
permettent donc d’attribuer à la voie directe de présentation un rôle dans les
phénomènes de rejet plus tardifs (rejets aigus au-delà de la première année,
rejet chronique...). La présentation indirecte se différencie de la présentation
directe par deux caractéristiques : elle est moins intense que la
reconnaissance directe mais elle n'a pas tendance à s'éteindre dans le temps.
Des travaux expérimentaux ont montré que les lymphocytes reconnaissant
76
les alloantigènes par voie indirecte étaient moins sensibles aux traitements
immunosuppresseurs conventionnels (188). Il était donc tentant de proposer
que la voie de présentation indirecte soit le support de l’alloreconnaissance
lors du rejet chronique, i.e. un mode de rejet à bas bruit, continu, mal controlé
par les traitements actuels. Certains arguments expérimentaux soutiennent
cette hypothèse : c’est le cas des expériences de Lechler et Batchelor (175)
consistant à « parquer » des allogreffes de reins pendant plusieurs semaines
chez un hôte intermédiaire immunosupprimé avant de les transférer à un
second receveur syngénique de l’hôte intermédiaire. Ces reins ayant été
déplétés de leurs CPA au cours du séjour chez l’hôte intermédiaire ne sont
pas rejetés de façon aiguë par le receveur définitif, probablement parce qu’en
l’absence de CPA du donneur, la présentation directe est impossible et les
épisodes de rejets aigus plus rares. Ils restent néanmoins la cible d’un rejet
chronique médié par la présentation indirecte des antigènes du donneur. Il
serait néanmoins complètement faux de cantonner le mode de présentation
indirecte au seul rejet chronique. Plusieurs modèles expérimentaux
démontrent que le rejet d’un greffon peut être accéléré par la sensibilisation
du receveur aux molécules du CMH allogéniques (189) ou aux peptides issus
des régions polymorphes des molécules de CMH du donneur (190). En
clinique, l’amélioration des techniques de détection des alloanticorps (191) et
la découverte du marqueur histologique C4d (témoignant de l’activation de la
voie classique du complément (192)) ont récemment permis de mieux
comprendre la physiopathologie de ce que les cliniciens ont longtemps
désigné par le terme de rejet aigu « cortico-résistant ». Ces derniers
correspondent cliniquement à des rejets aigus mais le bras effecteur du
système immunitaire du receveur à l’origine de ce tableau est la réponse
humorale (aussi distingue-t-on dans la nouvelle classification de Banff les
rejets aigus « cellulaires » des rejets aigus « humoraux » (193)). Or, seul le
mode indirect de présentation des alloantigènes peut expliquer la production
d’alloanticorps. En effet, la production d’alloanticorps par les plasmocytes du
receveur suppose la mise en place d’une réponse humorale T-dépendante.
Cette dernière requiert l’aide des clones T du receveur (via la voie CD40-
CD40L) aux lymphocytes B alloréactifs du receveur qui leur présentent
l’antigène par voie indirecte (Figure 12).
77
Figure 12 Illustration des étapes d’une réponse humorale T dépendante [Adapté de Janeway et al, Immunobiology 5ème Ed (2001)]
A) Le lymphocyte B naïf capture l’alloantigène dont il est spécifique via son immunoglobuline de surface (BCR). La liaison de l’antigène par le BCR lui fournit un premier signal d’activation. B) Internalisation de l’alloantigène, apprêtement et chargement du peptide linéarisé dans le CMH II. C) Le lymphocyte B présente le peptide linéarisé dans le contexte du CMH II du receveur (présentation indirecte) à sa surface. Le clone lymphocytaire T helper spécifique du complexe CMH/peptide fournit des signaux (CD40L et cytokines) indispensables pour que le lymphocyte B puisse initier la réaction de centre germinatif aboutissant à la génération de lymphocytes B mémoires et de plasmocytes.
78
2.2.2.2.2 Phase effectrice
Une grande variété de mécanismes peut intervenir lors de la phase effectrice
du rejet d’allogreffe. Ces mécanismes s’associent de diverses façons en
fonction de multiples paramètres (caractéristiques de la phase de
sensibilisation, caractéristiques du receveur, type de traitement
immunosuppresseur…), expliquant pourquoi le rejet d’allogreffe peut prendre
tellement de formes cliniques différentes (les trois principales ont été décrites
plus haut).
2.2.2.2.2.1 Dégâts provoqués par la réponse cellulaire
Les réactions cellulaires les plus communes comprennent les réactions
d’hypersensibilité retardée (correspondant à l’hypersensibilité de type IV dans
la classification de Gell et Coombs) et la cytotoxicité induite par les
lymphocytes.
Les réactions d’hypersensibilité retardée sont dues à l’infiltration du greffon
par les lymphocytes T (CD4+ ou CD8+) de spécificité directe. Ils
reconnaissent les complexes MHC/peptides portés à la surface des cellules
du greffon et produisent en réponse des cytokines (notamment le TNF-α et
l’IFNγ) et des chémokines. Il en résulte un afflux massif de cellules
inflammatoires (notamment les macrophages) responsables des dommages
tissulaires. La reconnaissance des macrophages de l’hôte ayant infiltrés le
greffon et ayant phagocytés les alloantigènes pourrait expliquer l’activation
des lymphocytes de spécificité indirecte et la mise en place d’une réaction
d’hypersensiblité retardée endommageant les tissus environnants
(« bystander killing ») (194).
Les cellules cytotoxiques prototypiques sont les cellules T CD8+ de spécificité
directe (reconnaissant les complexes CMH-I/peptide du donneur). Les
lymphocytes T CD8+ prolifèrent beaucoup plus efficacement que les T-CD4+.
Les lymphocytes T-CD8+ activés contiennent des granules lytiques remplis
des cytotoxines sous forme inactive. Après leur activation, ils migrent dans le
greffon établissent une synapse immunologique avec les cellules du greffon
portant à leur surface les complexes CMH-I/peptide pour lesquels ils sont
spécifiques. Le signal reçu par le TCR provoque la libération polarisée du
contenu des granules lytiques (au niveau de la synapse immunologique). La
79
perforine est une protéine analogue au complexe d’attaque membranaire du
complément qui forme, en polymérisant, des pores transmembranaires d’un
diamètre de 160 Å. A travers ces pores, les granzymes (A, B et H, constituant
une famille de serine protéases) peuvent pénétrer dans le cytoplasme de la
cellule cible et déclencher son apoptose. La cellule cible meurt en 1 à 2
heures et le lymphocyte cytotoxique se détache pour aller lyser d’autres
cibles. Un autre mécanisme cytotoxique peut être mis en place par les
lymphocytes T (CD8+ et CD4+ de spécificté directe). Les lymphocytes T
activés expriment à leur surface la molecule Fas. Cette dernière se lie à son
ligand à la surface de la cellule cible et déclenche la cascade de l’apoptose.
La manière avec laquelle les lymphocytes de spécificité indirecte peuvent
provoquer des dégâts au niveau greffon reste mal comprise. Une des
hypothèse avancée suggère que les cellules endothéliales vasculaires
provenant du receveur (et qui ont colonisé les vaisseaux du greffon comme
mécanisme de réparation) sont capables de présenter les alloantigènes
provenant du tissu sous-jacent et d’activer les lymphocytes T CD4+ (et CD8+
par le mécanisme de cross-priming), conduisant à la destruction ischémique
du greffon (195).
2.2.2.2.2.2 Dégâts provoqués par la réponse humorale
Les mécanismes humoraux de la phase effectrice de rejet sont l’activation du
complément et l’ADCC (« antibody-dependent cell-mediated cytotoxicity »).
Les anticorps spécifiques des alloantigènes du greffon sont produits par les
plasmocytes et passent dans la circulation sanguine pour gagner leur cible à
la surface des cellules du greffon. Les anticorps fixés à la surface des cellules
du donneur peuvent, selon leur isotype, activer la cascade du complément,
menant à la lyse de la cellule cible par la formation du complexe d’attaque
membranaire. Lors de l’activation de la voie classique du complément, le
fragment C4d peut être produit. Il se lie de façon covalente à la membrane
plasmique la plus proche permettant de faire le diagnostic des rejets à
médiation humorale par immunohistologie (192).
Lors de l’ADCC, les anticorps liés à leur cible activent certaines cellules
cytotoxiques via leur récepteur de la région Fc des immunoglobulines. Les
cellules possédant ce récepteur sont les cellules NK, les macrophages, les
monocytes, les neutrophiles et les éosinophiles. La majorité de ces cellules
80
lysent leur cible en relâchant des enzymes cytolytiques ou en sécrétant du
TNF-α.
2.2.2.3 Modélisation du rejet d’allogreffe : l’exemple du modèle d’interposition aortique
2.2.2.3.1 Présentation du modèle d’interposition aortique
Le modèle d’interposition aortique consiste à remplacer l’aorte abdominale
sous-rénale d’un rat receveur par un segment d'aorte de même longueur
provenant d’un rat donneur de souche histoincompatible. L’anastomose
termino-terminale par points séparés ne prend qu’une vingtaine de minutes à
un opérateur entraîné.
Ce modèle a été décrit simultanément par 4 équipes au début des années
1990 (196-199). Ses nombreux avantages ont conduit à sa diffusion rapide et
il reste à l’heure actuelle le moyen le plus simple de modéliser la réponse
alloimmune contre un tissu vascularisé.
Les principaux avantages du modèle de greffe d'aorte abdominale sont les
suivants :
-c'est un modèle de réalisation relativement simple sur le plan
chirurgical, y compris chez la souris (en particulier lorsqu’on le
compare à ses alternatives : principalement la transplantation
cardiaque hétérotopique et la transplantation rénale)
-il est adapté à une étude cinétique prolongé du phénomène
immunologique. En effet, les conséquences du rejet sur la paroi
artérielle ne compromettent pas les fonctions essentielles de celle-
ci que sont la contention et la conduction du sang. Ce modèle peut
donc s'utiliser sans immunosuppresseur, à long terme, sans
conséquence fonctionnelle pour l'animal, et sans interférences
liées à la perte de fonction du greffon.
-L'organisation de la paroi artérielle est simple en trois couches
parallèles, l'intima, la média et l'adventice. Cette simplicité a de
multiples avantages, dont :
*l’analyse quantitative facilitée des lésions.
81
*la microdissection, techniquement possible, des trois
tuniques (avant ou après transplantation) permet l’isolement
et la culture des cellules qui les composent (200).
*l’évaluation possible de manipulations qui seraient
impossibles à mettre en place sur un organe entier
(décellularisation (201), seeding de cellules du receveur avant
transplantation (202)…)
Certains auteurs, notamment Pober, ont critiqué ce modèle (203) lui
reprochant d’être trop éloigné de la situation clinique qu’il cherchait à
reproduire. En particulier en raison : de l’absence d’immunosuppresseurs, du
développement rapide des lésions (en quelques semaines) et de l’analyse
centrée sur le développement de la néointima (qui n’a rien de spécifique à la
réponse alloimmune puisqu’il a été bien démontré que ce phénomène était
une réponse commune à tous les types d’agression du tissu artériel et
notamment les lésions mécaniques de l’endothélium par « ballooning »).
Parmi les autres critiques il faut signaler le risque de minimisation du rôle du
parenchyme puisque notre transplant en est à priori dépourvu.
Nous verrons plus bas (cf paragraphe 3.1) qu’il est possible d’objecter pour
une bonne part à ces critiques et que ce modèle, malgré ses limites, a permis
de réelles avancées dans la compréhension du rejet d’allogreffe.
2.2.2.3.2 Etat des connaissances
2.2.2.3.2.1 Cinétique du rejet d’allogreffe aortique
La séquence des événements survenant dans le modèle de greffe aortique
entre une souche donneuse de rats Brown-Norway (BN) et une souche
receveuse de rats Lewis (LEW) a été décrite par un de mes laboratoires
d’accueil (204). Ce travail d'immuno-histochimie et de morphologie cellulaire a
montré que :
-les cellules endothéliales du greffon, du fait de leur position à
l'interface entre le sang (véhiculant les cellules
immunocompétentes de l'hôte) et la paroi artérielle (cible du rejet),
jouent un rôle prédominant dans la phase initiale de
l'alloreconnaissance dont elles constituent la première cible. Elles
sont attaquées par les lymphocytes alloréactifs dès le 3ème jour
82
post-greffe et disparaissent totalement au 15ème jour. La
prolifération intimale apparaît progressivement, après la phase de
disparition de l’endothélium, de façon concomitante avec la
disparition des cellules musculaires lisses (CML) de la média.
Initialement, la prolifération intimale est mixte, composée de CML
et de cellules inflammatoires (essentiellement des macrophages).
Le caractère musculaire et fibreux de la prolifération augmente
progressivement pour devenir prépondérant à partir du premier
mois témoignant d'un phénomène de cicatrisation.
-la média, contenant les CML, est un site relativement privilégié du
point de vue immunologique. Bien que la disparition des cellules
musculaires lisses de la média débute à partir du 8ème jour, pour
laisser ce compartiment complètement acellulaire entre le 20ème
et le 30ème jour, la juxtaposition des lames élastiques rend la
média difficilement accessible aux effecteurs immunologiques
cellulaires. En revanche, la média peut être la cible chronique d'un
rejet à médiation non cellulaire. La présence d'immunoglobulines G
(IgG) dans la média (voir plus bas) suggère que ce compartiment
est sujet à une agression immune à médiation humorale. Le
respect des structures élastiques explique que la rupture du greffon
ne soit jamais observée et distingue ce modèle de celui de l’aortite
utilisé pour modéliser l’anévrysme de l’aorte.
-l'adventice est le siège d'une infiltration intense par les cellules
mononuclées formant un manchon autour du vaisseau de façon
précoce. L’infiltration inflammatoire débute à partir du 5ème jour
post-transplantation pour être maximale au 18ème jour. Ensuite
l’infiltrat décroît progressivement jusqu’à la fin du deuxième mois,
tandis qu’apparaît une fibrose de réparation extrêmement intense
quasiment acellulaire. Les types cellulaires constituant l’infiltrat
sont : des macrophages, des lymphocytes T (majoritairement
CD4+) des lymphocytes NK. Il n’y a pas de dépôt d’IgG, de C3 ou
de C5b-9 dans l’adventice (204). Cet infiltrat est fortement et
chronologiquement corrélé à la disparition des CML de la
média (205). Ceci suggèrant un lien entre les deux phénomènes.
83
2.2.2.3.2.2 Chimérisme au cours du rejet d’allogreffe aortique
Le comportement discordant des CML de la média qui disparaissent, tandis
que celles de l’intima prolifèrent, ne peut s’expliquer que par une origine
différente des CML intimales. Cette hypothèse est renforcée par le fait que les
CML intimales ne sont pas rejetées au cours du temps, ce qui suggère
qu’elles ne sont pas allogéniques à l’inverse des CML médiales.
En présensibilisant le receveur avec des greffes de peau du donneur,
Plissonier et al (204) ont pu produire un titre élevé d'anticorps dirigés contre
les déterminants allogéniques portés par les cellules du donneur. Ces
anticorps ont permis de montrer que les cellules musculaires lisses de la
prolifération intimale proviennent du donneur et non du receveur. Un tel
chimérisme cellulaire à été récemment confirmé chez l’animal et mis en
évidence sur des reins détransplantés chez l’homme (206).
2.2.2.3.2.3 Rôle de la réponse humorale au cours du rejet d’allogreffe aortique
L’importance de la réponse humorale au cours du rejet d’allogreffe aortique a
été mise en évidence par Shi et al (207) dès le début des années 90. Ce
dernier a utilisé le modèle de transposition aortique chez des receveurs
déficients pour les différents acteurs des réponses immunes adaptatives
(Lymphocytes T-CD4+ et -CD8+, lymphocytes B) et innées (Lymphocytes NK
et macrophages). En comparant l’importance des lésions du greffon entre ces
animaux déficients et des animaux sauvages de même fond génétique, les
auteurs ont pu montrer que l’absence de lymphocytes B était la condition la
plus protectrice vis à vis du développement de la néointima. Par la suite,
Russell et al ont apporté une démonstration définitive de l’importance du bras
humoral dans la réponse alloimmune en démontrant que le transfert des
seuls alloanticorps à un animal immunodéficient suffisait pour observer la
totalité des lésions caractéristiques du rejet chronique vasculaire (208, 209).
Plissonnier et Kolb ont également contribué à illustrer le rôle des alloanticorps
dans la séquence des événements conduisant à la disparition des CML de la
média au cours du rejet du greffon aortique en démontrant :
-La présence constante d'immunoglobulines déposées dans la
média entre le 5ème et le 15ème jour après la greffe, de façon
concomitante à la mort des CML.
84
-L'absence d’infiltrat inflammatoire dans la média pendant la
période de destruction des CML.
-L'augmentation de la réponse humorale sérique, par greffes de
peau préalables à la greffe d'aorte, accélérant le phénomène de
rejet (210).
-Les travaux de Plissonnier et al (211) suggèrent que la cible
moléculaire de la réponse humorale du receveur pourrait être le
CMH I porté par les cellules du donneur.
2.3 Objectifs du travail de thèse
Le rejet d’allogreffe, première cause de perte des greffons au delà de
la première année, reste une problématique centrale en transplantation
d’organe compte tenu de la pénurie des greffons. Améliorer notre
compréhension de la physiopathologie du rejet d’allogreffe nous paraît être un
préambule indispensable pour élaborer des stratégies thérapeutiques
innovantes plus efficaces. Au cours de ce travail de recherche, nous avons
souhaité valider notre hypothèse que le rejet d’allogreffe pouvait être
considéré comme une pathologie inflammatoire chronique parmi les autres, et
que, de ce fait, les progrès réalisés dans la compréhension de la
physiopathologie de l’inflammation chronique (notamment dans
l’autoimmunité ou les infections chroniques) pouvaient nous fournir des pistes
pour mieux comprendre les mécanismes responsables de la perte
progressive et actuellement inéluctable des organes transplantés par rejet
d’allogreffe.
Un autre objectif était, à l’inverse, de profiter de la situation particulière
du rejet d’allogreffe [dans laquelle le début de la réponse inflammatoire est
clairement identifié (le jour de la transplantation), les antigènes cibles sont
connus (mismatch HLA du couple doneur/receveur) et où l’on peut facilement
obtenir une grande quantité de tissu cible pour effectuer une analyse
exhaustive des processus biologiques à l’œuvre] pour améliorer notre
compréhension de la physiopathologie de l’inflammation chronique dans ce
qu’elle a de plus universel.
Enfin, nous souhaitions tirer profit de notre position privilégiée à
l’interface entre le monde clinique et celui de la recherche fondamentale pour
développer une approche transversale dans laquelle :
85
o chaque nouvelle hypothèse issue du cadre simplifié de notre
modèle expérimental pouvait être rapidement validée en clinique
sur des prélèvements humains
o une fois une stratégie thérapeutique définie, cette dernière
pouvait être rapidement mise à l’épreuve dans notre modèle
expérimental.
86
3 Résultats
3.1 Le rejet d’allogreffe aortique expérimental intègre les
différentes phases de la réponse alloimmune
Les avantages du modèle d’interposition aortique chez le rat sont en premier
lieu d’ordre pratique : technique chirurgicale accessible, greffon de structure
simple facilitant l’analyse des lésions…
Compte tenu de la polémique existant autour de sa validité (203), il nous a
paru souhaitable de vérifier qu’il remplissait effectivement son rôle en étudiant
la cinétique avec laquelle intervenaient les différents acteurs identifiés lors
des réponses alloimmunes en clinique.
Dans ce travail, nous démontrons que les premières cibles de la réponse
alloimmune sont les cellules endothéliales. Ces dernières, activées par la
procédure chirurgicale et l’ischémie-reperfusion, se trouvent au contact des
effecteurs alloimmuns circulants. Une analyse par microscopie électronique a
montré que les leucocytes du receveur adhéraient à l’endothélium du greffon
dès le 5ème jour post-transplantation. Les lymphocytes alloréactifs de
spécificité directe sont vraisemblablement primés par ces CPA semi-
professionnelles. Il en résulte une destruction rapide de l’endothélium avec
une mise à nu de la limitante élastique interne. Un processus de cicatrisation
vasculaire non-spécifique se met alors en place : l’endothélium du greffon est
colonisé par des myofibroblastes du receveur (chimérisme) afin de séparer le
courant sanguin de la matrice extra-cellulaire pro-thrombogène. L’origine de
ces cellules n’a pas été étudiée dans notre travail. Plusieurs travaux ont
proposé des hypothèses différentes mais non mutuellement exclusives : les
myofibroblastes tapissant l’endothélium du greffon pourraient provenir de
l’aorte du receveur émigrant à partir des berges du greffon (212) ou être issus
de précurseurs circulants provenant de la moelle osseuse (213). Cette
réponse alloimmune cellulaire cytotoxique est incapable de détruire les cibles
allogéniques portées par les cellules musculaires lisses (CML) de la média
car les effecteurs cellulaires ne peuvent pas franchir les lames élastiques.
Une transition dans la nature de la réponse alloimmune se met en place au
profit du bras humoral. On constate en effet, une augmentation progressive
du titre des alloanticorps dans le sérum. Ceci implique que les débris
87
cellulaires issus de la première vague effectrice ont été phagocytés apprêtés
et présentés par les CPA du receveur aux lymphocytes alloréactifs
« indirects » (ces derniers étant indispensables à la mise en place d’une
réponse alloimmune humorale, cf ci-dessus). Les alloanticorps (et notamment
les anti-CMH-I) traversent les lames élastiques et se fixent sur les cibles
médiales. L’agrégation des molécules de CMH-I à la surface des CML
médiales induit un effet biologique complexe : stimulation de la transcription
de facteurs de croissance (platelet derived growth factor, PDGF ; fibroblast
growth factor, FGF ; et insulin growth factor, IGF), puis induction d’apoptose.
Les facteurs de croissance produits lors de la phase initiale sont insuffisants
pour sauver les CML médiales de la mort, mais agissent de façon paracrine
sur les CML du receveur qui tapissent l’intérieur du vaisseau induisant leur
prolifération et le développement d’une néointima épaisse qui obstrue la
lumière du greffon. Dans l’adventice on note qu’un infiltrat inflammatoire est
présent dès le 7ème jour et persiste jusqu’à la destruction complète des CML
médiales (J45-J60) avant de laisser la place à une cicatrice fibreuse
collagénique acellulaire.
Ce travail démontre que le rejet du transplant aortique implique la mise en
place séquentielle des reconnaissances directe puis indirecte déclenchant les
bras effecteurs cellulaires cytotoxiques et humoraux. La réponse alloimmune
se maintient aussi longtemps que les cibles allogéniques persistent et
s’accompagne d’une infiltration inflammatoire du tissu. Une fois cet objectif
atteint, elle s’éteint au profit de processus de cicatrisation tissulaire. Au total,
nous avons montré que le modèle d’interposition aortique intégrait la totalité
des aspects physiopathologiques de la réponse alloimmune identifiés en
clinique suggérant qu’il la modélise de façon adéquate.
Direct and Indirect Effects of Alloantibodies LinkNeointimal and Medial Remodeling in Graft Arteriosclerosis
Olivier Thaunat, Liliane Louedec, Jianping Dai, Florence Bellier, Emilie Groyer, Sandrine Delignat,Anh-Thu Gaston, Giuseppina Caligiuri, Etienne Joly, Didier Plissonnier,
Jean-Baptiste Michel, Antonino Nicoletti
Objective—Chronic vascular rejection, the main cause of allograft failure, is characterized by the destruction of smoothmuscle cells (SMCs) in the media concomitantly with the proliferation of SMCs in the adjacent neointima. Wehypothesized that alloantibodies might be responsible for these 2 opposite but coordinated events.
Methods and Results—We used the rat aortic interposition model of chronic vascular rejection. During the rejectionprocess, a neointima composed of proliferating SMCs from the recipient developed, whereas the SMCs in the media,all of donor origin, underwent apoptosis. Alloantibody deposition was detected only in the media. Using in vitro culturesexperiments, we observed that alloantibody binding to donor SMCs exerts (1) a rapid upregulation of the transcriptionof growth factors genes, followed by (2) the induction of apoptosis after 24 hours. The transient production of growthfactors by donor SMCs in response to the binding of alloantibodies induced the proliferation of recipient SMCs inculture supernatant transfer experiments. Additional data suggest that among the repertoire of alloantibodies, thosedirected against major histocompatibility complex I might carry the remodeling effect.
Conclusions—Our data suggest that during chronic vascular rejection, alloantibody binding to donor medial SMCs is acrucial event that links neointimal and medial remodeling. (Arterioscler Thromb Vasc Biol. 2006;26:2359-2365.)
Key Words: anti-MHC antibodies � chronic rejection � graft arteriosclerosis � remodeling � smooth muscle cells
During the last 20 years, the half-life of transplants hasremained the same as the result of chronic rejection,
which represents the main cause of long-term graft failure.1
Excluding organ-specific manifestations, the most commonhistopathological feature is chronic vascular rejection, alsoknown as graft arteriosclerosis, which is estimated to affectmore than 40% of recipients within the first 5 years followingtransplantation.2
The animal model of aortic transplantation between histo-incompatible rat strains reproduces the main characteristics ofallograft arteriosclerosis found in the arteries of rejectedhuman grafts.3 In previous studies, we have shown that therejection process of the aortic graft follows 2 consecutivephases.3 During the first phase (day 0 to 5 posttransplanta-tion), the circulating leukocytes of the recipient target theendothelial cells (ECs) of the graft that expose donor majorhistocompatibility complex (MHC) molecules. The cellularcytotoxic effectors rapidly destroy the endothelium of thegraft but fail to reach the allogenic smooth muscle cells(SMCs) in the media because they are protected by the elasticlaminas. The immune system of the recipient then switches
from a cellular to a humoral response.3 During this phase,destruction of SMCs in the media results in the shrinkage ofthis tunica, whereas the same cell type, ie, SMC, proliferatesin the adjacent neointima leading to a widespread and diffusenarrowing of the vascular lumen. Because the events takingplace in these 2 tunica are tightly coordinated,3 we hypothe-sized that a single effector, alloantibodies, may paradoxicallytrigger both the destruction and the proliferation of the SMCsdepending on their localization in the vessel.
A seminal work by Russell et al4 has demonstrated that thepassive transfer of sera containing alloantibodies was suffi-cient to promote graft arteriosclerosis. Because MHC mole-cules are highly polymorphic, they are the main targets of thehumoral alloimmune response. Several clinical studies haveconfirmed that the development of alloantibodies directedagainst donor MHC molecules is associated with an increasedrisk of transplant arteriosclerosis after transplantation.5
Interestingly, in addition to their classical role in antigenpresentation, MHC molecules also act as signal-transducingmolecules, and it has been demonstrated that the binding ofantibodies to MHC molecules could modulate the biology ofcells.6
Original received March 9, 2006; final version accepted August 6, 2006.From the Universite Pierre et Marie Curie-Paris6 (O.T., F.B., E.G., S.D., A.-T.G., G.C., A.N.), INSERM UMRS 681, Centre de recherche des
Cordeliers, Paris; INSERM U698 and Universite Denis Diderot (L.L., D.J., J.-B.M.), Hopital Xavier Bichat, Paris; INSERM U563 (E.J.), IFR Claude dePreval, Toulouse; and Department of Vascular Surgery (D.P.), Hopital Universitaire de Rouen, France.
Correspondence to Dr Olivier Thaunat, INSERM UMRS 681, Institut Biomedical des Cordeliers, 15 rue de l’ecole de medecine, 75006 Paris, France.E-mail [email protected]
© 2006 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org DOI: 10.1161/01.ATV.0000241980.09816.ac
2359
In the present work, we have tested whether alloantibodiesbinding to MHC molecules on graft medial smooth musclecells could promote the events leading to the development ofgraft arteriosclerosis.
Materials and MethodsMurine Experimental ModelAge-matched male Brown–Norway (BN) (RT1n) and Lewis (LEW)(RT1l) rats were obtained from Charles River (l’Arbresie, France).LEW rats were used as recipients and syngeneic donors, BN rats asallogeneic donors. The aorta transplantation was performed aspreviously described.7 (Please see the online data supplement,available at http://atvb.ahajournals.org.)
Serum was collected and aortic grafts were removed after salineperfusion from the Lewis recipients under anesthesia. Fresh aorticsamples were dissected and embedded in paraffin, in Epon resin orin OCT medium (Tissue-Tek, Agar Scientific Ltd, Stansted, UK) andsnap frozen immediately in liquid nitrogen (LN2). All animalexperimentation was undertaken in compliance with the EuropeanCommunity Standards (authorization no. 75-214). Animals werekept under conventional conditions and fed a standard diet.
Titration of Alloantibody in the SerumSerum alloantibodies were titrated by flow cytometry using Lewis(recipient) fibroblasts expressing BN (donor) MHC molecules aspreviously described.7 (Please see the online data supplement.)
Immunohistochemistry AnalysisImmunohistochemistry for rat IgG (biotinylated rabbit anti rat IgG;DAKO, Trappes, France), IgM (purified mouse anti rat IgM;MARM4), rat pan MHC I (purified mouse anti-RT1.A; OX-18),BN-specific MHC I (purified mouse anti-RT1.An; OX-27), and ratpan MHC II (purified mouse anti-RT1.B; OX6) was performed on5-�m thick cryostat cross-sections of aortic allograft.
The biotinylated primary antibody was revealed with avidin-ALEXA 555. The other purified mouse anti-rat antibodies weredetected by a biotinylated anti-mouse antibody that was revealedwith avidin-fluorescein isothiocyanate or avidin-ALEXA 555 or byan anti-mouse IgG1 conjugated with ALEXA 350. The nuclei werecounterstained with 4�,6-diamidino-2-phenylindole (DAPI). Fluores-cence was examined with a microscope equipped with epifluores-cence (Leica Microsystemes SAS; France). Computer-assisted mor-phometry was used to quantify the intensity of IgG and IgMdeposition in the medial (Figure I in the online data supplement).
In Situ Apoptosis DetectionThe terminal deoxynucleotidyl transferase-mediated dUTP nick-endlabeling (TUNEL) technique was used to detect apoptosis on 5-�mthick paraffin-embedded cross-sections as previously described.7(Please see the online data supplement.)
Transmission Electron MicroscopyElectron microscopy analysis was performed on aortic grafts 5 days(5 grafts) and 2 month (5 grafts) after transplantation, as previouslydescribed.7 (Please see the online data supplement.)
In Vitro Experiments
Rat Vascular SMC Isolation and CultureThe technique of tissue processing and culture has been previouslydescribed.8 (Please see the online data supplement.) Cells were usedat passage 3 to 6. After passage 3, SMCs acquire a myofibroblasticphenotype9 and therefore represent an appropriate in vitro model ofneointima.
Generation and Purification of Polyclonal AlloantibodiesPolyclonal anti-BN alloantibodies were generated by the skin graftmethod.10 Briefly, 1-cm2 full-skin patch was removed from a BN ratand grafted orthotopically onto a LEW recipient. Four successive
skin grafts were performed every 14 days to each of the 10 sensitizedLEW rats.
Presence of anti-BN alloantibodies in sensitized LEW rats wasassessed using flow cytometry as previously described.7 (Please seethe online data supplement.)
Serum IgG were purified by chromatography on a proteinG-Sepharose column, followed by immediate size-exclusion chro-matography on a superose-12 column. (Please see the online datasupplement.)
SMC Survival AssayLEW and BN SMCs were plated (104 cells/well) in flat bottom96-well plates and cultured until confluence. After a starvationperiod of 24 hours, 0.1 mg of LEW anti-BN alloantibodies (fromsensitized LEW rats) or control IgG (from naive LEW rats) wasadded to the culture.
Cell survival was evaluated using the tetrazolium salt reduction(MTT) assay11 according to the instructions of the manufacturer(Roche Diagnostics, Indianapolis, Ind). (Please see the online datasupplement.)
Quantification of In Vitro ApoptosisApoptotic cell death of BN or LEW (control) SMCs was measuredafter 8 and 24 hours of culture with LEW anti-BN alloantibodies.The Cell Death Detection sandwich ELISAPLUS kit (Roche Diagnos-tics, Mannheim, Germany), which determines cytoplasmic histone-associated DNA fragments was used according to the instructions ofthe manufacturer.
Production of Growth Factors by SMCs IncubatedWith Alloantibodies
Transfer of Culture SupernatantSupernatants from LEW (control) or BN SMCs stimulated withLEW anti-BN alloantibodies were harvested after 8 or 24 hours ofculture. The supernatants were then added to 5.104 serum-starvedLEW SMCs for which the proliferation was assessed by the MTTassay as described above after 48 hours of culture.
Semiquantitative Polymerase Chain ReactionTranscription levels of 4 growth factors (platelet-derived growthfactor [PDGF]-A and -B, fibroblast growth factor [FGF]-2, insulin-like growth factor [IGF]-1, transforming growth factor [TGF]-�) anda housekeeping gene (GAPDH) were analyzed by semiquantitativeRT-PCR in BN SMC pellet (106 cells/ well; flat bottom 24-wellplates) after 2 or 4 hours of culture with alloantibodies. RT-PCR wasperformed as described in the online data supplement.
Statistical AnalysisData were analyzed using the Statview 5.0 software (AbacusConcept Inc). Statistical significance of results was determined by1-way ANOVA, followed by Fischer’s partial least-squares differ-ence tests and with a Mann–Whitney nonparametric test. Probabilityvalues of less than 0.05 were considered statistically significant.
ResultsArterial Wall Is Profoundly Reshaped DuringChronic RejectionMorphological changes of EC and medial SMCs of aorticallograft were tracked during the chronic rejection process.Five days posttransplantation, transmission electron micros-copy analysis showed donor leukocytes bound to the surfaceof graft ECs (Figure 1A). This feature was associated with thenecrosis of ECs and their shedding in the lumen (Figure 1B),indicating that graft ECs are targeted early by the rejectionprocess. In contrast, no leukocyte was detectable beyond theinternal elastic lamina, suggesting that medial SMCs thatdisplayed a normal phenotype were spared by the early
2360 Arterioscler Thromb Vasc Biol. October 2006
cell-mediated injury stage of rejection. Two months post-transplantation, a neointima consisting of SMCs intermingledwith mononuclear cells had developed. Medial SMCs had losttheir normal contractile phenotype and were either apoptotic(Figure 1C) or displayed a synthetic phenotype (Figure 1D).At this time point, we were still unable to detect anyleukocyte infiltration in the media.
TUNEL staining of aortic allografts collected 2 monthsposttransplantation confirmed that medial SMCs underwentmassive apoptosis, whereas SMCs in the adjacent neointimawere spared by this process (Figure 1G and 1H). Proliferationpattern of SMCs analyzed at the same time point byproliferating-cell nuclear antigen staining revealed an in-versed situation, ie, neointimal SMCs but not medial SMCs,were stained (Figure 1E and 1F).
Kinetics of Alloantibody Production andDeposition in the Medial Layer of AllograftsAlloantibody levels in the serum of grafted animals peaked45 days after transplantation and dropped at 90 days (Figure2A). IgM deposits in the media of the graft were detected asearly as 15 days. Fifteen days later (at day 30), IgG were alsopresent and peaked at 45 days (Figure 2A and supplementalFigure I). Alloantibody binding was followed by a decreasedin medial thickness (Figure 2A). These kinetics suggestedthat alloantibodies may be involved in the destruction of themedial SMCs.
The pattern of immunoglobulin deposition within chroni-cally rejected aortic grafts was reproducible. Immunoglobulindeposits were bound to the remaining medial SMCs of thedonor, whereas adjacent neointima was devoid of detectableimmunoglobulin deposition (Figure 2B).
Alloantibody binding to medial SMCs is likely unable totrigger the activation of the complement cascade becauseimmunofluorescence staining for the C5b9 lytic complex wasnegative (Figure 2C).
Chronically Rejected Aortic Allografts AreChimeric for SMCsThe origin of SMCs in aortic grafts 2 months posttransplan-tation was analyzed by immunohistochemistry. We observedthat SMCs from both the media and neointima expressedMHC I molecules, as assessed by the staining with thepan-MHC I OX-18 antibody. However, only medial SMCswere stained with the OX-27 antibody (Figure 2D), which isspecific for BN MHC I molecules. This demonstrates thatchronically rejected aortic grafts are chimeras in which themedial SMCs are from the donor, whereas neointimal SMCsare from recipient origin.
Alloantibody Binding Exerts a Sequential BiphasicEffect on the Survival of Cultured SMCsThe presence of alloantibodies in purified IgG was tested bymeasuring by flow cytometry their binding to LEW fibro-blasts transfected or not with BN MHC molecules. IgG fromnonimmune controls did not bind to the 2 types of LEWfibroblasts (Figure 3A). In contrast, purified IgG from allsensitized LEW rats contained alloantibodies that bound toLEW fibroblasts transfected with BN MHC molecules (Fig-ure 3A). Importantly, no binding was detected when the sameIgG were tested on nontransfected LEW fibroblasts.
Adjunction of LEW anti-BN alloantibodies induced asequential biphasic effect on the survival of cultured BNSMCs. We observed an initial short phase, during which BN
Figure 1. Cellular morphological and functional changes characterizing chronic vascular rejection. Aortic allografts (5 days and 2months posttransplantation) were processed for transmission electron microscopy. After 5 days, donor leukocytes (Lk) were detectedbound to the surface of graft EC (original magnification, �8000) (A), leading to the necrosis of EC and their shedding in the lumen (orig-inal magnification, �3150) (B). Two months posttransplantation, medial SMCs were either (1) apoptotic (original magnification, �8000)(C), as assessed by the condensation of chromatin, the fragmentation of the nucleus, and the shedding of apoptotic bodies (blackarrows); or (2) displayed a synthetic phenotype (original magnification, �8000) (D) characterized by the loss of the elongated filamen-tous cytoplasmic expansions and the enrichment of the perinuclear area in ergastoplasm and mitochondria (white arrows). Immunohis-tochemistry was applied to cross-sections of aortic allografts (2 month posttransplantation). The proliferating-cell nuclear antigen stain-ing (E and F) shows that SMCs proliferated only in the neointima (black arrowheads). Medial SMCs were stained by the in situ TUNELtechnique (G and H), indicating that they underwent apoptosis (white arrowheads). Original magnification, �40 (E and G) and �100 (Fand H).
Thaunat et al Alloantibodies Reshape the Vessel in Graft Arteriosclerosis 2361
SMC survival seems unaffected by alloantibodies, followedby a rapid drop in their survival (Figure 3B). As anticipated,LEW anti-BN alloantibodies had no effect on the survival ofLEW SMCs (Figure 3B).
BN SMCs cultured during 24 hours with alloantibodiesdisplayed an apoptotic phenotype (Figure 3B). Accordingly,after 8 hours, ie, during the initial phase, BN SMCs culturedwith LEW anti-BN alloantibodies displayed a level of cyto-plasmic histone-associated DNA fragments reduced by 30%as compared with BN SMCs alone (Figure 3C). In contrast,when the same measure was performed after 24 hours ofculture, ie, when BN SMCs started to undergo apoptosis, thislevel was increased by 50% (Figure 3C). No difference wasobserved at the 2 time points, when the level of cytoplasmichistone-associated DNA fragments of LEW SMCs culturedalone was compared with that of LEW SMCs cultured withLEW anti-BN alloantibodies (data not shown).
Conditioned Medium From Donor SMCs CulturedWith Alloantibodies Induces Proliferation ofRecipient SMCsSupernatants from BN SMCs cultured with IgG from naiveLEW rats had no effect on the cell growth when transferredonto LEW SMCs. In contrast, when supernatants from BNSMCs cultured 8 hours with alloantibodies were transferredon LEW SMCs, a significant proliferation was detected(Figure 4A). Interestingly, this effect was not detected anylonger when the same experiment was performed with thesupernatants from BN SMCs cultured 24 hours with alloan-tibodies (Figure 4A).
Given that we had shown that LEW anti-BN alloantibodiesdid not bind to LEW SMCs and that they had no effect whenadded directly to LEW SMCs, we assumed that the prolifer-ation of LEW SMCs cultured with conditioned medium fromBN SMCs treated for 8 hours with alloantibodies wastriggered by promitotic factors produced transiently by BNSMCs in response to alloantibodies.
Transcription of Growth Factors Is Upregulated inSMCs Exposed to AlloantibodiesThe transcription levels of PDGF, FGF-2, IGF-1, and TGF-�,all involved in chronic vascular rejection,12 were assessed bysemiquantitative RT-PCR. As controls, BN SMCs were alsoexposed to IgG from naive LEW rats. The transcription levelswere measured after 2 and 4 hours of incubation.
We were unable to find detectable levels of TGF-� mRNAin SMCs exposed or not to alloantibodies at the 2 time points.In contrast, BN SMCs cultured with alloantibodies signifi-cantly increased their level of expression of PDGF, FGF-2,and IGF-1 mRNA as compared with the same cells culturedwith control IgG (Figure 4B). Interestingly, the kinetics ofexpression of these 3 growth factors were different. PDGFmRNA level was transiently augmented after 2 hours andpreceded the increase in FGF-2 and IGF-1 mRNA levelsobserved at 4 hours. This may indicate, as recently reported,13
that PDGF induces the production of other growth factors thatact synergistically to promote the survival and the prolifera-tion of SMCs in autocrine/paracrine mode.
Figure 2. Alloantibody production and deposition in aortic allo-grafts. A, Serum alloantibodies were sequentially titrated by flowcytometry (top left). The kinetic of binding of immunoglobulins tothe grafted media was quantified by morphometry on immuno-histochemical stainings of IgG (lower right) and IgM (lower left).Results are expressed as the surface area of the labeling. Thethickness of the media was also determined (top right). Immu-nofluorescence was performed on cross-section of aortic allo-grafts (2 months posttransplantation) to analyze alloantibodiesdeposition (original magnification, �60). Alloantibodies weredetected (red fluorescence) within the media, whereas the neo-intima was devoid of immunoglobulin deposition (B). Staining forthe C5b9 lytic complex (green fluorescence) was negative (C).The source of SMCs in the graft was determined by double im-munofluorescence staining with OX18 (anti-rat pan MHC I; redfluorescence) and OX27 (directed against an MHC I determinantspecific for BN rats; green fluorescence) (D).
2362 Arterioscler Thromb Vasc Biol. October 2006
Anti–MHC I Alloantibodies Carry theRemodeling EffectAnti-MHC alloantibodies are predominant during the hu-moral alloimmune response. We hypothesized that alloanti-bodies responsible for the remodeling effect during chronicrejection were directed against donor MHC. We found thatmedial SMCs from the rejected aortic graft did not expressMHC II molecules (supplemental Figure II). Strikingly, LEWanti-BN alloantibodies did induce apoptosis of LEW fibro-blasts only if transfected with the BN RT1.A1n MHC Imolecules (F-LEW�A1n cells; Figure 3D), indicating that
anti–MHC I alloantibodies can induce cell death of donorSMCs.
DiscussionThe hallmark of graft arteriosclerosis is the development of athick neointima composed mainly of myofibroblasts. Theorigin of these cells has been extensively debated. Earlierstudies proposed that these cells migrated from the media ofthe graft14 suchlike in the balloon-injured arteries. Recentdata rather favor a recipient origin, either from bone marrow–derived precursors15 or from SMCs migrating from the edge
Figure 3. Effect of alloantibody binding on thesurvival of cultured SMCs. Flow cytometrywas performed on LEW fibroblasts trans-fected or not with BN MHC molecules (A) toanalyze the binding of alloantibodies presentin purified IgG from naive LEW rats (gray line)and sensitized LEW rats (black line) (filled his-tograms, fluorescence intensity obtained withthe secondary antibody alone). The time-dependent survival of LEW and BN SMCscultured with 0.1 mg of LEW anti-BN alloanti-bodies was evaluated using the MTT assay(B). Results are expressed as the ratio of theoptical density (OD) (570 to 630 nm) obtainedwith SMCs cultured with and without alloanti-bodies. *P�0.05 LEW SMCs vs BN SMCs.Representative micrographs of LEW and BNSMCs cultured 24 hours with LEW anti-BNalloantibodies are shown. Apoptotic celldeath of BN SMCs was quantified after 8 and24 hours of culture with LEW anti-BN alloanti-bodies using ELISAPLUS kit (C). Results areexpressed as the ratio of the OD (405 to 490nm) obtained with BN SMCs cultured withand without alloantibodies. **P�0.01 with vswithout alloantibodies. Figures are represen-tative of 3 individual experiments. The pro-apoptotic effect of the LEW anti-BN alloanti-bodies was analyzed using colorimetric MTTassay. F-LEW-F or F-LEW�A1n were culturedwith 0.1 mg of purified LEW anti-BN alloanti-bodies (D). Cell survival was evaluated after36 hours and is expressed as the ratio of theOD (570 to 630 nm) obtained with fibroblastscultured with and without alloantibodies.***P�0.001 LEW-F vs LEW-F�A1n.
Figure 4. Proliferation of SMCs andgrowth factor transcription levels. Super-natants from BN SMCs cultured for 8hour and 24 hour with IgG from naıveLEW rats or with LEW anti-BN alloanti-bodies were transferred on LEW SMCs.Proliferation of LEW SMCs was mea-sured by the MTT assay after 48 hours(A). *P�0.05 with IgG from naıve LEWrats vs with LEW anti-BN alloantibodies.Levels of the mRNA for PDGFA and B,FGF-2, IGF-1, and TGF-� were measuredby semiquantitative RT-PCR in BN SMCscultured for 2 or 4 hours with IgG fromnaıve LEW rats, or with LEW anti-BNalloantibodies, or without addition of IgG.The results are normalized to the GAPDHmRNA level (B). *P�0.05, **P�0.01 LEWanti-BN vs LEW naıve and SMCs alone.
Thaunat et al Alloantibodies Reshape the Vessel in Graft Arteriosclerosis 2363
of the graft. The remodeling process characterizing chronicrejection also affects the medial layer because SMCs progres-sively disappear from grafted arteries.
In the present study, we propose to consider alloantibodiesas among the triggering factors for the reshaping process ofthe vessel during graft arteriosclerosis. In an experimentalmodel of chronic vascular rejection, we have shown thatmedial SMCs switch toward a synthetic or apoptotic pheno-type, whereas SMCs in the neointima proliferate subse-quently to the rapid destruction of the endothelium of thegraft. Therefore, SMCs have opposite fates depending ontheir localization within grafted arteries. We have linkedthese differentiated events with the pattern of deposition ofalloantibodies. Indeed, alloantibody deposits are detectedwithin the media, whereas the neointima remains devoid ofIgG deposition. Because alloantibodies are directed againstantigens that are polymorphic and thus distinct between thedonor and the recipient, we hypothesized that the pattern ofdeposition was a witness to the fact that chronically rejectedarteries were chimeras. We showed indeed that whereasMHC I was expressed by SMCs both in the media and theneointima, only medial SMCs expressed donor (BN) MHC Imolecules. From this, we can deduce that (1) the proliferatingSMCs in the neointima are from recipient origin, and (2)therefore anti-donor alloantibodies can directly target onlySMCs in the media. These observations have however to bereconciled with previous studies in which passive transfer ofalloantibodies to a recipient of an allograft was sufficient totrigger the full remodeling of grafted arteries, including theshrinkage of the media but also the development of theneointima.4 Conversely, cyclosporin therapy was shown toefficiently protect against the development of graft arterio-sclerosis in the rat aortic interposition model.16,17 In thissetting, reduced titer of alloantibodies correlated with anincreased survival of medial SMCs as well as a reducedaccumulation of host-derived SMCs in the neointima.17 Thisimplies that despite their exclusive deposition in the media,alloantibodies could have an effect both on the media and theneointima.
We therefore first asked whether alloantibodies could beresponsible for the disappearance of SMCs of the medialdonor. We observed that alloantibodies deposition in themedia failed to activate the complement cascade. We foundthat the effector mechanism leading to cell destruction reliesrather on a proapoptotic effect triggered by the binding ofalloantibodies on SMCs.
We next addressed whether alloantibodies could trigger theproliferation of SMCs of the recipient, leading to the devel-opment of the neointima. Because we observed that they haveno direct effect on SMCs of the recipient, we hypothesizedthat the effect of alloantibodies on the development of theneointima may be a consequence of their binding to SMCs ofthe medial donor. To model in vitro the influence of eventstaking place in the media on the development of the neigh-boring neointima, we performed culture supernatant transferexperiments. We demonstrated that binding of alloantibodiesto SMCs of the donor induces an early and transient produc-tion of growth factors that in turn is responsible for theproliferation of SMCs of the recipient. Therefore, alloanti-
body binding to SMCs of the donor in the media transducesa signal that exerts a sequential biphasic effect able to triggerboth the remodeling of the media and the development of theneointima during graft arteriosclerosis. Unraveling the intra-cellular events following alloantibody binding may help toexplain this biphasic sequential effect on SMCs. The findingthat medial SMCs participate to the production of growthfactors promoting neointimal proliferation does not precludethat other cells could do so. For instance, recipient inflam-matory cells infiltrating the neointima are likely participatingto this process.
One limitation of this study is that we did not explore therole of the early deendothelialization in the development ofthe neointima. Indeed, the mechanical destruction of ECs issufficient to trigger the development of a neointima in anonalloimmune setting. Of note, we have shown in analloimmune system that deendothelialization followed byimmediate reendothelialization with recipient SMCs was ableto prevent only marginally the development of neointima,suggesting that alloimmune response is the main trigger forintimal SMC proliferation in graft arteriosclerosis.18
Another limitation of this study is that we did not directlyidentify the specificity of alloantibodies carrying the remod-eling effect. Indeed, to model in vitro the in vivo situation asclosely as possible, we used nonpooled polyclonal alloanti-bodies purified from individual animals containing multiplespecificities (mostly anti–MHC I and anti–MHC II antibod-ies). However, neither SMCs from the donor nor from therecipient expressed the MHC II molecules as assessed byimmunohistochemistry with a mouse anti-rat MHC II anti-body (OX-6; supplemental Figure I). Furthermore, weshowed that polyclonal alloantibodies induced apoptosis ofrecipient fibroblasts when they were transfected to express asingle alloantigen, the donor MHC I molecules.
In conclusion, we propose that anti–MHC I alloantibodiesplay a key role in the arterial remodeling during graftarteriosclerosis. Significantly, we have recently reported thatlymphoid neogenesis takes place in the adventitia of graftedarteries and leads to the development of ectopic germinalcenters in which B cells produce anti–MHC I alloantibodieslocally.7 In the present work, we demonstrate that the bindingof anti–MHC I alloantibodies to the SMCs of the medialdonor exerts a sequential biphasic effect. First, they induce atransient production of growth factors that promote an inap-propriate response to injury of the intima. These growthfactors act in a paracrine fashion to promote the proliferationof SMCs of the recipient that may contribute to the develop-ment of an obstructive neointima. In a second phase, thebinding of anti–MHC I alloantibodies drives the apoptosis ofSMCs of the donor, resulting in the shrinkage of the media.This work ultimately supports a vision in which the remod-eling features specific to each tunica are not independent butrather linked to each other in a chain reaction initiated by theproduction of anti–MHC I alloantibodies.
AcknowledgmentsWe are grateful to Dr Srini Kaveri for critical reading ofthe manuscript.
2364 Arterioscler Thromb Vasc Biol. October 2006
Disclosure(s)None.
References1. Sayegh MH, Carpenter CB. Transplantation 50 years later–progress,
challenges, and promises. N Engl J Med. 2004;351:2761–2766.2. Libby P, Pober JS. Chronic rejection. Immunity. 2001;14:387–397.3. Plissonnier D, Nochy D, Poncet P, Mandet C, Hinglais N, Bariety J,
Michel JB. Sequential immunological targeting of chronic experimentalarterial allograft. Transplantation. 1995;60:414–424.
4. Russell PS, Chase CM, Winn HJ, Colvin RB. Coronary atherosclerosis intransplanted mouse hearts. II. Importance of humoral immunity.J Immunol. 1994;152:5135–5141.
5. Reed EF, Hong B, Ho E, Harris PE, Weinberger J, Suciu-Foca N.Monitoring of soluble HLA alloantigens and anti-HLA antibodies iden-tifies heart allograft recipients at risk of transplant-associated coronaryartery disease. Transplantation. 1996;61:566–572.
6. Gilliland LK, Norris NA, Grosmaire LS, Ferrone S, Gladstone P,Ledbetter JA. Signal transduction in lymphocyte activation throughcrosslinking of HLA class I molecules. Hum Immunol. 1989;25:269–289.
7. Thaunat O, Field AC, Dai J, Louedec L, Patey N, Bloch MF, Mandet C,Belair MF, Bruneval P, Meilhac O, Bellon B, Joly E, Michel JB, NicolettiA. Lymphoid neogenesis in chronic rejection: evidence for a localhumoral alloimmune response. Proc Natl Acad Sci U S A. 2005;102:14723–14728.
8. Battle T, Arnal JF, Challah M, Michel JB. Selective isolation of rat aorticwall layers and their cell types in culture—application to convertingenzyme activity measurement. Tissue Cell. 1994;26:943–955.
9. Hultgardh-Nilsson A, Lovdahl C, Blomgren K, Kallin B, Thyberg J.Expression of phenotype- and proliferation-related genes in rat aorticsmooth muscle cells in primary culture. Cardiovasc Res. 1997;34:418–430.
10. Forbes RD, Kuramochi T, Guttmann RD, Klassen J, Knaack J. A con-trolled sequential morphologic study of hyperacute cardiac allograftrejection in the rat. Lab Invest. 1975;33:280–288.
11. Hussain RF, Nouri AM, Oliver RT. A new approach for measurement ofcytotoxicity using colorimetric assay. J Immunol Methods. 1993;160:89–96.
12. Vuillemin T, Lantz O, Legendre C, Meduri G, LaRue JR, Kriaa F, HiesseC, Senik A, Kreis H, Charpentier B. Potential involvement of growthfactors in the proliferation of arteriolar smooth muscle cells duringchronic graft rejection. Adv Nephrol Necker Hosp. 1996;25:39–49.
13. Millette E, Rauch BH, Defawe O, Kenagy RD, Daum G, Clowes AW.Platelet-derived growth factor-BB-induced human smooth muscle cellproliferation depends on basic FGF release and FGFR-1 activation. CircRes. 2005;96:172–179.
14. Hayry P, Paavonen T, Mennander A, Ustinov J, Raisanen A, LemstromK. Pathophysiology of allograft arteriosclerosis. Transplant Proc. 1993;25:2070.
15. Shimizu K, Sugiyama S, Aikawa M, Fukumoto Y, Rabkin E, Libby P,Mitchell RN. Host bone-marrow cells are a source of donor intimalsmooth- muscle-like cells in murine aortic transplant arteriopathy. NatMed. 2001;7:738–741.
16. Plissonnier D, Amichot G, Lecagneux J, Duriez M, Gentric D, Michel JB.Additive and synergistic effects of a low-molecular-weight, heparin-likemolecule and low doses of cyclosporin in preventing arterial graftrejection in rats. Arterioscler Thromb. 1993;13:112–119.
17. Religa P, Bojakowski K, Bojakowska M, Gaciong Z, Thyberg J, Hedin U.Allogenic immune response promotes the accumulation of host-derivedsmooth muscle cells in transplant arteriosclerosis. Cardiovasc Res. 2005;65:535–545.
18. Gomes D, Louedec L, Plissonnier D, Dauge MC, Henin D, Osborne-Pellegrin M, Michel JB. Endoluminal smooth muscle cell seeding limitsintimal hyperplasia. J Vasc Surg. 2001;34:707–715.
Thaunat et al Alloantibodies Reshape the Vessel in Graft Arteriosclerosis 2365
Thaunat et al - 1
SUPPLEMENTAL DATA – ONLINE
MATERIALS AND METHODS
Aorta transplantation
All animal experimentation was undertaken in compliance with the European Community
standards (authorization n° 75-214).
Rats were anesthetized with 50mg/Kg of pentobarbital injected intraperitoneally. Two
animals were operated simultaneously, one as the donor of aortic graft and the other as
the recipient, with the aid of an operating microscope. A 1 cm long segment of the donor
abdominal aorta was excised, perfused with normal saline and small collateral arteries
that originated from the graft were ligated. The donor aorta was transplanted in orthotopic
position by end-to-end anastomosis in the recipient aorta below the renal arteries and
above the iliac bifurcation. We used the 38 animals that survived to the surgical
procedure. No immunosuppressive or anticoagulant treatment was used. Aortic grafts
were removed at indicated time-points from the Lewis recipients under anesthesia and
perfused with saline. Fresh aortic samples were dissected and embedded in paraffin or in
OCT medium (Tissue-Tek, Agar Scientific Ltd, UK) and snap frozen immediately in
liquid nitrogen.
Titration of alloantibody in the serum
Two hundreds µl of serum harvested at various time points from grafted animals were
incubated with 200,000 Lewis (recipient) fibroblasts expressing Brown-Norway (donor)
Thaunat et al - 2
MHC molecules cells (LEW-F+A1n) for 30 min at 4°C. The binding of antibodies on the
cell surface was then determined with a FITC-conjugated rabbit anti-rat Ig secondary
antibody (PARIS; France), by measuring the mean fluorescence intensity (MFI) with a
LSR II flow cytometer (BD Biosciences; France).
Morphometry
Labeling of IgG and IgM was quantified from images acquired on the same field within
the green, red, and blue channels of a fluorescent microscope. Image analysis was
performed using a customized program (Leica Qwin). Elastin autofluorescence (green
channel) was substracted from the fluorescence detected on the blue channel while no
elastin signal was detected in the red channel in the acquisition condition used for image
capture. The external and internal elastic lamina were used to delineate the media and to
calculate its surface area and its thickness.
In-situ apoptosis detection
In situ 3-end labeling of apoptotic DNA was performed using Apotag Peroxidase Kits
(Oncor, USA) following the manufacturer's instructions. Briefly, after dewaxing,
rehydration, and blocking of endogenous peroxidase, 3-hydroxy-DNA strand breaks in
permeabilized tissue sections were enzymatically labeled with digoxigenin-nucleotides,
by using terminal deoxynucleotidyl transferase (TdT). The labeled DNA was then bound
with antidigoxigenin antibody peroxidase conjugate, and the peroxidase color reaction
was developed with a 3-amino-9-ethyl carbazole substrate.
Thaunat et al - 3
Transmission electron microscopy
Aortic graft specimens were dissected, immediately fixed in 2.5 % glutaraldehyde in PBS
buffer, post-fixed in 4% osmium tetroxide and embedded in Epon resin. Ultrathin
sections (50 to 80 nm thick) were prepared, stained with lead citrate and uranyl acetate
and observed with a Zeiss EMI transmission electron microscope.
Rat vascular SMC isolation and culture
Rat (LEW and BN) aortic SMC were isolated after microdissection of the adventitia from
the media and the endothelium. The media was cut into 1 mm-long rings and subjected to
an enzymatic digestion with a mixture of collagenase and elastase (Gibco/Invitrogen).
Cell suspensions were plated and cultured to confluence at 37°C, 5% CO2, in Dulbecco's
modified Eagle's medium (Gibco) supplemented with 10% fetal calf serum (FCS),
100U/ml penicillin and 0.1 mg/ml streptomycin (complete medium).
Polyclonal alloantibodies generation and purification
Ten µl of serum collected 10 days after the 4th skin graft were incubated 20 min at 4°C
with 2.5 105 LEW fibroblasts expressing or not BN MHC molecules. The binding of
antibodies on the cell surface was detected with a FITC-conjugated rabbit anti-rat Ig
secondary antibody (PARIS; France) by measuring the mean fluorescence intensity in a
LSRII flow cytometer (Becton Dickinson Biosciences).
A two-step procedure for IgG purification was applied to avoid the contamination of the
IgG preparation with other serum proteins. Fourteen days after the 4th skin graft, 10 ml of
blood was collected from LEW rats sensitized or not (source for control IgG) and serum
Thaunat et al - 4
was prepared. Serum IgG were purified by chromatography on a protein G-Sepharose
column, followed by immediate size-exclusion chromatography on a superose-12
column. The IgG-containing fraction was dialyzed against PBS at 4°C for 24h, adjusted
to a concentration of 10 mg/ml, aliquoted and stored at –80°C until analysis.
SMC survival assay
LEW and BN SMC were plated (104 cells/well) in flat bottom 96-well plates and cultured
at 37°C, 5% CO2, in 100 µl of complete medium (DMEM supplemented with 10% fetal
calf serum, 100U/ml penicillin, and 0.1 mg/ml streptomycin) until confluence. Complete
medium was then replaced with 90 µl of starvation medium (DMEM supplemented with
2% bovine serum albumin, 100U/ml penicillin, and 0.1 mg/ml streptomycin). After a
starvation period of 24h, 10 µl (0.1 mg) of LEW anti-BN alloantibodies (from sensitized
LEW rats) or control IgG (from naïve LEW rats) were added to the culture.
Cell survival was evaluated using the tetrazolium salt reduction (MTT) assay according
to the manufacturer’s instructions (Roche Diagnostics; IN, USA; please see
http://atvb.ahajournals.org). The MTT assay (Roche Diagnostics; IN, USA) is based on
the colorimetric measurement of a formazan derivative of 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyltetrazolium bromide that is formed by live cells. Briefly, 10 µl of MTT
labeling solution (5 mg/ml) were added to the culture at various time-points after addition
of antibodies (4h, 8h, 24h, 36h, and 48h). After an incubation period of 4h at 37°C and
5% CO2, formazan crystals were dissolved by adding 100µl of the solubilization solution
(10%SDS in 0.01 M HCl) and the absorbance was measured using a scanning multiwell
spectrophotometer at dual wavelength 570–630 nm.
Thaunat et al - 5
All measurements were performed in duplicates and the experiments were repeated 3
times.
Semi-quantitative PCR
Messenger RNAs were extracted with 500 µl of TRIzol (Invitrogen, France) after 2 or 4 h
of culture. Reverse transcription reaction was performed with 2 µg of RNA using Oligo
dT, random hexamers, and Moloney Murine Leukemia Virus reverse transcriptase
(Invitrogen). All oligonucleotide primers were synthesized by Eurogentec (France)
(Table I). The PCR reaction was performed in capillaries with 5µl cDNA, 10µl 2x SYBR
Green master mix (Qiagen, France) and 0.5 µM of sense and antisense primer. Real time
PCR was performed in LightCycler (Roche Diagnostics, France) starting with 15 min of
pre-incubation at 95°C followed by 55 cycles of 10 sec at 95 °C, 20 sec at annealing
temperature depending on primers used (Table 1), and 30 sec at 72 °C. Amplification of
expected PCR product was confirmed by agarose gel electrophoresis (2%) and melting
curve analysis.
The threshold cycle (Ct) was determined with the maximum-second-derivative function
of the LightCycler software. Results are expressed as the ratio between the Ct of the gene
tested and the Ct of GAPDH.
Thaunat et al - 6
Table I: Primer list and characteristics of polymerization
Genes
Primer sequences
Fragment
size
(bp)
Annealing
temperature
(°C)
GAPDH Upper: GTGAAGGTCGGAGTCAACG
Lower: GGTGAAGACGCCAGTGGACTC
299 55
PDGFA & B Upper: GTAACACCAGCAGCGTCAAGT
Lower: CTCACCTCACATCCGTCTCCT
195 56
FGF-2 Upper: GCACTGAAACGAACTGGGCAGTAT
Lower: CGCGTTCCTTCACCATCAACTTCT
344 59.7
IGF-1 Upper: GTACCAAAATGAGCGCACCTC
Lower: TTGGTCCACACACGAACTGA
165 58.1
TGF!-1 Upper: CTGCCGCTTCTGCTCCCACTC
Lower: GCCCTGTATTCCGTCTCCTTG
624 55
Thaunat et al - 7
Figure I
The computer-assisted morphometric program used to quantify the labeling of IgG and
IgM in the media was run on images acquired on the same field within the green, red, and
blue channels of a fluorescent microscope (Original magnification x40). Elastin
autofluorescence (green channel, Left inset) was substracted from the fluorescence
detected on the blue channel (Right inset) while no elastin signal was detected in the red
channel (Middle inset) in the acquisition condition used for image capture. The main
picture represents an overlay of the surface areas calculated from each of the three
channels on a transversal section of an allograft harvested 30 days post-transplantation
The external and internal elastic lamina were used to delineate the media and to calculate
its surface area and its thickness.
Thaunat et al - 8
Figure II
Six aortic allografts were harvested 10 days (n = 2), 1 month (n = 2) and 2 months (n = 2)
post-transplantation. We analyzed by immunohistology the expression of MHC class II
by medial SMC of the chronically rejected allografts. Five-micrometer thick transversal
sections of aortic allografts were stained using the alkaline phosphatase anti-alkaline
phosphatase technique. Primary monoclonal antibodies used were anti pan-MHC class II
OX6. A representative photograph obtained on an aorta harvested 10 day post-
transplantation is shown (Original magnification x5). MHC class II expression was
detected at every time points in the intima and the adventitia of the graft but not in the
media.
103
3.2 Néogenèse lymphoïde au cours du rejet d’allogreffe
aortique expérimental : mise en évidence d’une réponse
alloimmune locale
Nous avons porté notre attention sur l’infiltrat inflammatoire adventitiel pour 2
raisons: i) la disproportion du nombre d’effecteurs inflammatoires infiltrant
l’adventice par rapport au faible nombre de cibles allogéniques présents dans
cette tunique (quelques fibroblastes résidents), et ii) le fait que la cinétique de
l’infiltration est très corrélée chronologiquement à la persistance de cibles
allogéniques dans le greffon (204, 210).
Nous avons montré que le recrutement des effecteurs cellulaires au sein de
l’adventice se faisait par les veinules post-capillaires des vasa vasorum. Au
cours de la réponse alloimmune les cellules endothéliales des veinules post-
capillaires changent de phénotype. Une analyse par microscopie électronique
a montré qu’elles devenaient cuboïdes avec un cytoplasme abondant riche en
organelles et qu’elles émettaient des prolongements cytoplasmiques dans la
lumière du vaisseau. Ces caractéristiques morphologiques les rapprochent
des HEV, ces cellules endothéliales spécialisées des organes lymphoïdes
secondaires capables de recruter avec une grande efficacité les lymphocytes
naïfs de la circulation sanguine.
Nous avons microdisséqué l’adventice et mis en suspension les cellules qui
l’infiltraient à différents temps post-transplantation afin de réaliser une analyse
phénotypique par cytométrie en flux. Cette analyse cinétique de l’infiltrat
inflammatoire a montré que sa composition changeait au cours du temps. Les
premières cellules pénétrant dans le greffon sont des macrophages
rapidement suivis par des lymphocytes T. Aux temps précoces, l’infiltrat
lymphocytaire T est diffus. Il est composé à part égale de lymphocyte T CD4+
et CD8+ présentant une polarisation de type 1. Au cours du temps, des
renforcements nodulaires apparaissent au sein de l’infiltrat. La part des
lymphocytes T CD4+ augmente et la polarisation change en faveur d’un
phénotype « helper B ». Ce fait est d’autant plus significatif qu’il coïncide avec
la présence dans l’adventice aux temps tardifs de lymphocytes B. Ces
derniers présentent une disposition particulière : ils sont groupés en nodules à
proximité des veinules post-capillaires. Ces nodules lymphocytaires B sont le
104
siège d’une intense prolifération et apoptose suggérant qu’il pourrait s’agir de
centres germinatifs ectopiques. Afin de vérifier i) si ces structures étaient des
centres germinatifs ectopiques fonctionnels, et ii) si elles étaient impliquées
dans le rejet du greffon aortique, nous avons mis en place une technique de
culture tissulaire d’adventice microdisséquée à partir de greffons aortiques
prélevés un mois après transplantation. Nous avons mis en évidence la
présence dans le surnageant d’immunoglobulines. Nous avons analysé la
spécificité de ces immunoglobulines par cytométrie en flux et démontré la
présence d’une réactivité contre les molécules du CMH-I du donneur.
L’organisation progressive des infiltrats inflammatoires en structures
lymphoïdes évocatrices de tissu lymphoïde secondaire a déjà été décrite
dans de nombreuses situations inflammatoires chroniques (pour une revue
récente des situations où ce phénomène a été identifié voir (93)) et
dénommée néogenèse lymphoïde (214). Nos résultats : i) identifient la
néogenèse lymphoïde comme un nouveau mécanisme physiopathologique
survenant au cours du rejet d’allogreffe expérimental, rapprochant cette
situation clinique particulière des très nombreuses pathologies inflammatoires
chroniques ; et ii) suggèrent que la néogenèse lymphoïde est impliquée dans
les processus de destruction chronique du greffon aortique chez le rat en
étant un site de production des alloanticorps (dont nous avons souligné le rôle
précédemment). Au cours du rejet, le greffon est la fois la cible et un des sites
où s’élabore la réponse alloimmune.
Lymphoid neogenesis in chronic rejection: Evidencefor a local humoral alloimmune responseOlivier Thaunat*†, Anne-Christine Field*, Jianping Dai‡, Liliane Louedec‡, Natacha Patey§, Marie-Francoise Bloch*,Chantal Mandet*, Marie-France Belair*, Patrick Bruneval*, Olivier Meilhac‡, Blanche Bellon*, Etienne Joly¶,Jean-Baptiste Michel‡�, and Antonino Nicoletti*�
*Institut National de la Sante et de la Recherche Medicale U681, Institut Biomedical des Cordeliers, Universite Pierre et Marie Curie Paris VI 75006 Paris,France; ‡Institut National de la Sante et de la Recherche Medicale U698, Hopital Xavier Bichat, 75870 Paris, France; §Department of Pathology, HopitalNecker, 75270 Paris, France; and ¶Institut National de la Sante et de la Recherche Medicale U563, L’Institut Federatif de Recherche Claude de Preval,31300 Toulouse, France
Communicated by Jean Dausset, Fondation Jean Dausset, Centre d’Etude du Polymorphisme Humain, Paris, France, August 29, 2005 (received for reviewJune 10, 2005)
Recent advances indicate that, in various chronic inflammatorydisorders, the activation of the immune system is triggered locallyrather than in lymphoid organs. In this study, we have evaluatedwhether the humoral alloimmune response involved in chronicrejection is elicited within the graft. We used the rat aorticinterposition model and microdissected the adventitia of the graft.Over time, the T cell infiltrate shifted toward a B helper phenotype.B lymphocyte clusters were detected and were the site of intenseproliferation and apoptosis. Simultaneously, adventitial vascularendothelium acquired a high endothelial venule phenotype. Sim-ilar features were evidenced in the interstitium of chronicallyallografts (hearts and kidneys). Strikingly, ganocultured graft in-terstitial tissue was found to be the site of production of antibodiesdirected against donor MHC-I molecules. These findings, therefore,document the appearance of germinal centers in chronically re-jected tissues. This lymphoid neogenesis implies that the graft isnot only the target of the alloimmune response but also a sitewhere this response actually develops, so as to optimize thecommunication between the targeted tissue and the immuneeffectors.
chronic rejection � transplantation � B cells � germinal centers � adventitia
Despite recent advances in transplantation, the long-termoutcome of transplanted organs remains impeded by
chronic rejection (1). Accumulating evidence suggests that hu-moral immunity (2–4) and, particularly, alloantibodies directedagainst donor MHC I molecules (5–8) are critical in the patho-genesis of chronic vascular rejection.
Clinically, chronic rejection is responsible for a slow deteriorationof graft function, which correlates with typical histological changes.Excluding organ-specific manifestations, the most common his-topathological feature is chronic vascular rejection, also known asallograft arteriosclerosis, characterized by widespread and diffusenarrowing of the vascular lumen as a result of intimal proliferationof smooth muscle cells and fibroblasts and destruction of smoothmuscle cells from the media (9–12). Chronic vascular rejection isalso typified by an abundant adventitial inflammatory infiltrate (9).We therefore evaluated whether the humoral alloimmune responsewas elicited within the adventitia of the graft. In such case, chronicvascular rejection would be similar to other chronic inflammatorydisorders in which tissue destruction results from a vicious circlemaintained by an uncontrolled local immune response.
We demonstrate the involvement of intragraft lymphoid neo-genesis in the development of chronic rejection in an animal model,based on aortic transplantation between histoincompatible strainsof rats (13–16). We show that the adventitial inflammatory infiltrateharbors a secondary lymphoid organ structure and that anti-donorMHC I antibodies are produced within these structures. Addition-ally, we provide insights into the clinical relevance of these obser-vations because similar lymphoid structures were detected in theinterstitium of human chronically rejected grafts.
Materials and MethodsAnimals. Age-matched male Brown-Norway (BN; RT1n) and Lewisrats (LEW; RT1l) were obtained from Charles River BreedingLaboratories. LEW rats were used as recipients and syngeneicdonors and BN rats were used as allogeneic donors. All animalexperimentation was undertaken in compliance with the EuropeanCommunity standards (authorization no. 75-214). Animals werekept under conventional conditions and fed a standard diet.
Aorta Transplantation. Rats were anesthetized with 50 mg�kg pen-tobarbital injected i.p. Two animals were operated simultaneously,one as the donor of aortic graft and the other as the recipient, withthe aid of an operating microscope. A 1-cm-long segment of thedonor abdominal aorta was excised, perfused with normal saline,and small collateral arteries that originated from the graft wereligated. The donor aorta was transplanted in orthotopic position byend-to-end anastomosis in the recipient aorta below the renalarteries and above the iliac bifurcation. We used the 94 of 100animals that survived to the surgical procedure. No immunosup-pressive or anticoagulant treatment was used. At 10 days, 1 month,and 2 months posttransplantation, aortic grafts were removed fromthe Lewis recipients under anesthesia and perfused with saline.These three time points were selected in accordance with one of ourprevious studies (17), which showed that they correspond, respec-tively, to three successive stages of the rejection process. Indeed, thecellular cytotoxic response takes place 10 days posttransplantation,followed by the humoral response and scarring process, respectively,1 and 2 months posttransplantation.
Fresh aortic samples were dissected and embedded in paraffin orsnap frozen immediately in optimal cutting temperature (OCT)medium (Tissue-Tek, Agar Scientific, Stansted, Essex, U.K.) inliquid nitrogen.
Isolation of Adventitial Cells. Cells within the adventitia of the graftwere isolated as described in ref. 18 by microdissection, digestion ina collagenase I solution (GIBCO�Invitrogen), and filtrationthrough 100-�m nylon meshes.
Antibodies. The following mouse anti-rat mAbs (Serotec) wereused: anti-TCR�� (R73; T cells), anti-CD4 (OX35; helper T cells),anti-CD8� (OX8; cytotoxic T cells), anti-CD134 (OX40), anti-RT1-B (OX6; MHC II molecule), and anti-ED1 (macrophages). Inaddition, anti-CD25 (OX39; RIL-2 receptor � chain), anti-IFN�antibodies, and adequate murine isotypic controls were used (BD
Abbreviations: HEV, high endothelial venule; PCNA, proliferating cell nuclear antigen.
†To whom correspondence should be addressed at: Institut National de la Sante et de laRecherche Medicale U681, Institut des Cordeliers, 15 Rue de l’Ecole de Medecine, 75006Paris, France. E-mail: [email protected].
�J.-B.M. and A.N. contributed equally to this work.
© 2005 by The National Academy of Sciences of the USA
www.pnas.org�cgi�doi�10.1073�pnas.0507223102 PNAS � October 11, 2005 � vol. 102 � no. 41 � 14723–14728
IMM
UN
OLO
GY
Pharmingen). B lymphocytes were detected with anti-rat Ig � chainantibodies (MARK 1, Lo-Imex, Brussels) for flow cytometry andwith anti-pan B cell antibodies (RLN-9D3; Serotec) for immuno-histology. Heavy-chain isotypes of surface immunoglobulins on Blymphocytes were defined with anti-� (MARD-3) and anti-�(MARM-4) antibodies (Lo-Imex).
Immunohistological Analysis. Cryosections were air dried and fixedin acetone. Endogenous biotin and avidin were blocked (Biotin–Avidin Block, DAKO). We used a biotin-conjugated horseanti-mouse secondary antibody (Vector Laboratories). Immuno-histochemical staining was revealed by using alkaline phospha-tase anti-alkaline phosphatase complexes. Alkaline phosphatasewas detected by incubation with a revelation substrate (fast redsalt dissolved in Tris buffer containing naphthol and levamisole)prepared just before use. Sections were counterstained withhematoxylin.
Flow Cytometry. Detection of cell-surface antigens. Cells (0.1 million)were stained with FITC-, phycoerythrin (PE)-, or biotin-conjugatedmAbs. Biotinylated mAbs were revealed with streptavidin-PE (BDBiosciences). After washing, cells were fixed in PBS containing 1%of formaldehyde. Fluorescence was detected by using a FACScanand analyzed by using the program CELLQUEST (BD Biosciences).Cells were counted in a tight electronic gate set on the lymphocytecluster on the forward and side scatter plot.Detection of intracellular IFN�. Measurement of IFN� production wasperformed by combined surface and intracellular staining withmAbs and subsequent three-color flow cytometric analysis. Adven-titial lymphocytes were stimulated with phorbol 12-myristate 13-acetate (50 ng�ml; Sigma-Aldrich) and ionomycin (1 �g�ml; Cal-biochem) for 6 h and cytokine secretion inhibited by treatment with10 �g�ml brefeldin A (Alexis, Lausanne, Switzerland) the last 2 hof incubation. Stimulated cells were washed and stained withFITC-conjugated anti-TCR�� antibodies and with CyChrome-conjugated anti-CD4 or PerCP-conjugated anti-CD8� antibodies.Double-labeled cells were fixed and permeabilized with a 0.1%saponin solution (Sigma-Aldrich). Intracellular staining was per-formed with a PE-conjugated anti-rat IFN� antibody. Cells werewashed twice in a 0.1% saponin solution and resuspended in PBSfor flow cytometry analysis. Cells were counted in a tight electronicgate set on the lymphocyte cluster on the forward and side scatterplot. CD4� and CD8� cells expressing IFN� were counted amongTCR��-positive cells.
Apoptosis. The TUNEL technique (19) was used to detect apopto-sis. In situ 3-end labeling of apoptotic DNA was performed by usingApotag Peroxidase kits (Oncor) on paraffin-embedded sections,following the manufacturer’s instructions. Briefly, after dewaxing,rehydration, and blocking of endogenous peroxidase, 3-hydroxy-DNA strand breaks in permeabilized tissue sections were enzymat-ically labeled with digoxigenin-nucleotides, by using terminal de-oxynucleotidyl transferase. The labeled DNA was then bound withantidigoxigenin antibody peroxidase conjugate, and the peroxidasecolor reaction was developed with a 3-amino-9-ethyl carbazolesubstrate.
Proliferation. Cell proliferation was assessed by immunohistochem-istry of proliferating cell nuclear antigen (PCNA) as described inref. 20. The monoclonal Ab PC 10 (Dakopatts) was applied toparaffin-embedded sections after antigen retrieval in a microwaveoven for 5 min in 0.1 M EDTA buffer (pH 8.0).
Transmission Electron Microscopy. Electron microscopy analysis wasperformed on aortic grafts 10 days (10 grafts) and 2 months (5grafts) after transplantation. Aortic graft specimens were har-vested, immediately fixed in 2.5% glutaraldehyde in PBS buffer,postfixed in 4% osmium tetroxide, and embedded in Epon resin.
Semithin sections (1–2 �m thick) were used to locate vascular tissuein the adventitia of the graft. Ultrathin sections (50–80 nm thick)were prepared, stained with lead citrate and uranyl acetate, andobserved with a Zeiss EMI transmission electron microscope.Temporal changes in the morphology of endothelial cells of graftadventitial arterioles, venules, and capillaries were tracked.
In Vitro Production and Characterization of Alloantibodies. Organocul-ture. Microdissected adventitia of aortic grafts and untouchedthoracic aortas, draining lymph nodes, and spleens were recoveredfrom 20 Lewis recipients 1 month posttransplantation and placedin cold sterile X-VIVO 15 serum-free medium (Cambrex, Walk-ersville, MD) with 100 units�ml penicillin�streptomycin and 25�g�ml Fungizone (GIBCO). Tissues were washed three times infresh medium. Each sample was fragmented with a sterile razorblade, placed into 2 ml of fresh medium, and cultured in 24-wellplates at 37°C under hyperoxic conditions (80% O2�20% CO2).Culture supernatants were recovered after 4 days of culture.Specificity of locally produced antibodies. The analysis of the specificityof the antibodies present in the organoculture-derived supernatantswas performed by flow cytometry by using Lewis (recipient)fibroblasts expressing or not expressing Brown-Norway (donor)MHC I molecules. These cells were obtained as follows. The cDNAfor RT1-A1n (nucleotide sequence from the EMBL database,accession no. X90375.1) was cloned in the BamH1 site of thepLXLJ vector and transfected into � 2 cells as described in refs. 21and 22. Culture supernatants from the G418-resistant � 2 cells wereused to infect Lewis fibroblasts (LEW-F). LEW-F cells expressingstable levels of functional RT1-A1n molecules were selected withG418 (GIBCO) at 0.5 mg�ml. All transfected LEW-F cells (LEW-F�A1n) expressed RT1-A1n as assessed by flow cytometry usingthe OX27 monoclonal antibody [mouse anti-rat MHC I, specific forRT1-A1n (23), data not shown]. Appropriate isotypic controls wereused (BD Biosciences).
One hundred microliters of each organoculture-derived super-natant were incubated with 200,000 LEW-F or LEW-F�A1n cellsfor 30 min at 4°C. The binding of antibodies on the cell surface wasthen determined with an anti-rat Ig � light-chain FITC-conjugatedantibody (MARK 1), by measuring the mean fluorescence intensityin a FACScan flow cytometer.
Processing of Human Tissues. Patients. Human tissue samples wereobtained from patients during their follow-up at Necker Hospital.Five heart grafts were obtained from pediatric recipients (threemales and two females, all Caucasians, with a mean age of 9.4 � 0.7years). These heart grafts were harvested at the time of retrans-plantation (mean transplantation period of 6.4 � 3.6 years) re-quired because of terminal chronic rejection inducing graft failure.Fifteen kidney grafts were obtained from adult recipients (ninemales and six females, all Caucasians, with a mean age of 41.7 � 3.8years). These patients underwent transplant nephrectomy afterreturn to hemodialysis because of kidney graft failure. In 10patients, indication for graft removal was terminal chronic rejectionafter a mean transplantation period of 8.7 � 5.6 years. For the 5remaining patients, transplant nephrectomy was performed after atransplantation period of �3 months because of primary graftfailure (two graft arterial thrombosis, two graft vein thrombosis,and one ureteral necrosis). Five additional kidneys were removedfor renal cancer (three males and two females, all Caucasians, meanage 50.7 � 6.4 years). Five to 24 samples from each organ werestudied by hematoxylin–eosin on paraffin sections to localizeinflammatory cells. The reference number of inflammatory cells ina kidney was set as compared with the number found in the tissuesaway from the tumor.Immunofluorescence. Indirect immunohistochemical stainings wereperformed by using a streptavidin–biotin complex method (24).Serial sections were deparaffinized and rehydrated. Endogenousperoxidase activity was blocked by methanol�H2O2. Tissue sections
14724 � www.pnas.org�cgi�doi�10.1073�pnas.0507223102 Thaunat et al.
underwent heat-induced antigen retrieval (25) with citrate buffer(15 min at 100°C). The following mouse anti-human antibodies(DAKO) were used: anti-CD20 (L26; anti-pan B cells), anti-CD3(polyclonal; anti-pan T cells), anti-CD23 (MHM6; anti-folliculardendritic cells), and anti-Ki67 (MiB1; proliferation marker). Theprimary antibodies were applied to the sections by using dilutionpredetermined for optimal staining, followed by incubation withbiotin-conjugated goat anti-mouse antibodies and streptavidin–biotin horseradish peroxidase complex (SABC�HRP; DAKO).Peroxidase activity was revealed by 3-amino-9-ethyl carbazole. Thesections were counterstained with hematoxylin.
Statistical Analysis. Data were analyzed by using the programSTATVIEW 5.0 (Abacus Concepts, Berkeley, CA). The statisticalsignificance of the results was determined by one-way ANOVAfollowed by Fischer’s probable least square difference tests. P valuesof �0.05 were considered as statistically significant.
ResultsKinetics of Aortic Allograft Adventitial Inflammatory Infiltration.Lewis rats were transplanted with Brown-Norway abdominal aortasand were killed at 10 days, 1 month, and 2 months posttransplan-tation. Grafts were harvested at each time point for analysis of theirmicroanatomy and cellular composition. Aortic allografts pre-sented a time-dependent leukocyte adventitial infiltration (Fig. 1).This infiltrate was mainly constituted of lymphocytes and ED1-positive macrophages. Most of the T cells infiltrated in the graftwere located in the adventitial layer. The infiltrate increasedbetween 10 days and 1 month posttransplantation, and T cellsaccumulated as a massive circumferential ring with external nodularreinforcements (Fig. 1). These nodules were enriched in CD4� Tlymphocytes, whereas CD8� T lymphocytes had a more diffusedistribution (data not shown). The number of macrophages and Tcells decreased at 2 months, leaving an acellular fibrous scar. By thistime, medial smooth-muscle cells had disappeared from the graft(Fig. 1). Conversely, control isografts were devoid of leukocyteinfiltration, but for a few scattered ED1-positive macrophagestransiently present in the adventitia at day 10 (Fig. 1), which likelyparticipate in surgical wound healing. These observations werecorroborated by flow cytometry quantitative analysis on cell sus-pensions obtained after microdissection and enzymatic digestion ofthe graft adventitial layer (data not shown).
Adventitial Vascular Endothelium Acquires a High Endothelial Venule(HEV) Phenotype. Because we did not detect inflammatory cellsacross the medial layer, it seemed likely that the recruitment ofleukocytes in the adventitia could be due to modifications of thepermeability of the vasa-vasorum endothelium. Changes in thephenotype of endothelial cells in the adventitia of aortic grafts were,therefore, sought by electron microscopy. Ten days after transplan-tation, endothelial cells in certain venules, but not in arterioles, hadacquired a HEV-like phenotype (Fig. 2A). These endothelial cellswere plump, with large quantities of cytoplasm, and had an in-
creased organelle content. The nuclei were ovoid with variabledegrees of folding and widely dispersed granular heterochromatin.The luminal surface displayed numerous microvillous projectionsand protruded into the vessel lumen, creating intercellular clefts(Fig. 2B). Remarkably, these HEVs were detected exclusively inadventitial areas containing lymphocyte nodules (Fig. 2A). Non-inflammatory areas of the adventitia displayed venules with normalflat endothelial cells (Fig. 2C). Two months posttransplantation,adventitial inflammatory infiltrates were found to have resorbedand adventitial venular endothelial cells had resumed a normalphenotype (data not shown). These observations suggest that theacquisition of a HEV phenotype by venular endothelial cells in theadventitia is temporally and spatially correlated with the inflam-matory infiltrate.
T Cell Infiltrates Acquire the Capacity to Help B Cells. Adventitial Tcell infiltrates examined by flow cytometry 10 days posttransplan-tation were composed of �50% of CD4� T cells and �50% ofCD8� T cells. The proportion of CD4� T cells as compared withCD8� T cells increased at 1 month (Fig. 3A). Concomitantly, thepercentage of cells expressing the MHC II (RT1.B) and CD134molecules increased among CD4� but not among CD8� T cells(Fig. 3 C and D), whereas both CD4� and CD8� T cells lost theircapacity to secrete IFN� (Fig. 3D). Taken together, these data pointto a shift in the immune response. Down-regulation of the initialcellular cytotoxic alloimmune response was associated with theemergence of CD4� T cells that may display the capacity to help Bcells to mature.
B Cells Infiltrate the Adventitia. Simultaneously with the changes inthe adventitial T lymphocyte population, the proportion of B cellsincreased progressively among leukocytes recovered from theadventitial layer of aortic allografts and analyzed by FACS: B cellsrepresented 12.75 � 3.37% of the infiltrated leukocytes at 10 daysand 23.94 � 3.74% at 1 month (P � 0.05). Immunohistochemicalanalysis on longitudinal sections of aortic allografts also revealed
Fig. 1. Kinetics of immunodetection of adventitial mononuclear cells. Seven-micrometer-thick transversal sections of aortic isografts (Left) and allografts(Center and Right) harvested 10 days (d10) and 2 months (M2) posttransplantation and stained by using the alkaline phosphatase anti-alkaline phosphatasetechnique (original magnification, �5). Primary monoclonal antibodies used were anti-macrophage (ED1) and anti-��TCR (R73). Note that 2 monthsposttransplantation (Right), adventitial infiltrate decreased in allografts, when all medial smooth muscle cells are destroyed, as assessed by media thinning.Development of neointima is detected at this time point.
Fig. 2. Adventitia acquires HEVs. (A–C) Electron microscopy analysis ofendothelial cells located in the adventitia of aortic grafts 10 days aftertransplantation (L, lymphocyte; Ery, erythrocyte; CE, normal flat venular en-dothelial cell). At 10 days posttransplantation, venular endothelial cells lo-cated nearby adventitial lymphocyte infiltrates displayed a HEV-like pheno-type. (A) Original magnification, �2,500. (B) Original magnification, �8,000.(C) Normal flat venular endothelial cells were observed in quiescent areas ofthe adventitia at the same time point (original magnification �2,500).
Thaunat et al. PNAS � October 11, 2005 � vol. 102 � no. 41 � 14725
IMM
UN
OLO
GY
the presence of B cells, exclusively in the adventitial layer (Fig. 4).These cells were clustered in nodular aggregates located in the outerpart of the graft adventitia and were surrounded by a ring of T cells.We also noted that B cell clusters were larger at 1 month than onday 10 (data not shown).
The Adventitial Inflammatory Infiltrate Is Structured as a SecondaryLymphoid Tissue. To characterize the B cell nodules further, aorticallograft paraffin-embedded sections were stained with antibodiesto the different Ig heavy-chain isotypes. As in germinal centers,cores of immature double-positive IgM� and IgD� B cells weresurrounded by mature single-positive IgM� B lymphocytes (datanot shown), and the adventitial B cell aggregates were the site of
intense proliferation and apoptosis, as documented by the PCNAstaining and the TUNEL assay, respectively (Fig. 4).
Antibodies Produced in the Adventitia Are Directed to Donor MHC IMolecules. Adventitia, draining lymph nodes, and spleen werecultured so as to collect immunoglobulins produced within thesetissues. The supernatants of these cultures were tested on Lewis(recipient) fibroblasts, transfected (LEW-F�A1n) or not trans-fected (LEW-F) with the RT1-A1n Brown-Norway (donor) MHCI molecules. Reactivity of antibodies against these cells was evalu-ated by flow cytometry. Antibodies against the donor MHC Imolecules (RT1-A1n), i.e., binding to LEW-F�A1n cells and not tothe untransfected control cells, were present in all of the superna-tants from allogeneic grafts (Fig. 5A). Strikingly, whereas theamounts of adventitial tissue placed in culture were far less abun-dant than for cultured spleens or draining lymph nodes, adventitialtissue produced as much alloantibodies as did the spleens andsignificantly more than did draining lymph nodes (Fig. 5 A and B).Supernatants from the adventitia of thoracic aortas from graftedanimals contained no antibodies (data not shown).
Ectopic Germinal Centers Are Present in Chronically Rejected HumanKidney and Heart Grafts. To evaluate the clinical relevance of theprevious observations, we studied surgically removed human heartand kidney grafts by histology. Remarkably, germinal-center-likestructures were detected in samples from grafts undergoing chronicrejection (Fig. 6) but not in control organs. Indeed, neither kidneysremoved for renal cancer nor renal grafts that were removed earlyand were therefore devoid of chronic rejection lesions displayedectopic germinal centers (data not shown). In striking contrast,germinal-center-like structures located in the interstitial tissue weredetected in all chronically rejected hearts and kidneys (Fig. 6 A andB). The core of these structures was composed of proliferatingKi67� cells (Fig. 6D) and B cells (Fig. 6C) in close proximity withCD23� follicular dendritic cells (Fig. 6E). This core was surroundedby CD3� T cells (Fig. 6F).
DiscussionIn this study, we report previously undescribed immunoinflam-matory events closely associated with chronic allograft rejection.Our results suggest that interstitial events play a crucial role inthe development of chronic rejection. Evidence obtained from
Fig. 3. Change in the phenotype of the T cell adventitial infiltrate. Adventitia of the allograft was selectively isolated by microdissection 10 days (d10) and 1month (M1) posttransplantation. After digestion in a collagenase I solution, adventitial cells were suspended and analyzed by flow cytometry. (A) The lymphocytecomposition in the adventitial infiltrate was evaluated by using anti-��TCR (R73), anti-CD4 (OX35), and anti-CD8 (OX8) mAbs. (B) Anti-MHC II (RT1.B) mAb wasused to study the level of activation of the adventitial CD4� and CD8� lymphocyte subpopulations. (C) Anti-CD134 mAb was used to identify cells able to providehelp to B cells among adventitial CD4� and CD8� lymphocyte subpopulations. (D) The evolution of the polarization of the adventitial T cell infiltrate was followedby measuring the percentage of IFN�-producing lymphocytes by using combined surface and intracellular staining with anti-��TCR (R73), anti-CD4 (OX35),anti-CD8 (OX8), and anti-IFN� mAbs. *, P � 0.05; **, P � 0.01; ***, P � 0.001; d10 vs. M1; each symbol represents an animal, and the bold line represents themean value.
Fig. 4. B cell aggregates in the adventitia are germinal-center-like struc-tures. Immunohistochemistry (alkaline phosphatase anti-alkaline phospha-tase technique) was applied to serial 7-�m-thick longitudinal sections of aorticallografts harvested 1 month posttransplantation. Original magnifications,�40 (Left) and �100 (Right). (Top) B cell nodules were detected with ananti-pan B lymphocyte mAb. Neointima development (black arrowheads)could be detected. (Middle) Cell proliferation was assessed by PCNA immu-nohistochemistry. (Bottom) The in situ DNA TUNEL technique was used todetect apoptosis.
14726 � www.pnas.org�cgi�doi�10.1073�pnas.0507223102 Thaunat et al.
a rat model of chronic vascular allograft rejection was confirmedon chronically rejected human graft samples.
In the experimental model, we show that (i) the number ofleukocytes infiltrating the adventitia is related to the amount ofallogeneic targets in the graft; (ii) the cellular contents of theseinfiltrates evolves over time and contains mostly CD4� T helperlymphocytes at 1 month posttransplantation; (iii) at 1 month, theadventitial CD4� T cells express MHC II molecules and CD134,suggesting that they have the capacity to provide help to B cells; (iv)
B cells infiltrate into the adventitia; (v) the adventitial inflammatoryinfiltrate is organized as a secondary lymphoid tissue, includingacquisition by the nearby venular endothelial cells of a HEV-likephenotype; and (vi) a humoral alloimmune response against thedonor MHC I molecules is elicited within the adventitial ectopicgerminal centers. We also show that (vii) similar ectopic germinalcenters are detected in the interstitial tissue of human heart andkidney chronically rejected grafts. Altogether, these findings sug-gest that the graft is not only a target for the alloimmune responsebut is also a site where the humoral alloimmune response ismounted.
The T cell infiltrate composition at 10 days likely reflects acytotoxic T cell function, because CD8� T cells producing IFN� areabundant. Whereas this initial cellular cytotoxic alloimmune re-sponse can rapidly destroy accessible donor endothelial cells, donorsmooth-muscle cells, which are protected by elastic lamina, persistin the media 1 month posttransplantation (ref. 17 and data notshown). A previous study has indicated that the immune system usesan alternative strategy to reach the residual allogeneic targets in themedia. Indeed, alloantibodies able to cross elastic lamina andinduce apoptosis of smooth muscle cells are found in the media (7).Accordingly, we found, at 1 month, that the major part of the T cellinfiltrate is composed of CD4� T cells expressing MHC II mole-cules, considered to be an activation marker for T cells, and CD134(OX40), which is expressed on T cells that provide help to B cells(26). Although the phenotype of the T cells present at 1 monthposttransplantation in the adventitia suggests that these lympho-cytes are involved in the B cell maturation, further studies arerequired to confirm this hypothesis. An original technical contri-bution of this work was to set up a tool to quantify the leukocyteinfiltrate in the interstitial tissue over time by flow cytometry.Strikingly, and in contrast to previous immunohistological studies(15, 27), this technique allowed us to detect B cells in the adventitialinfiltrate of the allograft. The B cells displayed a highly organizednodular disposition that might have prevented their prior detection.Indeed, immunohistological study showed that a ring of single-positive IgM� B lymphocytes surrounded a core of immaturedouble-positive IgM� and IgD� B cells. Our data suggest that thesenodules could be ectopic germinal centers.
Because, in most of the inflammatory lesions, the various cells inthe infiltrate are not noticeably spatially coordinated, the presenceof these highly organized lymphoid structures within the adventitialinflammatory infiltrate was unexpected and raises the questionconcerning their origin. These germinal centers could arise eitherfrom preexisting vascular lymphoid structures or as de novo struc-
Fig. 5. Antibodies produced in the adventitia are directed to donor MHC I. (A) The specificity of the antibodies present in the supernatants from organoculturesof adventitia, draining lymph nodes, and spleen was analyzed by flow cytometry using a Lewis (recipient) fibroblast cell line expressing (LEW-F�A1n) or notexpressing (LEW-F) Brown-Norway MHC I molecules. LEW-F and LEW-F�A1n were incubated with 100 �l of each supernatant. The binding of antibodies on thecell surface was determined with a FITC-conjugated anti-rat Ig � chain antibody (MARK 1) by measuring the mean fluorescence intensity in a FACScan flowcytometer. ***, P � 0.0001 LEW-F vs. LEW-F�A1n; ††, P � 0.01 Adventitia vs. draining lymph nodes. (B) A representative histogram overlay is shown.
Fig. 6. Ectopic germinal centers are present in human kidney and heartgrafts. Human heart and kidney grafts removed because of chronic rejectionwere studied by histology to determine whether a lymphoid neogenesisprocess could be detected. Four-micrometer-thick sections of chronically re-jected kidney (A) and heart (B) stained with hematoxylin and eosin displayedgerminal-center-like structures in the interstitial tissue nearby a vascularstructure (black arrows). Indirect immunohistochemical single staining wasperformed after a streptavidin–biotin complex method on sections of kidneysamples. The following mAbs were used: anti-Ki67 (MiB1, proliferationmarker) (C); anti-CD20 (L26, anti-pan B cells) (D); anti-CD23 (MHM6, anti-follicular dendritic cells) (E); and anti-CD3 (polyclonal, anti-pan T cells) (F).Original magnifications, �50 (A–D) and �100 (E).
Thaunat et al. PNAS � October 11, 2005 � vol. 102 � no. 41 � 14727
IMM
UN
OLO
GY
tures. Wick and coworkers (28) have described a developmentallyprogrammed vascular-associated lymphoid tissue (VALT), which islocated in the subendothelial layer of nondiseased arteries. Becausethe lymphoid structures that we describe are not observed innondiseased arteries and are exclusively detected in the adventitia,we believe that they are not related to the VALT. Conversely, theadventitial lymphoid architecture that we report could be similar togerminal-center-like organizations originating from the inflamma-tory infiltrate as de novo structures in nonlymphoid tissues. Thisprocess, known as lymphoid neogenesis (29), has been described invarious tissues subjected to chronic autoimmune aggressions (30,31) or microbial infections (32). We report here lymphoid neogen-esis in alloimmunity.
Germinal centers are generally regarded as specific of develop-mentally programmed secondary lymphoid organs (lymph nodes,Peyer’s patches, and spleen). Because, in these compartmentalizedstructures, antigen-driven maturation and T cell-dependent activa-tion of naıve B lymphocytes takes place, our observations suggestthat naıve alloimmune B cells could be educated within the graft.This hypothesis raises new perspectives regarding the sites able tosustain the initiation of the adaptive immune response to a solidorgan allograft. Since the late 1960s, the ‘‘peripheral sensitization’’concept ascribes to the donor endothelial cells lining vascularizedgrafts the capacity to activate the allospecific naıve T cells (33). Ourstudy suggests that, in addition to the cell-mediated alloimmuneresponse, the humoral reaction can also be initiated within the graft.
The aggregation of additional observations provides furtherevidence that the B cell nodules are ectopic germinal centers. First,the B cell nodules observed in the adventitia of allografted aortaswere the site of intense proliferation and apoptosis, in accordancewith the intensive cell turnover of germinal centers where B cellsundergo proliferative rounds and apoptosis associated with somatichypermutation of their B cell receptor. Second, the spatial com-partmentalization of IgM� and the IgM�IgD� B cells is the sameas in germinal centers. Third, adventitial CD4� T cells expressedCD134 (OX40). Interestingly, CD134� cells are found in the T cellzone of lymphoid organs after priming with antigen and theOX40–OX40L interaction is necessary for the in vivo differentia-tion of activated B cells into highly Ig-producing cells (34). Finally,we show that adventitial venular endothelial cells, located within thelymphoid infiltrates, acquired a HEV-like phenotype. HEVs are
postcapillary venules specialized in lymphocyte trafficking and arecharacteristic of lymphoid organs (35). This finding is in accordancewith the observation that peritubular capillary endothelium ac-quires HEV-like properties during acute renal allograft rejection(36). Next, we speculated that the capacity to acquire secondarylymphoid structures, in which B cells would undergo antigen-drivenmaturation, could be a general feature of interstitial tissue ofchronically rejected organs. Interestingly, lymphoid structures havebeen recently described in murine cardiac allografts undergoingchronic rejection (37). In our study, we extend this finding to humantransplantation. Indeed, germinal centers were systematically foundin the interstitium of chronically rejected human kidney and heartgrafts.
To provide evidence for functional significance of these lym-phoid structures in chronic rejection, we had to obtain antibodiesproduced locally. This technical hurdle was overcome by perform-ing hyperoxic organocultures of adventitia, lymph nodes, andspleen. We demonstrate that the adventitia from aortic graft (butnot from the untouched thoracic aorta of the same rat) producesantibodies and that these antibodies are specific for donor MHC Imolecules.
In conclusion, the interstitial immunoinflammatory infiltrateorganizes itself like a secondary lymphoid structure duringchronic rejection. In these local germinal centers, alloantibodiesresponsible for graft injury are produced. The mechanismsresponsible for triggering this lymphoid neogenesis remain to beelucidated. It could result either from a program intrinsic to thelocal tissue that would be instigated by the chronic inflammationor a general behavior of the immune system that would improveits efficiency by reducing the distance between the effectors andthe targets while locally restricting the response. The price to payfor such a local strategy might be that its inadequate controlmaintains a deleterious ongoing local inflammation. At any rate,the lymphoid neogenesis might be considered as a new thera-peutic target in chronic rejection.
We thank Pr. Henri Kreis, Dr. Srini Kaveri, and Dr. Giuseppina Caligiurifor critical reading of the manuscript. U681 is supported by the InstitutNational de la Sante et de la Recherche Medicale (INSERM) and theFondation pour la Recherche Medicale; U698 is supported by INSERMand The Leducq Foundation for Cardiovascular Research.
1. Hayry, P., Isoniemi, H., Yilmaz, S., Mennander, A., Lemstrom, K., Raisanen-Sokolowski, A., Koskinen, P., Ustinov, J., Lautenschlager, I. & Taskinen, E. (1993)Immunol. Rev. 134, 33–81.
2. Vongwiwatana, A., Tasanarong, A., Hidalgo, L. G. & Halloran, P. F. (2003) Immunol.Rev. 196, 197–218.
3. Russell, P. S., Chase, C. M. & Colvin, R. B. (1997) Transplantation 64, 1531–1536.4. Orosz, C. G. (2000) J. Heart Lung Transplant. 19, 634–637.5. Jin, Y. P., Jindra, P. T., Gong, K. W., Lepin, E. J. & Reed, E. F. (2005) Transplantation
79, S19–S21.6. Bian, H. & Reed, E. F. (1999) J. Immunol. 163, 1010–1018.7. Plissonnier, D., Henaff, M., Poncet, P., Paris, E., Tron, F., Thuillez, C. & Michel, J. B.
(2000) Transplantation 69, 2601–2608.8. Lee, R. S., Yamada, K., Houser, S. L., Womer, K. L., Maloney, M. E., Rose, H. S.,
Sayegh, M. H. & Madsen, J. C. (2001) Proc. Natl. Acad. Sci. USA 98, 3276–3281.9. Billingham, M. E. (1994) Clin. Transplant. 8, 289–292.
10. Paul, L. C. & Fellstrom, B. (1992) Transplantation 53, 1169–1179.11. Tilney, N. L., Whitley, W. D., Diamond, J. R., Kupiec-Weglinski, J. W. & Adams,
D. H. (1991) Transplantation 52, 389–398.12. Azuma, H. & Tilney, N. L. (1994) Curr. Opin. Immunol. 6, 770–776.13. Isik, F. F., McDonald, T. O., Ferguson, M., Yamanaka, E. & Gordon, D. (1992) Am. J.
Pathol. 141, 1139–1149.14. Mennander, A., Tiisala, S., Halttunen, J., Yilmaz, S., Paavonen, T. & Hayry, P. (1991)
Arterioscler. Thromb. 11, 671–680.15. Plissonnier, D., Levy, B. I., Salzmann, J. L., Nochy, D., Watelet, J. & Michel, J. B.
(1991) Arterioscler. Thromb. 11, 1690–1699.16. Schmitz-Rixen, T., Megerman, J., Colvin, R. B., Williams, A. M. & Abbott, W. M.
(1988) J. Vasc. Surg. 7, 82–92.17. Plissonnier, D., Nochy, D., Poncet, P., Mandet, C., Hinglais, N., Bariety, J. & Michel,
J. B. (1995) Transplantation 60, 414–424.18. Battle, T., Arnal, J. F., Challah, M. & Michel, J. B. (1994) Tissue Cell 26, 943–955.19. Negoescu, A., Lorimier, P., Labat-Moleur, F., Drouet, C., Robert, C., Guillermet, C.,
Brambilla, C. & Brambilla, E. (1996) J. Histochem. Cytochem. 44, 959–968.
20. Takasaki, Y., Deng, J. S. & Tan, E. M. (1981) J. Exp. Med. 154, 1899–1909.21. Joly, E., Mucke, L. & Oldstone, M. B. (1991) Science 253, 1283–1285.22. Gonzalez-Munoz, A. L. (1999) Ph.D. thesis (University of Cambridge, Cambridge,
U.K.).23. Gonzalez, A. L., Ruffell, D., Butcher, G. W. & Joly, E. (1995) Transplant. Proc. 27,
1516–1518.24. van der Loos, C. M., Das, P. K. & Houthoff, H. J. (1987) J. Histochem. Cytochem. 35,
1199–1204.25. Cattoretti, G., Pileri, S., Parravicini, C., Becker, M. H., Poggi, S., Bifulco, C., Key, G.,
D’Amato, L., Sabattini, E. & Feudale, E. (1993) J. Pathol. 171, 83–98.26. Walker, L. S., Gulbranson-Judge, A., Flynn, S., Brocker, T. & Lane, P. J. (2000)
Immunol. Today 21, 333–337.27. Rossmann, P., Lacha, J. & Lodererova, A. (1999) Folia Microbiol. (Prague) 44,
339–353.28. Waltner-Romen, M., Falkensammer, G., Rabl, W. & Wick, G. (1998) J. Histochem.
Cytochem. 46, 1347–1350.29. Kratz, A., Campos-Neto, A., Hanson, M. S. & Ruddle, N. H. (1996) J. Exp. Med. 183,
1461–1472.30. Takemura, S., Klimiuk, P. A., Braun, A., Goronzy, J. J. & Weyand, C. M. (2001)
J. Immunol. 167, 4710–4718.31. Salomonsson, S., Jonsson, M. V., Skarstein, K., Brokstad, K. A., Hjelmstrom, P.,
Wahren-Herlenius, M. & Jonsson, R. (2003) Arthritis Rheum. 48, 3187–3201.32. Shomer, N. H., Fox, J. G., Juedes, A. E. & Ruddle, N. H. (2003) Infect. Immun. 71,
3572–3577.33. Lakkis, F. G. (2003) Am. J. Transplant. 3, 241–242.34. Stuber, E. & Strober, W. (1996) J. Exp. Med. 183, 979–989.35. Gowans, J. L. & Knight, E. J. (1964) Proc. R. Soc. London B 159, 257–282.36. Renkonen, R., Turunen, J. P., Rapola, J. & Hayry, P. (1990) Am. J. Pathol. 137,
643–651.37. Baddoura, F. K., Nasr, I. W., Wrobel, B., Li, Q., Ruddle, N. H. & Lakkis, F. G. (2005)
Am. J. Transplant. 5, 510–516.
14728 � www.pnas.org�cgi�doi�10.1073�pnas.0507223102 Thaunat et al.
111
3.3 Validation des données expérimentales dans le contexte
clinique
La mise en évidence de la néogenèse lymphoïde dans notre modèle murin
experimental de rejet d’allogreffe nous a conduit à postuler que ce
phénomène pouvait jouer un rôle en clinique.
Nous avons mis en place une collaboration multicentrique impliquant les
services de transplantation, d’urologie et d’anatomopathologie afin d’obtenir
des pièces de détransplantation rénale fraîches sur lesquelles nous pourrions
valider notre hypothèse. A ce jour, 6 centres participent au développement de
cette biocollection : Necker (Paris), Foch (Suresnes), Henri-Mondor (Créteil),
Pasteur (Nice), Edouard Herriot (Lyon) et Michallon (Grenoble) et nous avons
étendu notre recueil aux explants pulmonaires et cardiaques ainsi qu’aux
tissus lymphoïdes secondaires « professionnels » que nous utilisons comme
témoins (rates, ganglions, végétations adénoïdes et thymus).
L’examen des pièces de détransplantation rénale (n=46), cardiaque (n=5) et
pulmonaire (n=3) humaines a permis de retrouver la présence de structures
nodulaires très semblables à celles que nous avions identifiées dans notre
modèle expérimental. Ces nodules sont constitués par un noyau de
lymphocytes B et sont entourés d’un infiltrat lymphocytaire T au sein duquel
on retrouve des plasmocytes et des cellules dendritiques matures exprimant
DC-LAMP. En périphérie de l’infiltrat, la présence des cellules endothéliales
spécialisées HEV (porteuses d’adressines spécifiques, les PNAd) est mise en
évidence par l’anticorps monoclonal MECA-79. Le marquage par l’anticorps
anti-podoplanine révèle également le développement d’un réseau
lymphatique centré sur les nodules. L’ensemble de ces observations
démontre que la microarchitecture de ce néo-tissu lymphoïde est
superposable à celle des organes lymphoïdes secondaires
« professionnels ».
Un examen plus approfondi montre que les structures nodulaires ne sont pas
homogènes. Certaines sont le siège d’une prolifération intense (comme en
témoigne le marquage nucléaire des cellules par l’anticorps anti-Ki67) tandis
que les autres sont simplement constituées par des lymphocytes B naïfs (IgD+
Bcl2+) au repos. Les nodules qui prolifèrent présentent généralement un
réseau dense de cellules dendritiques folliculaires. Ces nodules semblent être
112
des centres germinatifs ectopiques fonctionnels comme le suggèrent i) le
marquage nucléaire des lymphocytes B centraux par les anticorps anti-AID
(l’enzyme clé contrôlant les réactions d’hypermutations somatiques et de
commutations isotypiques) et anti-Bcl6 et ii) le fait que les lymphocytes
marqués perdent l’expression de l’IgD de surface. Fait notable, en périphérie
on retrouve systématiquement une couronne de lymphocytes B naïfs au
repos, repoussés de façon centrifuge par les clones B de la réaction de centre
germinatif (suggérant que le micro-environnement offert par les follicules
primaires est indispensable à l’établissement d’un centre germinatif, même
ectopique).
La comparaison des greffons rénaux détransplantés entre-eux nous apprend
que le nombre de centres germinatifs ectopiques n’est pas proportionnel à
celui des follicules primaires ni au temps d’exposition du tissu au système
immunitaire du receveur. Ces résultats suggèrent que le développement de
centres germinatifs fonctionnels n’est pas « automatique » (lorsqu’un nombre
suffisant de lymphocytes B a été recruté où après un certain délai) mais
dépend plutôt de mécanismes biologiques qui peuvent être mis en place ou
pas au cours d’une réponse inflammatoire chronique.
Lymphoid neogenesis in chronic rejection: the murdereris in the houseOlivier Thaunat1, Natacha Patey2, Emmanuel Morelon3,Jean-Baptiste Michel4 and Antonino Nicoletti1
Although chronic rejection is currently the main cause of long-
term allograft failure, its pathogenesis remains elusive, hereby
preventing the development of effective therapy. Recent
advances in the comprehension of the pathophysiology of
chronic inflammatory diseases could shed new light on the
pathogenesis of chronic rejection. Lymphoid neogenesis is a
mechanism responsible for the progressive organization of
chronic inflammatory infiltrates into functional ectopic germinal
centers, and has been evidenced recently in various
pathological situations sharing a common feature: the failure of
the immune response to eradicate the targeted antigen(s).
Chronic rejection is such a situation as it results from a
sustained alloimmune response against the donor’s antigens
that are constantly replenished by the grafted tissue.
Accordingly, functional ectopic germinal centers develop
within chronically rejected organs. This implies that, during
chronic rejection, graft is at the same time the target and the
site of elicitation of the alloimmune response.
Addresses1 Universite Pierre et Marie Curie-Paris 6, INSERM UMR S 681,
Centre de recherche des Cordeliers, 15 rue de l’Ecole de Medecine,
75006 Paris, France2 Pathology Department, Necker Hospital, 149 rue de Sevres,
75015 Paris, France3 Renal Transplantation Department, Edouard Herriot Hospital,
Universite Claude Bernard Lyon-1, 5 place d’Arsonval, 69437 Lyon,
France4 U698 INSERM, Xavier Bichat Hospital, 46 rue Henri Huchard,
75018 Paris, France
Corresponding author: Thaunat, Olivier ([email protected])
Current Opinion in Immunology 2006, 18:576–579
This review comes from a themed issue on
Transplantation
Edited by Eliane Gluckman
Available online 1st August 2006
0952-7915/$ – see front matter
# 2006 Elsevier Ltd. All rights reserved.
DOI 10.1016/j.coi.2006.07.006
IntroductionA half-century has elapsed since the first organ transplan-
tation. Advances in immunosuppressive therapy and in
surgical techniques have resulted in a regular improve-
ment of the short-term (i.e. one-year) rate of graft survival.
By contrast, the half-life of the transplants has remained
Current Opinion in Immunology 2006, 18:576–579
the same, illustrating the inefficiency of the immunosup-
pressive agents against chronic rejection [1]. Because
chronic rejection is now recognized as the primary cause
of long-term allograft failure [1], it has become the focus
of considerable clinical and experimental attention.
The progressive organization of chronic inflammatory
infiltrates into functional ectopic germinal centers has
been documented recently to occur in various chronic
inflammatory diseases and is named lymphoid neogenesis
(see glossary). Herein, we will review recent evidence
supporting the involvement of lymphoid neogenesis in
the pathogenesis of chronic rejection (see glossary) and
will demonstrate that chronically rejected allografts are, at
the same time, the target and the site of production of
alloantibodies. In other words, during chronic rejection,
‘the murderer is in the house’.
Lymphoid neogenesis: from chronicinflammatory infiltrates to ectopic lymphoidtissuesInflammation is expected to be short-lived and self-limit-
ing. However, in some situations, acute inflammation
shifts towards a long-lived and self-perpetuating chronic
inflammatory response. The chronic inflammatory
response is characterized by infiltration of cellular effec-
tors of the immune system, mainly T cells and macro-
phages, but also natural killer cells, dendritic cells, B cells
and plasma cells. In most of these chronic inflammatory
infiltrates, the various cell populations are not noticeably
spatially coordinated. However, it has long been observed
that immune cells can sometimes organize themselves
into structures that morphologically resemble the second-
ary lymphoid organs [2].
The molecular mechanisms that underlie organization
of chronic inflammatory infiltrates into ectopic lym-
phoid tissue recapitulate some of those involved in
lymphoid organogenesis during development [3�,4].
Thus, the de novo formation of organized lymphoid
tissue in chronic inflammation has been referred to as
lymphoid neogenesis.
Recent studies have documented that, beyond micro-
anatomical similarities to secondary lymphoid organs,
ectopic lymphoid tissues are functional and support local
germinal center reactions, including clonal expansions,
somatic hypermutations, immunoglobulin class switching
and antibody production, which are likely to contribute to
www.sciencedirect.com
Lymphoid neogenesis in chronic rejection Thaunat et al. 577
Glossary
Adventitia: The outermost membranous covering of an organ or
structure, especially the outer coat of an artery.
Banff classification: A standardized international classification
of renal allograft pathology introduced in 1991. This consensus
on renal allograft biopsy grading allows uniform reporting and
help to establish an objective rejection end point in clinical trials.
Banff classification is the worldwide standard in renal allograft
pathology, and the consensus process has now extended to all
solid organs.
Chronic rejection: The slow failure of a transplanted organ owing to
attack by the immune system of the recipient. Chronic rejection is
currently the main cause of long-term allograft failure.
Class switch recombination: The first antibodies produced in a
humoral immune response are IgM, but activated B cells
subsequently undergo class switch recombination in the germinal
center to secrete antibodies of different isotypes (IgG, IgA or IgE).
Class switch recombination does not affect the antibody specificity
but alters the effector functions that an antibody can exert.
Ectopic germinal centers: Germinal centers located outside
secondary lymphoid organs such as the ones arising from a chronic
inflammatory infiltrate during lymphoid neogenesis.
Germinal centers: Located in secondary lymphoid tissues. They are
sites of intense B-cell proliferation, selection, maturation and death
during antibody responses. Germinal centers form around follicular
dendritic cell networks when activated B cells migrate into lymphoid
follicles.
Lymphoid neogenesis: Term coined by Kratz et al. [4] to name the
progressive organization of chronic inflammatory infiltrates into
functional ectopic germinal centers.
Somatic hypermutations: In activated B cells within the germinal
centers, the V regions of the assembled immunoglobulin genes
undergo a high rate of point mutation that creates additional diversity
within the expanded clone of B cells responding to antigen. Those B
cells in which the variable regions have accumulated deleterious
mutations and can no longer bind the antigen die. In contrast, the B
cells in which the variable regions have acquired mutations that result
in improved antigen binding receive signal that drives their
proliferation and expansion. Somatic hypermutation is the main
process responsible for the increase of affinity for the specific antigen
of the antibodies produced during the course of a humoral immune
response.
the exacerbation of chronic inflammatory diseases [5,6].
Lymphoid neogenesis has therefore received increasing
attention, and the list of pathological situations in which it
has been observed has grown longer, including autoim-
mune diseases, infectious diseases, allergy, atherosclero-
sis and cancer (for review see [3�,7�]).
Although apparently diverse, all the pathological situa-
tions in which lymphoid neogenesis has been evidenced
share a common feature: the inability of the inflammatory
response to eradicate the antigen. This might result
from efficient countermeasures of the pathogen that
escapes the immune surveillance or because the antigen
is a self or tumor antigen that is constantly replenished by
the tissue. Interestingly, chronic rejection is such a situa-
tion. Alloantigens are indeed constantly replenished by
the grafted tissue and trigger a sustained alloimmune
response that is responsible for progressive destruction
of the graft. It is therefore tempting to speculate that
lymphoid neogenesis takes place in chronically rejected
allografts.
www.sciencedirect.com
Germinal center-like structures are presentin chronically rejected human allograftsKerjaschki et al. [8] reviewed retrospectively 350 renal
allograft biopsies. They found 35 biopsies that had ampli-
fication of the lymphatic vasculature that was associated
with the appearance of regionalized but not diffuse
inflammatory infiltrates. These nodular infiltrates were
mainly composed of variable proportions of proliferating
T- and B-lymphocytes that were frequently segregated
into distinct regions. The nodular infiltrates contained
also few l- or k-chain-producing plasmocytoid cells, as
well as dendritic cells. Interestingly, the authors corre-
lated the presence of these immunologically active orga-
noid structures with the chronicity indices of the Banff
classification (see glossary) and an increased probability of
graft loss.
Following this seminal work, we have undertaken a
prospective study aimed at establishing the connection
between these nodular lymphoid infiltrates and the
chronic rejection process ([9�] and O Thaunat et al.,unpublished). To date, 24 renal and 5 cardiac grafts,
detransplanted because of terminal chronic rejection
inducing graft failure, have been analyzed (Figure 1a, b
and c). In all of these, B-cell nodular infiltrates that
resemble ectopic germinal centers have been evidenced
(Figure 1d). Indeed, the B-cell nodules are the site of
intense proliferation and apoptosis, which is in accor-
dance with the intensive cell turn-over that characterizes
germinal centers; the spatial compartmentalization of B
cells are the same as in germinal centers: a ring of single-
positive IgM+ B lymphocytes surround a core of immature
double-positive IgM+ and IgD+ B cells; B cells express
activation-induced cytidine deaminase (AID; Figure 1f),
an enzyme that catalyzes somatic hypermutation and
class switch recombination (see glossary) of the immu-
noglobulin gene and the expression of which is highly
regulated and restricted to germinal center B cells [10]; a
network of CD23-positive follicular dendritic cells is
present within the nodule (Figure 1e); B-cell nodular
infiltrates are surrounded by helper T-lymphocytes that
express OX40 (CD134), a molecule that provides a
crucial signal for the differentiation of activated B cells
into high immunoglobulin-producing cells [11]; and
the venular endothelial cells located in the vicinity of
the lymphoid infiltrates acquire a high endothelial
venule-like phenotype.
Of note, the demonstration that B-cell nodular infiltrates
develop within chronically rejected allografts has also
been shown concomitantly in a murine experimental
model of cardiac transplantation [12�].
The finding that ectopic germinal centers develop within
the graft during chronic rejection suggests that chronically
rejected organs could be at the same time the target and
the site of production of alloantibodies.
Current Opinion in Immunology 2006, 18:576–579
578 Transplantation
Figure 1
Ectopic germinal centers are present in human kidney and heart grafts that have been chronically rejected. Human heart and kidney grafts
removed because of chronic rejection were studied by histology to determine whether the process of lymphoid neogenesis could be detected.
Four-micrometer thick sections of chronically rejected (a) heart and (b,c) kidney stained with haematoxylin and eosin displayed lymphoid nodular
infiltrates in the interstitial tissue nearby a vascular structure. Indirect immunohistochemical single staining was performed on sections of kidney
samples. These lymphoid nodular infiltrates display ectopic germinal center features because they are composed of B lymphocytes (anti-CD20; [d])
clustered around a follicular dendritic cell network (anti-CD23; [e]). (f) The expression of activation-induced cytidine deaminase (AID) by the B
lymphocytes — the key enzyme for class switch recombination and somatic hypermutation — demonstrates that these ectopic germinal centers
are functional (anti-AID, kind gift from Anne Durandy). (a,b,d) original magnification �10; (c,e,f) original magnification �100.
Lymphoid neogenesis in chronic rejection:evidence for a local humoral alloimmuneresponseAlthough the above data demonstrated that chronic rejec-
tion is associated with the development of lymphoid
nodular infiltrates within rejected organs, evidence for
the involvement of these lymphoid structures in the
rejection process was still lacking. Hence, microdissection
techniques were used to isolate the lymphoid nodular
infiltrates present within chronically rejected rat aortic
allografts one month after transplantation. The rat aortic
interposition model is indeed a widely used experimental
model of chronic rejection, and lymphoid nodular infil-
trates have been evidenced in the adventitia (see glos-
sary) of chronically rejected aortic grafts [9�]. These
isolated ectopic lymphoid structures were then cultured
for four days in serum-free media under hyperoxic con-
ditions. Antibodies directed against donor’s MHC mole-
cules were systematically documented in the culture
supernatants, demonstrating that nodular lymphoid struc-
tures were functional ectopic germinal centers that parti-
cipate in the rejection process of the grafted organ.
Strikingly, the amount of antibodies produced within
these ectopic germinal centers was found to be markedly
higher than the amount produced by the draining lymph
node cells. It is, however, important to underline that
these data provide only indirect evidence for the role of
lymphoid neogenesis in chronic rejection. The conclusive
demonstration that this process is necessary and/or suffi-
cient for development of chronic rejection lesions
requires an experimental model of chronic rejection in
Current Opinion in Immunology 2006, 18:576–579
which lymphoid neogenesis is specifically blocked. Such
a model is currently unavailable, but recent advances in
the comprehension of lymphoid organogenesis could
provide useful tools to reach this goal [13,14].
Pathophysiological implicationsWhat is the advantage for the immune system to build up
such complex structures outside the ‘professional’ sec-
ondary lymphoid organs (such as draining lymph nodes)
allotted to this task?
Lymphoid neogenesis has always been evidenced in
situations in which the immune system fails to eradicate
the antigen. It is thus tempting to view this process as a
backup procedure selected by evolution to increase the
efficiency of the immune response against pathogens that
escape from immune surveillance. Indeed, concentrating
all the elements of the immune response in the infected
tissue increases both the quantity and the immunogeni-
city of available antigen (because damaged tissue pro-
vides ‘danger’ signals that stimulate innate immunity).
Because autoimmune diseases and chronic rejection are
pathological situations in which immune system fails to
eliminate the antigen, they also trigger lymphoid neogen-
esis. In contrast to its protective function in infectious
diseases, lymphoid neogenesis associated with autoim-
mune diseases and chronic rejection could be detrimental
and promote tissue destruction. Local immune responses
taking place in ectopic lymphoid tissue are likely to be
less controlled and self-perpetuating owing to the positive
feedback loop initiated by the activation of the innate
www.sciencedirect.com
Lymphoid neogenesis in chronic rejection Thaunat et al. 579
immune system. Beyond the difficulty to switch off the
immune response that accounts for the progressive
destruction of the tissue, lymphoid neogenesis could also
contribute to break immune tolerance against self-anti-
gens and/or be responsible for an increased risk for
lymphoma — two pathophysiological mechanisms shown
to be associated with chronic rejection [15–18].
ConclusionsThe progressive organization of chronic inflammatory
infiltrates into functional ectopic germinal centers has
been evidenced recently in various chronic inflammatory
diseases. This is named lymphoid neogenesis. Recent
data obtained from both experimental and clinical studies
have demonstrated that this takes place in chronically
rejected allografts. Further studies are warranted to deter-
mine if lymphoid neogenesis is necessary and/or suffi-
cient to promote the development of chronic rejection
lesions. If so, lymphoid neogenesis could well be a new
target for therapy aimed at preventing chronic rejection.
AcknowledgementsThe authors are grateful to Srini Kaveri for critical reading of themanuscript, to Anne Durandy for the kind gift of the anti-AID antibody,and to the departments of Urology, Pathology and Transplantation of Foch,Necker and Henri Mondor Hospitals for their help in the procurement ofthe clinical material.
References and recommended readingPapers of particular interest, published within the annual period ofreview, have been highlighted as:
� of special interest�� of outstanding interest
1. Sayegh MH, Carpenter CB: Transplantation 50 years later —progress, challenges, and promises. N Engl J Med 2004,351:2761-2766.
2. Prineas JW: Multiple sclerosis: presence of lymphaticcapillaries and lymphoid tissue in the brain and spinal cord.Science 1979, 203:1123-1125.
3.�
Drayton DL, Liao S, Mounzer RH, Ruddle NH: Lymphoid organdevelopment: from ontogeny to neogenesis. Nat Immunol 2006,7:344-353.
This work provides an up-to-date review of recent advances in the fieldsof lymphoid organogenesis and lymphoid neogenesis. Similarities anddifferences between ectopic and professional secondary lymphoidorgans are discussed.
4. Kratz A, Campos-Neto A, Hanson MS, Ruddle NH: Chronicinflammation caused by lymphotoxin is lymphoid neogenesis.J Exp Med 1996, 183:1461-1472.
5. Armengol MP, Juan M, Lucas-Martin A, Fernandez-Figueras MT,Jaraquemada D, Gallart T, Pujol-Borrell R: Thyroid autoimmunedisease: demonstration of thyroid antigen-specific B cells andrecombination-activating gene expression in chemokine-
www.sciencedirect.com
containing active intrathyroidal germinal centers. Am J Pathol2001, 159:861-873.
6. Schroder AE, Greiner A, Seyfert C, Berek C: Differentiation of Bcells in the nonlymphoid tissue of the synovial membrane ofpatients with rheumatoid arthritis. Proc Natl Acad Sci USA 1996,93:221-225.
7.�
Aloisi F, Pujol-Borrell R: Lymphoid neogenesis in chronicinflammatory diseases. Nat Rev Immunol 2006, 6:205-217.
A comprehensive review of lymphoid neogenesis associated with chronicinflammatory diseases.
8. Kerjaschki D, Regele HM, Moosberger I, Nagy-Bojarski K,Watschinger B, Soleiman A, Birner P, Krieger S, Hovorka A,Silberhumer G et al.: Lymphatic neoangiogenesis in humankidney transplants is associated with immunologically activelymphocytic infiltrates. J Am Soc Nephrol 2004, 15:603-612.
9.�
Thaunat O, Field AC, Dai J, Louedec L, Patey N, Bloch MF,Mandet C, Belair MF, Bruneval P, Meilhac O et al.: Lymphoidneogenesis in chronic rejection: evidence for a localhumoral alloimmune response. Proc Natl Acad Sci USA 2005,102:14723-14728.
This work extends the finding of [8]. The authors demonstrated thatectopic germinal centers are present within human allografts (heartsand kidneys) that are chronically rejected. Indirect evidence for theinvolvement of lymphoid neogenesis in the rejection process is providedby the demonstration of local production of alloantibodies.
10. Muramatsu M, Sankaranand VS, Anant S, Sugai M, Kinoshita K,Davidson NO, Honjo T: Specific expression of activation-induced cytidine deaminase (AID), a novel member of theRNA-editing deaminase family in germinal center B cells.J Biol Chem 1999, 274:18470-18476.
11. Walker LS, Gulbranson-Judge A, Flynn S, Brocker T, Lane PJ:Co-stimulation and selection for T-cell help for germinalcentres: the role of CD28 and OX40. Immunol Today 2000,21:333-337.
12.�
Baddoura FK, Nasr IW, Wrobel B, Li Q, Ruddle NH, Lakkis FG:Lymphoid neogenesis in murine cardiac allografts undergoingchronic rejection. Am J Transplant 2005, 5:510-516.
The authors report the presence of ectopic germinal centers withinchronically rejected mouse heart allografts.
13. Eberl G, Marmon S, Sunshine MJ, Rennert PD, Choi Y, Littman DR:An essential function for the nuclear receptor RORgt in thegeneration of fetal lymphoid tissue inducer cells. Nat Immunol2004, 5:64-73.
14. Mebius RE: Organogenesis of lymphoid tissues. Nat RevImmunol 2003, 3:292-303.
15. Capello D, Rossi D, Gaidano G: Post-transplantlymphoproliferative disorders: molecular basis of diseasehistogenesis and pathogenesis. Hematol Oncol 2005, 23:61-67.
16. Tanaka M, Zwierzchoniewska M, Mokhtari GK, Terry RD,Balsam LB, Robbins RC, Fedoseyeva EV: Progression ofalloresponse and tissue-specific immunity during graftcoronary artery disease. Am J Transplant 2005, 5:1286-1296.
17. Higgins CD, Swerdlow AJ, Smith JD, Hunt BJ, Thomas JA,Burke MM, Crawford DH, Yacoub MH: Risk of lymphoidneoplasia after cardiothoracic transplantation: the influenceof underlying disease and human leukocyte antigen type andmatching. Transplantation 2003, 75:1698-1703.
18. Rose ML: Activation of autoimmune B cells and chronicrejection. Transplantation 2005, 79:S22-S24.
Current Opinion in Immunology 2006, 18:576–579
117
3.4 Identification des mécanismes induisant la néogenèse
lymphoïde
3.4.1 Rôle initiateur potentiel d’un défaut de drainage lymphatique
La fréquence avec laquelle nous avons retrouvé les nodules lymphocytaires B
dans les greffons rénaux détransplantés (>80%) dépasse largement celle
rapportée dans les autres pathologies inflammatoires chroniques associées à
la néogenèse lymphoïde (93). Nous avons donc émis l’hypothèse qu’il
existait un facteur au cours du rejet d’allogreffe, spécifique à cette étiologie,
qui joue un rôle crucial dans l’initiation de la néogenèse lymphoïde au cours
de l’inflammation chronique.
Nous avons rapidement écarté la nature des antigènes (allo versus auto ou
exogènes) tous étant de même nature biochimique. Le mode de présentation
antigénique direct est un élément distinctif de l’alloimmunité mais le
développement de la néogenèse lymphoïde est tardif, à un stade où le mode
de présentation indirect est prédominant. Plus important, la néogenèse
lymphoïde implique la mise en place d’une réponse alloimmune locale
humorale, donc un mode classique de présentation. La nature du tissu rénal a
aussi été écartée puisque nous avons pu mettre en évidence ce tissu
lymphoïde ectopique dans tous les types de greffons (rénaux, cardiaques,
pulmonaires mais aussi pancréatiques).
Une piste de réflexion nous a paru intéressante : la possibilité d’un défaut de
drainage lymphatique du tissu cible de la réponse immune. Nous avons vu
plus haut que le réseau lymphatique remplissait des rôles clés dans la
régulation des réponses immunes. Or, l’organe transplanté est initialement
déconnecté du réseau lymphatique du receveur (seules les anastomoses
veineuse, artérielle et urinaire sont réalisées par le chirurgien). Les processus
de cicatrisation aboutissent au rétablissement rapide du flux lymphatique
entre le greffon et les ganglions du receveur (entre le 10ème et le 14ème
jour (167, 168)). Cependant, comme le réseau lymphatique du greffon est
porteur des alloantigènes, il est la cible de la réponse alloimmune. Diverses
études ont ainsi parfaitement documenté les altérations structurales (215,
216) et fonctionnelles (217) du réseau lymphatique du greffon au cours du
rejet. Ce défaut de drainage lymphatique du tissu rejeté a deux
118
conséquences : la stagnation de « l’information antigénique » dans le tissu et
la séquestration des effecteurs immunitaires qui ne peuvent plus gagner les
ganglions drainants. Toutes les conditions seraient alors réunies pour mettre
en place une réponse locale intervenant comme solution de secours afin de
suppléer à l’impossibilité de recourir aux organes lymphoïdes secondaires
professionnels.
L’observation faite par Kerjaschki et al (218) et nous-mêmes (cf ci-dessus)
que la néogenèse lymphoïde s’accompagnait du développement d’un néo-
réseau lymphatique au sein des greffons rejetés ne contredit pas notre
hypothèse. En effet : i) la densité accrue des lymphatiques n’indique pas le
caractère fonctionnel de ce réseau, ii) plus encore les travaux récents de
Angeli et al (219) indiquent que les lymphocytes B activés sont capables de
remodeler le réseau lymphatique afin d’assurer une alimentation continue des
centres germinatifs en antigènes. Il est donc concevable que les néo-
lymphatiques, générés lors de la réponse inflammatoire chronique, non
seulement ne reconnectent pas le tissu avec le ganglion mais au contraire,
contribuent à renforcer la déconnection en détournant le flux antigénique vers
les centres germinatifs ectopiques (créant un cercle vicieux qui contribue à
entretenir l’inflammation).
Notons que cette hypothèse physiopathologique actuellement en cours de
validation pourrait aussi s’appliquer aux autres situations inflammatoires
chroniques. Nous avons vu plus haut que la réponse inflammatoire se
caractérisait par une perméabilité vasculaire accrue. Cet excès de fluide
interstitiel dépasse les capacités de réabsorption du réseau lymphatique du
tissu cible (comme en témoigne l’œdème) créant un défaut « relatif » de
drainage et reproduisant de façon incomplète la situation décrite plus haut
lors du rejet d’allogreffe.
Is defective lymphatic drainage atrigger for lymphoid neogenesis?Olivier Thaunat1, Dontjscho Kerjaschki2 and Antonino Nicoletti1
1 Universite Pierre et Marie Curie – Paris 6, INSERM UMR S 681, Centre de recherche des Cordeliers – 75006, Paris, France2 Department of Pathology, Medical University of Vienna Allgemeines Krankenhaus Wahringer Gurtel, Vienna, A-1090, Austria
Opinion TRENDS in Immunology Vol.27 No.10
The progressive organization of cellular infiltrates intofunctional ectopic germinal centers (i.e. lymphoidneogenesis) has been recently evidenced in variouschronic inflammatory diseases. Failure of the immunesystem to eradicate the targeted antigen(s) is a sharedfeature of all of the pathological situations associatedwith lymphoid neogenesis. Although necessary, inabil-ity of the immune system to eradicate the antigen(s)seems insufficient to trigger lymphoid neogenesis byitself. We propose that both defective lymphatic drai-nage of the inflamed tissue and enduring local antigenicstimulation are the crucial triggers of the cascade ofevents leading to lymphoid neogenesis. In turn, ectopicgerminal centers prevent the restoration of lymph out-flow by diverting inflammation-dependent lymphangio-genesis. Antigens and immune effectors are reroutedtowards the neoformed ectopic lymphoid structures. Aself-perpetuating feedback loop, which further sustainsthe development of the local immune response, is nowimposed.
IntroductionThe task of the immune system is to protect the host from awide range of invading pathogens and from malignancies.To meet this challenge, an adaptive immune system hasemerged through evolution, based on an array of T cellsand B cells, each expressing a unique receptor for a parti-cular antigen. Because these receptors have to display agigantic diversity to confront the wide spectrum of poten-tial antigens, and because the size of the lymphocytepopulation is limited by immune homeostasis, only a smallnumber of lymphocytes share the same antigen specificity.Meanwhile, the expanse of environmental interfacesmakes the continual representation of all clones, at allpotential sites of antigen display impossible. Instead, thegeneration of protective immune responses relies on spe-cialized tissues – that is, secondary lymphoid organs –where the antigen and the rare lymphocytes bearingappropriate receptors are gathered in three-dimensionalstructures, providing appropriate conditions for the anti-gen-driven clonal expansion and the differentiation of theresponding clones. The architecture of these secondaryorgans is characterized by an elaborate system of circula-tion for antigens and cells [1–3]. On the one hand, theafferent lymphatics that drain lymph and collect antigens
Corresponding author: Thaunat, O. ([email protected]).Available online 22 August 2006.
www.sciencedirect.com 1471-4906/$ – see front matter � 2006 Elsevier Ltd. All rights reserve
and antigen-loaded antigen-presenting cells from mosttissues of the body end in lymph nodes, the prototypicsecondary lymphoid organ (Figure 1a,b). On the otherhand, the naive T and B cells enter lymph nodes via highendothelial venules [4–6], a unique vascular adaptation ofsecondary lymphoid organs designed to recruit lympho-cytes from the blood with high efficiency. Inside the sec-ondary lymphoid organs, naive T and B cells home todistinct compartments: the T-cell areas and the B-cellfollicles. They remain in their compartments for severalhours and then leave the lymph nodes via efferent lym-phatics, unless they are held back by their specific anti-gens. The antigen-specific interaction that occurs at theinterface of the T- and B-cell zones initiates germinalcenter (GC) reactions (Figure 1b). After migrating intothe network of follicular dendritic cells, B cells proliferate[7–9] and revise their antigen receptors through somatichypermutation of IgV region genes. This process generatesantibodies with a higher or lower affinity to the correspond-ing antigen. Newly generated antibody mutants are thenselected [10,11] on the basis of their ability to bind theircognate antigen with the help of follicular dendritic cellsandT cells. A large fraction of B cells undergoes apoptosis asa result of having acquired deleterious somaticmutations intheir IgV regions that abolish antigen binding, whereas Bcells expressing high-affinity antibody mutants eventuallydifferentiate into plasma cells or memory B cells. Some Bcells also switch from expression of IgM and IgD to that ofother Ig classes by somatic DNA recombination to generateantibodies with different effector functions [12]. The GCreaction of antigen-activated B cells is thought to bethe hallmark of antibody-mediated immune responses toT-cell-dependent antigens, and individuals with geneticdefects impairing GC formation suffer from immuneincompetence.
Surprisingly, growing evidence suggests that GC reac-tions can take place outside specialized secondary lymphoidorgans. Indeed, chronic inflammatory infiltrates withinnonlymphoid organs can organize themselves into localfunctional ectopic GCs. This process, known as lymphoidneogenesis [13], has beenevidenced invarious experimentaland clinical situations, such as chronic infectious diseases,autoimmune diseases and neoplasia [14,15].
Lymphoid neogenesis raises basic questions regardingthe role of secondary lymphoid organsIf the immune system can mount adaptive immuneresponses within nonlymphoid organs, why would these
d. doi:10.1016/j.it.2006.08.003
Figure 1. Role of lymphatic drainage in lymphoid neogenesis during chronic inflammation. (a) Under physiological conditions, dendritic cells patrolling in peripheral
tissues receive no ‘danger’ signals. Consequently, only rare dendritic cells presenting self-antigens migrate to the lymph nodes, where they participate in the maintenance
of tolerance to self-antigens. In some pathological situations, when the immune system fails to eradicate the antigen, enduring antigenic stimulation promotes a chronic
inflammatory response. In these chronic inflammatory conditions, and depending on the status of the lymphatic drainage of the injured tissue, two situations can arise [(b)
and (c)]. (b) The lymphatic drainage of the injured tissue succeeds in carrying the antigen and the dendritic cells to the draining lymph nodes, and the immune response is
elicited in the context of these specialized secondary lymphoid organs. Immune effectors reach the targeted tissue through the efferent lymphatics and the bloodstream.
Follicular B cells in the lymph node remodel inflammation-dependent lymphangiogenesis remotely, thus increasing the lymphatic outflow towards the secondary lymphoid
organ. This communication between the ‘demand’ and ‘supply’ sites enables the fine adaptation of the level of the immune response to the amount of antigen and the
number of effector cells. (c) In the hypothesized scenario, lymphoid neogenesis would take place when the lymphatic outflow between the injured tissue harboring the
antigen and the secondary lymphoid organ is deficient. This results in the development of ectopic GCs within the damaged tissue. This backup procedure enables the
immune system to overcome the inability to elicit the response in the specialized lymphoid organ. In turn, ectopic GCs divert inflammation-dependent lymphangiogenesis
to their own advantage: antigens and immune cells are rerouted towards the neoformed tertiary lymphoid structures, leading to a self-perpetuating feedback loop that
further sustains the development of the local immune response. This scenario challenges the current understanding in the field but awaits further confirmation.
442 Opinion TRENDS in Immunology Vol.27 No.10
sophisticated specialized structures have been selected bythe evolution? Conversely, why would GCs develop ecto-pically within nonlymphoid organs when specialized sec-ondary lymphoid organs are available?
We believe that recent data that we have obtained in thefield of chronic rejection of solid organ transplants providesome answers to these questions. Put in perspective withrelated studies, our findings prompt us to propose thatlymphoid neogenesis is a default response of an immunesystem simultaneously facing a chronic local antigenicstimulation and a defect in the lymphatic drainage ofthe tissue harboring the targeted antigen.
From chronic inflammation to lymphoid neogenesisThe inflammatory process has evolved to facilitate effectiveelimination of the target antigen and is normally transientand turned off when the causative stimulus has beeneliminated. The difficulty in eradicating antigens, as aresult of the pathogen escaping immunosurveillance, orconstant replenishment of the antigen by the tissue (eithera self- or tumor antigen), leads to a sustained inflammatoryresponse. This inflammation is characterized by chronic
www.sciencedirect.com
infiltration of cellular effectors of the immune system,mainly T cells and macrophages, but also dendritic cells,NK cells, B cells and plasma cells. In most of these chronicinflammatory infiltrates, the various cell populations arenot noticeably spatially coordinated. However, it has longbeen observed that the cellular elements can sometimesorganize themselves in structures that morphologicallyresemble the secondary lymphoid organs [16].
Beyond microanatomical similarities with secondarylymphoid organs, ectopic lymphoid tissues are functionalbecause they support local GC reactions, including clonalexpansions, somatic hypermutations, immunoglobulinclass switching and antibody production, which are likelyto contribute to the exacerbation of chronic inflammatorydiseases [17,18]. This process has therefore receivedincreasing attention, and the list of diseases in which ithas been observed has grown longer [14,15].
Themolecularmechanisms underlying the organizationof chronic inflammatory lesions into ectopic lymphoid tis-sue recapitulate some of those involved in lymphoid orga-nogenesis during development [15]. Thus, the de novoformation of organized lymphoid tissue in chronic
Opinion TRENDS in Immunology Vol.27 No.10 443
inflammation has been referred to as lymphoid neogenesis[13]. The first evidence that inflammation-associated lym-phoid neogenesis could involve the same signaling path-ways that regulate lymphoid organogenesis came fromstudies of transgenic mice, showing that overexpressionof lymphotoxin a [13], CCL21 [19] or CXCL13 [20] in anonlymphoid tissue is sufficient to trigger B- and T-cellrecruitment and segregation at these ectopic sites. Furtherevidence that similar mechanisms drive lymphoid organo-genesis and ectopic GC formation was derived from immu-nohistochemical and gene expression analyses of tissuesamples from patients [21,22]. Together, these studiesclearly demonstrate that the action of a panel of chemo-kines and cytokines is required to generate (ectopic) GCs.
Despite these advances in the comprehension of themolecular mechanisms leading to the development of ecto-pic GCs, the pathophysiological triggers for the switch froma diffuse chronic inflammatory infiltrate into organizedectopic GCs remain to be fully identified. The first triggeridentified was enduring local antigenic stimulation result-ing from the inability of the immune system to eradicatethe targeted antigens. Although necessary, this conditionalone is not sufficient to promote lymphoid neogenesis. If itwere sufficient, tissues targeted by an autoimmuneresponse would always display ectopic GCs. However, thisis not the case because several clinical studies have docu-mented the formation of ectopic GCs in only a limitednumber of patients (30% in rheumatoid arthritis, 17% inSjogren’s syndrome) [14]. Finding a pathological conditionin whichGCs are systematically detected is likely to help toidentify the factors that promote their development.
Lymphoid neogenesis in chronic rejection: evidence fora local humoral alloimmune responseThe involvement of lymphoid neogenesis in the pathogen-esis of chronic rejection of solid organ transplants has beenrecently demonstrated [23]. Using a murine experimentalmodel, it was shown that the T-cell infiltrate within theinterstitial tissue of a chronically rejected graft shiftstowards a B helper phenotype. Indeed, the major part ofthe T-cell infiltrate was composed of CD4+ T cells expres-sing MHC II molecules and CD134 (also known as OX40).Interestingly, following priming with antigen, CD134+ Tcells have been shown to be located in the T-cell zone ofsecondary lymphoid organs, where they provide a crucialstimulation for the differentiation of activated B cells intohigh Ig-producing cells. The T-cell infiltrate surrounded B-cell clusters that were ectopic GCs. Indeed, (i) the B-cellnodules were the site of intense proliferation and apopto-sis, which is in accordance with the intensive cell turnovercharacterizing GCs; (ii) the spatial compartmentalizationof B cells was the same as in GCs: a ring of single-positiveIgM+ B cells surrounded a core of immature double-posi-tive IgM+ and IgD+ B cells; (iii) B cells expressed activa-tion-induced cytidine deaminase, an enzyme that catalyzessomatic hypermutation and class switch recombination ofthe immunoglobulin gene and whose expression is highlyregulated and restricted to GC B cells; and (iv) the venularendothelial cells, located in the vicinity of the lymphoidinfiltrates, acquired a high endothelial venule-like pheno-type. These findings have been extended to the human
www.sciencedirect.com
clinical setting, where the interstitium of chronicallyrejected human allografts (hearts and kidneys) exhibitedsimilar features [23]. Hyperoxic organocultures of theseectopic lymphoid structures demonstrated that they areinvolved in the rejection process because they producedalloantibodies directed against donor MHC I molecules.
Interestingly, ectopic GCs were found in 100% of chroni-cally rejected grafts analyzed. This finding is in strikingcontrast with the fact that only a limited percentage ofpatients develop ectopic GCs in the other pathologicalconditions associated with lymphoid neogenesis [14].Therefore, in the particular setting of chronic rejection,additional pathogenic factor(s) synergize with the failureto eradicate antigens to promote the development of ecto-pic GCs.
Is defective lymphatic drainage a prerequisite forlymphoid neogenesis?The lymphatic vasculatureof graftedorgans originates fromthe recipient and is thusone of the targets of the alloimmuneresponse. Consequently, chronically rejected solid organgrafts display defective lymphatic drainage. Here, wereview the evidence that insufficient lymph outflow mightbe a crucial trigger for lymphoid neogenesis in this setting.
Although the lymphatic vasculature of the graft is notanastomosed to that of the recipient during the surgicalprocedure, spontaneous re-establishment of the lymphaticoutflow from the transplanted organ occurs within 14 dayspost-transplantation, when immunosuppressive therapyefficiently controls the alloimmune response of the recipi-ent [24]. However, because the lymphatic vasculature ofthe graft originates from the donor and displays allogeneicantigens, it is one of the targets of the immune system ofthe recipient. Accordingly, previous ultrastructural studieshave demonstrated that rejection episodes were associatedwith focal narrowing of the lumina of lymph vessels, dis-ruption of lymphatic microvascular endothelial junctionsand destruction of endothelial cells responsible for focaldefects in the walls of the lymphatic vessels [25,26]. Thesealterations probably have functional repercussionsbecause an interruption in the lymph flow from thegraft to the draining lymph node of the recipient hasbeen reported in a canine allograft lung rejection model[27].
Chronic rejection is defined by a persistent low-gradealloimmune response which continues during the entirelife span of the graft. It has been demonstrated that thisongoing immune response required the continuous pre-sentation of alloantigens to recipient T cells [28]. Thus, ifthe sensitization phase of the immune system wasrestricted to specialized secondary lymphoid organs,chronic rejection would be a self-controlled process becausedestruction of the afferent lymphatics by the alloimmuneresponse would progressively reduce the amount of alloan-tigens carried to the draining lymph node. However, thenatural history of chronic rejection suggests that the pro-gressive deterioration of lymphatic drainage does notimpede the immune response against the graft.We proposethat in this situation, lymphoid neogenesis takes placewithin the rejected organ, enabling the immune systemto overcome the defective lymphatic drainage by gathering
444 Opinion TRENDS in Immunology Vol.27 No.10
the effectors and the targets while locally restricting all ofthe phases of the immune response (Figure 1c).Interestingly, it has been shown that lymphatic vesselsare also important exit routes for immune effectors respon-sible for the rejection process (Figure 1b). Thus, defectivelymphatic drainage could further favor lymphoidneogenesis by promoting the accumulation of immuneeffectors in the tissue [29,30] (Figure 1c). Indeed, inter-ruption of lymph flow from the inflammatory site wouldlead to the accumulation of cellular effectors andthe soluble mediators that they have released, thuscreating optimal conditions for ectopic GCs to develop.The hypothesis that lymphoid neogenesis arises fromchronic inflammation when lymphatic drainage is compro-mised is in apparent contradiction with several studiesshowing that chronic inflammation drives lymphangiogen-esis [31,32].
Lymphoid neogenesis and lymphangiogenesisLymphangiogenesis corresponds to the de novodevelopment of lymphatic vessels. Because chronicinflammatory conditions lead to the genesis of newlymphatic vessels, the distribution and local density oflymphatic vessels and their topographic relationship withthe inflammatory infiltrate was investigated in humanrenal grafts explanted for terminal chronic rejection[33,34]. In normal kidneys, lymphatic vessels were foundto follow the larger intrarenal branches of the renal arteryup to the level of interlobular arteries but not further. Nolymphatic vessels were encountered either in the peritub-ular spaces or in proximity to the glomeruli. Renal graftsthat were devoid of lymphoid neogenesis did not displaysignificant proliferation of lymphatic vessels, and theirlocation and number resembled that of normal kidneys.By contrast, significant amplification (�50-fold) of thelymphatic microvasculature density was observed in100% of the chronically rejected grafts with ectopic GCs.In these grafts, lymphatic vessels were not only found inthe periarterial adventitia, but also within the intertubu-lar stroma. Numerous lymphatic endothelial cellsexpressed the nuclear proliferationmarker KI-67, suggest-ing that the increased lymphatic density results from denovo lymphangiogenesis. Finally, a close colocalizationbetween the neoformed lymphatic vessels and the ectopicGCs was found. This could suggest that lymphoid neogen-esis and lymphangiogenesis are interconnected events.Because lymphangiogenesis has been evidenced in theabsence of ectopic GCs [32], we can rule out that it is asufficient trigger for lymphoid neogenesis.
Because chronically rejected allografts display ectopicGCs [23,33,34], an increased density of lymphatic vessels[33,34] and defective lymphatic communication with thedraining lymph node [27,29], this condition demonstratesthat when ectopic GCs are present, the lymphatic vesseldensity can increase in the inflamed tissue without re-establishing the lymphatic connection with the draininglymph nodes. A recent study by Angeli et al. [35] showedthat follicular activated B lymphocytes can orchestrate theexpansion of the lymphatic network not only within theactivated lymph node, but also to the upstream site ofinflammation [35]. This results in increased dendritic-cell
www.sciencedirect.com
migration to the draining lymph node. We speculate thatactivated B cells in the ectopic GCs could similarly drivelymphangiogenesis within inflamed tissues. Consequently,the de novo lymphatic vessels would not carry the antigento the draining lymph node but rather to the ectopic GCs(Figure 1c). Hence, during chronic rejection, lymphangio-genesis and lymphoid neogenesis would be synergisticprocesses that mutually amplify each other.
ConclusionIn conclusion, recent advances in chronic rejection enableus to propose that lymphoid neogenesis and lymphangio-genesis are intimately interconnected. Chronicallyrejected organs display defective lymphatic drainage asa consequence of the alloimmune response. The subse-quent accumulation of immune effector cells that releaselocally soluble mediators (including lymphotoxin andlymphoid chemokines) initiates the formation of ectopicGCs. We speculate that activated follicular B cells rerouteinflammatory-associated lymphangiogenesis towardsectopic GCs. Therefore, draining lymph nodes aredisconnected from the immune events taking place withinthe graft. By contrast, ectopic GCs drain most of theantigenic burden. At this step, a self-amplified loop isestablished that will ultimately lead to the destructionof the tissue.
We finally propose to extend this pathogenic schema tomost of the chronic inflammatory disorders associatedwiththe development of ectopic GCs. Edema, a cardinal sign ofinflammation and clinically significant feature of inflam-matory disease [36], occurs when the amount of leakagefrom inflamed blood vessels exceeds the capacity of lym-phatic vessels for drainage [37]. A relative defect in lym-phatic drainage reduces the amount of antigen reachingthe draining lymph node [38]. We believe that such arelative defect in the lymphatic drainage of the inflamedtissue is a trigger for the cascade of events leading to thedevelopment of lymphoid neogenesis. Interestingly, thestatus of the lymphatic drainage is likely not to be asdrastically affected in chronic inflammatory disorders asin rejected allografts. This difference could explain whylymphoid neogenesis develops in 100% of chronicallyrejected allografts and in only a limited number of casesin the other chronic inflammatory diseases.
Why would evolution have selected both specializedsecondary lymphoid organs and the capacity to organizeinflammatory infiltrates into ectopic GCs in whichthe control of the immune response is lax? Indeed, theimmune response taking place within ectopic GCs occurs ina microenvironment where normal mechanisms thatshould operate to control the expansion and maturationof activated T and B cells are defective, as assessed by anincreased risk for autoimmunity [39] and GC-derived lym-phomas [21,40] (Box 1). The basis for the selection of such apotentially harmful mechanism is probably the fact thatthis process should provide a backup to the immune systemfor mounting a response against pathogens when lympha-tic communications are defective. Another plausible expla-nation is that lymphoid neogenesis creates the optimalconditions for eliciting potent immune responses againstpoorly immunogenic antigens.
Box 1. The pros and cons of lymphoid neogenesis
Advantages of lymphoid neogenesis
1. It constitutes a backup process enabling the immune system to
mount a response against pathogens when lymphatic commu-
nications between the secondary lymphoid organs and the
infected tissue are defective.
2. It creates the optimal conditions for eliciting an effective immune
response against poorly immunogenic antigens [14] by:
(a) increasing the quantity of antigen available for the immune
effectors;
(b) providing an inflammatory context congenial to the antigen
being recognized as ‘dangerous’.
3. It enables local sequestration of pathogens, preventing their
dissemination [15].
Disadvantages of lymphoid neogenesis
1. The presentation of self-antigens, released by the destructive
inflammatory process, in a context of ‘danger’:
(a) increases the risk of autoreactive clones to escape during the
immune response [39];
(b) promotes the chronicization of the inflammation because the
immune response within ectopic lymphoid tissue is main-
tained independently of the inducing mechanism [14].
2. Sustained stimulation of reactive B cell clones increases the risk
of lymphomas [21,40].
Opinion TRENDS in Immunology Vol.27 No.10 445
AcknowledgementsWe are grateful to Anne-Christine Field, Marie-Caroline Dieu-Nosjean,Jean-Baptiste Michel and Srini Kaveri for critical reading of themanuscript. O.T. is supported by the INSERM and the Fondation pourla Recherche Medicale.
References1 Gretz, J.E. et al. (1997) Cords, channels, corridors and conduits: critical
architectural elements facilitating cell interactions in the lymph nodecortex. Immunol. Rev. 156, 11–24
2 Gretz, J.E. et al. (2000) Lymph-borne chemokines and other lowmolecular weight molecules reach high endothelial venules viaspecialized conduits while a functional barrier limits access to thelymphocytemicroenvironments in lymph node cortex. J. Exp.Med. 192,1425–1440
3 Romani, N. et al. (2001) Migration of dendritic cells into lymphatics –the Langerhans cell example: routes, regulation, and relevance. Int.Rev. Cytol. 207, 237–270
4 Anderson, A.O. andAnderson,N.D. (1976) Lymphocyte emigration fromhigh endothelial venules in rat lymph nodes. Immunology 31, 731–748
5 Butcher, E.C. and Picker, L.J. (1996) Lymphocyte homing andhomeostasis. Science 272, 60–66
6 Stamper, H.B., Jr and Woodruff, J.J. (1976) Lymphocyte homing intolymph nodes: in vitro demonstration of the selective affinity ofrecirculating lymphocytes for high-endothelial venules. J. Exp. Med.144, 828–833
7 Jacob, J. and Kelsoe, G. (1992) In situ studies of the primary immuneresponse to (4-hydroxy-3-nitrophenyl)acetyl. II. A common clonal originfor periarteriolar lymphoid sheath-associated foci and germinalcenters. J. Exp. Med. 176, 679–687
8 Jacob, J. et al. (1991) Intraclonal generation of antibody mutants ingerminal centres. Nature 354, 389–392
9 Nieuwenhuis, P. et al. (1992) De novo germinal center formation.Immunol. Rev. 126, 77–98
10 Neuberger, M.S. andMilstein, C. (1995) Somatic hypermutation. Curr.Opin. Immunol. 7, 248–254
11 Rajewsky, K. (1996) Clonal selection and learning in the antibodysystem. Nature 381, 751–758
12 Honjo, T. et al. (2002) Molecular mechanism of class switchrecombination: linkage with somatic hypermutation. Annu. Rev.Immunol. 20, 165–196
13 Kratz, A. et al. (1996) Chronic inflammation caused by lymphotoxin islymphoid neogenesis. J. Exp. Med. 183, 1461–1472
www.sciencedirect.com
14 Aloisi, F. and Pujol-Borrell, R. (2006) Lymphoid neogenesis in chronicinflammatory diseases. Nat. Rev. Immunol. 6, 205–217
15 Drayton, D.L. et al. (2006) Lymphoid organ development: fromontogeny to neogenesis. Nat. Immunol. 7, 344–353
16 Prineas, J.W. (1979) Multiple sclerosis: presence of lymphaticcapillaries and lymphoid tissue in the brain and spinal cord. Science203, 1123–1125
17 Armengol, M.P. et al. (2001) Thyroid autoimmune disease:demonstration of thyroid antigen-specific B cells and recombination-activating gene expression in chemokine-containing activeintrathyroidal germinal centers. Am. J. Pathol. 159, 861–873
18 Schroder, A.E. et al. (1996) Differentiation of B cells in thenonlymphoid tissue of the synovial membrane of patients withrheumatoid arthritis. Proc. Natl. Acad. Sci. U. S. A. 93, 221–225
19 Fan, L. et al. (2000) Cutting edge: ectopic expression of the chemokineTCA4/SLC is sufficient to trigger lymphoid neogenesis. J. Immunol.164, 3955–3959
20 Luther, S.A. et al. (2000) BLC expression in pancreatic islets causes Bcell recruitment and lymphotoxin-dependent lymphoid neogenesis.Immunity 12, 471–481
21 Mazzucchelli, L. et al. (1999) BCA-1 is highly expressed inHelicobacterpylori-induced mucosa-associated lymphoid tissue and gastriclymphoma. J. Clin. Invest. 104, R49–R54
22 Salomonsson, S. et al. (2003) Cellular basis of ectopic germinal centerformation and autoantibody production in the target organ of patientswith Sjogren’s syndrome. Arthritis Rheum. 48, 3187–3201
23 Thaunat, O. et al. (2005) Lymphoid neogenesis in chronic rejection:evidence for a local humoral alloimmune response. Proc. Natl. Acad.Sci. U. S. A. 102, 14723–14728
24 Malek, P. et al. (1969) Lymphatic aspects of experimental and clinicalrenal transplantation. Bull. Soc. Int. Chir. 28, 110–114
25 Demetris, A.J. et al. (1997) Analysis of chronic rejection andobliterative arteriopathy. Possible contributions of donor antigen-presenting cells and lymphatic disruption. Am. J. Pathol. 150, 563–578
26 Eliska, O. et al. (1986) Lymph vessels of the transplanted kidney.Nephron 44, 136–141
27 Ruggiero, R. et al. (1994) Detection of canine allograft lung rejection bypulmonary lymphoscintigraphy. J. Thorac. Cardiovasc. Surg. 108,253–258
28 Chandraker, A. et al. (1998) Late blockade of T cell costimulationinterrupts progression of experimental chronic allograft rejection. J.Clin. Invest. 101, 2309–2318
29 Kline, I.K. and Thomas, P.A. (1976) Canine lung allograft lymphaticalterations. Ann. Thorac. Surg. 21, 532–535
30 Pedersen, N.C. and Morris, B. (1970) The role of the lymphatic systemin the rejection of homografts: a study of lymph from renal transplants.J. Exp. Med. 131, 936–969
31 Alitalo, K. et al. (2005) Lymphangiogenesis in development and humandisease. Nature 438, 946–953
32 Maruyama, K. et al. (2005) Inflammation-induced lymphangiogenesisin the cornea arises from CD11b-positive macrophages. J. Clin. Invest.115, 2363–2372
33 Kerjaschki, D. et al. (2006) Lymphatic endothelial progenitor cellscontribute to de novo lymphangiogenesis in human renaltransplants. Nat. Med. 12, 230–234
34 Kerjaschki, D. et al. (2004) Lymphatic neoangiogenesis in humankidney transplants is associated with immunologically activelymphocytic infiltrates. J. Am. Soc. Nephrol. 15, 603–612
35 Angeli, V. et al. (2006) B cell-driven lymphangiogenesis in inflamedlymphnodesenhancesdendritic cellmobilization. Immunity24, 203–215
36 Braunwald, E. (1994) Edema. In Harrison’s Principles of InternalMedicine (13th edn) (Isselbacher, K.J. et al., eds), pp. 183–187,McGraw-Hill
37 Alitalo, K. and Carmeliet, P. (2002) Molecular mechanisms oflymphangiogenesis in health and disease. Cancer Cell 1, 219–227
38 Hawley, A.E. et al. (1998) The effect of lymphatic oedema on the uptakeof colloids to the lymph nodes. Biopharm. Drug Dispos. 19, 193–197
39 Weyand, C.M. et al. (2001) Ectopic lymphoid organogenesis: a fast trackfor autoimmunity. Am. J. Pathol. 159, 787–793
40 Hjelmstrom, P. (2001) Lymphoid neogenesis: de novo formation oflymphoid tissue in chronic inflammation through expression ofhoming chemokines. J. Leukoc. Biol. 69, 331–339
124
3.4.2 Détournement d’un programme génétique embryonnaire par la réponse inflammatoire chronique
Les mécanismes biologiques responsables de l’organisation de l’infiltrat
cellulaire lors des situations inflammatoires chroniques sont encore largement
inconnus. Compte tenu des résultats précédents montrant une très grande
similitude architecturale entre le tissu lymphoïde ectopique et les organes
lymphoïdes secondaires « professionnels », nous avons postulé que la
néogenèse lymphoïde pouvait correspondre à une récapitulation du
programme « développemental » conduisant à la formation de ces derniers.
Ces dernières années, d’importants progrès ont été réalisés dans la
compréhension de l’ontogénie des organes lymphoïdes secondaires (220,
221). Leur développement répond à un programme biologique complexe,
appelé organogenèse lymphoïde, qui peut être divisé en plusieurs
étapes (Figure 13). Schématiquement, ce processus peut être résumé
comme suit : i) émergence du foie foetal d’une population cellulaire : les LTIC
(lymphoid tissu inducer cells) caractérisés par l’expression du facteur de
transcription RORγt (isoforme thymique du « retinoid-related orphan receptor
gamma » ; aussi appelé RORC2 chez l’homme), ii) les LTIC expriment le
récepteur CXCR5 et remontent le gradient de CXCL13 mis en place par les
cellules « organisatrices » d’origine non hématopoïétique, iii) Les LTIC
expriment à leur membrane la lymphotoxine α1β2 (LTα1β2) qui se lie au
récepteur β de la lymphotoxine (LTβR) à la surface des cellules stromales
activées, iv) la liaison LTα1β2/LTβR induit la synthèse par la cellule stromale
contactée des chémokines homéostatiques CXCL13, CCL19 et CCL21. Ces
dernières attirent les lymphocytes T et B dans le tissu et sont ensuite
responsables de leur ségrégation.
Nous avons étudié l’expression des gènes de l’organogenèse lymphoïde
(LTα, LTβ, LTβR, CXCL13, CXCR5, CCL19, CCL21, CCR7, CXCL12,
CXCR4) dans 26 greffons rénaux détransplantés : 20 pour rejet terminal, 3
pour un échec chirurgical primaire (2 thromboses artérielles et 1 thrombose
veineuse) et 3 pour une dysfonction tardive d’origine non-immunologique (1
récidive de hyalinose segmentaire et focale et 2 récidives de
microangiopathie thrombotique). La même analyse a été conduite sur 6
pièces de néphrectomie pour tumeur utilisées comme tissu rénal témoin.
125
L’expression des gènes a été quantifiée par RT-PCR et normalisée par
rapport à celle d’un gène de ménage (GAPDH).
Figure 13 Principales étapes de l’ontogénie des organes lymphoïdes secondaires : l’organogenèse lymphoïde (Adapté de Mebius et al, Nat Rev Immunol (2003), p292-303)
Légende : a) Les LTIC (lymphoid tissu inducer cells) CD3–CD4+CD45+, issues du foie fœtal et exprimant la lymphotoxine (LT)α1β2, se lient aux cellules stromales activées exprimant VCAM1 par l’intégrine α4β1. Le contact LTα1β2 sur le récepteur β de la lymphotoxine (LT βR) induit un programme biologique dans la cellule stromale aboutissant à la synthèse des chémokines homéostatiques : CCL19, CCL21, CXCL12 et CXCL13. b) Les lymphocytes T et B remontant le gradient chémokinique s’accumulent au contact des cellules stromales activées. Une boucle d’amplification dépendante de TRANCE (tumour-necrosis factor-related activation induced cytokine) se met en place. c) Lorsqu’une taille critique est atteinte, les lymphocytes s’organisent dans l’espace. La différentiation des cellules endothéliales en HEV (high endothelial venules) permet d’augmenter le recrutement des lymphocytes depuis le courant sanguin au niveau de l’organe lymphoïde secondaire néoformé.
126
L’application d’une technique de « clusterisation » à ces données a fait
ressortir les points suivants : i) le tissu rénal témoin n’exprime pas ces gènes
et constitue un premier groupe (C1), ii) au sein du groupe C1 sont également
rassemblés les 3 greffons détransplantés précocément pour échec chirurgical
primaire et les 3 greffons ayant cessé de fonctionner en raison de la récidive
de la néphropathie initiale et iii) les 20 greffons détransplantés pour rejet
terminal expriment tous, à des degrés divers, les gènes de l’organogenèse
lymphoïde et se divisent en 3 groupes supplémentaires (C2, C3 et C4 ;
correspondant respectivement à une augmentation progressive du nombre de
gènes exprimés, le groupe C4 rassemblant les greffons dans lesquels tous
les gènes sont fortement exprimés).
Afin de vérifier si ces groupes ont une signification fonctionnelle en terme de
maturation locale de la réponse humorale, les sous-populations
lymphocytaires B ont été quantifiées par cytométrie en flux sur la base de
l’expression du CD38 et de l’IgD (classification Bm établie par Banchereau et
al (143)). Cette analyse montre, que tandis que la quantité de cellules CD19+
infiltrant les greffons rejetés n’est pas différente entre les groupes C2, C3 et
C4, seuls les greffons du dernier groupe contiennent tous les stades de
maturation des lymphocytes B : du lymphocyte B naïf CD38-IgD+ au
lymphocyte B mémoire CD38-IgD-. Dans les greffons des autres groupes, la
maturation B est bloquée à un stade d’autant plus précoce que les gènes de
l’organogenèse lymphoïde sont moins exprimés (C2<C3). Logiquement, un
blocage de maturation lymphocytaire B corrèle avec une production locale
d’immunoglobuline plus faible. En plus de cette conséquence quantitative, un
défaut d’expression des gènes de l’organogenèse lymphoïde s’accompagne
également d’un défaut qualitatif de la réponse humorale locale. Ainsi, non
seulement les greffons du groupe C4 produisent beaucoup plus
d’alloanticorps que ceux des groupes C2 et C3, mais les spécificités des
alloanticorps des greffons C4 sont aussi beaucoup plus diverses (environ 9
fois plus que le nombre de « mismatch » HLA potentiels). En clinique, ces
différences « d’efficacité de néogenèse lymphoïde » se traduisent par une
durée de fonctionnement sensiblement réduite pour les greffons du groupe
C4 (1295±365 jours) par rapport à ceux des groupes C3 (1672±1987) et C2
(3542±1474). Dernier fait notable, les spécificités des alloanticorps produits
dans les greffons sont différentes de celles détectées dans le sérum au
127
moment de la détransplantation. Ceci suggère une déconnection des
réponses humorales locale et systémique et une autonomie de la réponse
locale.
Ce travail démontre que la néogenèse lymphoïde est un détournement par
l’inflammation chronique du programme biologique « développemental » mis
en place chez l’embryon au cours de l’ontogénie des organes lymphoïdes
secondaires. Seule une récapitulation complète du programme biologique
aboutit à la formation de centres germinatifs ectopiques, fonctionnels, sièges
d’une réponse locale autonome participant à la destruction du greffon. Les
tissus dans lesquels un blocage survient au cours du processus présentent
une réponse immune locale déficiente (quantitativement et qualitativement)
dont l’agressivité est réduite. Notre travail identifie trois verrous moléculaires
« gardant » le passage d’un groupe au suivant (respectivement CXCL13,
CCL21, LTβR) et suggère que ces molécules pourraient servir de cibles
thérapeutiques pour contrôler l’inflammation chronique non seulement au
cours du rejet d’allogreffe mais peut-être également dans les autres
pathologies chroniques associées à la néogenèse lymphoïde.
Thaunat et al - Page 1
Chronic immune activation triggers the development
of an autonomous humoral response within inflamed
tissues through the stepwise recapitulation of
lymphoid organogenesis
Olivier Thaunat1,2, Natacha Patey3, Giuseppina Caligiuri1, Chantal Gautreau4,
Maria Mamani-Matsuda5, Marie-Caroline Dieu-Nosjean1, Gérard Eberl6, Jean-
Baptiste Michel7, Stéphanie Graff-Dubois1* and Antonino Nicoletti1*
1) Centre de Recherche des Cordeliers; Université Pierre et Marie Curie -
Paris6; Université René Descartes Paris5; UMR S 872, Paris, France.
2) Hospices Civils de Lyon, Hôpital Edouard Herriot, Service de
transplantation rénale et d’immunologie clinique, F-69437, Lyon, France;
Université de Lyon, F-69622, Lyon, France; INSERM U851, Lyon, France.
3) Service d’Anatomopathologie, Hôpital Necker, AP-HP, Paris, France.
4) Laboratoire d’immunologie et d’histocompatibilité, Hôpital Saint-Louis, AP-
HP, Paris, France.
5) INSERM U783, Développement du système immunitaire, Université Paris
Descartes, Faculté de Médecine, Site Necker-Enfants Malades, Paris,
France.
6) Laboratoire du développement du tissu lymphoïde, Centre National de la
Recherche Scientifique URA1961, Institut Pasteur, Paris 75724, France.
Thaunat et al - Page 2
7) INSERM U698; Université Denis Diderot-Paris 7; CHU Xavier Bichat, Paris,
France.
* These two authors equally contributed to the work
Correspondence to:
Olivier Thaunat, M.D.,
Service de transplantation rénale et d’immunologie clinique,
Hôpital Edouard Herriot,
5 place d’Arsonval,
69437 Lyon Cedex 03,
France.
Tél: +33 4 37 28 74 68
Fax : +33 4 37 28 76 52
email : [email protected]
Word count: 3112
Figures: 4
Tables: 2
Thaunat et al - Page 3
Abstract (141 words)
The persistence of the immuno-inflammatory process turns this critical
component of the body’s natural defenses into a destructive mechanism
involved in a wide range of diseases, including chronic rejection. Performing a
comprehensive analysis of human kidney grafts explanted for terminal failure,
we observed that the inflammatory infiltrate organizes itself into an ectopic
lymphoid tissue supporting the maturation of an autonomous local humoral
immune response. The structuration of the immune effectors within adult
human inflamed tissues was dependent upon the stepwise recapitulation of
the biological pathways recently identified in murine embryos during the
ontogeny of secondary lymphoid organs. Whenever this recapitulation was
incomplete, B cell maturation was blocked, limiting the aggressiveness of the
local humoral response. The identification of the molecular checkpoints critical
for the completion of the lymphoid neogenesis program paves the way for
innovative therapeutic strategies to control chronic inflammation.
Thaunat et al - Page 4
The immuno-inflammatory process aims at eliminating the target antigen.
Tight regulation mechanisms normally ensure that the process is transient and
turned off when the causative stimulus has been cleared. The difficulty to
eradicate antigens, because of escape from immunosurveillance by the
pathogen, or constant replenishment of the antigens by the tissue, leads to
sustained inflammation responsible for extensive tissue destruction and loss
of function.
The progression towards chronic inflammation is characterized by a
progressive shift in the type of immune effectors present at the site of
inflammation i.e. enrichment in cells from the adaptive immune system 1.
Beside this change in the composition of the inflammatory infiltrate, the
organization of infiltrated cells is also rearranged. Indeed, it has long been
observed that the inflammatory cells can organize themselves into structures
that morphologically resemble follicles within secondary lymphoid organs 2.
The process by which de novo organized lymphoid structures (“tertiary
lymphoid tissues”) arise during chronic inflammation has been referred to as
lymphoid neogenesis 3,4. Recurrent observation of these ectopic germinal
centers within inflamed tissues has lead to the hypothesis that they contribute
to the exacerbation of chronic inflammatory diseases. Lymphoid neogenesis
has therefore received increasing attention and the list of diseases in which it
has been observed has grown longer 5.
Chronic rejection, a major cause for late allograft failure 6, provides optimal
conditions to study the immune mechanisms involved in the development of
chronic inflammation-associated tertiary lymphoid tissues. Indeed, i) Tertiary
lymphoid tissues have systematically been detected in chronically rejected
Thaunat et al - Page 5
grafts 7-9; ii) The antigens targeted by the immune system are known
(recipient-mismatched HLA antigens of the transplanted tissues); iii) The
mechanisms by which inflammation becomes chronic relies on the sustained
replenishment of the antigen from the rejected tissue; iv) Chronically rejected
organs are sometimes removed providing an important amount of diseased
tissue allowing comprehensive analysis both at the molecular and cellular
levels.
In the present work, we show that in chronically rejected human kidneys,
lymphoid neogenesis is an heterogenous process borrowing the ontogenic
program triggered in the embryo during the development of secondary
lymphoid organs. Only the complete recapitulation of this program results in
the generation of fully functional ectopic germinal centers (eGC), that support
the efficient maturation of an autonomous local humoral immune response
perpetuating tissue destruction.
Thaunat et al - Page 6
Results
Microarchitecture of the inflammatory infiltrate during chronic rejection
Twenty-six successive explanted renal grafts have been analyzed (Table 1).
In contrast with kidneys removed for immediate primary surgical failure (n=3),
or non-immune failure (angiosarcoma, n=1; or recurrence of the renal
disease, n=2), all of the 20 chronically rejected renal grafts were infiltrated by
immune effectors. In the vast majority of the latter (18/20; 90%), the interstitial
chronic inflammatory infiltrate displayed a highly organized microarchitecture
similar to secondary lymphoid tissues (Fig. 1A), a process referred to as
lymphoid neogenesis 3. In particular, B cells were packed into nodular
structures evocative of B cell follicles. The phenotypic characterization of B
lymphocytes revealed the heterogenous nature of the nodules as already
reported in the synovia of rheumatoid arthritis patients 10. Two types of
nodules could be identified. Nodules composed by an uniform CD20pos B cell
population expressing IgD and Bcl-2 (Fig. 1B, left panels) evoked primary
follicles, while nodules with a core of CD20posIgDnegBcl-2neg B cells highly
expressing Bcl-6 that had drawn aside the CD20posIgDposBcl-2pos B cells (Fig.
1B, right panels) recalled secondary follicles, i.e. germinal centers. The ratio
between these two types of structures was different between the samples.
The number of ectopic germinal centers was not increasing with the quantity
of primary nodules (Fig. 1C), nor with the duration of exposition of the tissues
to the immune response of the host (Fig. 1D). This suggested that the low
number of eGC in certain tissues was neither due to a reduced number of
primary B cell nodules nor to lack of time for their conversion.
Thaunat et al - Page 7
Ectopic germinal center formation during chronic inflammation requires
the expression of genes involved in lymphoid organogenesis
We reasoned that the development of eGC during chronic inflammation could
follow the same biological steps as the ones identified in the embryo during
the ontogeny of secondary lymphoid organs. The level of expression of a
selected set of genes reported to play key roles in lymphoid organogenesis 11-
17 was quantified by realtime Q-PCR in each tissue sample and in six normal
kidneys (NK) devoid of inflammation. Data were processed by hierarchical
clustering in order to identify samples sharing similar expression patterns.
Normal kidneys displayed a pattern characterized by a low expression of all
lymphoid organogenesis genes. Strikingly, this pattern was shared by the 3
grafts explanted for primary surgical failure (DTR11, DTR12, DTR20) as well
as by the 3 grafts explanted for non immune-mediated failures (DTR2,
DTR10, DTR16). All these samples were gathered in C1 cluster (Fig. 2A).
In the 20 remaining chronically rejected grafts, the expression of lymphoid
organogenesis genes was detectable with heterogeneous levels. These
samples could be split into 3 additional clusters (C2, C3 and C4)
corresponding to a stepwise increase in the level of expression of these
genes (Fig. 2A). The four discrete patterns in which genes were sequentially
switched on imply that the biological program has to go through three
checkpoints. The C1 to C2 checkpoint involved the expression of CXCL13
and CXCR4; The C2 to C3, the additional expression of CCL19, CCL21,
CCR7, lymphotoxin(LT)α, LTß, and CXCR5; The C3 to C4, the
supplementary expression of CXCL12 and LTβ Receptor (LTßR). The C4
Thaunat et al - Page 8
cluster therefore gathered the samples expressing the complete set of
lymphoid organogenesis genes.
The principal component analysis of realtime Q-PCR data and the
identification of the first two eigenvectors (canon 1 and 2; Fig. 2B) showed
that CXCL13, CCL21, and LTßR were the genes with the largest eigenvalues,
i.e. the genes the expression of which contributed the most to distribute the
samples to the 4 clusters (Fig. 2B). We verified that these genes were readily
expressed at the protein level within inflamed tissues (Fig. 2C).
The analysis of histological data using the gene expression-defined clusters
showed that going through the first checkpoint resulted in B cell recruitment
(Fig. 2D). In the next steps (C3 and C4), primary follicles were converted into
eGC. This process was more efficient in C4 samples since the amount of eGC
was higher in C4 than in C3 samples (1±0.71 vs 0.50±0.62; Fig. 2E) while
arising from a reduced number of primary nodules (1.00±0.41 vs 1.70±1.03;
Fig. 2D).
Germinal center reaction is characterized by the expression of activation-
induced cytidine deaminase (AID), the key enzyme controlling class switch
recombination and somatic hypermutations. As expected, AID protein was not
detectable in naïve B cells forming the primary follicles, but was readily
evidenced in eGC B cells (Fig. 2F). Since this enzyme is mandatory to
produce high affinity antibodies endowed with adequate effector functions, the
gradual increase of AID expression evidenced from C1 to C4 (Fig. 2G)
indicates that the gene expression-based clusterization defines functional
clusters regarding the maturation of the local humoral immune response.
Thaunat et al - Page 9
RORC2, a lymphoid organogenesis initial trigger, operates in lymphoid
neogenesis
Next, we analyzed the expression level of the thymic isoform of the retinoic
acid receptor-related orphan receptor gamma (RORγt or RORC2) because
our previous results suggested that lymphoid neogenesis recapitulates
lymphoid organogenesis the initial step of which is under the control of this
transcription factor in so-called lymphoid tissue inducer cells (LTIc) 18. Cells
displaying a LTic phenotype (CD3neg CD4pos CD45pos CXCR5pos CCR7pos
CD127pos cells) could not be identified in our samples (data not shown).
However, there was a statistically significant positive correlation (R2 = 0.947; p
= 0.001; Fig. 2H) between the level of expression of RORC2 and AID, the
latter being used as a quantitative indicator of the efficiency of the lymphoid
neogenesis. Remarkably, the clusters were ordered (C1 to C4) along the
regression line (Fig. 2H), unraveling RORC2 as a master regulator of eGC
development during chronic inflammation. The expression levels of RORC2
and of AID in the C4 cluster were almost superimposed to the ones detected
in normal lymph nodes (Fig 2H).
Incomplete biological program results in local B cell maturation
blockade
The proportion of CD19pos cells in the inflammatory infiltrate measured by flow
cytometry (Fig. 3A) was concordant with the histological quantification of
primary nodules (Fig. 2D) and further documented the paucity of B cells in the
samples of the C1 cluster.
Thaunat et al - Page 10
The various B cell subsets infiltrating chronically rejected grafts were
quantified using the Bm1-Bm5 classification based on the expression of CD38
and IgD 19. This classification allows discriminating the successive
developmental stages from naïve B cells towards memory B cells. A stepwise
increase in the proportion of Bm5 memory B cells and a symmetric reduction
of Bm1/Bm2 naïve B cells was observed from C2 to C4 samples (Fig. 3B). In
the samples of the C4 cluster, in which the complete set of lymphoid
organogenesis genes was expressed, the B cell maturation program was
proceeding towards the memory stage without hurdles. In contrast, the B cell
maturation in the C3 cluster was blocked at the Bm2’+Bm3δ pre-germinal
stage since a marked reduction of Bm3+Bm4 germinal center B cells was
evidenced (Fig. 3B). In the C2 cluster, B cells did not mature since naïve B
cells accumulated while pre-germinal and germinal center B cell
subpopulations were not detected (Fig. 3B). However, Bm5 B cells were
evidenced in the C2 cluster suggesting that a direct recruitment of memory B
cells from the periphery is also possible.
The Bm1-Bm5 classification has recently been challenged by the
demonstration that some Bm1 cells express the CD27 memory marker 20
therefore indicating that the CD19pos IgDpos CD38neg population includes both
naïve Bm1 cells (CD27neg) and IgDpos memory B cells (CD27pos) 21. To
exclude the possibility that the amount of memory B cells was underestimated
when identified by their expression of IgD/CD38, we compared the proportion
of CD19pos CD27pos cells. We found a gradual increase of CD27pos B cells
from C2 to C4, further validating the results obtained with the Bm1-Bm5
classification (Fig. 3C).
Thaunat et al - Page 11
Finally, kidneys from the C2 cluster can be regarded as inflamed tissues in
which the maturation of naïve B cells is blocked, while the C4 cluster gathers
samples in which naïve B cells are efficiently converted into memory B cells.
We therefore conclude that the progression of B cells along the maturation
stages is influenced by the gene expression profile of inflamed tissue.
Clusters and the aggressiveness of the local immune response
During germinal center reaction, high affinity B cells are converted into
plasmacells secreting large amount of antibodies. In accordance with our
previous results, plasmacells defined as CD19pos CD38bright CD138pos were
detected only in the samples from the C3 and C4 clusters (Fig. 4A), i.e. the 2
clusters gathering the samples in which i) lymphoid organogenesis genes
were highly expressed (Fig. 2A), ii) eGC were detected histologically (Fig.
2E), and iii) the local maturation of B cells was the most efficient (Fig. 3B).
This suggested that the C4 cluster was grouping the samples in which the
local production of antibodies was the most efficient. To test this hypothesis,
the production of immunoglobulin was quantified in tissue culture conditioned
media. The amount of the various classes and subclasses of immunoglobulin
produced locally were measured by ELISA in the supernatants after 5 days of
tissue-culture. IgA and IgM were not detected (data not shown). In contrast, a
local production of IgG, increasing gradually from C1 to C4 samples, was
documented (Fig. 4B). No difference regarding IgG subclasses distribution
was found between the samples of the various clusters (Fig. 4C). A limitation
of the detection of IgG by ELISA performed on the tissue-culture supernatants
is the impossibility to discriminate between IgG that could potentially be
trapped in the tissue and subsequently released from IgG readily produced by
Thaunat et al - Page 12
infiltrated plasmacells. Indeed, a small amount of IgG was detected in the C1
cluster samples (Fig. 4B), in which plasmacells were not detected (Fig. 4A).
We therefore performed an enzyme-linked immunosorbent spot (ELISPOT)
assay on representative samples from the C3 and C4 clusters that
demonstrated the presence of IgG producing cells among the inflammatory
infiltrate (Fig. 4D). The increased number of spots observed upon mitogen
stimulation in the C4 as compared to the C3 cluster (Fig. 4D) indicated that
the number of memory B cells was higher in the C4 samples, which is in
accordance with the flow cytometry analysis (Fig. 3B, C). In order to further
characterize the humoral immune response, the specificities of antibodies
produced locally were tested with luminex® assays. As expected, there were
no alloantibodies in the supernatants of the tissues from the C1 cluster. In
contrast, a local production of anti-donor antibodies was detected in the
tissues of the 3 remaining clusters. Interestingly, a correlation between the
gene expression profile of the inflamed tissues and the aggressiveness of the
local humoral response was evidenced. Indeed, the density, diversity, and
intensity of the local humoral response against the target antigens increased
from C2 to C4. Additionally, a symmetric reduction of graft survival was
evidenced (Table 2). Grafts of the C2 cluster lasted 9.7 years in average
while those of the C4 cluster functioned half that time (4.6 years).
Local humoral response is uncoupled from the systemic response
The luminex assay performed on the sera collected at the time of the
explantation demonstrated a disconnection between systemic and local
humoral responses. Indeed, antibody specificities found in tissue-culture
supernatants were almost systematically distinct from those detected in the
Thaunat et al - Page 13
sera (Table 2). Also, the local response appeared more diverse, especially in
the C4 samples in which a local production of antibody directed against HLA-
antigens not expressed by the graft was evidenced.
Thaunat et al - Page 14
Discussion
In the present study, we performed a comprehensive analysis of the
molecular and cellular events taking place in chronically rejected grafts, a
clinical condition in which lymphoid neogenesis is invariably observed 8,9. We
show that, in human, chronic inflammation triggers a stepwise recapitulation
of the biological pathways identified in murine embryos 14. Whenever this
recapitulation was complete within inflamed tissues, it resulted in the
development of functional ectopic germinal centers supporting the maturation
of B cells up to memory B cells and plasmacells. This recapitulation was
incomplete in certain tissue samples and allowed us to identify at least three
checkpoints along the local maturation of B cells.
Among the molecules reported to play a role in lymphoid neogenesis 22-27, our
data point toward CXCL13, CCL21 and LTßR as tertiary lymphoid tissues
maturation molecular checkpoints. This is in line with the known functions of
these molecules. CXCL13 and CCL21 are chemokines involved in the
recruitment and subsequent segregation of B and T cells, respectively 28.
LTßR signaling induces the expression of these homeostatic chemokines in
stromal cells 29. The LTßR was identified as a late molecular checkpoint (C3
to C4 transition) indicating that its role is not restricted to the early stages of
the ontogeny of lymphoid organs but also extends to the maintenance of
lymphoid-tissue architecture as proposed by Browning 30. In addition, LTßR
has been shown to orchestrate lymphangiogenesis 31 that could fuel lymphoid
neogenesis by carrying the antigenic information to the neoformed ectopic
germinal centers 32.
Thaunat et al - Page 15
Experimental studies have demonstrated that during lymphoid organogenesis,
the very initial triggering of LTßR on stromal cells is carried out by lymphoid
tissue inducer cells (LTic) expressing RORC2 14,18. We therefore investigated
whether this prime step was also involved in the formation of ectopic
secondary lymphoid organs. Indeed, we did detect RORC2 transcripts whose
level of expression was strikingly correlated with the efficiency of lymphoid
neogenesis. However, cells displaying a LTic phenotype could not be
identified in our samples. This suggests that the role exerted by LTic during
lymphoid organogenesis is carried out by another cell population in chronic
inflammation. A recently identified T lymphocyte subpopulation
characteristically expresses RORC2 33, the Th17 cells. Of note, Th17
lymphocytes play a prevalent role in inflammatory diseases 34 and hence
could be the surrogate cells for LTic during chronic inflammation. This
hypothesis is substantiated by recent works in mice showing that mature
CD3pos CD4pos T cells can trigger the development of tertiary lymphoid tissues
in the absence of LTic 35, and that Th17 cells can promote B cell maturation
36.
We found that the specificities of circulating antibodies were different from
those of locally-produced antibodies. This implies that the two immune
responses target distinct antigens, and are highly compartimentalized.
Furthermore, the higher diversity of the local response that extends to HLA-
antigens not expressed by the graft points to a laxer selection process of B
cell clones. These observations provide interesting clues regarding the
reasons why evolution have kept in mammals the ancestral capacity to mount
a local immune response in the presence of secondary lymphoid organs, the
Thaunat et al - Page 16
canonic place for adaptive immune responses 37. Since lymphoid neogenesis
generates effectors close to their targets and displaying original specificities, it
may provide selective advantage to prevent dissemination of pathogens
resistant to “classical” responses. In the other hand, the higher
aggressiveness of the local response implies that it may be more difficult to
control by standard therapeutic strategies. In line with this hypothesis, we 38
and others 39 have recently shown that tertiary lymphoid tissue B cells could
survive anti-CD20 antibody (rituximab®) therapy when circulating B cells were
efficiently depleted. The identification of the molecular checkpoints critical for
the completion of the lymphoid neogenesis program therefore paves the way
for innovative therapeutic strategies to control chronic inflammation.
The present study was performed on explanted organs, i.e. on grafts that had
failed. This could explain the discrepancies between our results indicating a
detrimental role of lymphoid neogenesis during chronic inflammation and
biopsy-based studies that failed to reach a similar conclusion 40-42. Two
explanations can be proposed to reconcile these apparently conflicting
results. First, not only the data provided by the biopsies are limited to a small
area of tissue, but also this small amount of tissue is insufficient to perform
functional analysis of the ectopic lymphoid organs. In our own experience,
histological analysis (even on large area) had limited value to discriminate
samples from the C4 cluster from those of the C2 cluster (Fig. 2D, E). An
alternative though not exclusive hypothesis is that in some situations,
lymphoid neogenesis could generate a regulatory and protective immune
response as demonstrated in a murine model of experimental autoimmune
gastritis 43. If such a protective response is able to prevent terminal failure of
Thaunat et al - Page 17
grafts, samples with “tolerogenic” lymphoid neogenesis would be missing in
our study. Developing future therapeutic strategies targeting lymphoid
neogenesis to prevent chronic inflammation will therefore require to determine
whether it is desirable to block or to deviate the local immune response.
Thaunat et al - Page 18
Material and methods
Human samples
Twenty-six consecutive renal allografts removed because of terminal failure
have been collected in 4 transplantation centers over a period of 3 years.
Tissues were maintained in germ-free conditions at 4°C and were processed
<24 hours from explantation. The individual characteristics of these 26
patients are presented in Table 1.
The immunohistological analysis of the first 8 explanted kidneys revealed that
intragraft B cell nodules were phenotypically heterogeneous raising the
possibility that they may lead to lymphoid structures with distinct capacities to
produce antibodies. The following 18 explanted grafts were subjected to a
more comprehensive analysis, which could not be applied retrospectively to
DTR1 to DTR8.
Fresh normal renal tissue was obtained from the intact portion of six kidneys
removed for renal cancer.
Frozen lymphoid tissues were obtained from lymph nodes harvested during
coronary artery bypass procedure (n=4) and found normal after histological
examination.
All the patients gave informed consent for the utilization of the samples for
research purpose.
Thaunat et al - Page 19
Histopathology
Fresh explanted renal allografts or control kidneys were dissected and
embedded in paraffin or snap frozen immediately in Optimal Cutting
Temperature (OCT) medium (Tissue-Tek, Agar Scientific) in liquid nitrogen.
Ten micrometers-thick cryosections and 4µm-thick paraffin sections were
used. Routine examination was performed on Masson’s trichrome,
Hematoxylin-Eosine-Safran, Periodic Acid Shiff, and Silver stainings.
Indirect immunoperoxidase staining was performed with the following primary
antibodies: rabbit anti-human CD3ε (polyclonal, Abcam), mouse anti-human
CD20 (clone L26, Dako), mouse anti-human follicular dendritic cells (clone
CNA.42, Dako), goat anti-human CXCL13 (polyclonal, R&D Systems), goat
anti-human CCL21 (polyclonal; R&D Systems), rat anti-human PNAd, (clone
MECA 79, BD Pharmingen), rabbit anti-human podoplanin (polyclonal, Sigma-
Aldrich), mouse anti-human IgD (clone IA6-2, BD Pharmingen), rabbit anti-
AID (polyclonal, Kind gift from A. Durandy, Necker Paris), mouse anti-human
Bcl2 (clone 124, Dako), mouse anti-human Bcl6 (clone PG-B6p, Dako),
mouse anti-human LTßR (clone BCG6.AF5, BD Pharmingen), mouse anti-
human CD208/DC-LAMP (clone 104.G4, Beckman Coulter). The first primary
antibody was applied, followed by incubation with the appropriate biotinylated
secondary antibodies and with streptavidin peroxidase and 3,3-
diaminobenzidine-tetrachloride (ChemMate detection Kit Dako). Negative
staining control experiments were performed by omitting the primary antibody.
Slides were counterstained in hematoxylin (Dako).
Thaunat et al - Page 20
The number of primary follicle-like nodules and of ectopic germinal centers
was evaluated blindly by a trained pathologist (NP) at the x5 magnification on
10 sections (from 2 distinct paraffin-embedded blocks) using a semi
quantitative scale ranging from 0 (samples without follicle/eGC) up to 3
(samples with >5 follicles/eGC per field).
Molecular biology
mRNA extraction and RT
Total RNA was isolated from 2 distinct tissue fragments for the 26 explanted
grafts, 6 control kidneys and 4 lymph nodes using the RNeasy Mini Kit
(Qiagen). cDNAs were generated from 1 µg of total RNA using SuperScript II
reverse transcriptase (Invitrogen) and random decamers (ABgene).
Primer design
The gene-specific primer sets are provided in the Supplemental Table I.
Except for the RORC2 primer set (kindly provided by T. Cupedo, Rotterdam,
The Netherlands), all the primers were designed using Primer3 software and
obtained from Eurogentec.
Realtime Q-PCR
Real-time quantitative PCR was performed on an ABI Prism 7300 sequence
detection system (Applied Biosystems) in a total volume of 24 µl, containing 4
µl of cDNA sample, 8 µl of diluted primer set and 12 µl of SYBR Green Master
Mix (Qiagen). The thermal cycling was carried out by starting with 95°C for 10
min hold, followed by 50 amplification cycles of 95°C for 15 s, 60°C for 60 s.
Dissociation curve analysis was performed at the end of 50 cycles to verify
Thaunat et al - Page 21
the identity of the PCR product. No signals were detected in no-template
controls. Results are expressed as threshold cycle (Ct) values corresponding
to the cycle at which PCR enters the exponential phase and were normalized
to the Ct value obtained with the GAPDH house keeping gene amplification.
For each gene and each cDNA preparation, the PCR reactions were run 5
times and the results were averaged.
Cell biology
Cell suspension preparation
Fresh explanted grafts were cut with a sterile razor blade in ~0.125mm3
fragments which were incubated in a solution of 1 mg/ml collagenase A and
0.1 mg/ml DNAse I (Roche) for 1 hour at 37°C. Cell suspensions were passed
through a 70 µm cell strainer, and mononuclear cells were separated over
Ficoll-Paque Plus (Amersham).
Flow cytometry
Ten million cells were incubated with a cocktail of fluorescent monoclonal
antibodies (BD Biosciences) specific for the following human cell surface
markers: CD19 (AmCyan, clone SJ25C1), CD138 (APC, clone MI15), IgD
(FITC, clone IA6-2), CD38 (PE, clone HB7) from BD Pharmingen; CD27
(APC-Alexa Fluor 750, clone 0323) from eBioscience. More than 1.106 events
in the lymphoid FSC/SSC gate were acquired on an LSRII flow cytometer and
analyzed with the DIVA software (BD Biosciences).
Thaunat et al - Page 22
ELISPOT
The quantification of IgG-producing plasmacells was performed by ELISPOT
as previously described 44,45. Briefly, mononuclear cells isolated from kidneys
were plated in complete culture medium and cultured for 6 days at 37°C,
under an atmosphere containing 5% CO2. Cultured cells were serially diluted
in culture medium, in triplicate, before transfer to ELISPOT plates. Multiscreen
96-well filter plates (Millipore) were coated by incubation overnight at 4°C with
10 µg/mL anti-human Ig polyvalent antibody (Caltag Laboratories). After 6
hours of incubation at 37°C, ELISPOT was performed with 1 µg/mL
biotinylated goat anti–human IgG Fc (Caltag Laboratories) followed by 5
µg/mL HRP-conjugated avidin D (Vector Laboratories) and developed using
3-amino-9-ethylcarbazole (Sigma-Aldrich).
Quantification of memory B cells was conducted following the same protocol
except that the cells were stimulated with an optimized mix of polyclonal
mitogens: 10 ng/mL pokeweed mitogen extract (PWM, batch 1303H, ICN; MP
Biomedicals, Aurora, OH), a 1/10 000 dilution of fixed Staphylococcus aureus,
Cowan extract (SAC; Sigma-Aldrich), and 6 µg/mL fully phosphothioated CpG
(ODN-2006,15 Proligo; Sigma-Aldrich) during the 6-day culture preceding the
ELISPOT assay.
Analysis of the local immunoglobulin production
Tissue-culture
Tissue-cultures were performed as previously described 8. Briefly, 24
randomly selected fragments (~0.5 mm3) of explanted allografts were washed
3 times and cultured in 24-well plate in 1ml RPMI 1640 medium (Cambrex)
Thaunat et al - Page 23
supplemented with 100U/ml penicillin/streptomycin and 25µg/ml Fungizone
(Gibco). Culture supernatants were harvested after 5 days of culture and
stored at -20°C until further analysis.
ELISA
The concentration of IgG, IgA and IgM in the supernatants were measured
using standard ELISA. Human IgG subclasses were quantified using a
Human IgG Subclass Profile ELISA Kit (Zymed Laboratories). ELISA was
performed at least twice on two different tissue-culture wells.
Luminex
Luminex assays were used to detect the presence of anti-HLA alloantibodies
in the supernatants (LifeScreen®, Tepnel Lifecodes Corporation) and
subsequently to determine their specificity (LABScreen® single antigen HLA
class I and class II detection tests, One Lambda).
Thaunat et al - Page 24
Acknowledgments
We are indebted to the urologists the pathologists and the nephrologists from
Foch, Henri Mondor, Necker, and Pasteur Hospitals for their assistance
during the collection of the samples. We thank Sophie Lechaton for excellent
technical assistance, Anne Durandy for anti-AID antibodies and Tom Cupedo
for the primer sequences of human RORC2. This work was supported by
grants from the Institut National de la Santé et de la Recherche Médicale
(OT), the Fondation pour la Recherche Médicale (OT), the Fondation du Rein
(OT), and the Fondation de France (AN).
Thaunat et al - Page 25
Bibliographic references
1. Rosenberg, H.F. & Gallin, J.I. Inflammation. in Fundamental
Immunology, Vol. VII. Effector Mechanisms of Immunity (ed. Paul, W.E.)
(Lippincott Williams & Wilkins, 2003).
2. Prineas, J.W. Multiple sclerosis: presence of lymphatic capillaries and
lymphoid tissue in the brain and spinal cord. Science 203, 1123-1125 (1979).
3. Kratz, A., Campos-Neto, A., Hanson, M.S. & Ruddle, N.H. Chronic
inflammation caused by lymphotoxin is lymphoid neogenesis. J Exp Med 183,
1461-1472 (1996).
4. Drayton, D.L., Liao, S., Mounzer, R.H. & Ruddle, N.H. Lymphoid organ
development: from ontogeny to neogenesis. Nat Immunol 7, 344-353 (2006).
5. Aloisi, F. & Pujol-Borrell, R. Lymphoid neogenesis in chronic
inflammatory diseases. Nat Rev Immunol 6, 205-217 (2006).
6. Pascual, M., Theruvath, T., Kawai, T., Tolkoff-Rubin, N. & Cosimi, A.B.
Strategies to improve long-term outcomes after renal transplantation. N Engl J
Med 346, 580-590 (2002).
7. Baddoura, F.K., et al. Lymphoid neogenesis in murine cardiac
allografts undergoing chronic rejection. Am J Transplant 5, 510-516 (2005).
8. Thaunat, O., et al. Lymphoid neogenesis in chronic rejection: evidence
for a local humoral alloimmune response. Proc Natl Acad Sci U S A 102,
14723-14728 (2005).
Thaunat et al - Page 26
9. Thaunat, O., Patey, N., Morelon, E., Michel, J.B. & Nicoletti, A.
Lymphoid neogenesis in chronic rejection: the murderer is in the house. Curr
Opin Immunol 18, 576-579 (2006).
10. Wagner, U.G., et al. The role of CD8+ CD40L+ T cells in the formation
of germinal centers in rheumatoid synovitis. J Immunol 161, 6390-6397
(1998).
11. Ansel, K.M., et al. A chemokine-driven positive feedback loop
organizes lymphoid follicles. Nature 406, 309-314 (2000).
12. Cyster, J.G. Lymphoid organ development and cell migration. Immunol
Rev 195, 5-14 (2003).
13. Futterer, A., Mink, K., Luz, A., Kosco-Vilbois, M.H. & Pfeffer, K. The
lymphotoxin beta receptor controls organogenesis and affinity maturation in
peripheral lymphoid tissues. Immunity 9, 59-70 (1998).
14. Mebius, R.E. Organogenesis of lymphoid tissues. Nat Rev Immunol 3,
292-303 (2003).
15. Rennert, P.D., Browning, J.L., Mebius, R., Mackay, F. & Hochman,
P.S. Surface lymphotoxin alpha/beta complex is required for the development
of peripheral lymphoid organs. J Exp Med 184, 1999-2006 (1996).
16. Rennert, P.D., James, D., Mackay, F., Browning, J.L. & Hochman, P.S.
Lymph node genesis is induced by signaling through the lymphotoxin beta
receptor. Immunity 9, 71-79 (1998).
17. De Togni, P., et al. Abnormal development of peripheral lymphoid
organs in mice deficient in lymphotoxin. Science 264, 703-707 (1994).
Thaunat et al - Page 27
18. Eberl, G., et al. An essential function for the nuclear receptor
RORgamma(t) in the generation of fetal lymphoid tissue inducer cells. Nat
Immunol 5, 64-73 (2004).
19. Pascual, V., et al. Analysis of somatic mutation in five B cell subsets of
human tonsil. J Exp Med 180, 329-339 (1994).
20. Agematsu, K., Hokibara, S., Nagumo, H. & Komiyama, A. CD27: a
memory B-cell marker. Immunol Today 21, 204-206 (2000).
21. Bohnhorst, J.O., Bjorgan, M.B., Thoen, J.E., Natvig, J.B. & Thompson,
K.M. Bm1-Bm5 classification of peripheral blood B cells reveals circulating
germinal center founder cells in healthy individuals and disturbance in the B
cell subpopulations in patients with primary Sjogren's syndrome. J Immunol
167, 3610-3618 (2001).
22. Carlsen, H.S., Baekkevold, E.S., Morton, H.C., Haraldsen, G. &
Brandtzaeg, P. Monocyte-like and mature macrophages produce CXCL13 (B
cell-attracting chemokine 1) in inflammatory lesions with lymphoid
neogenesis. Blood 104, 3021-3027 (2004).
23. Corcione, A., et al. Recapitulation of B cell differentiation in the central
nervous system of patients with multiple sclerosis. Proc Natl Acad Sci U S A
101, 11064-11069 (2004).
24. Manzo, A., et al. Systematic microanatomical analysis of CXCL13 and
CCL21 in situ production and progressive lymphoid organization in
rheumatoid synovitis. Eur J Immunol 35, 1347-1359 (2005).
25. Salomonsson, S., et al. Expression of the B cell-attracting chemokine
CXCL13 in the target organ and autoantibody production in ectopic lymphoid
Thaunat et al - Page 28
tissue in the chronic inflammatory disease Sjogren's syndrome. Scand J
Immunol 55, 336-342 (2002).
26. Takemura, S., et al. Lymphoid neogenesis in rheumatoid synovitis. J
Immunol 167, 1072-1080 (2001).
27. Hjelmstrom, P., et al. Lymphoid tissue homing chemokines are
expressed in chronic inflammation. Am J Pathol 156, 1133-1138 (2000).
28. Cyster, J.G. Chemokines and cell migration in secondary lymphoid
organs. Science 286, 2098-2102 (1999).
29. Dejardin, E., et al. The lymphotoxin-beta receptor induces different
patterns of gene expression via two NF-kappaB pathways. Immunity 17, 525-
535 (2002).
30. Browning, J.L., et al. Lymphotoxin-beta receptor signaling is required
for the homeostatic control of HEV differentiation and function. Immunity 23,
539-550 (2005).
31. Furtado, G.C., et al. Lymphotoxin beta receptor signaling is required for
inflammatory lymphangiogenesis in the thyroid. Proc Natl Acad Sci U S A 104,
5026-5031 (2007).
32. Thaunat, O., Kerjaschki, D. & Nicoletti, A. Is defective lymphatic
drainage a trigger for lymphoid neogenesis? Trends Immunol 27, 441-445
(2006).
33. Ivanov, II, et al. The orphan nuclear receptor RORgammat directs the
differentiation program of proinflammatory IL-17+ T helper cells. Cell 126,
1121-1133 (2006).
Thaunat et al - Page 29
34. Korn, T., Oukka, M., Kuchroo, V. & Bettelli, E. Th17 cells: effector T
cells with inflammatory properties. Semin Immunol 19, 362-371 (2007).
35. Marinkovic, T., et al. Interaction of mature CD3+CD4+ T cells with
dendritic cells triggers the development of tertiary lymphoid structures in the
thyroid. J Clin Invest 116, 2622-2632 (2006).
36. Hsu, H.C., et al. Interleukin 17-producing T helper cells and interleukin
17 orchestrate autoreactive germinal center development in autoimmune
BXD2 mice. Nat Immunol 9, 166-175 (2008).
37. Klein, J. Immunology. The science of self-nonself discrimination, (John
Wiley & Sons, New York, 1982).
38. Thaunat, O., et al. B cell survival in intragraft tertiary lymphoid organs
after rituximab therapy. Transplantation 85, 1648-1653 (2008).
39. Kavanaugh, A., et al. Assessment of rituximab's immunomodulatory
synovial effects (ARISE trial). 1: clinical and synovial biomarker results. Ann
Rheum Dis 67, 402-408 (2008).
40. Cantaert, T., et al. B lymphocyte autoimmunity in rheumatoid synovitis
is independent of ectopic lymphoid neogenesis. J Immunol 181, 785-794
(2008).
41. Motallebzadeh, R., Bolton, E.M. & Pettigrew, G.J. Lymphoid tissue
formation in allografts: innocent until proven guilty. Transplantation 85, 309-
311 (2008).
42. Thurlings, R.M., et al. Synovial lymphoid neogenesis does not define a
specific clinical rheumatoid arthritis phenotype. Arthritis Rheum 58, 1582-1589
(2008).
Thaunat et al - Page 30
43. Katakai, T., et al. Spontaneous large-scale lymphoid neogenesis and
balanced autoimmunity versus tolerance in the stomach of H+/K+-ATPase-
reactive TCR transgenic mouse. J Immunol 177, 7858-7867 (2006).
44. Crotty, S., Aubert, R.D., Glidewell, J. & Ahmed, R. Tracking human
antigen-specific memory B cells: a sensitive and generalized ELISPOT
system. J Immunol Methods 286, 111-122 (2004).
45. Mamani-Matsuda, M., et al. The human spleen is a major reservoir for
long-lived vaccinia virus-specific memory B cells. Blood 111, 4653-4659
(2008).
Thaunat et al - Page 31
Legend to Figures Figure 1: Persistent immune activation triggers the development of
heterogeneous nodular B cell structures in inflamed tissues
A: Systematic histological analysis was carried out on sections of kidney
grafts explanted for terminal failure. Representative findings characterizing
chronically rejected grafts are shown. The hematoxylin eosine staining (HES)
showed the nodular organisation of the inflammatory infiltrate. The PNAd and
podoplanin stainings revealed the high endothelial venule and lymphatic
networks, respectively, surrounding the nodules. The spatial organization of
cell populations was analyzed by immunohistochemistry with antibodies
directed to CD3 (T cells), DC-LAMP (mature dendritic cells), and follicular
dendritic cells (FDC).
B: Nodules were composed by a core of CD20pos cells. Most of the nodules
were composed of an homogenous B cell population expressing IgD and Bcl-
2 but no Bcl-6 (left column, thereafter referred to as primary follicle-like
nodules). In certain nodules (thereafter referred as to ectopic germinal
centers), this B cell population was pushed away in the periphery by CD20pos
IgDneg Bcl-2neg cells expressing Bcl-6 (right column) now occupying the center
of the nodule. a: the same arteriole on the successive serial sections.
C: The number of primary follicle-like nodules, evaluated blindly by a
pathologist (NP) using a semi-quantitative scale ranging from 0 that stands for
samples without follicle/eGC up to 3 that stands for samples with >5
follicles/eGC per field at the x5 magnification). Given that for each kidney, 10
sections from two paraffin embedded blocks were analyzed and given that the
Thaunat et al - Page 32
process is heterogeneous, the semi-quantitative score assigned was
sometimes a decimal number.
D: The number of ectopic germinal centers (see above) was plotted against
the time during which the tissue was exposed to the immune response, ie,
from the day of transplantation to the day of explantation.
Figure 2: Lymphoid neogenesis is a stepwise recapitulation of lymphoid
organogenesis
A: For each kidney, mRNA was extracted from 2 distinct tissue fragments and
reverse transcribed. For each gene involved in lymphoid organogenesis,
realtime Q-PCR was run 5 times on each cDNA preparation. Expression level
of these genes was normalized over that of the GAPDH housekeeping gene.
For each gene, the ten values obtained for a single kidney were averaged and
the set of data was computed to clusterize tissues according to their pattern of
expression (Ward hierarchical clustering). Individual samples are listed in
raws, genes in column, and increasing expression levels are encoded from
dark blue to bright red. On the top and on the right of the color map,
dendrograms list each observation, and shows which cluster it is in and when
it entered its cluster. Four clusters C1 to C4 were identified.
B: The principal component analysis (PCA) was used to reduce the
multidimensional gene expression data set to lower dimensions for analysis
by retaining those characteristics of the data set that contributed most to its
variance. The projection of the data on the first and second principal
components (Canonical 1 and 2) efficiently discriminated the 4 clusters when
Thaunat et al - Page 33
individual samples were projected orthogonally. Circles represent multivariate
mean for each cluster and the size of the circle corresponds to a 95%
confidence limit. Non-intersecting circles indicate that clusters are significantly
different.
The composition of the eigenvectors, indicated in the Table below the graph,
revealed that the chemokines CCL21 and CXCL13, and the lymphotoxin β
receptor were the genes with the largest eigenvalues, i.e. the genes that
contributed the most to distribute the samples to the 4 clusters.
C: Immunohistochemistry demonstrates that CXCL13, CCL21 and LTßR were
readily expressed at the protein level at the site of lymphoid organization.
D, E: Histological quantifications (obtained as described in the Figure 1) of
primary follicle-like nodules (D) and of ectopic germinal centers (E) were
analyzed using the gene expression-defined clusters. Of note, in addition to
the 26 explanted kidney grafts, data from 6 normal kidneys (included in the
cluster C1) have been collected (Mean ± Standard Deviation).
F: AID protein expression analysis was performed by immunohistochemistry.
This staining, performed on the successive serial sections used for the
immunohistological study presented in Figure 1B (a: the same arteriole as in
the sections of Figure 1B), shows that AID expression is restricted to the
germinal center B cell population (CD20pos IgDneg Bcl2neg Bcl6pos). AID was
not expressed by the CD20pos IgDpos Bcl2pos Bcl6neg B cells either in the
periphery of ectopic germinal center or in primary follicle-like nodules.
Thaunat et al - Page 34
G: The expression level of AID was analyzed by realtime Q-PCR with the
same methods described in the Figure 2A legend (Mean ± Standard
Deviation).
H: The expression levels of RORC2 and AID were analyzed by realtime Q-
PCR with the same methods described in the Figure 2A legend. The least
square regression was computed with the averaged values obtained for each
cluster. LN represents the averaged expression values for RORC2 and AID
obtained from 4 normal lymph nodes (Mean ± Standard Deviation). The
formula of the linear regression is provided as well as R2, the coefficient of
determination and the p value of the regression.
Figure 3: Incomplete genetic program results in local B cell maturation
blockade
Tissue samples were processed to isolate the inflammatory infiltrate which
was then analyzed by polychromatic flow cytometry.
A: The percentage of CD19pos B cells among lymphocytes (identified on the
FSC/SSC morphology gating) is provided for each cluster. Note that the
inflammatory infiltrate in the samples from the C1 cluster was minimal and B
cells were barely detectable (Mean ± Standard deviation).
B: B cell maturation stages were identified on the basis of the IgD/CD38
staining of CD19pos cells in the C2 (left), C3 (middle), and C4 (right) clusters
(dot plots from three representative samples). The Bm1 and Bm2 naïve cells
are IgDpos CD38neg and IgDpos CD38dim, respectively; The Bm2’+BM3δ pre-
germinal center B cells are IgDpos CD38bright; the Bm3+Bm4 germinal center B
Thaunat et al - Page 35
cells are IgDneg CD38bright; The early and late Bm5 are respectively IgDneg
CD38dim and IgDneg CD38neg. The gating that was used excluded the
CD38ultrabright from the present analysis. The bubble graphs below the dot plots
represents the average percentage of each type of B cells (Mean ± Standard
deviation).
C: The percentage of CD27pos cells among CD19pos cells was used to quantify
the amount of memory B cells.
nd: not determined in the C1 cluster because the paucity of the infiltrate in the
samples from this cluster made the assessment of memory B cells unreliable.
Figure 4: Complete genetic program leads to the development of fully
functional ectopic germinal centers
A: The percentage of CD38bright CD138pos plasmacells among CD19pos
analyzed by flow cytometry is represented.
B, C: For each explanted kidney, tissue-cultures of 24 tissue fragments were
conducted in 24-well plates in 1 ml of serum-free RPMI. Supernatants were
collected after 5 days. The content of total IgG was measured in 2 randomly
selected supernatants by ELISA in duplicate (A) (Mean ± Standard deviation).
The subclasses of IgG were quantified in duplicate in the same supernatants
by ELISA (B). The values are expressed as the percentage of the total
amount of IgG.
D: Quantification of IgG-producing cells (plasmacells and stimulated memory
B cells) was carried out by an ELISPOT assay on 2 randomly selected
samples from the C3 and C4 clusters. Given that CD19pos CD38bright CD138pos
Thaunat et al - Page 36
cells were not detected by flow cytometry in the samples from the C1 and C2
clusters, ELISPOT assays were not run on cells from these samples.
Representative findings are shown. Cells extracted from explanted kidneys
were cultured during 6 days in complete medium containing or not a B cell
mitogen mix (PWM, SAC, CpG). Cells were plated 6 hours in cascade ¼
dilutions in multiscreen 96-well filter plates coated with anti-human IgG
antibodies. Spots were revealed with biotinylated goat anti-human IgG Fc,
HRP-conjugated Avidin D, and 3-amino-9-ethylcarbazole. Unstimulated wells
allows evaluating plasmacells while mitogen-treated ones that of memory B
cells.
Thaunat et al - Page 37
Figures
Fig 1
Thaunat et al - Page 38
Fig 2
Thaunat et al - Page 39
Fig 3
Thaunat et al - Page 40
Fig 4
Th
au
na
t et a
l - Pa
ge
41
Ta
ble
1: C
linic
al c
ha
racte
ristic
s o
f the
stu
dy
po
pu
latio
n
Ch
ara
cte
ristic
s o
f the
d
on
or
Ch
ara
cte
ristic
s o
f th
e re
cip
ien
t T
ran
sp
lan
tatio
n
A
ge
(Y
r)/ G
en
de
r
(C)a
da
ve
ric
or (L
)ivin
g
do
no
r
Ag
e
(Yr)/G
en
de
r/E
thn
icity
Ca
use
of
ES
RF
Tim
e o
n
dia
lysis
(D
ays)
Ra
nk
of T
r IS
reg
ime
n
# o
f A
R
Ca
use
of g
raft fa
ilure
T
ime
to
exp
lan
tatio
n
(Da
ys)
Clu
ste
r
DT
R1
5
5/F
L
2
6/F
/Ara
b
Un
kn
ow
n
91
5
1
CS
,Aza
,Csa
1
C
hro
nic
reje
ctio
n
12
81
C
3
DT
R2
7
4/M
C
6
6/M
/Afr
FS
GS
4
88
1
A
nti-IL
2R
, CS
, MM
F, C
sa
0
R
ec F
SG
S
10
98
C
1
DT
R3
4
3/M
C
1
5/F
/Ca
uc
Lu
pu
s
19
83
2
A
TG
, CS
, MM
F, F
K5
06
1
C
hro
nic
reje
ctio
n
16
77
C
3
DT
R4
3
5/F
C
4
3/F
/Ca
uc
EC
GN
5
03
3
2
AT
G, C
S, C
sa
0
C
hro
nic
reje
ctio
n
47
28
C
3
DT
R5
6
0/M
C
5
7/F
/Ca
uc
AD
PK
D
11
59
1
A
TG
, CS
, MM
F, F
K5
06
2
C
hro
nic
reje
ctio
n
25
62
C
2
DT
R6
4
9/M
C
2
8/F
/Ca
uc
Lu
pu
s
35
69
1
A
nti-IL
2R
, CS
, MM
F, F
K5
06
3
C
hro
nic
reje
ctio
n
20
44
C
2
DT
R7
6
8/F
C
6
1/M
/Afr
NA
S
73
2
1
CS
, MM
F, S
iro
1
Ch
ron
ic re
jectio
n
19
52
C
4
DT
R8
7
9/F
C
4
6/M
/Ca
uc
MG
N
12
51
1
A
nti-IL
2R
, CS
, MM
F, C
sa
2
C
hro
nic
reje
ctio
n
73
2
C2
DT
R9
3
5/M
C
2
4/M
/Ca
uc
Uro
pa
thy
13
11
2
O
KT
3, C
S, A
za
, Csa
0
C
hro
nic
reje
ctio
n
19
59
C
4
DT
R1
0
62
/M
C
56
/M/C
au
c
NA
S
11
59
1
C
S, M
MF
, FK
50
6
0
An
gio
sa
rco
ma
1
83
C
1
DT
R1
1
38
/M
L
39
/M/C
au
c
HS
P
42
40
2
A
nti-IL
2R
, CS
, MM
F, F
K5
06
0
A
rteria
l thro
mb
osis
1
0
C1
DT
R1
2
57
/F
C
41
/M/C
au
c
Un
kn
ow
n
36
60
1
A
TG
, CS
, MM
F, F
K5
06
0
A
rteria
l thro
mb
osis
6
C
1
DT
R1
3
18
/M
C
40
/F/C
au
c
Alp
ort S
d
15
86
1
C
S, M
MF
, FK
50
6
0
Ch
ron
ic re
jectio
n
16
47
C
3
DT
R1
4
17
/M
C
40
/F/A
fr F
SG
S
21
35
1
A
TG
, CS
, Aza
, FK
50
6
0
Ch
ron
ic re
jectio
n
37
21
C
2
DT
R1
5
46
/F
C
22
/M/C
au
c
Uro
pa
thy
57
9
1
An
ti-CD
7, C
S, A
za
, Csa
1
C
hro
nic
reje
ctio
n
59
17
C
2
DT
R1
6
59
/M
C
24
/M/A
fr T
MA
7
02
1
A
nti-IL
2R
, CS
, MM
F, C
sa
0
R
ec T
MA
6
71
C
1
DT
R1
7
55
/M
C
27
/F/C
au
c
Uro
pa
thy
42
2
1
CS
, MM
F, F
K5
06
1
C
hro
nic
reje
ctio
n
26
44
C
2
DT
R1
8
16
/F
C
7/M
/Ara
b
HU
S
11
83
2
C
S, A
za
, Csa
1
C
hro
nic
reje
ctio
n
61
47
C
3
DT
R1
9
41
/F
C
36
/M/C
au
c
Be
rge
r 1
22
1
A
nti-IL
2R
, CS
, MM
F, C
sa
1
C
hro
nic
reje
ctio
n
21
4
C3
DT
R2
0
81
/M
C
71
/F/C
au
c
Un
kn
ow
n
36
6
1
An
ti-IL2
R, C
S, M
MF
, Csa
0
V
en
ou
s th
rom
bo
sis
1
C
1
DT
R2
1
52
/M
L
27
/M/C
au
c
Co
rt Ne
c
13
42
2
A
nti-IL
2R
, CS
, MM
F, F
K5
06
6
C
hro
nic
reje
ctio
n
15
86
C
3
DT
R2
2
59
/F
C
55
/M/C
au
c
NA
S
24
4
1
CS
, Eve
ro, C
sa
1
C
hro
nic
reje
ctio
n
51
9
C3
DT
R2
3
57
/F
C
25
/F/C
au
c
Uro
pa
thy
76
5
1
An
ti-IL2
R, C
S, M
MF
, FK
50
6
1
Ch
ron
ic re
jectio
n
23
72
C
4
DT
R2
4
49
/M
L
18
/M/A
rab
U
rop
ath
y
10
65
2
C
S, A
za
, Csa
2
C
hro
nic
reje
ctio
n
32
25
C
4
DT
R2
5
54
/F
C
27
/M/A
rab
H
US
1
46
7
2
AT
G, C
S, M
MF
, FK
50
6
0
Ch
ron
ic re
jectio
n
27
32
C
3
DT
R2
6
61
/M
C
35
/M/C
au
c
AD
PK
D
74
3
1
An
ti-IL2
R, C
S, M
MF
, FK
50
6
1
Ch
ron
ic re
jectio
n
18
2
C3
Th
au
na
t et a
l - Pa
ge
42
Ab
bre
via
tion
s a
re : Y
r: ye
ars
; ES
RF
: En
d-s
tag
e re
na
l failu
re; R
an
k o
f Tr: R
an
k o
f tran
sp
lan
tatio
n; IS
reg
ime
n: Im
mu
no
su
pp
ressiv
e
trea
tmen
t; # o
f AR
: Nu
mb
er o
f bio
psy-p
rove
n e
pis
od
e o
f acu
te re
jectio
n; F
: Fe
ma
le; M
: Ma
le; A
rab
: Ara
bic
; Afr: A
frica
n; C
au
c:
Ca
uca
sia
n; R
ec: R
ecu
rren
ce
; FS
GS
: Fo
ca
l seg
me
nta
l glo
me
rulo
scle
rosis
; EC
GN
: Extra
ca
pilla
ry g
lom
eru
lon
eph
ritis; A
DP
KD
:
Au
toso
ma
l dom
ina
nt p
oly
cystic
kid
ne
y d
ise
ase
; NA
S: N
ep
hro
an
gio
scle
rosis
; MG
N: M
em
bra
no
us g
lom
eru
lopa
thy; H
SP
: He
nlo
ch
Sch
on
lein
pu
rpu
ra; A
lport S
d: A
lpo
rt Syn
dro
me
; TM
A: T
hro
mb
otic
mic
roa
ng
iop
ath
y; H
US
: He
mo
lytic
an
d u
rem
ic s
yn
dro
me
; Cort
Ne
c: C
ortic
al n
ecro
sis
. CS
: Co
rtico
ste
roid
; Csa
: Cyclo
sp
orin
e A
; Aza
: Aza
thio
prin
e; M
MF
: myco
ph
en
ola
te m
ofe
til; FK
50
6:
Ta
cro
limu
s; A
TG
: An
ti-thym
ocyte
glo
bu
lin; S
iro: S
irolim
us; E
ve
ro: E
ve
rolim
us; A
nti-IL
2R
: Anti-in
terle
ukin
2 re
ce
pto
r; OK
T3
: An
ti-
!CD
3 a
ntib
od
ies.
Th
au
na
t et a
l - Pa
ge
43
Ta
ble
2: D
en
sity
, div
ers
ity, a
nd
inte
ns
ity o
f the
loc
al h
um
ora
l allo
imm
un
e re
sp
on
se
De
ns
ity o
f the
loc
al im
mu
ne
re
sp
on
se
D
ive
rsity
of th
e im
mu
ne
res
po
ns
e
Inte
ns
ity o
f the
loc
al
imm
un
e re
sp
on
se
A
B D
R m
ism
atc
he
s
An
ti- H
LA
I A
nti-
HL
A II
To
tal
Lo
ca
l (N
b s
pe
cific
ities
/Nb
m
ism
atc
he
s)
Se
rum
(N
b s
pe
cific
ities
/Nb
m
ism
atc
he
s)
MF
I ma
x / M
FI p
os
itive
c
on
trol
Gra
ft fun
ctio
n
time
(da
ys
to
failu
re)
DT
R1
0
A2
9 B
13
B7
2 D
R1
3 D
R1
6
0/2
3
0/2
3
0%
- (0
) - (0
)
12
1
DT
R1
1
No
mis
ma
tch
0
/24
0
/24
0
%
- (0)
- (0)
0
DT
R1
2
B5
1 D
R8
DR
13
0
/23
0
/23
0
%
- (0)
DR
11
DQ
2 (0
.5)
0
DT
R1
6
A2
5 B
65
DR
1
0/2
3
0/2
3
0%
- (0
) A
25
(0.3
)
14
0
DT
R2
0
A3
1 B
7 B
37
DR
11
0
/24
0
/24
0
%
- (0)
- (0)
1
C1
0±
0%
(0
) (0
.2±
0.2
) -
18
0±7
2
DT
R1
4
A2
6 B
7 B
53
DR
1 D
R1
0
7/2
2
0/2
2
31
.8%
A
26
A3
A1
1 B
59
B6
7 (1
) B
53
DR
10
3 (0
.4)
0.6
3
26
6
DT
R1
5
A2
DR
6 D
R7
8
/23
1
0/2
3
43
,5%
A
2 D
R7
A6
8 (1
) A
2 (0
.3)
0.8
5
13
6
DT
R1
7
B2
7 D
R8
DR
14
0
/23
8
/23
3
7.8
%
DR
8 D
Q2
DQ
3 D
Q4
(1.3
) - (0
) 0
.5
22
26
C2
37
.7±
5.9
%
(1.1±
0.2
) (0
.2±
0.2
) 0
.6±
0.2
3
54
2±1
47
4
DT
R1
3
A1
A3
3 B
51
B3
5 D
R1
3
0/1
1
0/1
1
0%
- (0
) - (0
)
12
85
DT
R1
8
B7
B3
2
0/2
3
23
/23
1
00
%
DR
3 D
R7
(1)
DR
3 D
R5
DR
6 D
R8
(2)
0.7
6
02
5
DT
R1
9
A2
B5
1 B
62
DR
3 D
R4
0
/23
0
/23
0
%
- (0)
- (0)
1
57
DT
R2
1
A3
1 B
51
2
0/2
3
15
/23
8
7%
A
25
, 26
, 34
, 66
DR
13
(2.5
) D
R8
DR
10
3 (1
) 0
.7
12
35
DT
R2
2
A3
A2
6 B
52
DR
15
0
/22
0
/22
0
%
- (0)
- (0)
5
06
DT
R2
5
A2
6 B
35
B3
8 D
R1
1
2/1
2
0/1
2
10
0%
B
35
DR
1 (0
.5)
- (0)
0.5
8
10
DT
R2
6
B5
1
12
/12
0
/12
1
00
%
B5
1 (1
) - (0
) 0
.8
16
89
C3
55
.3±
51
.9%
(0
.7±
0.9
) (0
.4±
0.8
) 0
.7±
0.1
1
67
2±1
98
7
DT
R9
A
2 D
R7
2
9/3
2
0/3
2
90
.6%
A
2 A
26
A2
9 A
32
A6
8 A
69
(3)
A2
A2
9 A
32
A3
3 A
68
A6
9 (3
) 1
.1
17
16
DT
R2
3
A3
A2
6 B
51
DR
13
DR
4
23
/23
2
3/2
3
10
0%
3
2 s
pe
cific
ities (6
.4)
15
sp
ecific
ities (3
) 2
0.7
1
09
1
DT
R2
4
B1
7 B
44
DR
4
23
/23
2
3/2
3
10
0%
5
8 s
pe
cific
ities (1
9.3
) A
25
(0.3
) 1
.2
10
77
C4
96
.9±
5.4
%
(9.6±
8.6
) (2
.1±
1.5
) 7
.7±
0.3
1
29
5±3
65
Th
au
na
t et a
l - Pa
ge
44
Pre
limin
ary
data
ob
tain
ed
from
DT
R1
to D
TR
8 s
ho
we
d th
at in
trag
raft B
ce
ll no
du
les w
ere
ph
en
oty
pic
ally
hete
roge
ne
ou
s ra
isin
g th
e
po
ssib
ility th
at th
ey m
ay le
ad
to ly
mp
ho
id s
tructu
res w
ith d
istin
ct c
ap
acitie
s to
pro
du
ce
an
tibo
die
s. C
on
se
qu
en
tly, 2
4 fra
gm
en
ts
(ran
dom
ly s
ele
cte
d) o
f the
follo
win
g e
xp
lan
ted k
idn
eys w
ere
tissu
e-c
ultu
red
. Sin
ce
this
part o
f the
stu
dy w
as in
itiate
d a
fter D
TR
8,
the
da
ta c
on
ce
rnin
g D
TR
1 to
DT
R8 a
re m
issin
g. A
nti-c
lass I a
nd
an
ti-cla
ss II H
LA
an
tibo
die
s w
ere
se
ek in
the
sup
ern
ata
nts
of
tissu
e-c
ultu
res a
nd in
the
se
ra o
bta
ine
d im
med
iate
ly b
efo
re th
e d
etra
nsp
lan
tatio
n b
y th
e lu
min
ex d
ete
ctio
n k
it. We
de
fine
d th
e
de
nsity
of th
e lo
ca
l hum
ora
l allo
imm
un
e re
sp
on
se
as th
e p
erc
en
tag
e o
f we
lls p
ositiv
e fo
r eith
er H
LA
I or H
LA
II. We
su
bse
qu
en
tly
me
asu
red
the
div
ers
ity a
nd
the
inte
nsity
of th
e lo
ca
l hu
mora
l imm
un
e re
sp
on
se u
sin
g th
e lu
min
ex s
ing
le a
ntig
en
kit o
n th
e
su
pe
rna
tan
t from
the
we
ll dis
pla
yin
g th
e h
igh
est m
ea
n flu
ore
scen
t inte
nsity
(MF
I) in th
e lu
min
ex d
ete
ctio
n k
it. Th
e d
ivers
ity o
f the
pe
riph
era
l hum
ora
l resp
on
se
wa
s m
ea
su
red
with
the
sa
me
lum
ine
x k
it on
the
se
ra o
bta
ined
imm
ed
iate
ly b
efo
re th
e
de
tran
sp
lan
tatio
n. D
on
or s
pe
cific
antib
od
ies (d
irecte
d a
ga
inst H
LA
mo
lecu
les e
xpre
sse
d b
y th
e g
raft) a
nd
no
n-d
ono
r sp
ecific
an
tibo
die
s w
ere
de
tecte
d (d
irecte
d a
ga
inst H
LA
mo
lecu
les n
ot e
xp
resse
d b
y th
e g
raft). T
he
imm
un
olo
gic
al s
ub
stra
tum
exp
lain
ing
wh
y th
e im
mu
ne
syste
m o
f the
recip
ien
t wo
uld
de
ve
lop
antib
od
ies d
irecte
d a
ga
inst H
LA
-an
tige
ns n
ot e
xp
ressed
by th
e ta
rge
ted
gra
ft rem
ain
s e
lusiv
e. T
he
div
ers
ity o
f the
imm
un
e re
spo
nse
wa
s c
alc
ula
ted
as th
e n
um
ber o
f de
tecte
d s
pe
cific
ities n
orm
aliz
ed
by
the
nu
mb
er o
f HL
A m
ism
atc
he
s fo
r the
do
no
r/recip
ien
t pa
ir. Th
e in
ten
sity
of th
e lo
ca
l hum
ora
l imm
un
e re
sp
on
se
wa
s s
et a
s th
e
ma
xim
al M
FI o
bse
rve
d n
orm
aliz
ed
by th
e M
FI o
f the
po
sitiv
e c
on
trol. T
he
dire
ct c
om
pa
riso
n o
f the
den
sity
an
d th
e in
ten
sity
of th
e
loca
l an
d s
eric
hu
mora
l resp
on
se
s is
no
t ach
ieva
ble
. Th
e g
raft fu
nctio
n tim
e is
the
nu
mb
er o
f da
ys b
etw
ee
n tra
nsp
lan
tatio
n a
nd
retu
rn to
dia
lysis
.
Thaunat et al - Page 45
Supplemental data
Table I: List of primers
Gene Sequences Amplicon length (bp)
AID 5’-CGTAGTGAAGAGGCGTGACA-3’ 5’-TCAGACTGAGGTTGGGGTTC-3’ 227
RORC2 5’-GCTAGGTGCAGAGCTTCAGG-3’ 5’-GACGACTTGTCCCCACAGAT-3’ 189
LTα 5’-CACCGGAGCTTTCAAAGAAG-3’ 5’-TGCTCTTCCTCTGTGTGTGG-3’ 175
LTΒ 5’-TACGGGCCTCTCTGGTACAC-3’ 5’-ATATTCCCTCACCCCACCAT-3’ 155
LTΒR 5’-ACCAGGTGTGAGAACCAAGG-3’ 5’-GAGCAGAAAGAAGGCCAGTG-3’ 153
CXCL12 5’-TCAGCCTGAGCTACAGATGC-3’ 5’-CTTTAGCTTCGGGTCAATGC-3’ 161
CXCR4 5’-GGTGGTCTATGTTGGCGTCT-3’ 5’-TGGAGTGTGACAGCTTGGAG-3’ 227
CXCL13 5’-CTCTGCTTCTCATGCTGCTG-3’ 5’-TGAGGGTCCACACACACAAT-3’ 220
CXCR5 5’-CCTCCCAGAACACACTCCAT-3’ 5’-TGCTTGGTCAAGATGACTGC-3’ 229
CCL21 5’-GCCTTGCCACACTCTTTCTC-3’ 5’-CAAGGAAGAGGTGGGGTGTA-3’ 218
CCL19 5’-GGTGCCTGCTGTAGTGTTCA-3’ 5’-GGTCCTTCCTTCTGGTCCTC-3’ 220
CCR7 5’-GATGCGATGCTCTCTCATCA-3’ 5’-TGTAGGGCAGCTGGAAGACT-3’ 218
GAPDH 5’-GTGAAGGTCGGAGTCAAC-3’ 5’-GGTGAAGACGCCAGTGGACTC-3’ 294
173
3.5 Cibler la réponse immunitaire locale lors des pathologies
inflammatoires chroniques : pistes thérapeutiques
Les travaux de l’équipe de Bromberg ont parfaitement illustré : i) que le site
où se développait une réponse immune importait (les mêmes CPA pouvant
induire tolérance ou rejet selon l’organe lymphoïde secondaire où elles
agissent) et ii) le rôle des ganglions lymphatiques drainants comme site
d’induction de la tolérance immunologique (186).
Nos propres résultats suggèrent que la réponse immune locale joue un rôle
particulièrement délétère (diversité et originalité des spécificités anticorps
générées en grande quantité au site même de la réponse). Par ailleurs, cette
réponse se développant au sein même du tissu agressé, dans un contexte de
« danger immunologique » (60), pourrait être plus difficile à contrôler (nous
avons vu plus haut le rôle inducteur de l’inflammation des débris tissulaires ou
cellulaires).
Ces réflexions nous ont conduit à tester l’efficacité de stratégies
thérapeutiques innovantes ciblant la réponse immune locale avec l’espoir
d’améliorer l’efficacité de nos traitements immunosuppresseurs sans
augmenter le degré d’immunosuppression générale.
3.5.1 Limiter l’infiltration du tissu cible par une stratégie anti-angiogénique
Le développement de stratégies thérapeutiques ciblant la réponse locale n’est
pas chose aisée car, comme nous l’avons vu plus haut, réponse systémique
et réponse locale partagent beaucoup de voies biologiques communes. Une
piste consiste à interférer avec la migration des effecteurs immunitaires.
De nouvelles molécules ont été développées avec cet objectif, notamment le
FTY720 qui faisait jusqu’à récemment figure de chef de file pour cette classe
thérapeutique. Cette molécule, rapidement phosphorylée après son
administration, se comporte comme un agoniste compétitif de la sphingosine
1 phosphate (S1P) et se fixe sur 4 des 5 récepteurs de S1P décrits. Cette
liaison indissociable conduit à l’internalisation du récepteur et sa dégradation.
Or la voie S1P/S1PR est la voie biologique contrôlant l’export des
lymphocytes hors des organes lymphoïdes secondaires (pour une revue
174
exhaustive voir (222)). L’administration de FTY720 provoque donc une
séquestration des lymphocytes dans les organes lymphoïdes secondaires
bloquant efficacement la mise en place des réponses immunes dans les
différentes situations dans lesquelles il a été testé. Son développement a du
être interrompu récemment par la firme pharmaceutique en raison d’effets
indésirables graves (principalement des bradycardies et des œdèmes
maculaires conduisant à la cécité).
Une stratégie alternative pourrait être de ne cibler que la pénétration des
effecteurs cellulaires dans le tissu cible. Nos résultats précédents ayant mis
en lumière le rôle crucial des veinules post-capillaires des vasa vasorum
comme porte d’entrée des effecteurs immunitaires dans le greffon aortique
rejeté, nous avons émis l’hypothèse qu’une stratégie anti-angiogénique
pourrait limiter cette invasion et réduire le développement des dégâts
tissulaires.
Parmi les stratégies anti-angiogéniques possibles, le ciblage de la voie du
VEGF, principal facteur pro-angiogénique, a déjà fait l’objet de rapports
encourageants au cours des pathologies inflammatoires chroniques (223) et
notamment lors du rejet d’allogreffe (224). Il nous semble cependant difficile
d’interpréter ces résultats en terme de mécanisme d’action puisque Reinders
et al ont parfaitement démontré le rôle directement pro-inflammatoire et
chémoattractant du VEGF (103).
Au cours du présent travail nous avons souhaité tester l’efficacité de l’ABT-
510 dans le modèle d’interposition aortique chez le rat. La TSP
(thrombospondine)-1 appartient à la famille des protéines matri-cellulaires,
sécrétées lors d’un stress tissulaire (225). La TSP-1 possède une puissante
activité anti-angiogénique et l’ABT-510, un heptapeptide dérivé des domaines
répétés properdin de type-1 de la TSP-1, est actuellement en cours de
développement par le laboratoire Abbott comme thérapie anti-
cancéreuse (226).
Nous avons d’abord vérifié que l’ABT-510 était dépourvu d’effet
immunomodulateur en contrôlant in vitro et in vivo qu’il n’influençait ni la
cinétique ni l’intensité de la réponse alloimmune. En revanche, comme
attendu, le traitement par ABT-510 réduisait efficacement la réaction
angiogénique adventitielle accompagnant le rejet du greffon aortique (-66%
versus greffons témoins non traités). Cette réduction du nombre de néo-
175
vaisseaux adventitiels s’accompagnait d’une diminution (-44%) du nombre
d’effecteurs cellulaires (macrophages, lymphocytes T et B) infiltrant le greffon,
mais la composition de cet infiltrat n’était pas modifié notablement. Aux temps
tardifs d’analyse (3 mois post-transplantation), les greffons des rats traités par
l’ABT-510 présentaient un dépôt collagénique adventitiel moins dense et en
conséquence une lumière totalement préservée. Fait notable, ni l’épaisseur
de la néointima, ni la destruction des cellules musculaires lisses de la média
n’étaient modifiées par le traitement. Ces dernières constatations ne sont pas
surprenantes étant donné que : i) ces 2 processus dépendent principalement
de l’action des alloanticorps et non des effecteurs cellulaires (cf paragraphe
3.1), et ii) nous avons démontré plus haut que la production des alloanticorps
n’était pas restreinte aux centres germinatifs ectopiques adventitiels (cf
paragraphe 3.2).
Les efforts réalisés ces dernières décennies pour contrôler les processus
inflammatoires chroniques ont consisté en la mise au point de molécules
immunosupressives de plus en plus puissantes. En conséquence, les effets
indésirables de ces traitements (cancers et infections opportunistes) ont
augmenté alors que le bénéfice sur le contrôle des pathologies est resté
modeste. Ce travail préliminaire suggère qu’il est possible d’influencer un
processus inflammatoire chronique autrement que par l’induction d’une
immunosuppression systémique. Le blocage de l’angiogenèse au cours d’une
réponse inflammatoire chronique permet de briser le cercle vicieux :
inflammation => angiogenèse => infiltration par davantage d’effecteurs
cellulaires => inflammation…, et ouvre la voie à de nouvelles associations
thérapeutiques qui pourraient permettre d’accroître l’efficacité des traitements
tout en réduisant leurs effets indésirables.
Antiangiogenic Treatment Prevents AdventitialConstrictive Remodeling in Graft Arteriosclerosis
Olivier Thaunat,1,2,3,9 Liliane Louedec,4 Stephanie Graff-Dubois,1,2,3 Jiangping Dai,4 Emilie Groyer,1,2,3
Houda Yacoub-Youssef,4 Chantal Mandet,5 Patrick Bruneval,5 Srini Kaveri,1,2,3 Giuseppina Caligiuri,1,2,3
Stephane Germain,6,7,8 Jean-Baptiste Michel,4 and Antonino Nicoletti1,2,3
Background. Lumen loss in graft arteriosclerosis is the consequence of the development of a thick neointima andconstrictive arterial remodeling. The latter is due to adventitial chronic inflammation and excessive perivascularcollagen deposition. We reasoned that blockade of the portal of entry of inflammatory effectors may constitute astrategy to prevent constrictive arterial remodeling.Methods and Results. We found that an anti-angiogenic therapy (ABT-510 nonapeptide), devoid of direct immuno-modulatory properties, dramatically reduced adventitial angiogenesis by 66% (P�0.0001) in the rat aortic interposi-tion model of graft arteriosclerosis. The associated decreased entry of inflammatory cells (44%; P�0.00001) resulted indrastic reduction of collagen deposition (57%; P�0.0001) thereby preventing subsequent adventitial constrictiveremodeling and reduction of lumen surface area (5.26�0.74 vs. 8.58�2.48 �m2; Control vs. ABT-510-treated rats;P�0.0001). ABT-510 had no effect on the development of the neointima.Conclusion. This work supports the idea that targeting angiogenesis may act synergistically with conventional immu-nosuppressive therapy in preventing graft arteriosclerosis, a crucial feature of chronic graft rejection.
Keywords: Angiogenesis, Chronic rejection, Graft arteriosclerosis, Remodeling, Inflammation.
(Transplantation 2008;85: 281–289)
Our modern armamentarium of immunosuppressivedrugs is effective in preventing acute rejection of solid-
organ transplants. In contrast, chronic rejection persists as adistinct problem inadequately addressed by current thera-pies, as evidenced by stagnancy of graft survival (1). Chronicrejection is responsible for a gradual decrease in graft func-tion that correlates with typical histological changes. Ex-cluding organ-specific manifestations, the most commonhistopathological feature is graft arteriosclerosis character-ized by a dramatic reduction of the lumen of graft arteries (2).
The pathogenesis of graft arteriosclerosis consists of acomplex interplay between the alloimmune response, chronicinflammation, and angiogenesis. Indeed, during chronic re-jection, immunoinflammation and angiogenesis probablymutually amplify each other because inflammation that re-
sults from a sustained alloimmune response is responsible forexaggerated angiogenesis (3, 4) and thereafter, neovesselsprovide a portal of entry for inflammatory cells (5).
In a murine model of graft arteriosclerosis, we usedABT-510, a peptide endowed with antiangiogenic properties,to block angiogenesis and thereby disrupt the crosstalk be-tween angiogenesis and inflammation. Our results show thatthis therapeutic strategy can prevent the pathogenic lumenloss in chronically rejected arteries.
MATERIALS AND METHODS
AnimalsAge-matched male Brown-Norway (BN; RT1n) and
Lewis rats (LEW; RT1l) were obtained from Charles River(L’Arbresle Cedex, France). LEW rats were used as recipientsand syngeneic donors, BN rats as allogeneic donors. All ani-mal experimentation was undertaken in compliance with theEuropean Community standards (authorization n° 75-214).
Aortic TransplantationThe animal model of aortic transplantation between
histoincompatible rat strains reproduces the main character-istics of graft arteriosclerosis found in the arteries of rejectedhuman grafts (6). Rats were anesthetized with 50 mg/kg ofpentobarbital injected intraperitoneally. With the aid of anoperating microscope, two animals were operated simulta-neously: one as the donor of the aortic graft and the other asthe recipient. A 1-cm long segment of the donor abdominalaorta was excised, perfused with normal saline, and small col-lateral arteries that originated from the graft were ligated. Thedonor aorta was transplanted in an orthotopic position byend-to-end anastomosis in the recipient aorta below the renalarteries and above the iliac bifurcation. A total of 47 aortictransplantations were performed (35 allotransplantationsand 12 isotransplantations).
O. T. is supported by INSERM, the Fondation pour la Recherche Medicale,and the Fondation du Rein. J. B. M. is supported by Leducq Foundation.A. N. is supported by the Fondation de France (grant #2006005656).
1 INSERM, UMR S 872, Les Cordeliers, Paris, France.2 Universite Pierre et Marie Curie-Paris6, UMR S 872, Les Cordeliers, Paris,
France.3 Universite Paris Rene Descartes, UMR S 872, Les Cordeliers, Paris, France.4 INSERM U698 and Universite Denis Diderot, Hopital Xavier Bichat, Paris,
France.5 Service d’Anatomopathologie, Hopital Europeen Georges Pompidou,
Paris, France.6 INSERM U833, Paris, France.7 College de France, Experimental Medicine Unit, Paris, France.8 Service d’Hematologie Biologique A, AP-HP, Hopital Europeen Georges
Pompidou, Paris, France.9 Address for correspondence: Olivier Thaunat, M.D., INSERM UMRS 681 –
Centre de Recherche des Cordeliers, 15 rue de l’ecole de Medecine, 75006Paris France.
E-mail: [email protected] 24 July 2007. Revision requested 15 August 2007.Accepted 19 October 2007.Copyright © 2008 by Lippincott Williams & WilkinsISSN 0041-1337/08/8502-281DOI: 10.1097/TP.0b013e318160500a
Transplantation • Volume 85, Number 2, January 27, 2008 281
Experimental DesignTo investigate the effect of the treatment with ABT-510
on the development of graft arteriosclerosis, LEW rats graftedwith BN aortas received, after transplantation, the vehicle(control group n�10) or 50 mg/kg ABT-510 (ABT-510group, n�10) by daily intraperitoneal injection until the dayof the sacrifice. Before use, ABT-510 was dissolved at a con-centration of 30 g/l in PBS-dextran 2.5% (Sigma-Aldrich,Saint-Quentin-Fallavier, France).
Five rats of each group were sacrificed 15 days aftertransplantation, and the remaining five were sacrificed 90days after transplantation. Blood was collected in heparin andthe spleen and aortic grafts were removed from the Lewisrecipients under anesthesia. The aortic grafts were dissected,perfused with saline and cut in two parts of equal length. Thefirst one was embedded in paraffin and the second in OCTmedium (Tissue-Tek, Agar Scientific Ltd, UK) and snap-frozen immediately in liquid nitrogen.
Full-Thickness Skin Graft ModelSkin grafting was used, as previously described (7), as a
model of acute allograft rejection. In brief, round-shapedfull-thickness skin grafts (12.5 cm2) were prepared from thetrunk skin of BN donor rats. Graft beds were prepared on theright lateral thoracic wall of LEW recipient rats and the graftwas fixed to the graft bed with eight interrupted sutures of5-O silk thread. Recipient rats were treated (n�4) or not(n�4) with 50 mg/kg/day ABT-510 daily injected intraperi-toneally. Graft survival was assessed by daily inspection andpalpation. Grafts were considered as rejected when completeinduration was observed. Graft survival was plotted accord-ing to Kaplan-Meier method and the Log-Rank test was usedto compare graft survival of the two groups.
Measurement of Plasma Levels of TransformingGrowth Factor-�1 (TGF-�1)
A commercially available ELISA kit (Quantikine, R&DSystems, Minneapolis, MN) was used to measure the levels ofTGF-�1 in the plasma of LEW rats treated (n�4) or not(n�4) with ABT-510 (50 mg/kg daily ip injection) for 12days. The active form of TGF-�1 was quantified by directlyprocessing the plasma and the total TGF-�1 (i.e. active�latent) after acid activation of latent TGF-�1 following man-ufacturer recommendations.
Transmission Electron MicroscopyElectron microscopy analysis was performed on seven
aortic grafts (five allografts and two isografts) that were har-vested 30 days after transplantation. Aortic graft specimenswere dissected, fixed immediately in 2.5% glutaraldehyde inphosphate-buffered saline, postfixed in 4% osmium tetroxideand embedded in Epon resin. Ultrathin sections (50 to 80 nmthick) were prepared, stained with lead citrate and uranylacetate, and observed with a Zeiss EMI transmission electronmicroscope.
Flow Cytometry Analysis
Cell Suspension PreparationPeripheral blood mononuclear cells were isolated on a
Ficoll gradient from 10 mL of heparinized blood. Each spleen
was meshed, cell suspensions were pelleted, and red bloodcells were lysed.
Detection of Cell Surface AntigensCells (0.1 million) were incubated with a cocktail of 5
fluorescent monoclonal antibodies (BD Biosciences) directedagainst rat CD3 (FITC), CD4 (APC), CD8 (PerCP), CD25(PE), and CD62L (Pacific Blue). Fluorescence was detectedusing an LSRII (BD Biosciences) flow cytometer and was an-alyzed using the FacsDiva Software (BD Biosciences). Cellswere counted in a tight electronic gate set on the lymphocytecluster on the forward and side scatter plot.
Mixed Lymphocyte ReactionThe eventual immunomodulatory effect of ABT-510
was tested both in vitro and in vivo. In preliminary experi-ments, the optimal ratio for responders/ stimulators wasfound to be 10/1. The in vitro effect of ABT-510 was tested byadding various concentrations of ABT-510 in a one-waymixed lymphocyte reaction. Cyclosporine A was used as apositive control for this experiment. One hundred thousandresponder cells (LEW splenocytes) were cultured in round-bottomed 96 well plates (duplicates) with or without 104
stimulators (BN splenocytes irradiated at 2000 rads) in 10%FCS RPMI. Plates were kept at 37°C in a 5% CO2 atmosphere.After 5 days, 0.5 �Ci [3H]thymidine (Amersham, UK) wasadded to each well and the cultures were further maintainedfor 18 hr. Cells were then harvested on filter paper strips anduptake of the radioisotope was measured in a � scintillationcounter (1450 microbetaplus, Wallac-PerkinElmer, MA).
The effect of ABT-510 treatment on the alloimmuneresponse was also tested. Proliferation index of splenocytes orPBMCs from grafted rats treated or not with ABT-510 wasmeasured. PBMCs and splenocytes were cultured in similarconditions as those for the evaluation of the in vitro studies.
Histological ExaminationHistologic sectioning was started at the center of the
graft to avoid effect of the suture line. Ten sections of eachsample were examined in a blindfolded manner for eachstaining technique.
Hematoxylin & Eosin (H&E) and Sirius Red StainingTen-micrometer thick paraffin-embedded sections of
aortic grafts were de-waxed and rehydrated. H&E stainingwas performed following a standard protocol for morpho-metric analysis. Sirius red staining was used to detect collagendeposition in chronically rejected grafts. Aortic cross sectionswere stained for 1 hr in picro-Sirius red solution (Sirius redF3B [Sigma-Aldrich] 0.1% saturated aqueous solution ofpicric acid). Sections were washed two times in a solution ofacidified water (5 mL of glacial acetic acid in 1 liter of distilledwater), dehydrated in three batches of 100% ethanol, andcleared in xylene. Sections were then examined with a brightfield microscope. For the Sirius red-stained sections, imageswere acquired under polarized light.
Evaluation of AngiogenesisTen micrometer-thick cryosections were air dried and
fixed in acetone. Endothelial cells were detected using the mouseanti-rat endothelial cell monoclonal antibody RECA-1 (Abcam;
282 Transplantation • Volume 85, Number 2, January 27, 2008
Cambridge, MA) as the primary antibody. Endogenous bi-otin and avidin were blocked (Biotin-avidin Block, Dako,Trappes, France). We used a biotin-conjugated horse anti-mouse secondary antibody (Vector Laboratories, Burlin-game, CA). Immunohistochemical staining was revealedusing alkaline phosphatase antialkaline phosphatase com-plexes. Alkaline phosphatase was detected by incubation witha revelation substrate (fast red salt dissolved in Tris buffer,containing naphtol and levamisole) prepared before use. Sec-tions were counterstained with hematoxylin. Microvesseldensity was quantified by immunofluorescence using isolectin-BS-I Trict conjugate (Sigma-Aldrich, red) (8) and nucleicounter-staining with DAPI (blue). Fluorescence was exam-ined with a microscope equipped with epifluorescence (LeicaMicrosystemes SAS; Rueil-Malmaison, France) and quanti-fication was carried out using the Qwin� program (LeicaMicrosystemes SAS). Endothelial cells were identified by co-localization of red and blue staining.
Characterization of the Adventitial InflammatoryInfiltrate
The composition and the density of the adventitial in-flammatory infiltrate were evaluated 15 days after the trans-plantation on 10-�m thick cross-sections of aortic allografts.
The presence of T lymphocytes and macrophages wasevaluated on paraffin embedded sections using the followingmouse anti-rat primary antibodies: anti-CD3 (1F4; 1/10; Se-rotec) and anti-CD68 (ED1; 1/100; Serotec). Primary anti-bodies were revealed with the LSAB� System (HRP, Dako).
The presence of B lymphocytes was evaluated on frozen-sections using the mouse anti-pan rat B cell antibody (RLN-9D3; 1/100; Serotec). We used a biotin-conjugated horseanti-mouse secondary antibody (Vector Laboratories). Im-munohistochemical staining was revealed using alkalinephosphatase antialkaline phosphatase complexes. Sectionswere counterstained with hematoxylin. Negative control slideswere performed with the primary antibody omitted.
Computer-Assisted MorphometryHistological images were digitally captured using the
Leica IM50 software. Customized programs (Qwin�, Leica)were used to quantify the remodeling of the vessels, the col-lagen deposition, the inflammatory infiltrate, and the angio-genesis in the adventitia on 10 sections per graft. Results areexpressed as a density (percentage of adventitial surface area).
Remodeling of the VesselsH&E-stained sections were used to measure the surface
area of the lumen, of the neointima (surface area of the inter-nal elastic lamina�surface area of the lumen), and the media(surface area of the external elastic lamina�surface area ofthe internal elastic lamina).
Collagen Deposition in the AdventitiaAdventitial collagen content was assessed on Sirius red-
stained sections observed under polarized light. Tightlypacked thick collagen fibers display a red color whereas thinneoformed collagen fibers are green. The surface areas of ad-
FIGURE 1. Lumen loss is a compositeprocess during graft arteriosclerosis.H&E-stained cross sections of aortic grafts(upper panel) were used to analyze themechanism leading to lumen loss duringgraft arteriosclerosis. Digitalized images(magnification �2.5) of allografted (n�5)and isografted (n�5) aortas were processedwith a customized computer-assisted mor-phometry software (Leica Qwin). Externaland internal elastic laminae were used todefine the luminal (white bars), neointi-mal (black bars), and medial (gray bars)surface areas (lower panel). The kinet-ics of lumen loss was analyzed 15 days(left) and 90 (right) days after transplan-tation (**P�0.01; ***P�0.001 isografts vs.allografts, respectively).
© 2008 Lippincott Williams & Wilkins 283Thaunat et al.
ventitial red fibers and of green fibers were computed on fourrandom fields (magnification �20) per section. Areas inwhich both kinds of collagen were detected (yellow color)were quantified.
Adventitial AngiogenesisLectin-stained area in the adventitia also was quantified
with the use of histomorphometry on immunostained cryo-sections (four random fields per section; magnification �20).
Adventitial Inflammatory InfiltrateThe composition and the density of the adventitial
inflammatory infiltrate was evaluated 15 days after transplan-tation by measuring the stained surface obtained after immu-nostaining of aortic allograft cross sections with respectivelyanti-CD3, anti-CD68, and anti pan-B cell antibody (four ran-dom fields per section; magnification �20).
Statistical AnalysisData were analyzed using the Statview 5.0 software
(Abacus Concept Inc.). Statistical significance of results wasdetermined by analysis of variance with one-way analysis ofvariance followed by Fischer’s PLSD tests. Results are pre-sented as mean�SD. P�0.05 was considered as statisticallysignificant.
RESULTS
Mechanisms of Lumen Loss in the Rat AorticInterposition Model
The luminal surface area of grafted aortas was mea-sured by computer-assisted histomorphometry 15 and 90days after transplantation. These two time points correspondto different phases of the rejection process as we have previ-ously shown (6). No reduction of lumen was observed inisografted arteries throughout the follow-up period (Fig. 1).In contrast, allografts displayed a 30% reduction of surfacearea of the lumen at 15 days after transplantation that re-mained stable thereafter (Fig. 1). The mechanisms responsi-ble for the reduction of the lumen were investigated. Fifteendays after transplantation, there was no detectable neointimalproliferation, and the media displayed normal thickness inallografted aortas. At this time point, reduction of lumen sizewas thus entirely imputable to adventitial constriction, as ev-idenced by the reduction of external elastic membrane area(Fig. 1). This constriction is likely attributable to the adven-titial inflammation as demonstrated by massive perivascularinfiltration (Fig. 1, Upper panels). Ninety days after trans-plantation, the adventitial constriction persisted as a conse-quence of the scarring process rather than to inflammation.Indeed, we have previously documented that, in this model,the progressive exhaustion of the alloantigens leads to thefading of inflammation and to the fibrotic scarring of theadventitial layer 90 days after transplantation (6). In agree-ment, the adventitial layer of aortic allografts was devoid ofinflammatory cells at 90 days (Fig. 1, Upper panels).
Interestingly, the lumen obstruction remained stablebetween 15 and 90 days posttransplantation despite the de-velopment of a thick neointima at the latter time point. This isexplained by the opposite fates of the media and neointimaduring chronic rejection. Indeed, thickening of neointima
was compensated by the simultaneous shrinkage of the mediadue to the progressive destruction of donor’s smooth musclecells (Fig. 1) (9).
Consistent Adventitial Angiogenic Responseand Perivascular Inflammation in GraftArteriosclerosis
Thirty days after transplantation, a florid angiogenicresponse was evidenced in the adventitia of aortic allograftswith the use of immunohistochemical staining with RECA-1,a monoclonal antibody directed against rat endothelial cells(Fig. 2B) and by the presence of mitosis features in endothe-lial cells of the vasa vasorum examined by transmission electronmicroscopy (Fig. 2C). This angiogenic response is related nei-ther to the healing reaction nor to the surgery since it was notobserved in control isografts (Fig. 2A).
Given that we did not detect inflammatory cells acrossthe medial layer, it seemed likely that the recruitment of leu-kocytes in the adventitia could be the result of modifications
FIGURE 2. Adventitial angiogenesis promotes perivascu-lar inflammation during vascular rejection. The adventitial an-giogenic response was analyzed by immunohistochemistryusing the RECA-1 monoclonal antibody 90 days after trans-plantation. (A) Aortic isografts displayed a normal aspect withfew vasa vasorum in their adventitia (original magnification�40). (B) At this time point, aortic allografts exhibited all thefeatures characterizing graft arteriosclerosis including thedisappearance of medial smooth muscle cells and the devel-opment of a thick neointima (white star). A florid angiogenicresponse was evidenced in the adventitia (original magni-fication �40). Sections of aortic allografts were observedby transmission electron microscopy 30 days after trans-plantation (L, lymphocyte; HEV, high endothelial venule;EC, endothelial cell). (C) Endothelial cells of the adventitialvasa vasorum displayed mitotic features (black arrows; orig-inal magnification �5000). (D) Endothelial cells located nearadventitial lymphocyte infiltrates with a HEV-like phenotype.The white arrowhead points toward a lymphocyte infiltratingthe adventitia through HEV (original magnification �4000).
284 Transplantation • Volume 85, Number 2, January 27, 2008
of the permeability of the vasa-vasorum endothelium. Inter-estingly, endothelial cells of the vasa vasorum in the adventi-tia of aortic allografts exhibited features of high endothelialvenules (Fig. 2D). These endothelial cells were plump withlarge quantities of cytoplasm and had an increased organellecontent. Their nuclei were ovoid with variable degrees offolding and widely dispersed granular heterochromatin.Their luminal surface displayed numerous microvillous pro-jections and protruded into the vessel lumen, creating inter-cellular clefts. Remarkably, leukocyte egress was recurrentlyobserved across the wall of the vasa vasorum (Fig. 2D) furtherdemonstrating that neo vasa vasorum are the portal of entryof inflammatory cells into the graft during the rejection pro-cess. These phenotypic alterations of endothelial cells of theadventitial vasa vasorum were not observed in isografted aor-tas (data not shown).
ABT-510 Efficiently Prevents ConstrictiveRemodeling by Reducing Adventitial CollagenDeposition
ABT-510, a nonapeptide derived from the N-terminalproperdin type-1 repeats of thrombospondin I, was used as
an anti-angiogenic molecule in the rat aortic interpositionmodel. The remodeling process was kinetically analyzed inaortic allografts of rats receiving or not ABT-510. The ABT-510 treatment prevented lumen loss associated with chronicrejection (Fig. 3A). This effect was manifest at 15 days and waseven more pronounced 90 days after transplantation. Sinceneointimal proliferation was not affected by ABT-510 treat-ment (Fig. 3A), we hypothesized that ABT-510 could act byaltering collagen accumulation in the adventitia responsiblefor constrictive adventitial remodeling. We have previouslyshown that computer-assisted morphometric analysis ofsirius red-stained sections under polarized light is accurate toquantify the collagen content of a tissue (10). In addition, it alsoprovides valuable data regarding the collagen composition be-cause neoformed fibers display green polarization colors, whilemature collagen molecules show polarization colors of longerwavelengths (red) (11). Ninety days posttransplantation,ABT-treated grafts displayed significantly reduced collagencontent as compared with controls (Fig. 3B). Furthermore,the collagen in the adventitia of ABT-treated grafts was lesstightly packed as indicated by a reduced red collagen/greencollagen ratio (Fig. 3C).
FIGURE 3. ABT-510 prevents adventitialconstrictive remodeling by reducing colla-gen deposition. (A) Computer-assisted mor-phometric analysis of aortic allografts wasperformed in control and ABT-treated ani-mals, 15 days and 90 days after transplanta-tion. Luminal (white bars), neointimal(black bars), and medial (gray bars) sur-face areas (lower panel) were computed asin Figure 1. (**P�0.01; ***P�0.001 ABT-510-treated vs. control allograft). (B) Siriusred-stained sections observed under polar-ized light were used to quantify, by histo-morphometry, the collagen deposited inthe adventitia. Results are expressed as thepercentage of birefringent surface over thesurface area of adventitia. (C) The degreeof packing of the adventitial collagen wasanalyzed on the same sections. Poorlypacked collagen appeared as green fi-bers, whereas the tightly packed one wasred. Results are expressed as the percent-age green, yellow, and red surface areasover the total birefringent surface area(ns: not statistically significant; **P�0.01;***P�0.001 ABT 510-treated rats vs. con-trol rats).
© 2008 Lippincott Williams & Wilkins 285Thaunat et al.
ABT-510 Reduces Leukocyte Infiltration in theAdventitia of Chronically Rejected Arteries byDecreasing Angiogenesis
ABT-510 markedly reduced the density of the adventi-tial inflammatory infiltrate (71.32�8.50 vs. 39.25�1.19% ofthe adventitial surface area; control vs. ABT-510; P�0.0001)but marginally affected its composition (Fig. 4A). We firsttested whether ABT-510 exerted this effect by interfering di-rectly with the alloimmune response. As shown in Figure 5A,in vitro alloimmune-induced lymphocyte proliferation wasnot affected by ABT-510. However, elaboration of an im-mune response in vivo is dependent upon many factors thatcan be barely modeled in vitro. Therefore, to further test anypotential immunosuppressive effect of ABT-510, we com-pared the alloimmune response of recipients of an aortic al-lograft, which were treated or not with ABT-510. At sacrifice,splenocytes from treated and nontreated recipients prolifer-ated equally well in response to irradiated donor splenocytes(Fig. 5B). Flow cytometry analysis was used to evaluate, in thecirculation and the spleen (the secondary lymphoid organsupporting the initiation of the alloimmune response againstvascularized allografts) (12, 13), the percentage of variouslymphocyte subpopulations: regulatory T cells (defined asCD3� CD4� CD25 bright and CD62L�) (14), activatedCD4� T lymphocyte (defined as CD3� CD4� CD25�and CD62L�), and activated CD8� T lymphocyte (definedas CD3� CD8� CD25�). Fifteen days after transplantation,we found that regulatory T cells, activated CD4� T lympho-
cytes, and activated CD8� T lymphocytes accounted respec-tively for 2.54�0.13, 4.92�0.38, and 5.15�0.46% of theCD3� splenocytes of nontreated recipients (Fig. 5C). Thesepercentages were lower in the circulation (0.32�0.07,1.84�0.32, and 2.25�0.20%, respectively, of CD3� cells).Ninety days after transplantation, the alloimmune reactionhas subdued (6). Accordingly, the percentages of activated Tlymphocytes were reduced both in the spleen and the circu-lation (Fig. 5C). No significant difference was observed be-tween nontreated and treated recipients (Fig. 5C). Finally, weevaluated the effect of ABT-510 on acute allograft rejectionusing the murine skin graft model (7), and we found thatABT-510 treatment did not prolong the survival of full-thickness skin allograft (Fig. 5D). Altogether, these resultssuggest that ABT-510 treatment minimally impacts the allo-immune response of treated recipients.
Because the reduction of adventitial inflammatory re-action was not caused by a direct immunomodulatory effectof the treatment, we tested whether this effect was related tothe reduced angiogenesis. We postulated that a reduction ofadventitial angiogenesis would impede the infiltration of re-cipients’ leukocyte, as we have previously identified adventi-tial vasa vasorum as a portal of entry for inflammatory cellsinto the graft (Fig. 2). Indeed, microvessel density was dras-tically reduced in the adventitia of ABT-510 treated animalscompared with the untreated controls (7.03�0.84 vs.1.86�0.18% of adventitial surface area; control vs. ABT-510treated rats; P�0.001; Fig. 4B and 4C).
FIGURE 4. ABT-510 reduces adventitial an-giogenesis and subsequent perivascular in-flammation. (A) The size and the compositionof the adventitial inflammatory infiltrate werequantified 15 days after transplantation. Theblack frames represent the surface of adventi-tia analyzed by computer-assisted morphom-etry. The percentage of adventitial surfacearea stained with respectively anti-CD3, anti-CD68 and anti-pan B cell antibody are repre-sented as a section of disk. (***P�0.001;****P�0.0001, ABT 510-treated rats vs. controlrats). (B) Computer-assisted morphometricanalysis of lectin-stained aortic allograft crosssections was performed to quantify the adven-titial angiogenic response in control and ABT-treated animals, 15 days after transplantation.(C) Representative cross sections of aortic al-lografts from control (upper thumbnail) andABT-510-treated (lower thumbnail) recipientsstained with RECA-1 monoclonal antibody. Adrastic reduction of adventitial angiogenesis isevidenced in treated recipients as comparedwith controls.
286 Transplantation • Volume 85, Number 2, January 27, 2008
FIGURE 5. ABT-510 does not influence the immune response. (A) A one-way mixed lymphocyte reaction was performed toevaluate the immunomodulatory effect of ABT-510. LEW splenocytes were cultured with BN-irradiated splenocytes for 6 days.[3H]thymidine was added for the last 18 hr. Two concentrations of ABT-510 were tested and cyclosporine A (Cs) was used as acontrol immunosuppressor. Results are expressed as percentage of inhibition of the proliferation as compared to controls(without drugs). (B) The effect of an ABT-510 treatment on the alloimmune response also was tested by measuring the prolifera-tion of splenocytes or PBMCs from grafted rats treated or not with ABT-510. Recipients’ splenocytes or PBMC were cultured withdonor’s irradiated splenocytes for 6 days. [3H]thymidine was added for the last 18 hr. Results are expressed as percentage ofinhibition of the proliferation as compared to controls (untreated rats). (C) Flow cytometry analysis was performed on spleen cellsuspensions and on PBMC in ABT 510-treated and control animals, 15 days and 90 days after transplantation. The followinglymphocyte subpopulations were analyzed: regulatory T cells (defined as CD3� CD4� CD25 bright and CD62L�), activatedCD4� T lymphocyte (defined as CD3� CD4� CD25� and CD62L�), and activated CD8� T lymphocyte (defined as CD3� CD8�CD25�). Results are expressed as the percentage of CD3� cells. (D) Full-thickness skin graft model was used to evaluate in vivothe impact of ABT-510 on acute allograft rejection. Graft survival was plotted using the Kaplan-Meier method. No difference wasfound between control (n�4) and ABT-510-treated group (n�4) (Log-Rank P�0.317). Representative macroscopic features ofskin grafts 5 days after transplantation are shown in thumbnails (upper: control group; lower: ABT-510-treated group).
© 2008 Lippincott Williams & Wilkins 287Thaunat et al.
DISCUSSIONIn the present study, we confirmed the findings of sem-
inal studies that have shown that lumen loss characterizingchronic vascular rejection results both from diffuse neointimalproliferation and constrictive adventitial remodeling (15, 16).We also demonstrate that the antiangiogenic peptide ABT-510prevented lumen loss during chronic vascular rejection.
Previous studies have demonstrated that chronicallyrejected grafts are the site of excessive neovessel formation(17, 18) raising the possibility that antiangiogenic therapycould prevent the disease (19). Initial attempts to target an-giogenesis have been focused on vascular endothelial growthfactors (VEGFs) because these major angiogenic moleculesare overexpressed in chronically rejected grafts (20, 21). Al-though VEGF blockade does delay the development of graftarteriosclerosis (22, 23), it is difficult to attribute the thera-peutic efficacy exclusively to the inhibition of angiogenesis,because VEGF is also endowed with proinflammatory prop-erties (24, 25). For instance, Reinders et al. showed that dur-ing allograft rejection, VEGF acts mostly by promoting theexpression of chemokines and cell adhesion molecules by en-dothelial cells rather than through its proangiogenic proper-ties (26). The angiogenic and inflammatory properties ofVEGF therefore complicates the interpretation of the resultsfrom anti-VEGF studies.
The angiogenesis-inhibiting activity of TSP-1 has beenmapped to the 50,000-dalton N-terminal third domain of themolecule and, more specifically, to the properdin type-1 re-peats in this region. A single D-amino acid replacement inone properdin-region heptapeptide leads to a 1000-fold in-crease of angiogenesis-inhibitory activity in preclinical models(27). ABT-510 (Abbott Laboratories, Chicago, IL) is a non-apeptide (NAc-Sar-Gly-Val-DalloIle-thr-nva-Ile-Arg-ProNHEt)analog of this active peptide that mimics the naturalangiogenesis-inhibiting activity of TSP-1 (28). At variancewith anti-VEGF molecules, ABT-510 is devoid of immu-nomodulatory effect since we did not observe any differ-ence in the alloimmune response of treated animals ascompared to controls.
Despite the lack of a direct effect of ABT-510 on the allo-immune response, treated grafts displayed in their adventitia (1)a reduced inflammatory infiltrate, (2) a decreased density ofneovessels, and (3) a decreased collagen deposition. We proposethat the reduced adventitial angiogenic response impeded recip-ients’ leukocyte migration within the graft. The blunted adven-titial inflammation resulted in turn in a decreased fibrogenicreaction that prevented constrictive remodeling.
Interestingly, Sidkey and Auerbach have describedlymphocyte-induced angiogenesis in which new vessels ariseas the consequence of the release of soluble mediators byallogenic lymphocytes (4). It is conceivable that ABT-510 dis-rupts the pathogenic self-amplified loop in which angiogen-esis promotes inflammation that in turn participates in thegeneration of neovessels.
Another possible explanation for the preventive effectof ABT-510 on constrictive remodeling of chronically re-jected arteries could be related to the interference of the drugwith the fibrogenic growth factor TGF-�. A major mecha-nism regulating TGF-� activity occurs through factors thatcontrol the processing of the latent to the biologically active
form of the molecule. It has been shown that TSP-1 is apotent activator of latent TGF-� acting via a protease- andcell-independent mechanism (29). It was subsequently foundthat a sequence in type 1 repeats of TSP-1 inhibits the activa-tion of TGF-� by TSP-1 (30). Because ABT-510 is a nonapep-tide derived from the properdin-like type 1 repeats of TSP-1(28), it is conceivable that ABT-510 interferes with the TSP-1-mediated activation of TGF-�. A decrease in the level of activeTGF-� in ABT-510-treated animals would reduce the adven-titial fibrogenesis and therefore limits the constrictive re-modeling (31). We have recently obtained data indicatingthat ABT-510 does not affect the ratio of activate/latentTGF-�, but reduces by 20% the level of total TGF-� in theplasma of treated rats (data not shown). Further studiesare therefore warranted to determine whether, in additionto its antiangiogenic effect, ABT-510 also exerts its benefi-cial influence on adventitial constrictive remodeling byinterfering with TGF-�-mediated fibrogenesis duringchronic vascular rejection.
Despite its overall beneficial effect on the preservationof the lumen, ABT-510 did not modulate the remodeling ofall vascular layers. Notably, the extent of neointimal prolifer-ation was not different between ABT-510-treated and controlanimals. These results are not unexpected because previousstudies have demonstrated the critical implication of the hu-moral alloimmune response in the thickening of the neoin-tima (9) and the efficiency of immunosuppressive drugs toprevent this process (32).
One possible limitation of this study is that the functionof the aortic graft is not compromised by the rejectionprocess in the model we have used because blood flow isnot impeded in terminally rejected aortic grafts. Assessingthe effect of ABT-510 on graft survival will therefore re-quire to test this drug in a solid-organ transplant modelsuch as cardiac or kidney transplantation. The fact thatgrafted animals do not receive any immunosuppressivedrug potentially limits the extrapolation that can be madefor the clinical use of ABT-510. However, this model isremarkably accurate in order to decipher the crosstalk be-tween angiogenesis and inflammation that is responsiblefor remodeling of chronically rejected arteries in the ab-sence of confounding factor.
The present results demonstrate that neointimalproliferation and adventitial constrictive remodeling, thetwo components participating in lumen loss during graftarteriosclerosis, are independent and can be uncoupledfrom each other, thereby indicating that they are driven bydifferent processes. We believe that these observationsshould encourage a revision of our current strategy to pre-vent chronic rejection in solid organ transplantation. Wepropose to investigate alternative therapies that would si-multaneously target the immune response, inflammationand angiogenesis.
REFERENCES1. Sayegh MH, Carpenter CB. Transplantation 50 years later—progress,
challenges, and promises. N Engl J Med 2004; 351: 2761.2. Libby P, Pober JS. Chronic rejection. Immunity 2001; 14: 387.3. Libby P, Zhao DX. Allograft arteriosclerosis and immune-driven an-
giogenesis. Circulation 2003; 107: 1237.4. Sidky YA, Auerbach R. Lymphocyte-induced angiogenesis: A quanti-
288 Transplantation • Volume 85, Number 2, January 27, 2008
tative and sensitive assay of the graft-vs.-host reaction. J Exp Med 1975;141: 1084.
5. Reinders ME, Rabelink TJ, Briscoe DM. Angiogenesis and endothelialcell repair in renal disease and allograft rejection. J Am Soc Nephrol2006; 17: 932.
6. Plissonnier D, Nochy D, Poncet P, et al. Sequential immunologicaltargeting of chronic experimental arterial allograft. Transplantation1995; 60: 414.
7. Calnan J, Fry H. The technique of skin grafting in the rat. Br J Plast Surg1962; 15: 155.
8. Alroy J, Goyal V, Skutelsky E. Lectin histochemistry of mammalianendothelium. Histochemistry 1987; 86: 603.
9. Thaunat O, Louedec L, Dai J, et al. Direct and indirect effects of alloan-tibodies link neointimal and medial remodeling in graft arteriosclero-sis. Arterioscler Thromb Vasc Biol 2006; 26: 2359.
10. Nicoletti A, Heudes D, Mandet C, Hinglais N, Bariety J, Michel JB. Inflam-matory cells and myocardial fibrosis: Spatial and temporal distribution inrenovascular hypertensive rats. Cardiovasc Res 1996; 32: 1096.
11. Dayan D, Hiss Y, Hirshberg A, Bubis JJ, Wolman M. Are the polariza-tion colors of picrosirius red-stained collagen determined only by thediameter of the fibers? Histochemistry 1989; 93: 27.
12. Lakkis FG, Arakelov A, Konieczny BT, Inoue Y. Immunologic ‘igno-rance’ of vascularized organ transplants in the absence of secondarylymphoid tissue. Nat Med 2000; 6: 686.
13. Ochando JC, Homma C, Yang Y, et al. Alloantigen-presenting plasma-cytoid dendritic cells mediate tolerance to vascularized grafts. Nat Im-munol 2006; 7: 652.
14. Bach JF, Chatenoud L. Tolerance to islet autoantigens in type 1 diabe-tes. Annu Rev Immunol 2001; 19: 131.
15. Pethig K, Heublein B, Wahlers T, Haverich A. Mechanism of luminalnarrowing in cardiac allograft vasculopathy: Inadequate vascular re-modeling rather than intimal hyperplasia is the major predictor ofcoronary artery stenosis. Working Group on Cardiac Allograft Vascu-lopathy. Am Heart J 1998; 135: 628.
16. Tsutsui H, Ziada KM, Schoenhagen P, et al. Lumen loss in transplantcoronary artery disease is a biphasic process involving early intimalthickening and late constrictive remodeling: Results from a 5-year se-rial intravascular ultrasound study. Circulation 2001; 104: 653.
17. Atkinson C, Southwood M, Pitman R, Phillpotts C, Wallwork J,Goddard M. Angiogenesis occurs within the intimal proliferationthat characterizes transplant coronary artery vasculopathy. J HeartLung Transplant 2005; 24: 551.
18. Tanaka H, Sukhova GK, Libby P. Interaction of the allogeneic state andhypercholesterolemia in arterial lesion formation in experimental car-diac allografts. Arterioscler Thromb 1994; 14: 734.
19. Denton MD, Magee C, Melter M, Dharnidharka VR, Sayegh MH,
Briscoe DM. TNP-470, an angiogenesis inhibitor, attenuates the devel-opment of allograft vasculopathy. Transplantation 2004; 78: 1218.
20. Pilmore HL, Eris JM, Painter DM, Bishop GA, McCaughan GW. Vas-cular endothelial growth factor expression in human chronic renal al-lograft rejection. Transplantation 1999; 67: 929.
21. Torry RJ, Labarrere CA, Torry DS, Holt VJ, Faulk WP. Vascular endo-thelial growth factor expression in transplanted human hearts. Trans-plantation 1995; 60: 1451.
22. Nykanen AI, Krebs R, Tikkanen JM, et al. Combined vascular endothe-lial growth factor and platelet-derived growth factor inhibition in ratcardiac allografts: Beneficial effects on inflammation and smooth mus-cle cell proliferation. Transplantation 2005; 79: 182.
23. Raisky O, Nykanen AI, Krebs R, et al. VEGFR-1 and -2 regulate inflam-mation, myocardial angiogenesis, and arteriosclerosis in chronicallyrejecting cardiac allografts. Arterioscler Thromb Vasc Biol 2007; 27: 819.
24. Barleon B, Sozzani S, Zhou D, Weich HA, Mantovani A, Marme D.Migration of human monocytes in response to vascular endothelialgrowth factor (VEGF) is mediated via the VEGF receptor flt-1. Blood1996; 87: 3336.
25. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, Ferrara N. Vascularendothelial growth factor is a secreted angiogenic mitogen. Science1989; 246: 1306.
26. Reinders ME, Sho M, Izawa A, et al. Proinflammatory functions ofvascular endothelial growth factor in alloimmunity. J Clin Invest 2003;112: 1655.
27. Volpert OV, Zaichuk T, Zhou W, et al. Inducer-stimulated Fas tar-gets activated endothelium for destruction by anti-angiogenicthrombospondin-1 and pigment epithelium-derived factor. NatMed 2002; 8: 349.
28. Haviv F, Bradley MF, Kalvin DM, et al. Thrombospondin-1 mimeticpeptide inhibitors of angiogenesis and tumor growth: Design, synthe-sis, and optimization of pharmacokinetics and biological activities.J Med Chem 2005; 48: 2838.
29. Schultz-Cherry S, Lawler J, Murphy-Ullrich JE. The type 1 repeats ofthrombospondin 1 activate latent transforming growth factor-beta.J Biol Chem 1994; 269: 26783.
30. Schultz-Cherry S, Chen H, Mosher DF, et al. Regulation of transform-ing growth factor-beta activation by discrete sequences of throm-bospondin 1. J Biol Chem 1995; 270: 7304.
31. Ryan ST, Koteliansky VE, Gotwals PJ, Lindner V. Transforming growthfactor-beta-dependent events in vascular remodeling following arterialinjury. J Vasc Res 2003; 40: 37.
32. Lemstrom KB, Raisanen-Sokolowski AK, Hayry PJ, Koskinen PK. Tri-ple drug immunosuppression significantly reduces aortic allograft ar-teriosclerosis in the rat. Arterioscler Thromb Vasc Biol 1996; 16: 553.
© 2008 Lippincott Williams & Wilkins 289Thaunat et al.
185
3.5.2 Le microenvironnement inflammatoire protège les lymphocytes B des centres germinatifs ectopiques de la déplétion induite par le rituximab
Le rituximab, un anticorps monoclonal chimérique dirigé contre la molécule
CD20, a été développé dans les années 90 comme traitement des
lymphomes non-hodgkiniens. Son efficacité à induire une déplétion
lymphocytaire B et son excellent profil de tolérance l’ont rapidement désigné
comme la solution thérapeutique de choix pour contrôler les réponses
humorales. Des résultats encourageants ont récemment été rapportés dans
diverses pathologies auto-immunes chroniques caractérisées par une forte
implication de la réponse humorale, notamment dans le lupus
érythémateux (227) et la polyarthrite rhumatoïde (228) pour laquelle la
molécule a récemment bénéficié d’une extension d’autorisation de mise sur le
marché.
Au cours de la mise en place de notre biocollection, nous avons reçu 2
greffons humains explantés pour dysfonction terminale en rapport avec un
rejet humoral réfractaire. Les biopsies pré-thérapeutiques montraient la
présence d’infiltrats nodulaires B entourés d’HEV. Ces deux patients avaient
reçu du rituximab comme thérapeutique de sauvetage après échec d’un
traitement conventionnel maximal (associant plasmaphérèse,
immunoglobulines polyvalentes intraveineuses et corticostéroïdes à fortes
doses). L’explantation de ces greffons a eût lieu alors que le compte
périphérique des lymphocytes CD19 inférieur à 5/mm3 indiquait un succès de
la déplétion lymphocytaire B. Il nous a donc semblé intéressant d’utiliser ce
matériel biologique pour analyser l’impact du rituximab sur le tissu lymphoïde
intra-greffon.
L’analyse par cytométrie en flux de la composition de l’infiltrat a révélé que,
bien que réduite par rapport à celle des autres greffons de la biobanque, une
population lymphocytaire B persistait au sein des échantillons. Le traitement
par rituximab n’avait pas affecté la microarchitecture du tissu lymphoïde
ectopique qui présentait toujours son organisation habituelle en
immunohistologie. Les cultures tissulaires nous permirent d’établir avec
certitude le caractère fonctionnel des centres germinatifs ectopiques par la
démonstration d’une production locale d’alloanticorps dans ces 2 greffons.
186
Bien entendu, le faible nombre d’échantillons et le biais de recrutement (nous
n’analysons que des greffons détransplantés) ne nous permettent pas de tirer
de conclusions définitives concernant l’efficacité du traitement par rituximab
dans les rejets humoraux. Il est par contre tentant de spéculer que ces 2
patients ont connu une évolution défavorable en raison de l’incapacité du
traitement à contrôler les processus immuns locaux. Des travaux antérieurs
ont identifié un polymorphisme du récepteur FcγIIIa réduisant l’efficacité de la
déplétion induite par le rituximab (229). Il est peu vraisemblable que ce
mécanisme soit en cause ici puisque ces 2 patients présentaient une
déplétion périphérique lymphocytaire B satisfaisante. Nous avons donc
cherché à expliquer la différence de sensibilité des lymphocytes B selon leur
localisation. Nous avons émis l’hypothèse que l’infiltrat inflammatoire autour
des centres germinatifs ectopiques pourrait jouer un rôle en créant un
microenvironnement protecteur comme le suggère les travaux de Gong et
al (230). Parmi les molécules susceptibles de remplir ce rôle, nous nous
sommes intéressés plus spécifiquement à BAFF (B Cell-Activating Factor of
the TNF family ; CD257) et APRIL (a proliferation-inducing ligand), 2 facteurs
de croissance pour les lymphocytes B appartenant à la famille du TNF. Nous
avons montré que le niveau d’expression de BAFF dans les greffons rejetés
était plusieurs dizaines de fois supérieur à celui mesuré dans un rein normal.
Une analyse immunohistochimique a confirmé que l’infiltrat inflammatoire
produisait de grande quantité de BAFF (sans qu’il nous soit possible de
déterminer quel type cellulaire participait le plus). De façon notable, le niveau
d’expression de BAFF dans les ganglions lymphatiques était plus élevé que
dans un tissu non-lymphoïde mais nettement inférieur à celui des reins
rejetés. Ceci pourrait expliquer le niveau « intermédiaire de difficulté »
observé pour obtenir une déplétion lymphocytaire B des organes lymphoïdes
secondaires (plus difficile que dans la circulation mais moins que dans le tissu
lymphoïde ectopique).
Ce travail préliminaire suggère que la réponse immune locale est plus difficile
à cibler par les thérapeutiques conventionnelles car l’infiltrat inflammatoire
crée un microenvironnement protecteur en fournissant aux lymphocytes B des
centres germinatifs ectopiques des facteurs de croissance (notamment
BAFF). Lorsque la réponse locale est insuffisamment contrôlée, le processus
pathologique continue d’évoluer malgré un blocage satisfaisant de la réponse
187
périphérique. Ce travail suggère enfin que le suivi de l’efficacité thérapeutique
sur des paramètres périphériques est probablement inadapté au monitoring
des pathologies inflammatoires chroniques compte tenu de l’autonomisation
des processus locaux.
B Cell Survival in Intragraft Tertiary Lymphoid OrgansAfter Rituximab Therapy
Olivier Thaunat,1,2,11 Natacha Patey,3 Chantal Gautreau,4 Sophie Lechaton,5 Veronique Fremeaux-Bacchi,6
Marie-Caroline Dieu-Nosjean,2 Elisabeth Cassuto-Viguier,7 Christophe Legendre,5 Michel Delahousse,8
Philippe Lang,9 Jean-Baptiste Michel,10 and Antonino Nicoletti2,10
Background. Rituximab is emerging as a potent therapeutic option in chronic inflammatory diseases associated with aprominent humoral component. Recent studies have demonstrated that chronic inflammatory infiltrate organizeprogressively themselves into ectopic lymphoid tissues (tertiary lymphoid organs; TLOs) supporting a local humoralimmune response. In the present study, we evaluated the impact of rituximab therapy on TLOs associated with chronicactive antibody-mediated rejection, a prototypic humoral chronic inflammatory condition.Methods. Renal allografts removed for terminal chronic rejection were prospectively collected in four transplantationcenters over 4 years. Among 38 grafts collected, two were explanted after rituximab therapy for chronic active antibody-mediated rejection. Clinical characteristics and circulating B cell count were recorded for these two patients. Thecomposition and the microarchitecture of the inflammatory infiltrate were analyzed by flow cytometry and immuno-histochemistry. Organotypic cultures were performed to evaluate the intragraft production of alloantibody. Levels ofexpression of BAFF (Blys, CD257) were evaluated by quantitative reverse transcriptase-polymerase chain reaction.Results. Despite the complete depletion of circulating B cells in peripheral blood, TLOs were evidenced in the inter-stitium of both explanted grafts. Their functionality was assessed by the demonstration of a persistent local productionof alloantibody. BAFF, a potent survival factor for B cells, was found to be overexpressed (both at the gene and theprotein levels) in chronically rejected grafts when compared with normal kidneys and lymph nodes.Conclusions. In certain patients, inflammatory microenvironment provides BAFF-dependent paracrine survival signalto B-cells in TLOs, allowing them to escape rituximab-induced apoptosis, thereby thwarting therapeutic efficiency.
Keywords: Rituximab, Lymphoid neogenesis, Tertiary lymphoid organs, Chronic rejection, Inflammation.
(Transplantation 2008;85: 1648–1653)
R ituximab, an engineered monoclonal antibody directedagainst the B cell specific CD20 molecule, has recently
emerged as a potent therapeutic option for chronic inflam-matory diseases with a prominent humoral component, suchas rheumatoid arthritis (1), lupus (2), and antibody-mediatedallograft rejection (3). In these indications, rituximab admin-
istration is currently guided on the peripheral B cell countthat should decrease below 5/mm3 (2). However, focusing thefollow-up of rituximab therapy on circulating B cells could beinappropriate because this parameter may not provide reli-able information regarding the impact of the treatment ontertiary lymphoid organs. Indeed, chronic inflammatory in-filtrates progressively organize into ectopic lymphoid tissuesnamed “tertiary lymphoid organs” (TLOs) (4). Recurrent ob-servations of these fully functional ectopic germinal centerswithin inflamed tissues suggest that the local humoral im-mune response participates in the pathological process (5).
The aim of the present study was to investigate the ef-fect of rituximab therapy on the TLOs located within chron-ically rejected renal allografts.
MATERIALS AND METHODS
Origin of Human Samples
Renal allografts removed because of terminal chronic rejec-tion have been collected in four transplantation centersover a period of 4 years. Among a total of 38 consecutivegrafts, two were harvested after rituximab therapy forchronic active antibody-mediated rejection (CAAMR).The individual characteristics of these two patients are pre-sented in Table 1.Fresh normal renal tissue was obtained from the intact por-tion of six kidneys removed for renal cancer.Frozen lymphoid tissues were obtained from lymph nodesharvested during surgery (for colorectal cancer [n�6], orduring a coronary artery bypass procedure [n�2]) andwere found normal after histological examination.
This work was supported by the research grants from INSERM, the Fonda-tion pour la Recherche Medicale, and the Fondation du Rein (O.T.).
Disclosures: The authors reported no financial conflict.1 Renal Transplantation and Clinical Immunology Department, Edouard
Herriot Hospital, HCL; Universite Claude Bernard Lyon I; INSERMU851, Lyon, France.
2 Centre de Recherche des Cordeliers; Universite Pierre et Marie Curie -Paris6; Universite Rene Descartes Paris5; UMR S 872, Paris, France.
3 Pathology Department, Necker Hospital AP-HP, Paris, France.4 Immunology and Histocompatibility Laboratory, Saint-Louis Hospital
AP-HP, Paris, France.5 Renal Transplantation Department, Necker Hospital, APHP; Universite
Rene Descartes, Paris, France.6 Immunology Department, Georges Pompidou Hospital AP-HP, Paris,
France.7 Nephrology Department, Pasteur Hospital, Nice, France.8 Nephrology Department, Foch Hospital, Suresnes, France.9 Nephrology and Transplantation Department, Henri Mondor Hospital
AP-HP; Universite Paris 12, Creteil, France.10 INSERM U698; Universite Denis Diderot- Paris 7; CHU Xavier Bichat,
Paris, France.11 Address Correspondence to: Olivier Thaunat, M.D., Renal Transplanta-
tion and Clinical Immunology Department, Edouard Herriot Hospital, 5place d’Arsonval, 69437 Lyon Cedex 03, France.
E-mail: [email protected] 17 December 2007. Revision requested 7 January 2008.Accepted 4 March 2008.Copyright © 2008 by Lippincott Williams & WilkinsISSN 0041-1337/08/8511-1648DOI: 10.1097/TP.0b013e3181735723
1648 Transplantation • Volume 85, Number 11, June 15, 2008
All the patients gave informed consent for the usage of thesamples for research purpose.
Renal Allograft Pathology
Paraffin-embedded renal tissues were cut into 4 �m-thicksections and underwent routine examination.Indirect immunoperoxidase staining was performed on 4�m-thick paraffin-embedded sections with a mouse anti-human CD20 antibody (1:50; clone L26; Zymed Laborato-ries) to detect B cells; with an antiperipheral lymph nodeaddressin ([PNAd]; 1:100; clone MECA79; Pharmingen) todetect high endothelial venules; or with rat anti-humanBAFF (BLyS, CD257; 1:300; clone buffy-2; Abcam) as pre-viously described (6).Detection of C4d was performed on 4 �m-thick frozensections, with a mouse anti-human C4d (1:50; Quidel) andan FITC-labeled secondary antibody (1:20; rabbit anti-mouse IgG; DAKO).
Flow Cytometry AnalysisFragments of renal grafts were incubated in a solution
of 1 mg/mL collagenase A and 0.1 mg/mL DNAse I (Roche).The cell suspension was filtered and mononuclear cells wereisolated on a Ficoll gradient. Cells (0.1 million) were incu-bated with two fluorescent monoclonal antibodies (BD Bio-sciences) directed against human CD3 (PE-TxRed), andCD19 (AmCyan). Analysis was performed with an LSRII flowcytometer and the DIVA software (BD Biosciences).
In Vitro Production of AlloantibodiesOrganocultures were performed as previously de-
scribed (7). After 5 days, concentrations of IgG, IgA, and IgMwere measured using nephelometry (Beckman Instruments)in the supernatants.
Luminex assays were used to detect the presence ofanti-human leukocyte antigen alloantibodies in the super-natants (LifeScreen®, Tepnel Lifecodes Corporation) andsubsequently to determine their specificity (LABScreen®single antigen human leukocyte antigen class I and class IIdetection tests, One Lambda). The results are expressed asthe difference between the mean fluorescence intensitymeasured after incubation of the beads with the supernatantsand the background mean fluorescence intensity (determinedfor this particular single antigen bead after incubation with anegative control serum).
Semiquantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis
Total RNA was isolated from the 38 explanted grafts, sixcontrol kidneys, and eight lymph nodes using the RNeasy MiniKit (Qiagen). cDNAs were generated from 1 �g of total RNAusing SuperScript II reverse transcriptase (Invitrogen) and randomdecamers (ABgene). The primers for GAPDH (5�-GTGAAGG-TC GGAGTCAAC-3�; 5�-GGTGAAGACGCCAGTGGACTC-3�)and B-cell activating factor (BAFF; 5�-CCTCACGGTGGT-GTCTTTCT-3�; 5�-AAAGCTGAGAAGCCATGGAA-3�) weredesigned using Primer3 software and obtained from Euro-gentec. Real-time quantitative polymerase chain reaction(PCR) was performed on an ABI Prism 7300 sequence detec-tion system (Applied Biosystems) with SYBR Green MasterMix (Qiagen). Results were expressed as threshold cycle (Ct)values corresponding to the cycle at which PCR enters theexponential phase.
The relative quantification of BAFF mRNA was deter-mined using the 2(���Ct) formula (8), in which GAPDH wasused as house keeping gene, and normal kidneys were consid-ered as control tissues (level of expression arbitrarily fixed to 1).
TABLE 1. Characteristics of the patients and timing of rituximab therapy
Patient 1 Patient 2
Age (yr) 42 41
Gender Male Female
Ethnicity Caucasian Caucasian
Cause of end stage renal failure Henoch-Schonlein purpura Membranous glomerulopathy
Rank of the transplantation 2 1
Type of donor Living donation Cadaveric
Age of donor (yr) 38 45
Baseline immunosuppressive regimen Anti-IL2R/MMF/FK506/CS OKT3/Aza/Csa/CS
Time from transplantation to diagnosis of CAAMR (mos) 12 166
Treatment of antibody-mediated rejection IVIg IVIg
Plasmapheresis Rituximab (1 course)
Rituximab (2 courses)
At the time of explantation
Time from transplantation to explantation (mos) 26 174
Time from last course of rituximab (mos) 10.3 3.8
CD19 count in peripheral blood 5/mm3 3/mm3
Anti-IL2R, anti-interleukine 2 receptor antibody; MMF, mycophenolate mofetil; FK506, tacrolimus; CS, corticosteroid; Aza, azathioprine; Csa, cyclospor-ine; IVIg, intravenous immunoglobulin.
© 2008 Lippincott Williams & Wilkins 1649Thaunat et al.
RESULTS
C4d Deposition and Tertiary Lymphoid Organsin Chronic Active Antibody-Mediated Rejection
Histological analysis of the biopsy samples obtained be-fore rituximab therapy for both grafts showed glomerulardouble contour (Fig. 1A), capillary basement membranemultilayering (Fig. 1B), interstitial fibrosis with tubular atro-phy, and intimal thickening in arteries (data not shown). Theparticipation of the humoral alloimmune response in thechronic rejection process was suggested by the deposition ofantibody as witnessed by a positive C4d staining (Fig. 1C).CD20 positive B cells packed in nodular aggregates were ob-served in the interstitium of the grafts (Fig. 1D). The presenceof TLOs in chronically rejected allografts is in accordancewith previous studies (7, 9, 10).
These features fulfilled the criteria for the diagnosis ofCAAMR (11). Rituximab therapy was therefore initiated ac-cording to previous studies suggesting that this treatmentmay improve the outcome of antibody-mediated rejectionepisodes (3).
Complete Disappearance of Circulating B CellsMay Not Reliably Predict Intragraft B CellDepletion
Rituximab was administered intravenously at a dose of375 mg/m2 (twice for patient 1 and once for patient 2). De-spite a rapid and profound peripheral B cell depletion, bothpatients experienced an unfavorable outcome leading to ter-minal graft failure and graft explantation.
While the peripheral CD19 count was still below 5/mm3 attime of explantation, B cells were detected within the grafts byflow cytometry, accounting for 1.2% and 3.9% of the lymphoidinfiltrate (Fig. 2A, B). Of note, these percentages were lowerwhen compared with the 4.8%�0.8% (mean�SD) observed inthe remaining 36 explanted grafts from patients who were nottreated with rituximab. Immunohistochemistry analysis con-
firmed the persistence of B cell nodules (Fig. 2C, D) and demon-strated that these nodules were surrounded by blood vesselsexpressing a family of sialomucins: PNAd, specific of high endo-thelium venules (Fig. 2E, F).
These data therefore suggest that rituximab-inducedintragraft B cell depletion remains incomplete and insuffi-cient to disrupt the spatial organization of the ectopic lym-phoid tissue.
Incomplete Intragraft B Cell Depletion isAssociated With a Persistent Local Production ofAlloantibodies
To evaluate the impact of rituximab therapy on thefunctionality of the TLOs, we performed organocultures ofsmall cortical fragments of the 38 explanted grafts and sixcontrol kidneys. As expected only a very low amount of IgG(0.03�0.007 g/L) was found in the supernatants of the sixcontrol kidneys. In contrast, we evidenced a local productionof IgG in both chronically rejected grafts from patientstreated by rituximab (patient 1: 0.171 g/L; patient 2: 0.287g/L). These levels were however lower when compared withthe 0.692�0.353 g/L observed in the remaining 36 explantedgrafts of our cohort from patients who were not treated withrituximab (Fig. 3A). Using flow-beads assay we subsequentlyidentified locally produced IgG as antidonor alloantibodies(Fig. 3B).
Inflammatory Cells Provide Intragraft B CellsWith BAFF Survival Signal
The level of expression of BAFF, analyzed by semiquan-titative RT-PCR, was significantly increased in rejected renalallografts when compared with control kidneys and normallymphoid tissue (Fig. 3C). Of note, the two grafts harvested inpatients in whom rituximab failed to prevent CAAMR wereamong the top 10% of our cohort of 38 samples. The source ofBAFF within chronically rejected tissue was the inflammatory
FIGURE 1. Before rituximab. Histologicalanalysis of biopsy samples obtained beforerituximab therapy (representative findingsof the two patients are shown). Silver stainingshowed glomerular double contour (A) andcapillary basement membrane multilayer-ing (B). The bright linear C4d staining alongcapillary basement membranes involvingmore than half of sampled capillaries (17)demonstrated the participation of the hu-moral alloimmune response in the chronicrejectionprocess (C). CD20 positive B cellspacked in nodular aggregates were ob-served in the interstitium (D).
1650 Transplantation • Volume 85, Number 11, June 15, 2008
cells infiltrating the graft as demonstrated by immunohisto-chemistry analysis (Fig. 2G, H).
DISCUSSIONPrevious studies suggest that anti-CD20 therapy effi-
ciently depletes B cells in acutely rejected renal allografts (12) andmay improve the outcome of antibody-mediated rejection (3).We however report herein two cases of CAAMR refractory torituximab therapy. In these two grafts, rituximab therapy re-sulted in a significant decrease in the percentage of B cells and inthe amount of locally produced IgG but these effects remainedincomplete and therefore insufficient to control the intragrafthumoral alloimune response taking place in TLOs.
Performing simultaneously, immunohistochemis-try, flow cytometry, and functional analysis on a singlesample requires an important amount of tissue that canonly be obtained using explanted grafts. This strategy in-troduces two drawbacks. First, the number of explantedorgans that can be obtained is limited. Second, there is abias in the recruitment since we only analyzed materialcoming from patients for whom rituximab therapy failed.Therefore, the conclusion of this study shall not be gener-alized to all patients treated by rituximab for CAMMR.This work rather identifies a subpopulation of renal trans-planted patients characterized by an unfavorable outcomeon rituximab therapy.
FIGURE 2. Effect of rituximab on TLOs ofchronically rejected renal allografts. Afterrituximab therapy, B cells were still detectedwithin the grafts by flow cytometry, account-ing for 1.2% (patient 1; A) and 3.9% (patient2; B) of the lymphoid infiltrate. Immunohisto-chemistry analysis confirmed the persis-tence of CD20 positive nodular aggregates(patient 1, C; patient 2, D). These nodular ag-gregates were likely TLOs since they weresurrounded by blood vessels expressingPNAd, a family of sialomucins specific of HEV(E and F). BAFF, a potent growth factor for Bcells, was produced by the inflammatorycells infiltrating chronically rejected allo-grafts (G and H).
© 2008 Lippincott Williams & Wilkins 1651Thaunat et al.
The most striking feature shared by these two patientswas the discrepancy observed between the efficient depletionof circulating B cells and the persistence, within rejectedgrafts, of TLOs that were the site of production of alloanti-bodies. It is thus tempting to speculate that the failure ofrituximab therapy to control intragraft humoral alloimmuneresponse was responsible for the unfavorable outcome inthese patients. This hypothesis is in line with very recent dataobtained in rheumatoid arthritis demonstrating that (1) un-like those in circulation, synovial B cells may be decreased butare not eliminated by rituximab, and (2) there is a correlationbetween synovial B cell depletion and clinical response torituximab (13).
The design of the present study does not allow us toprovide any definitive explanation regarding why TLOs maypersist in rejected grafts when B cell are efficiently depleted inthe circulation. One plausible explanation would be that in-flammatory microenvironment provides survival signal(s) toB cells, reducing their sensitivity to the drug. Indeed, in aseminal experimental study, Gong et al. (14) used transgenicmice expressing human CD20 to analyze the in vivo factorsthat regulate mechanisms involved in anti-CD20 antibody-induced B cell depletion. They demonstrated that factors de-rived from the microenvironment were responsible for thedistinct in vivo mechanisms and sensitivities of the various B
cell subsets. Besides integrin-regulated homeostasis and cir-culatory dynamics of B cells, the authors acknowledged theimportance of BAFF, a potent B cell growth factor endowedwith antiapoptotic properties (15), in defining the thresholdfor anti-CD20 monoclonal antibody-mediated killing. In ad-dition, a recent report has demonstrated that rituximab ther-apy induced an upregulation of BAFF (16). We have thereforefocused our investigation on this TNF family member. Wefound that BAFF gene was overexpressed in chronically re-jected grafts and we identified the inflammatory cells infil-trating the grafts as the main source for BAFF. These clinicalobservations are therefore perfectly in line with the conclu-sions of Gong et al. (14) and extend their original concept inthe setting of human transplantation for the particular case ofintragraft ectopic germinal centers.
CONCLUSIONPeripheral B cell count may not be accurate enough to
follow the efficacy of rituximab therapy because this param-eter is poorly correlated with the effect of the drug on TLOs.
Optimizing rituximab therapy for chronic inflammatorydiseases, including CAAMR, would necessitate to efficiently tar-get B cells infiltrated in the inflamed tissue. This goal may requireinterfering with the BAFF-dependent survival signal provided bythe inflammatory microenvironment.
FIGURE 3. Functionality of TLOs and ex-pression of BAFF in renal grafts explantedafter rituximab therapy. Concentrations ofIgG, IgA, and IgM were measured by neph-elometry in the supernatants harvested after5 days of organoculture. IgM and IgA werenot present in supernatants. Very low levelsof IgG were measured in the supernatants ofsix control kidneys. In contrast, a local pro-duction of IgG was evidenced for all ex-planted grafts (A). Interestingly, the level ofproduction of IgG was lower in the two graftsharvested after rituximab when comparedwith the remaining 36 of the cohort. Specificanti-donor alloantibodies were detectedamong the locally produced IgG (B), sug-gesting that rituximab therapy insufficientlycontrols the local humoral alloimmune re-sponse. The relative expression of BAFF, apotent growth factor for B cells, was evalu-ated by semiquantitative RT-PCR in six con-trol kidneys, eight lymph nodes, and the 38explanted grafts (C). The results are ex-pressed using the 2(���Ct) formula, inwhich GAPDH was used as house keepinggene, and normal kidneys were considered ascontrol tissues (level of expression arbi-trarily fixed to 1). a.u., arbitrary unit; n.d.,not detected.
1652 Transplantation • Volume 85, Number 11, June 15, 2008
ACKNOWLEDGMENTSThe authors are grateful to the physicians from the De-
partments of Nephrology, Pathology and Urology of Foch, HenriMondor, Necker and Pasteur Hospitals for their help during thecollection of tissue samples.
REFERENCES1. Edwards JC, Szczepanski L, Szechinski J, et al. Efficacy of B-cell-targeted ther-
apy with rituximab in patients with rheumatoid arthritis. N Engl J Med 2004;350: 2572.
2. Looney RJ, Anolik JH, Campbell D, et al. B cell depletion as a novel treatmentfor systemic lupus erythematosus: A phase I/II dose-escalation trial of ritux-imab. Arthritis Rheum 2004; 50: 2580.
3. Becker YT, Becker BN, Pirsch JD, et al. Rituximab as treatment forrefractory kidney transplant rejection. Am J Transplant 2004; 4: 996.
4. Kratz A, Campos-Neto A, Hanson MS, et al. Chronic inflammationcaused by lymphotoxin is lymphoid neogenesis. J Exp Med 1996; 183:1461.
5. Aloisi F, Pujol-Borrell R. Lymphoid neogenesis in chronic inflamma-tory diseases. Nat Rev Immunol 2006; 6: 205.
6. Groom J, Kalled SL, Cutler AH, et al. Association of BAFF/BLyS over-expression and altered B cell differentiation with Sjogren’s syndrome.J Clin Invest 2002; 109: 59.
7. Thaunat O, Field AC, Dai J, et al. Lymphoid neogenesis in chronicrejection: Evidence for a local humoral alloimmune response. Proc NatlAcad Sci USA 2005; 102: 14723.
8. Livak KJ, Schmittgen TD. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-Delta Delta C(T)) method.Methods 2001; 25: 402.
9. Kerjaschki D, Regele HM, Moosberger I, et al. Lymphatic neoangiogen-esis in human kidney transplants is associated with immunologicallyactive lymphocytic infiltrates. J Am Soc Nephrol 2004; 15: 603.
10. Thaunat O, Patey N, Morelon E, et al. Lymphoid neogenesis in chronicrejection: The murderer is in the house. Curr Opin Immunol 2006; 18:576.
11. Solez K, Colvin RB, Racusen LC, et al. Banff ’05 meeting report: Differ-ential diagnosis of chronic allograft injury and elimination of chronicallograft nephropathy (“CAN”). Am J Transplant 2007; 7: 518.
12. Genberg H, Hansson A, Wernerson A, et al. Pharmacodynamics ofrituximab in kidney allotransplantation. Am J Transplant 2006; 6: 2418.
13. Kavanaugh A, Rosengren S, Lee SJ, et al. Assessment of rituximab’simmunomodulatory synovial effects (the ARISE trial). I. Clinical andsynovial biomarker results. Ann Rheum Dis 2007; 67: 402.
14. Gong Q, Ou Q, Ye S, et al. Importance of cellular microenvironmentand circulatory dynamics in B cell immunotherapy. J Immunol 2005;174: 817.
15. Batten M, Groom J, Cachero TG, et al. BAFF mediates survival of pe-ripheral immature B lymphocytes. J Exp Med 2000; 192: 1453.
16. Lavie F, Miceli-Richard C, Ittah M, et al. Increase of B cell-activatingfactor of the TNF family (BAFF) after rituximab treatment: Insightsinto a new regulating system of BAFF production. Ann Rheum Dis2007; 66: 700.
17. Racusen LC, Colvin RB, Solez K, et al. Antibody-mediated rejectioncriteria - An addition to the Banff 97 classification of renal allograftrejection. Am J Transplant 2003; 3: 708.
Instructions for Authors—Key Guidelines
Financial Disclosure and Products Page Authors must disclose any financial relationship with any entity or product described in the manuscript (including grant support, employment, honoraria, gifts, fees, etc.) Manuscripts are subject to peer review and revision may be required as a condition of acceptance. These instructions apply to all submissions.
Manuscript Review and Publication
Using an electronic on-line submission and peer review tracking system, Transplantation is committed to rapid review and publication. The average time to first decision is now less than 21 days. Time to publication of accepted manuscripts continues to be shortened, with the Editorial team committed to a goal of 3 months from acceptance to publication. Submit your manuscript to Transplantation® today. The Manuscript Central submission website (http://mc.manuscriptcentral.com/transplant) helps make the submission process easier, more efficient, and less expensive for authors, and makes the review process quicker, more accessible, and less expensive for reviewers.
© 2008 Lippincott Williams & Wilkins 1653Thaunat et al.
194
4 Discussion
4.1 Synthèse de nos principaux résultats
Lors de ce travail de recherche, nous avons utilisé le rejet chronique comme
un modèle de pathologie inflammatoire chronique secondaire à une
stimulation permanente du système immunitaire. Ce choix se justifie par les
nombreux avantages que procure cette situation pathologique particulière par
rapport aux autres maladies inflammatoires chroniques : i) le début de la
réponse inflammatoire est clairement identifié (le jour de la transplantation) ;
ii) les antigènes cibles sont connus (mismatch HLA du couple
doneur/receveur) ; iii) existence d’un modèle expérimental chez le rat
reproduisant de façon adéquate la pathologie clinique ; et iv) on peut
facilement obtenir une grande quantité de tissu cible pour effectuer une
analyse exhaustive des processus biologiques à l’œuvre.
Nos principaux résultats :
1) démontrent que l’infiltrat inflammatoire évolue au cours du
temps. Nous avons notamment observé un enrichissement en
effecteur du bras humoral de la réponse immune adaptative et une
organisation progressive de l’infiltrat qui forme un tissu lymphoïde
ectopique hautement organisé. L’architecture de ce tissu
lymphoïde ectopique est très semblable à celle des organes
lymphoïdes secondaires « professionnels » (i.e. dont le
développement est programmé au cours du l’embryogenèse, tels
que les ganglions lymphatiques, la rate...etc). Ce processus (connu
sous le nom de néogenèse lymphoïde) avait déjà été rapporté
dans diverses situations inflammatoires chroniques (liées à
l’autoimunité, le cancer ou l’infection (93)) mais jamais dans
l’alloimmunité. Ces résultats expérimentaux obtenus dans le
modèle d’interposition aortique chez le rat ont été corroborés par
ceux d’une équipe Américaine travaillant avec un autre modèle
murin (transplantation cardiaque hétérotopique chez la
souris (231)) puis validés en clinique par l’étude de différents types
de greffons explantés pour rejet terminal.
195
2) suggèrent fortement le rôle délétère de la néogenèse lymphoïde
au cours des pathologies inflammatoires chroniques. En effet, le
tissu lymphoïde ectopique est le siège d’une réponse humorale
locale dirigée contre les antigènes du tissu cible. Cette réponse
locale semble totalement autonome par rapport à la réponse
immune systémique puisqu’elle cible des épitopes différents et que
l’extinction de la réponse systémique ne suffit pas à l’éteindre.
3) démontrent que l’organisation du tissu lymphoïde ectopique
dépend de la récapitulation du programme biologique à l’ œuvre
chez l’embryon lors de l’ontogénie des organes lymphoïdes
secondaires professionnels. La récapitulation complète du
programme s’accompagne du développement d’une réponse
humorale locale agressive: production d’une grande quantité
d’anticorps dirigés contre une grande diversité de cibles
épitopiques. Lorsque le programme est tronqué, la réponse locale
est moins « performante » et nous avons pu identifier trois
« verrous moléculaires » (CXCL13, CCL21 et LTβR) qui pourraient
être des cibles thérapeutiques valables contre la néogenèse
lymphoïde.
4) suggèrent qu’un des mécanismes initiateur de la néogenèse
lymphoïde pourrait être un défaut de drainage lymphatique dans le
tissu cible. Des travaux en cours devraient permettre d’apporter
une réponse concernant la validité de cette hypothèse.
5) suggèrent certaines pistes dans le traitement de l’inflammation
chronique : i) couplage des traitements ciblant le système
immunitaire (immunosuppresseurs conventionnels) avec des
molécules interférant avec d’autres processus biologiques (anti-
angiogénique, anti-lymphangiogénique…etc), ii) utilisation de
molécules interférant avec la néogenèse lymphoïde (cf ci-dessus ;
des perspectives cliniques rapides peuvent être espérées dans la
mesure où des produits ciblant ces molécules sont déjà à l’essai
chez l’homme, notamment la LTßR-Ig , Baminercept-alpha®,
actuellement en essai de phase II dans la polyarthrite rhumatoïde).
6) incitent à la prudence concernant les techniques de monitoring
fondées sur l’analyse des phénomènes périphériques (qui sous-
196
estiment l’activité des processus locaux dont nous venons de
souligner l’importance).
4.2 Gouvernance de la réponse immunitaire locale
Parmi les interrogations soulevées par ce travail, l’une concerne la
gouvernance du processus : qui contrôle la mise en place du programme
biologique conduisant au développement d’une réponse locale ? Les travaux
de Buckley suggèrent que le fibroblaste (c’est-à-dire une cellule stromale du
tissu cible) contrôle le passage à la chronicité d’une réponse
inflammatoire(126, 127). Nos propres résultats, soulignant le rôle central du
LTßR exprimé par les cellules stromales, vont également dans ce sens. De
façon plus anecdotique, nous avons observé dans notre biocollection un
patient ayant reçu successivement 2 greffons génétiquement différents qui
ont tous les deux cessé de fonctionner en raison d’un rejet arrivé au stade
terminal. Leur analyse montre, qu’alors qu’ils ont été soumis au même
système immunitaire, la réponse locale s’est développée complètement dans
le premier (groupe C4), tandis que le processus a été abortif dans le second
(groupe C2). L’idée que le tissu contrôle l’intensité et la nature de la réponse
inflammatoire qui se met en place en lui-même en réponse à un signal
inducteur (de « danger ») commence à émerger dans la littérature,
notamment depuis la publication des travaux de Takabayshi et al (232). Cet
article (controversé, (233)) suggère que les cellules épithéliales pulmonaires
inhibent la réponse des macrophages alvéolaires aux stimulations
environnementales en condition basale. En cas d’infection, les cellules
épithéliales tissulaires lèvent leur inhibition et permettent à la réponse
inflammatoire protectrice de se mettre en place. Ce type de contrôle tissulaire
aurait l’avantage d’une plus grande modularité en permettant, avec les
mêmes effecteurs, de faire varier le seuil de stimulation nécessaire à
l’initiation de la réponse inflammatoire et son intensité maximale afin
d’optimiser la balance protection/dégâts. Cette vision du système permet
d’envisager sous un angle nouveau le vieux concept des « sites
immunologiques privilégiés ». L’œil, par exemple, est un tissu sensible à
l’inflammation et chaque réponse s’y développant réduit la fonctionnalité de
cet organe par ailleurs essentiel à l’individu. On conçoit donc aisément
l’avantage de ne déclencher de réponse inflammatoire que lorsque la
197
situation est menaçante pour l’organisme tout entier (seuil d’initiation de la
réponse élevé = site immunologique privilégié).
Comment le tissu contrôle-t-il la réponse inflammatoire ? Polly
Matzinger (234) propose deux pistes de réflexion : i) l’éducation des CPA
résidentes par le microenvironnement tissulaire et ii) la capacité pour le tissu
de recruter et de séquestrer certains effecteurs cellulaires. Illustrant cette
dernière hypothèse : le rôle des lymphocytes γδ cutanés (235) (aussi connu
sous le nom de « dendritic epidermal T cells »), des lymphocytes γδ intra-
épithéliaux du tube digestif (236), des lymphocytes NK T hépatiques (237) ou
placentaires (238), capables de reconnaître des signaux de « soi modifié »
(i.e. stress-induced self ) plutôt que de « non-soi », et dont la fonction est
d’orienter la réponse immune vers le bras effecteur approprié pour éliminer le
pathogène sans provoquer de dégât excessif au tissu.
4.3 Evolution du système immunitaire et néogenèse
lymphoïde
Si le tissu régule la réponse inflammatoire afin d’optimiser la balance
protection/dégâts, comment expliquer qu’il « autorise » la néogenèse
lymphoïde, i.e. le développement d’un tissu lymphoïde ectopique en son sein
qui, en supportant une réponse immune locale autonome, participe à
chroniciser la réponse inflammatoire et donc à la destruction progressive du
tissu ? D’autre-part, comment expliquer la coexistence de ce tissu lymphoïde
ectopique et des organes lymphoïdes secondaires « professionnels »,
sélectionnés par l’évolution précisément pour abriter les phases d’initiation de
la réponse immune ? Les données d’immunologie comparée suggèrent que
l’apparition des organes lymphoïdes secondaires est postérieure à celle de
l’immunité adaptative (239). On peut donc supposer que la néogenèse
lymphoïde représente une étape évolutive intermédiaire entre l’immunité
innée et le développement d’un système immunitaire adaptatif tel que nous le
connaissons actuellement chez les mammifères (c’est ce que suggère
l’exemple des ectothermes qui, bien que n’ayant pas d’organes lymphoïdes
secondaires, possèdent des lymphocytes B capables de se réunir en
follicules (239)). La question de la néogenèse lymphoïde sur le plan évolutif
peut donc être envisagée sous deux angles : i) si la néogenèse lymphoïde est
efficace pour développer une réponse immune adaptative, quels avantages
198
procurent les organes lymphoïdes secondaires pour « justifier » leur
sélection ?, et ii) si la néogenèse est moins efficace que les organes
lymphoïdes secondaires, existe-t-il des raisons qui pourraient expliquer
qu’elle ait été conservée au cours de l ‘évolution ? Dans ce domaine, nous ne
pouvons que spéculer à partir des données éparses de la littérature. Nous
pensons que la néogenèse lymphoïde est moins efficace que les organes
lymphoïdes secondaires car i) le développement d’une réponse immune au
sein d’un environnement inflammatoire rend le contrôle de cette réponse plus
difficile, ii) le développement d’une réponse immune au sein d’un tissu lésé
pourrait favoriser la survenue d’une rupture de tolérance au soi, et iii) la
stimulation antigénique chronique de clones B dans un microenvironnement
inflammatoire pourrait favoriser l’échappement de clones lymphomateux. En
effet, de nombreux travaux dans la littérature (240) ainsi que nos propres
observations (cf paragraphe 3.5.2) ont démontré que le microenvironnement
inflammatoire influait directement sur les effecteurs immunitaires en modifiant
leur sensibilité à divers processus biologiques importants pour le contrôle de
la réponse inflammatoire (en premier lieu l’apoptose).
La réponse inflammatoire crée des dégâts tissulaires qui génèrent de
nombreux néoantigènes. La libération de protéases par les effecteurs de
l’immunité innée (neutrophiles et macrophages en particulier) et le stress
oxydatif favorisent l’apparition de néoépitopes (épitopes cryptiques ou « soi
modifié ») au niveau du foyer inflammatoire. La présentation de ces
néoépitopes dans un contexte de « danger immunologique » pourrait
favoriser la survenue d’une rupture de la tolérance périphérique et le
développement d’une réponse auto-immune amplifiant les dégâts tissulaires.
Des données récentes démontrant l’existence d’une réponse auto-immune
dirigée contre des protéines du « soi » exprimées par les greffons rejetés :
myosine (241) et vimentine (242) lors des rejets cardiaques, collagène
V (243) dans les rejets pulmonaires et agrine (244) dans les rejets rénaux,
viennent accréditer cette hypothèse.
La responsabilité d’une stimulation antigénique chronique dans la génération
de clones lymphomateux a été clairement démontrée dans les situations
inflammatoires consécutives aux infections chroniques. En effet, un traitement
éliminant le pathogène permet en général de traiter efficacement ces
lymphomes (245-247). De nombreuses références dans la littérature signalent
199
un risque accru de lymphome dans les autres pathologies inflammatoires
chroniques associées à la néogenèse lymphoïde (248, 249). Si l’origine du
clone lymphomateux (tissu lymphoïde ectopique versus organes lymphoïdes
secondaires) n’a pas été jusqu’ici clairement établie, il faut noter la fréquence
exceptionnellement élevée des lymphomes du greffon au cours du rejet (250)
ou du tube digestif au cours des infections chroniques par Helicobacter
pylori (246).
Si la néogenèse lymphoïde présente tous ces dangers, pourquoi existe-t-elle
toujours alors que les organes lymphoïdes secondaires sont maintenant en
place? Deux hypothèses peuvent être avancées: i) la néogenèse lymphoïde
ne subsiste actuellement que comme un reliquat archaïque amené à
disparaître, ou ii) la néogenèse lymphoïde a été maintenue activement par le
processus évolutif pour les bénéfices qu’elle procure. Nous penchons pour la
deuxième possibilité. La néogenèse lymphoïde pourrait avoir été conservée
comme un moyen de défense de secours contre certains pathogènes
particulièrement difficiles à détruire. Cette réponse au contact de l’antigène,
plus difficile à réguler, développant des spécificités originales et plus diverses
offre en effet toutes les qualités requises pour répondre aux antigènes peu
immunogènes ou capables d’évasion immunologique (d’origine infectieuse ou
tumorale). La néogenèse lymphoïde se révèle également la seule option pour
développer une réponse adaptative efficace lorsque les voies de
communications immunologiques (notamment les lymphatiques) sont
déficientes entre les organes lymphoïdes secondaires et le tissu cible. Dans
ces situations, il est raisonnable d’imaginer que la balance bénéfice/risque de
la néogenèse lymphoïde s’inverse ce qui pourrait expliquer sa sélection
comme « système de secours ». Ce bénéfice n’est pas évident dans les
autres situations inflammatoires chroniques (au cours desquelles la
néogenèse lymphoïde semble au contraire contribuer à exacerber le
processus pathologique) mais il faut souligner que ces dernières n’exercent
que peu ou pas de pression sur le processus de sélection.
4.4 La néogenèse lymphoïde comme cible thérapeutique
pour contrôler l’inflammation chronique
Dans ces pathologies inflammatoires chroniques (auto ou allo-immunes) où la
néogenèse lymphoïde joue un rôle délétère, il pourrait être intéressant de
200
développer de nouvelles stratégies thérapeutiques la prenant pour cible. En
effet, l’arsenal thérapeutique actuellement à notre disposition pour traiter les
pathologies inflammatoires chroniques est en pleine expansion (anti-
TNF (251), inhibiteur du second signal (252)...). Tous ces nouveaux
traitements ont des modes d’action différents mais tous tendent vers un
même objectif : l’augmentation du niveau global d’immunosuppression. Aussi,
si les gains thérapeutiques ont été relativement modestes, il n’en est pas de
même avec les complications infectieuses et cancéreuses qui sont devenues
des préoccupations prioritaires chez les cliniciens. Consciente de cette
situation, la recherche biomédicale a consenti des efforts importants dans le
domaine du traitement de l’inflammation mais la quasi totalité des équipes se
concentre sur une seule piste (devenue un véritable « Graal
immunologique ») : l’induction d’une tolérance spécifique. Deux écoles
s’affrontent : i) les partisans d’une tolérisation centrale, imposant le recours à
une greffe de moëlle (auto ou allo selon la nature des antigènes à
tolériser (253)), et ii) les tenants d’une tolérisation périphérique qui se
proposent d’utiliser des cellules dendritiques tolérogéniques ou la population
T régulatrice. Même si certains succès ont été récemment obtenus chez
l’homme (notamment dans le domaine de la transplantation par les partisans
de la tolérisation centrale (254)), ces stratégies thérapeutiques sont encore
loin d’être transposables en clinique courante. Nous pensons qu’une
troisième voie est possible. Nous avons vu plus haut que des progrès
importants ont été faits dans la compréhension des mécanismes participant à
l’extinction d’une réponse immuno-inflammatoire (cf paragraphe 2.1.1.3.4). La
manipulation de ces « freins » pourrait se révéler une piste thérapeutique
intéressante dans la prévention du passage à la chronicité de l’inflammation.
[NB : On pourrait objecter qu’une telle stratégie sera inopérante dans le cadre
des processus pathologiques auto- et allo-immuns qui nous intéressent
puisqu’ils se caractérisent par la persistance de l’antigène. La disparition de
l’antigène est-elle un préalable indispensable à l’extinction de la réponse ?
Sans doute pas, puisqu’il existe divers exemples au cours desquels le
système immunitaire cesse de réagir à un antigène qui reste détectable (telles
que les rémissions spontanées observées dans diverses pathologies auto-
immunes ou certains modèles expérimentaux chez l’animal (255, 256))]. Cette
stratégie présente l’avantage conceptuel de tirer parti de la réponse qu’elle
201
cherche à contrôler. En effet, chercher à contrôler une réponse immune déjà
initiée (contrairement aux stratégies de tolérisation « a priori ») permet de
profiter des processus physiologiques qui se mettent en place dans les
effecteurs immunitaires après leur recrutement. Un lymphocyte T activé est
ainsi plus sensible à l’apoptose grâce au processus d’AICD (activation
induced cell death). Les travaux de Bromberg et al (186) démontrent que
l’induction d’une tolérance immune est hautement dépendante du site
d’initiation de la réponse (les ganglions lymphatiques paraissant un site
privilégié pour induire une tolérisation). Les données dont nous disposons
suggèrent que la réponse locale pourrait au contraire être un site où la
réponse se perpétue (notamment à cause du microenvironnement
inflammatoire protégeant des effecteurs de l’apoptose). Contrôler une
réponse inflammatoire chronique pourrait donc passer par une
« reprogrammation de sa topologie » : réorienter la réponse vers les
ganglions et bloquer son développement local. Un tel objectif sera sans doute
difficile à atteindre tant les processus biologiques en cours dans les tissus
lymphoïdes ectopiques et « classiques » sont voisins. Une approche originale
pour atteindre cet objectif pourrait consister à utiliser des stratégies
thérapeutiques composites, i.e. utilisant à la fois des immunosuppresseurs et
des molécules ciblant d’autres mécanismes biologiques indispensables à
l’établissement du tissu lymphoïde ectopique (l’angiogenèse est un exemple).
Une autre possibilité pourrait « simplement » consister à rétablir les voies de
communications lymphatiques entre le tissu cible et le ganglion ce qui pourrait
suffire à laisser le ganglion lymphatique reprendre le contrôle. Pour conclure,
nous voudrions proposer une dernière piste de réflexion : plutôt que de
chercher à bloquer ou à faire disparaître le tissu lymphoïde ectopique, il
pourrait être plus fructueux de le détourner à notre profit. En comprenant
mieux en quoi le tissu lymphoïde ectopique diffère d’un ganglion lymphatique
classique, il sera peut-être possible de proposer des stratégies dans
lesquelles la néogenèse lymphoïde serait modifiée pour devenir un site de
tolérisation locale. A cet égard, on pourra citer un article récent suggérant que
dans certaines conditions, le tissu lymphoïde ectopique peut remplir ce
rôle (257). Nous gardons à l’esprit que notre vision du processus est biaisée.
En n’analysant que des greffons détransplantés, nous nous focalisons sur les
situations défavorables. Il est tout à fait concevable que le processus de
202
tolérisation locale ne soit pas aussi exceptionnel que nos résultats le laissent
croire (puisque les greffons ayant bénéficié de ce processus ne sont pas
détransplantés , ils échappent à notre analyse). Des données de plus en plus
nombreuses viennent étayer cette hypothèse en soulignant le potentiel
immunorégulateur des lymphocytes B. Pendant trop longtemps leur rôle dans
les réponses immunes a été cantonné à leur fonction de cellule productrice
d’ anticorps, éclipsant leur capacité à présenter l’antigène et à influencer le
microenvironnement immunitaire par le biais de la synthèse de cytokines.
Ainsi la littérature regorge de références rapportant l’effet bénéfique des
stratégies thérapeutiques B déplétantes dans diverses pathologies auto-
immunes, mais d’autres travaux soulignent l’aggravation de la réponse
inflammatoire en cas de déplétion B préalable dans plusieurs modèles
expérimentaux murins : encéphalite allergique expérimentale (258), arthrite
au collagène (259), hypersensibilité de contact (260), ou colite auto-
immune (261). L’effet protecteur des lymphocytes B a été documenté, chez la
souris, pour plusieurs sous-populations : B1-a péritonéales (CD5+), B2
transitionnelles de type 2 (CD1d+) et B de la zone marginale (CD1d+). Les
données actuelles ne sont pas en faveur de l’existence de « B-reg
naturelles » dont la seule fonction serait d’assurer une régulation des
processus immuns (par analogie avec les CD4+CD25+ FOXP3+ T reg). Le
modèle proposé par Fillatreau et al (262) suggère plutôt que n’importe clone
B peut remplir une fonction régulatrice s’il a été activé dans les conditions
adéquates. Cette activation semble se faire en deux étapes : une ligation de
certains TLR (2 ou 4) enclencherait le programme et devrait être suivie d’une
phase d’amplification nécessitant un signal BCR (donc une spécificité pour
l’antigène) et un signal CD40 (supposant une aide CD40L par un lymphocyte
T helper ou par un lymphocyte T avec un TCR invariant interagissant avec la
molécule HLA de classe Ib CD1d). Le mécanisme de régulation serait
dépendant de l’IL-10 (263). Cette fonction régulatrice s’exerce dans les
ganglions draînants où L’IL-10 des lymphocytes B supprime indirectement les
populations T effectrices (Th1 et Th17) en réduisant la production d’IL-12 et
d’IL-6 par les cellules dendritiques (264). Fait notable, une population de
lymphocytes B produisant de l’IL-10 a récemment été identifiée chez
l’homme (265).
203
5 Conclusions et perspectives
5.1 Conclusions
L’incapacité du système immunitaire à éliminer les antigènes cibles conduit
au passage à la chronicité de la réponse immune et transforme
l’inflammation, pièce maîtresse de la défense de notre organisme, en un
processus destructeur commun à de nombreuses situations pathologiques.
Les maladies inflammatoires chroniques, du fait des souffrances individuelles
qu’elles infligent aux patients et du coût qu’elles représentent pour notre
société, occupent une place centrale dans les préoccupations des soignants.
Malgré les recherches intensives dont elles font l’objet, les avancées
thérapeutiques sont restées relativement modestes et imposent encore la
prise d’un traitement au long cours responsable de nombreux effets
indésirables.
Au cours de notre travail de thèse nous avons utilisé le rejet d’allogreffe
comme modèle de pathologie inflammatoire chronique. Nous avons montré,
d’abord dans un modèle expérimental murin puis dans des tissus humains,
rejetés que l’infiltrat inflammatoire tend à s’organiser avec le temps pour
reconstituer un tissu lymphoïde ectopique fonctionnel supportant une réponse
locale autonome qui participe à la destruction du tissu. Ce processus, connu
sous le nom de « néogenèse lymphoïde », semble dépendre de la
récapitulation du programme biologique embryonnaire en charge de
l’ontogénie des organes lymphoïdes secondaires. Les mécanismes initiateurs
de la néogenèse lymphoïde ne sont pas clairement élucidés, mais pourraient
inclure un défaut de drainage lymphatique entre le tissu cible et les organes
lymphoïdes secondaires, sites habituels d’initiation et de contrôle de la
réponse immune. Il est tentant de spéculer que la néogenèse lymphoïde a
précisément été conservée par l’évolution comme un système de secours
archaïque permettant de développer une réponse adaptative protectrice
malgré une rupture de communication antigénique. Le caractère autonome et
plus agressif de la réponse locale suggère également un intérêt de la
néogenèse lymphoïde pour faire face à des cibles peu immunogènes ou
capables d’évasion immune. Ces aspects bénéfiques dans les situations
d’immunité anti-infectieuses ou anti-tumorales rendent la néogenèse
204
lymphoïde délétère dans les pathologies auto-immunes et allo-immunes et
suggèrent de la prendre comme cible thérapeutique. L’identification de
verrous moléculaires indispensables à la maturation de la réponse locale et
l’observation du rôle crucial de l’angiogenèse comme préalable à l’infiltration
du tissu par les effecteurs immunitaires sont autant de pistes thérapeutiques
potentielles à explorer dans les pathologies inflammatoires chroniques. A plus
long terme, il pourrait aussi être souhaitable de détourner ce tissu lymphoïde
ectopique pour le rendre capable de régulation (au lieu de le détruire).
5.2 Perspectives
Nous poursuivons actuellement la mise en place de notre biocollection de
tissus humains détransplantés en tentant d’élargir nos sources
d’approvisionnement à toute la France. En parallèle, nous tentons d’installer
dans notre équipe de recherche le modèle d’interposition aortique chez la
souris afin de pouvoir évaluer plus commodément, notamment par l’utilisation
d’animaux transgéniques, l’influence de certains gènes identifiés lors de notre
étude de la néogenèse lymphoïde chez l’homme.
A court terme, nous souhaitons nous concentrer sur les questions suivantes :
-L’analyse comparée des transcriptomes des tissus lymphoïdes ectopiques et des organes lymphoïdes secondaires « professionnels » (rates, ganglions, amygdales) permet-elle d’identifier des singularités
que nous pourrions utiliser comme cibles thérapeutiques pour inhiber spécifiquement la néogenèse lymphoïde sans créer d’immunosuppression systémique ?
Nous isolons, par microdissection laser, des centres germinatifs à partir de
coupes congelées de greffons rénaux détransplantés, de ganglions
lymphatiques et de rates. Pour chaque échantillon, plusieurs (n=3-5) centres
germinatifs sont ainsi isolés. Le transcriptome des centres germinatifs est
analysé par la technique des puces à ADN. Notre analyse comporte plusieurs
niveaux de comparaisons statistiques : entre centres germinatifs provenant
du même échantillon, provenant d’échantillons différents mais de même
nature, provenant de tissus lymphoïdes de natures différentes.
-La néogenèse lymphoïde favorise-t-elle la rupture de tolérance au soi par le « spreading » de la réponse immunitaire vers des néoépitopes
provenant de protéines non allogéniques du tissu cible?
205
L’analyse de l’intensité et de la spécificité des réponses humorales locales
dirigées contre des protéines non-allogéniques de l’organe rejeté sont en
cours. Nous chercherons ensuite à corréler une éventuelle rupture de
tolérance au : i) degré de maturation de la réponse humorale locale, ii) à la
présence de population T-CD4+ particulières (Th17, T follicular helper…).
-La stimulation chronique des clones B au sein du microenvironnement inflammatoire caractérisant le tissu lymphoïde ectopique favorise-t-elle
les processus de lymphomagenèse ? Une publication récente par le groupe du Kremlin Bicêtre (266) suggère que
les lymphomes tardifs des patients immunosupprimés partagent une
physiopathologie commune baptisée « mutator pathway » et caractérisée par
l’instabilité des microsatellites. En collaboration avec cette équipe, nous
cherchons a évaluer le degré d’instabilité des microsatellites dans les cellules
B provenant des centres germinatifs ectopiques microdisséqués par rapport à
ceux des organes lymphoïdes secondaires « professionnels ». Si nous
observons une plus grande instabilité des microsatellites dans les cellules B
des centres germinatifs ectopiques, nous tenterons de corréler ce phénomène
avec le niveau d’expression de certaines enzymes impliquées dans la
mutation ou la réparation de l’ADN.
206
6 Références bibliographiques 1. Hunter, J. 1794. A treatise of the blood inflammation, and gunshot
wounds. Nicoll, J., London.
2. Cohnheim, J. 1889. Lectures in general pathology. In New Sydenham
Society, London.
3. Stearns, S., and J. Koella. 2008. Evolution in Health and Disease.
Oxford University Press.
4. Bunting, M., E. S. Harris, T. M. McIntyre, S. M. Prescott, and G. A.
Zimmerman. 2002. Leukocyte adhesion deficiency syndromes: adhesion and
tethering defects involving beta 2 integrins and selectin ligands. Current
opinion in hematology 9:30-35.
5. Biesma, D. H., A. J. Hannema, H. van Velzen-Blad, L. Mulder, R. van
Zwieten, I. Kluijt, and D. Roos. 2001. A family with complement factor D
deficiency. The Journal of clinical investigation 108:233-240.
6. Libby, P. 2002. Inflammation in atherosclerosis. Nature 420:868-874.
7. Meyer, T., and E. Stockfleth. 2008. Clinical investigations of Toll-like
receptor agonists. Expert opinion on investigational drugs 17:1051-1065.
8. Medzhitov, R. 2008. Origin and physiological roles of inflammation.
Nature 454:428-435.
9. Medzhitov, R., and C. A. Janeway, Jr. 1997. Innate immunity: the
virtues of a nonclonal system of recognition. Cell 91:295-298.
10. Chen, G., M. H. Shaw, Y. G. Kim, and G. Nuñez. 2009. Nod-like
Receptors: Role in Innate Immunity and Inflammatory Disease. Annual
Review of Pathology: Mechanisms of Disease 4:Epub ahead of print.
11. Gay, N. J., and M. Gangloff. 2007. Structure and function of Toll
receptors and their ligands. Annual review of biochemistry 76:141-165.
12. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annual
review of immunology 21:335-376.
13. Mariathasan, S., D. S. Weiss, K. Newton, J. McBride, K. O'Rourke, M.
Roose-Girma, W. P. Lee, Y. Weinrauch, D. M. Monack, and V. M. Dixit. 2006.
Cryopyrin activates the inflammasome in response to toxins and ATP. Nature
440:228-232.
14. Okazawa, H., S. Motegi, N. Ohyama, H. Ohnishi, T. Tomizawa, Y.
Kaneko, P. A. Oldenborg, O. Ishikawa, and T. Matozaki. 2005. Negative
207
regulation of phagocytosis in macrophages by the CD47-SHPS-1 system. J
Immunol 174:2004-2011.
15. Dostert, C., V. Petrilli, R. Van Bruggen, C. Steele, B. T. Mossman, and
J. Tschopp. 2008. Innate immune activation through Nalp3 inflammasome
sensing of asbestos and silica. Science (New York, NY 320:674-677.
16. Rock, K. L., and H. Kono. 2008. The inflammatory response to cell
death. Annual review of pathology 3:99-126.
17. Julius, D., and A. I. Basbaum. 2001. Molecular mechanisms of
nociception. Nature 413:203-210.
18. Hofmann, M. A., S. Drury, C. Fu, W. Qu, A. Taguchi, Y. Lu, C. Avila, N.
Kambham, A. Bierhaus, P. Nawroth, M. F. Neurath, T. Slattery, D. Beach, J.
McClary, M. Nagashima, J. Morser, D. Stern, and A. M. Schmidt. 1999. RAGE
mediates a novel proinflammatory axis: a central cell surface receptor for
S100/calgranulin polypeptides. Cell 97:889-901.
19. Park, J. S., F. Gamboni-Robertson, Q. He, D. Svetkauskaite, J. Y. Kim,
D. Strassheim, J. W. Sohn, S. Yamada, I. Maruyama, A. Banerjee, A.
Ishizaka, and E. Abraham. 2006. High mobility group box 1 protein interacts
with multiple Toll-like receptors. American journal of physiology 290:C917-
924.
20. Keller, M., A. Ruegg, S. Werner, and H. D. Beer. 2008. Active caspase-
1 is a regulator of unconventional protein secretion. Cell 132:818-831.
21. Chen, G., J. Li, M. Ochani, B. Rendon-Mitchell, X. Qiang, S. Susarla, L.
Ulloa, H. Yang, S. Fan, S. M. Goyert, P. Wang, K. J. Tracey, A. E. Sama, and
H. Wang. 2004. Bacterial endotoxin stimulates macrophages to release
HMGB1 partly through CD14- and TNF-dependent mechanisms. Journal of
leukocyte biology 76:994-1001.
22. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, and R.
Medzhitov. 2004. Recognition of commensal microflora by toll-like receptors is
required for intestinal homeostasis. Cell 118:229-241.
23. Vermeer, P. D., L. A. Einwalter, T. O. Moninger, T. Rokhlina, J. A.
Kern, J. Zabner, and M. J. Welsh. 2003. Segregation of receptor and ligand
regulates activation of epithelial growth factor receptor. Nature 422:322-326.
24. Majno, G., and I. Joris. 2004. Cells, Tissues and Disease. (Oxford
Univiversity Press.
208
25. Brownlee, M., A. Cerami, and H. Vlassara. 1988. Advanced
glycosylation end products in tissue and the biochemical basis of diabetic
complications. The New England journal of medicine 318:1315-1321.
26. Yan, S. F., G. R. Barile, V. D'Agati, S. Du Yan, R. Ramasamy, and A.
M. Schmidt. 2007. The biology of RAGE and its ligands: uncovering
mechanisms at the heart of diabetes and its complications. Current diabetes
reports 7:146-153.
27. Navab, M., G. M. Anantharamaiah, S. T. Reddy, B. J. Van Lenten, B. J.
Ansell, and A. M. Fogelman. 2006. Mechanisms of disease: proatherogenic
HDL--an evolving field. Nature clinical practice 2:504-511.
28. Jiang, D., J. Liang, J. Fan, S. Yu, S. Chen, Y. Luo, G. D. Prestwich, M.
M. Mascarenhas, H. G. Garg, D. A. Quinn, R. J. Homer, D. R. Goldstein, R.
Bucala, P. J. Lee, R. Medzhitov, and P. W. Noble. 2005. Regulation of lung
injury and repair by Toll-like receptors and hyaluronan. Nature medicine
11:1173-1179.
29. Jiang, D., J. Liang, and P. W. Noble. 2007. Hyaluronan in tissue injury
and repair. Annual review of cell and developmental biology 23:435-461.
30. Kumar, V., R. S. Cotran, and S. L. Robbins. 2003. Robbins Basic
Pathology. Saunders.
31. Higgs, G. A., S. Moncada, and J. R. Vane. 1984. Eicosanoids in
inflammation. Annals of clinical research 16:287-299.
32. Serhan, C. N., and J. Savill. 2005. Resolution of inflammation: the
beginning programs the end. Nature immunology 6:1191-1197.
33. Dinarello, C. A. 2003. Interleukin-1 Family of Ligands and Receptors. In
Fundamental Immunology, 5th ed. W. Paul, ed. Lippincott Williams & Wilkins,
Philadelphia. 775-800.
34. Moldawer, L. L. 2003. The Tumor Necrosis Factor Superfamily and Its
Receptors In Fundamental Immunology, 5th ed. W. Paul, ed. Lippincott
Williams & Wilkins, Philadelphia. 749-774.
35. Warren, J. L. 2003. Type I Cytokines and Interferons and Their
Receptors. In Fundamental Immunology, 5th ed. W. Paul, ed. Lippincott
Williams & Wilkins, Philadelphia. 701-748.
36. Rot, A., and U. H. von Andrian. 2004. Chemokines in innate and
adaptive host defense: basic chemokinese grammar for immune cells. Annual
review of immunology 22:891-928.
209
37. Cyster, J. G. 1999. Chemokines and cell migration in secondary
lymphoid organs. Science (New York, NY 286:2098-2102.
38. Sallusto, F., C. R. Mackay, and A. Lanzavecchia. 2000. The role of
chemokine receptors in primary, effector, and memory immune responses.
Annual review of immunology 18:593-620.
39. Sallusto, F., D. Lenig, R. Forster, M. Lipp, and A. Lanzavecchia. 1999.
Two subsets of memory T lymphocytes with distinct homing potentials and
effector functions. Nature 401:708-712.
40. Benoist, C., and D. Mathis. 2002. Mast cells in autoimmune disease.
Nature 420:875-878.
41. Steinhoff, M., N. Vergnolle, S. H. Young, M. Tognetto, S. Amadesi, H.
S. Ennes, M. Trevisani, M. D. Hollenberg, J. L. Wallace, G. H. Caughey, S. E.
Mitchell, L. M. Williams, P. Geppetti, E. A. Mayer, and N. W. Bunnett. 2000.
Agonists of proteinase-activated receptor 2 induce inflammation by a
neurogenic mechanism. Nature medicine 6:151-158.
42. Riewald, M., R. J. Petrovan, A. Donner, B. M. Mueller, and W. Ruf.
2002. Activation of endothelial cell protease activated receptor 1 by the
protein C pathway. Science (New York, NY 296:1880-1882.
43. Muller, W. A. 2002. Leukocyte-endothelial cell interactions in the
inflammatory response. Laboratory investigation; a journal of technical
methods and pathology 82:521-533.
44. van der Poll, T. 2001. Coagulation and inflammation. Journal of
endotoxin research 7:301-304.
45. Witko-Sarsat, V., P. Rieu, B. Descamps-Latscha, P. Lesavre, and L.
Halbwachs-Mecarelli. 2000. Neutrophils: molecules, functions and
pathophysiological aspects. Laboratory investigation; a journal of technical
methods and pathology 80:617-653.
46. Baggiolini, M., and I. Clark-Lewis. 1992. Interleukin-8, a chemotactic
and inflammatory cytokine. FEBS letters 307:97-101.
47. Nathan, C., Q. W. Xie, L. Halbwachs-Mecarelli, and W. W. Jin. 1993.
Albumin inhibits neutrophil spreading and hydrogen peroxide release by
blocking the shedding of CD43 (sialophorin, leukosialin). The Journal of cell
biology 122:243-256.
48. Fuchs, T. A., U. Abed, C. Goosmann, R. Hurwitz, I. Schulze, V. Wahn,
Y. Weinrauch, V. Brinkmann, and A. Zychlinsky. 2007. Novel cell death
210
program leads to neutrophil extracellular traps. The Journal of cell biology
176:231-241.
49. Leto, T. L., A. G. Adams, and I. de Mendez. 1994. Assembly of the
phagocyte NADPH oxidase: binding of Src homology 3 domains to proline-
rich targets. Proceedings of the National Academy of Sciences of the United
States of America 91:10650-10654.
50. Roos, D., R. van Bruggen, and C. Meischl. 2003. Oxidative killing of
microbes by neutrophils. Microbes and infection / Institut Pasteur 5:1307-
1315.
51. Weiss, S. J. 1989. Tissue destruction by neutrophils. The New England
journal of medicine 320:365-376.
52. Serbina, N. V., T. Jia, T. M. Hohl, and E. G. Pamer. 2008. Monocyte-
mediated defense against microbial pathogens. Annual review of immunology
26:421-452.
53. Morgan, J. G., H. A. Pereira, T. Sukiennicki, J. K. Spitznagel, and J. W.
Larrick. 1991. Human neutrophil granule cationic protein CAP37 is a specific
macrophage chemotaxin that shares homology with inflammatory proteinases.
Advances in experimental medicine and biology 305:89-96.
54. Geissmann, F., S. Jung, and D. R. Littman. 2003. Blood monocytes
consist of two principal subsets with distinct migratory properties. Immunity
19:71-82.
55. Shortman, K., and S. H. Naik. 2007. Steady-state and inflammatory
dendritic-cell development. Nature reviews 7:19-30.
56. Wu, L., and Y. J. Liu. 2007. Development of dendritic-cell lineages.
Immunity 26:741-750.
57. Stark, M. A., Y. Huo, T. L. Burcin, M. A. Morris, T. S. Olson, and K.
Ley. 2005. Phagocytosis of apoptotic neutrophils regulates granulopoiesis via
IL-23 and IL-17. Immunity 22:285-294.
58. Kuwana, M., Y. Okazaki, H. Kodama, K. Izumi, H. Yasuoka, Y. Ogawa,
Y. Kawakami, and Y. Ikeda. 2003. Human circulating CD14+ monocytes as a
source of progenitors that exhibit mesenchymal cell differentiation. Journal of
leukocyte biology 74:833-845.
59. Hurst, S. M., T. S. Wilkinson, R. M. McLoughlin, S. Jones, S. Horiuchi,
N. Yamamoto, S. Rose-John, G. M. Fuller, N. Topley, and S. A. Jones. 2001.
211
Il-6 and its soluble receptor orchestrate a temporal switch in the pattern of
leukocyte recruitment seen during acute inflammation. Immunity 14:705-714.
60. Matzinger, P. 2002. The danger model: a renewed sense of self.
Science (New York, NY 296:301-305.
61. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai,
and T. Honjo. 2000. Class switch recombination and hypermutation require
activation-induced cytidine deaminase (AID), a potential RNA editing enzyme.
Cell 102:553-563.
62. Levy, B. D., C. B. Clish, B. Schmidt, K. Gronert, and C. N. Serhan.
2001. Lipid mediator class switching during acute inflammation: signals in
resolution. Nature immunology 2:612-619.
63. Mizumoto, N., T. Kumamoto, S. C. Robson, J. Sevigny, H. Matsue, K.
Enjyoji, and A. Takashima. 2002. CD39 is the dominant Langerhans cell-
associated ecto-NTPDase: modulatory roles in inflammation and immune
responsiveness. Nature medicine 8:358-365.
64. Hoek, R. M., S. R. Ruuls, C. A. Murphy, G. J. Wright, R. Goddard, S.
M. Zurawski, B. Blom, M. E. Homola, W. J. Streit, M. H. Brown, A. N. Barclay,
and J. D. Sedgwick. 2000. Down-regulation of the macrophage lineage
through interaction with OX2 (CD200). Science (New York, NY 290:1768-
1771.
65. Daheshia, M., D. S. Friend, M. J. Grusby, K. F. Austen, and H. R. Katz.
2001. Increased severity of local and systemic anaphylactic reactions in
gp49B1-deficient mice. The Journal of experimental medicine 194:227-234.
66. Philippidis, P., J. C. Mason, B. J. Evans, I. Nadra, K. M. Taylor, D. O.
Haskard, and R. C. Landis. 2004. Hemoglobin scavenger receptor CD163
mediates interleukin-10 release and heme oxygenase-1 synthesis:
antiinflammatory monocyte-macrophage responses in vitro, in resolving skin
blisters in vivo, and after cardiopulmonary bypass surgery. Circulation
research 94:119-126.
67. Borovikova, L. V., S. Ivanova, M. Zhang, H. Yang, G. I. Botchkina, L. R.
Watkins, H. Wang, N. Abumrad, J. W. Eaton, and K. J. Tracey. 2000. Vagus
nerve stimulation attenuates the systemic inflammatory response to
endotoxin. Nature 405:458-462.
68. Tracey, K. J. 2002. The inflammatory reflex. Nature 420:853-859.
212
69. Wang, H., M. Yu, M. Ochani, C. A. Amella, M. Tanovic, S. Susarla, J.
H. Li, H. Wang, H. Yang, L. Ulloa, Y. Al-Abed, C. J. Czura, and K. J. Tracey.
2003. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator
of inflammation. Nature 421:384-388.
70. Gaillard, R. C. 2001. Interaction between the hypothalamo-pituitary-
adrenal axis and the immunological system. Annales d'endocrinologie 62:155-
163.
71. Giles, K. M., K. Ross, A. G. Rossi, N. A. Hotchin, C. Haslett, and I.
Dransfield. 2001. Glucocorticoid augmentation of macrophage capacity for
phagocytosis of apoptotic cells is associated with reduced p130Cas
expression, loss of paxillin/pyk2 phosphorylation, and high levels of active
Rac. J Immunol 167:976-986.
72. Ashcroft, G. S., K. Lei, W. Jin, G. Longenecker, A. B. Kulkarni, T.
Greenwell-Wild, H. Hale-Donze, G. McGrady, X. Y. Song, and S. M. Wahl.
2000. Secretory leukocyte protease inhibitor mediates non-redundant
functions necessary for normal wound healing. Nature medicine 6:1147-1153.
73. Jin, F. Y., C. Nathan, D. Radzioch, and A. Ding. 1997. Secretory
leukocyte protease inhibitor: a macrophage product induced by and
antagonistic to bacterial lipopolysaccharide. Cell 88:417-426.
74. Zhu, J., C. Nathan, W. Jin, D. Sim, G. S. Ashcroft, S. M. Wahl, L.
Lacomis, H. Erdjument-Bromage, P. Tempst, C. D. Wright, and A. Ding. 2002.
Conversion of proepithelin to epithelins: roles of SLPI and elastase in host
defense and wound repair. Cell 111:867-878.
75. Teder, P., R. W. Vandivier, D. Jiang, J. Liang, L. Cohn, E. Pure, P. M.
Henson, and P. W. Noble. 2002. Resolution of lung inflammation by CD44.
Science (New York, NY 296:155-158.
76. Fadok, V. A., D. L. Bratton, and P. M. Henson. 2001. Phagocyte
receptors for apoptotic cells: recognition, uptake, and consequences. The
Journal of clinical investigation 108:957-962.
77. Huynh, M. L., V. A. Fadok, and P. M. Henson. 2002.
Phosphatidylserine-dependent ingestion of apoptotic cells promotes TGF-
beta1 secretion and the resolution of inflammation. The Journal of clinical
investigation 109:41-50.
78. Bellingan, G. J., H. Caldwell, S. E. Howie, I. Dransfield, and C. Haslett.
1996. In vivo fate of the inflammatory macrophage during the resolution of
213
inflammation: inflammatory macrophages do not die locally, but emigrate to
the draining lymph nodes. J Immunol 157:2577-2585.
79. Bellingan, G. J., P. Xu, H. Cooksley, H. Cauldwell, A. Shock, S.
Bottoms, C. Haslett, S. E. Mutsaers, and G. J. Laurent. 2002. Adhesion
molecule-dependent mechanisms regulate the rate of macrophage clearance
during the resolution of peritoneal inflammation. The Journal of experimental
medicine 196:1515-1521.
80. Hodge-Dufour, J., M. W. Marino, M. R. Horton, A. Jungbluth, M. D.
Burdick, R. M. Strieter, P. W. Noble, C. A. Hunter, and E. Pure. 1998.
Inhibition of interferon gamma induced interleukin 12 production: a potential
mechanism for the anti-inflammatory activities of tumor necrosis factor.
Proceedings of the National Academy of Sciences of the United States of
America 95:13806-13811.
81. Marino, M. W., A. Dunn, D. Grail, M. Inglese, Y. Noguchi, E. Richards,
A. Jungbluth, H. Wada, M. Moore, B. Williamson, S. Basu, and L. J. Old.
1997. Characterization of tumor necrosis factor-deficient mice. Proceedings of
the National Academy of Sciences of the United States of America 94:8093-
8098.
82. Clark, R. A., and S. J. Klebanoff. 1979. Chemotactic factor inactivation
by the myeloperoxidase-hydrogen peroxide-halide system. The Journal of
clinical investigation 64:913-920.
83. Morgenstern, D. E., M. A. Gifford, L. L. Li, C. M. Doerschuk, and M. C.
Dinauer. 1997. Absence of respiratory burst in X-linked chronic
granulomatous disease mice leads to abnormalities in both host defense and
inflammatory response to Aspergillus fumigatus. The Journal of experimental
medicine 185:207-218.
84. Bogdan, C. 2001. Nitric oxide and the immune response. Nature
immunology 2:907-916.
85. Nathan, C. 1997. Inducible nitric oxide synthase: what difference does
it make? The Journal of clinical investigation 100:2417-2423.
86. Prineas, J. W. 1979. Multiple sclerosis: presence of lymphatic
capillaries and lymphoid tissue in the brain and spinal cord. Science (New
York, NY 203:1123-1125.
214
87. Young, C. L., T. C. Adamson, 3rd, J. H. Vaughan, and R. I. Fox. 1984.
Immunohistologic characterization of synovial membrane lymphocytes in
rheumatoid arthritis. Arthritis and rheumatism 27:32-39.
88. Drayton, D. L., S. Liao, R. H. Mounzer, and N. H. Ruddle. 2006.
Lymphoid organ development: from ontogeny to neogenesis. Nature
immunology 7:344-353.
89. Schroder, A. E., A. Greiner, C. Seyfert, and C. Berek. 1996.
Differentiation of B cells in the nonlymphoid tissue of the synovial membrane
of patients with rheumatoid arthritis. Proceedings of the National Academy of
Sciences of the United States of America 93:221-225.
90. Armengol, M. P., M. Juan, A. Lucas-Martin, M. T. Fernandez-Figueras,
D. Jaraquemada, T. Gallart, and R. Pujol-Borrell. 2001. Thyroid autoimmune
disease: demonstration of thyroid antigen-specific B cells and recombination-
activating gene expression in chemokine-containing active intrathyroidal
germinal centers. The American journal of pathology 159:861-873.
91. Nasr, I. W., M. Reel, M. H. Oberbarnscheidt, R. H. Mounzer, F. K.
Baddoura, N. H. Ruddle, and F. G. Lakkis. 2007. Tertiary lymphoid tissues
generate effector and memory T cells that lead to allograft rejection. Am J
Transplant 7:1071-1079.
92. Lee, Y., R. K. Chin, P. Christiansen, Y. Sun, A. V. Tumanov, J. Wang,
A. V. Chervonsky, and Y. X. Fu. 2006. Recruitment and activation of naive T
cells in the islets by lymphotoxin beta receptor-dependent tertiary lymphoid
structure. Immunity 25:499-509.
93. Aloisi, F., and R. Pujol-Borrell. 2006. Lymphoid neogenesis in chronic
inflammatory diseases. Nature reviews 6:205-217.
94. Kalluri, R., and E. G. Neilson. 2003. Epithelial-mesenchymal transition
and its implications for fibrosis. The Journal of clinical investigation 112:1776-
1784.
95. Zeisberg, M., J. Hanai, H. Sugimoto, T. Mammoto, D. Charytan, F.
Strutz, and R. Kalluri. 2003. BMP-7 counteracts TGF-beta1-induced epithelial-
to-mesenchymal transition and reverses chronic renal injury. Nature medicine
9:964-968.
96. Djonov, V., M. Schmid, S. A. Tschanz, and P. H. Burri. 2000.
Intussusceptive angiogenesis: its role in embryonic vascular network
formation. Circulation research 86:286-292.
215
97. Folkman, J. 1971. Tumor angiogenesis: therapeutic implications. The
New England journal of medicine 285:1182-1186.
98. Folkman, J., E. Merler, C. Abernathy, and G. Williams. 1971. Isolation
of a tumor factor responsible for angiogenesis. The Journal of experimental
medicine 133:275-288.
99. Carmeliet, P. 2000. Mechanisms of angiogenesis and arteriogenesis.
Nature medicine 6:389-395.
100. Hanahan, D., and J. Folkman. 1996. Patterns and emerging
mechanisms of the angiogenic switch during tumorigenesis. Cell 86:353-364.
101. Chu, S. C., C. H. Tsai, S. F. Yang, F. M. Huang, Y. F. Su, Y. S. Hsieh,
and Y. C. Chang. 2004. Induction of vascular endothelial growth factor gene
expression by proinflammatory cytokines in human pulp and gingival
fibroblasts. Journal of endodontics 30:704-707.
102. Weis, S. M., and D. A. Cheresh. 2005. Pathophysiological
consequences of VEGF-induced vascular permeability. Nature 437:497-504.
103. Reinders, M. E., M. Sho, A. Izawa, P. Wang, D. Mukhopadhyay, K. E.
Koss, C. S. Geehan, A. D. Luster, M. H. Sayegh, and D. M. Briscoe. 2003.
Proinflammatory functions of vascular endothelial growth factor in
alloimmunity. The Journal of clinical investigation 112:1655-1665.
104. Min, J. K., Y. M. Lee, J. H. Kim, Y. M. Kim, S. W. Kim, S. Y. Lee, Y. S.
Gho, G. T. Oh, and Y. G. Kwon. 2005. Hepatocyte growth factor suppresses
vascular endothelial growth factor-induced expression of endothelial ICAM-1
and VCAM-1 by inhibiting the nuclear factor-kappaB pathway. Circulation
research 96:300-307.
105. Mor, F., F. J. Quintana, and I. R. Cohen. 2004. Angiogenesis-
inflammation cross-talk: vascular endothelial growth factor is secreted by
activated T cells and induces Th1 polarization. J Immunol 172:4618-4623.
106. Thurston, G., P. Baluk, and D. M. McDonald. 2000. Determinants of
endothelial cell phenotype in venules. Microcirculation 7:67-80.
107. Smith, C., and B. K. Henon. 1959. Histological and histochemical study
of high endothelium of post-capillary veins of the lymph node. The Anatomical
record 135:207-213.
108. Berg, E. L., M. K. Robinson, R. A. Warnock, and E. C. Butcher. 1991.
The human peripheral lymph node vascular addressin is a ligand for LECAM-
216
1, the peripheral lymph node homing receptor. The Journal of cell biology
114:343-349.
109. Streeter, P. R., E. L. Berg, B. T. Rouse, R. F. Bargatze, and E. C.
Butcher. 1988. A tissue-specific endothelial cell molecule involved in
lymphocyte homing. Nature 331:41-46.
110. Hemmerich, S., E. C. Butcher, and S. D. Rosen. 1994. Sulfation-
dependent recognition of high endothelial venules (HEV)-ligands by L-selectin
and MECA 79, and adhesion-blocking monoclonal antibody. The Journal of
experimental medicine 180:2219-2226.
111. Freemont, A. J. 1983. A possible route for lymphocyte migration into
diseased tissues. Journal of clinical pathology 36:161-166.
112. Duijvestijn, A. M., M. Kerkhove, R. F. Bargatze, and E. C. Butcher.
1987. Lymphoid tissue- and inflammation-specific endothelial cell
differentiation defined by monoclonal antibodies. J Immunol 138:713-719.
113. Zhang, Z., X. Wu, B. H. Limbaugh, and S. L. Bridges, Jr. 2001.
Expression of recombination-activating genes and terminal deoxynucleotidyl
transferase and secondary rearrangement of immunoglobulin kappa light
chains in rheumatoid arthritis synovial tissue. Arthritis and rheumatism
44:2275-2284.
114. Alitalo, K., T. Tammela, and T. V. Petrova. 2005. Lymphangiogenesis
in development and human disease. Nature 438:946-953.
115. Cursiefen, C., L. Chen, L. P. Borges, D. Jackson, J. Cao, C.
Radziejewski, P. A. D'Amore, M. R. Dana, S. J. Wiegand, and J. W. Streilein.
2004. VEGF-A stimulates lymphangiogenesis and hemangiogenesis in
inflammatory neovascularization via macrophage recruitment. The Journal of
clinical investigation 113:1040-1050.
116. Ristimaki, A., K. Narko, B. Enholm, V. Joukov, and K. Alitalo. 1998.
Proinflammatory cytokines regulate expression of the lymphatic endothelial
mitogen vascular endothelial growth factor-C. The Journal of biological
chemistry 273:8413-8418.
117. Makinen, T., T. Veikkola, S. Mustjoki, T. Karpanen, B. Catimel, E. C.
Nice, L. Wise, A. Mercer, H. Kowalski, D. Kerjaschki, S. A. Stacker, M. G.
Achen, and K. Alitalo. 2001. Isolated lymphatic endothelial cells transduce
growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3.
The EMBO journal 20:4762-4773.
217
118. Baluk, P., T. Tammela, E. Ator, N. Lyubynska, M. G. Achen, D. J.
Hicklin, M. Jeltsch, T. V. Petrova, B. Pytowski, S. A. Stacker, S. Yla-Herttuala,
D. G. Jackson, K. Alitalo, and D. M. McDonald. 2005. Pathogenesis of
persistent lymphatic vessel hyperplasia in chronic airway inflammation. The
Journal of clinical investigation 115:247-257.
119. Irjala, H., E. L. Johansson, R. Grenman, K. Alanen, M. Salmi, and S.
Jalkanen. 2001. Mannose receptor is a novel ligand for L-selectin and
mediates lymphocyte binding to lymphatic endothelium. The Journal of
experimental medicine 194:1033-1042.
120. Salmi, M., K. Koskinen, T. Henttinen, K. Elima, and S. Jalkanen. 2004.
CLEVER-1 mediates lymphocyte transmigration through vascular and
lymphatic endothelium. Blood 104:3849-3857.
121. Nibbs, R. J., E. Kriehuber, P. D. Ponath, D. Parent, S. Qin, J. D.
Campbell, A. Henderson, D. Kerjaschki, D. Maurer, G. J. Graham, and A. Rot.
2001. The beta-chemokine receptor D6 is expressed by lymphatic
endothelium and a subset of vascular tumors. The American journal of
pathology 158:867-877.
122. Nathan, C. 2002. Points of control in inflammation. Nature 420:846-
852.
123. Schur, P. H. 1978. Genetics of complement deficiencies associated
with lupus-like syndromes. Arthritis and rheumatism 21:S153-160.
124. Swann, J. B., and M. J. Smyth. 2007. Immune surveillance of tumors.
The Journal of clinical investigation 117:1137-1146.
125. Bei, R., L. Masuelli, C. Palumbo, I. Tresoldi, A. Scardino, and A.
Modesti. 2008. Long-lasting tissue inflammatory processes trigger
autoimmune responses to extracellular matrix molecules. International
reviews of immunology 27:137-175.
126. Buckley, C. D., D. Pilling, J. M. Lord, A. N. Akbar, D. Scheel-Toellner,
and M. Salmon. 2001. Fibroblasts regulate the switch from acute resolving to
chronic persistent inflammation. Trends in immunology 22:199-204.
127. Douglas, M. R., K. E. Morrison, M. Salmon, and C. D. Buckley. 2002.
Why does inflammation persist: a dominant role for the stromal
microenvironment? Expert reviews in molecular medicine 4:1-18.
218
128. Akbar, A. N., J. M. Lord, and M. Salmon. 2000. IFN-alpha and IFN-
beta: a link between immune memory and chronic inflammation. Immunology
today 21:337-342.
129. Oeconomos, N., J. Hamburger, P. Delinotte, J. Vaysse, G. Richet, B.
Antoine, E. Elmelik, and C. Perrin. 1953. [Attempt at renal homograft
(maternal kidney) after nephrectomy for traumatism of a lone kidney.].
Memoires 79:642-652.
130. Dausset, J., and H. Brecy. 1957. Identical nature of the leucocyte
antigens detectable in monozygotic twins by means of immune iso-leuco-
agglutinins. Nature 180:1430.
131. Snell, G. D., and G. F. Higgins. 1951. Alleles at the histocompatibility-2
locus in the mouse as determined by tumor transplantation. Genetics 36:306-
310.
132. Calne, R. Y., J. R. Wheeler, and B. A. Hurn. 1965. Combined
Immunosuppressive Action of Phytohaemagglutinin and Azathioprine (Imuran)
on Dogs with Renal Homotransplants. British medical journal 2:154-155.
133. Murray, J. E., J. P. Merrill, G. J. Dammin, J. B. Dealy, Jr., G. W.
Alexandre, and J. H. Harrison. 1962. Kidney transplantation in modified
recipients. Annals of surgery 156:337-355.
134. Hamburger, J., J. Crosnier, J. Vaysse, J. Auvert, J. Dormont, C. M.
Lalanne, C. Perret, and B. Rueff. 1961. [Presentation of 3 patients treated
with renal transplantation for advanced chronic uremia.]. Bulletins et
memoires de la Societe medicale des hopitaux de Paris 77:649-650.
135. Starzl, T. E., C. G. Groth, L. Brettschneider, I. Penn, V. A. Fulginiti, J.
B. Moon, H. Blanchard, A. J. Martin, Jr., and K. A. Porter. 1968. Orthotopic
homotransplantation of the human liver. Annals of surgery 168:392-415.
136. Barnard, C. N. 1968. Human cardiac transplantation. An evaluation of
the first two operations performed at the Groote Schuur Hospital, Cape Town.
The American journal of cardiology 22:584-596.
137. Dubernard, J. M., B. Lengele, E. Morelon, S. Testelin, L. Badet, C.
Moure, J. L. Beziat, S. Dakpe, J. Kanitakis, C. D'Hauthuille, A. El Jaafari, P.
Petruzzo, N. Lefrancois, F. Taha, A. Sirigu, G. Di Marco, E. Carmi, D.
Bachmann, S. Cremades, P. Giraux, G. Burloux, O. Hequet, N. Parquet, C.
Frances, M. Michallet, X. Martin, and B. Devauchelle. 2007. Outcomes 18
219
months after the first human partial face transplantation. The New England
journal of medicine 357:2451-2460.
138. Dubernard, J. M., E. Owen, G. Herzberg, M. Lanzetta, X. Martin, H.
Kapila, M. Dawahra, and N. S. Hakim. 1999. Human hand allograft: report on
first 6 months. Lancet 353:1315-1320.
139. Jofre, R., J. M. Lopez-Gomez, F. Moreno, D. Sanz-Guajardo, and F.
Valderrabano. 1998. Changes in quality of life after renal transplantation. Am
J Kidney Dis 32:93-100.
140. Keown, P. 2001. Improving quality of life--the new target for
transplantation. Transplantation 72:S67-74.
141. Laupacis, A., P. Keown, N. Pus, H. Krueger, B. Ferguson, C. Wong,
and N. Muirhead. 1996. A study of the quality of life and cost-utility of renal
transplantation. Kidney international 50:235-242.
142. Meier-Kriesche, H. U., J. D. Schold, and B. Kaplan. 2004. Long-term
renal allograft survival: have we made significant progress or is it time to
rethink our analytic and therapeutic strategies? Am J Transplant 4:1289-1295.
143. Pascual, M., T. Theruvath, T. Kawai, N. Tolkoff-Rubin, and A. B.
Cosimi. 2002. Strategies to improve long-term outcomes after renal
transplantation. The New England journal of medicine 346:580-590.
144. Basadonna, G. P., A. J. Matas, K. J. Gillingham, W. D. Payne, D. L.
Dunn, D. E. Sutherland, P. F. Gores, R. W. Gruessner, L. Arrazola, and J. S.
Najarian. 1993. Relationship between early vs late acute rejection and onset
of chronic rejection in kidney transplantation. Transplantation proceedings
25:910-911.
145. Alegre, M. L., J. Leemans, A. Le Moine, S. Florquin, V. De Wilde, A.
Chong, and M. Goldman. 2008. The multiple facets of toll-like receptors in
transplantation biology. Transplantation 86:1-9.
146. Zinkernagel, R. M., and P. C. Doherty. 1974. Restriction of in vitro T
cell-mediated cytotoxicity in lymphocytic choriomeningitis within a syngeneic
or semiallogeneic system. Nature 248:701-702.
147. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, and D.
C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral
peptide and HLA-A2. Nature 384:134-141.
148. Garcia, K. C., M. Degano, L. R. Pease, M. Huang, P. A. Peterson, L.
Teyton, and I. A. Wilson. 1998. Structural basis of plasticity in T cell receptor
220
recognition of a self peptide-MHC antigen. Science (New York, NY 279:1166-
1172.
149. Jorgensen, J. L., U. Esser, B. Fazekas de St Groth, P. A. Reay, and M.
M. Davis. 1992. Mapping T-cell receptor-peptide contacts by variant peptide
immunization of single-chain transgenics. Nature 355:224-230.
150. Mason, D. 1998. A very high level of crossreactivity is an essential
feature of the T-cell receptor. Immunology today 19:395-404.
151. Elliott, J. I. 1999. Dual Valpha T cells. Cell Mol Life Sci 56:143-154.
152. Watts, T. H. 2005. TNF/TNFR family members in costimulation of T cell
responses. Annual review of immunology 23:23-68.
153. Greenwald, R. J., G. J. Freeman, and A. H. Sharpe. 2005. The B7
family revisited. Annual review of immunology 23:515-548.
154. Suchin, E. J., P. B. Langmuir, E. Palmer, M. H. Sayegh, A. D. Wells,
and L. A. Turka. 2001. Quantifying the frequency of alloreactive T cells in vivo:
new answers to an old question. J Immunol 166:973-981.
155. Sykes, M., H. Auchincloss, and D. H. Sachs. 2003. Transplantation
Immunology In Fundamental Immunology, 5th ed. W. Paul, ed. Lippincott
Williams & Wilkins, Philadelphia. 1481-1556.
156. Felix, N. J., and P. M. Allen. 2007. Specificity of T-cell alloreactivity.
Nature reviews 7:942-953.
157. Matzinger, P., and M. J. Bevan. 1977. Hypothesis: why do so many
lymphocytes respond to major histocompatibility antigens? Cellular
immunology 29:1-5.
158. Kaye, J., and C. A. Janeway, Jr. 1984. The Fab fragment of a directly
activating monoclonal antibody that precipitates a disulfide-linked heterodimer
from a helper T cell clone blocks activation by either allogeneic Ia or antigen
and self-Ia. The Journal of experimental medicine 159:1397-1412.
159. Lechler, R. I., O. A. Garden, and L. A. Turka. 2003. The
complementary roles of deletion and regulation in transplantation tolerance.
Nature reviews 3:147-158.
160. Lehner, P. J., and P. Cresswell. 2004. Recent developments in MHC-
class-I-mediated antigen presentation. Current opinion in immunology 16:82-
89.
221
161. Benichou, G., A. Valujskikh, and P. S. Heeger. 1999. Contributions of
direct and indirect T cell alloreactivity during allograft rejection in mice. J
Immunol 162:352-358.
162. Liu, Z., A. I. Colovai, S. Tugulea, E. F. Reed, P. E. Harris, A. Maffei, E.
R. Molajoni, F. Gargano, R. Cortesini, M. A. Hardy, and N. Suciu-Foca. 1997.
Mapping of dominant HLA-DR determinants recognized via the indirect
pathway. Transplantation proceedings 29:1014-1015.
163. Fedoseyeva, E. V., F. Zhang, P. L. Orr, D. Levin, H. J. Buncke, and G.
Benichou. 1999. De novo autoimmunity to cardiac myosin after heart
transplantation and its contribution to the rejection process. J Immunol
162:6836-6842.
164. Barber, L. D., A. Whitelegg, J. A. Madrigal, N. R. Banner, and M. L.
Rose. 2004. Detection of vimentin-specific autoreactive CD8+ T cells in
cardiac transplant patients. Transplantation 77:1604-1609.
165. Haque, M. A., T. Mizobuchi, K. Yasufuku, T. Fujisawa, R. R.
Brutkiewicz, Y. Zheng, K. Woods, G. N. Smith, O. W. Cummings, K. M.
Heidler, J. S. Blum, and D. S. Wilkes. 2002. Evidence for immune responses
to a self-antigen in lung transplantation: role of type V collagen-specific T cells
in the pathogenesis of lung allograft rejection. J Immunol 169:1542-1549.
166. Birk, O. S., S. L. Gur, D. Elias, R. Margalit, F. Mor, P. Carmi, J.
Bockova, D. M. Altmann, and I. R. Cohen. 1999. The 60-kDa heat shock
protein modulates allograft rejection. Proceedings of the National Academy of
Sciences of the United States of America 96:5159-5163.
167. Malek, P., and J. Vrubel. 1968. Lymphatic system and organ
transplantation. Lymphology 1:4-22.
168. Malek, P., J. Vrubel, and J. Kolc. 1969. Lymphatic aspects of
experimental and clinical renal transplantation. Bulletin de la Societe
internationale de chirurgie 28:110-114.
169. Surquin, M., S. Buonocore, A. Le Moine, V. Flamand, M. Goldman, and
D. Abramowicz. 2005. [The role of neutrophils during allograft rejection].
Nephrologie & therapeutique 1:161-166.
170. Wyburn, K. R., M. D. Jose, H. Wu, R. C. Atkins, and S. J. Chadban.
2005. The role of macrophages in allograft rejection. Transplantation 80:1641-
1647.
222
171. Goldstein, D. R., B. M. Tesar, S. Akira, and F. G. Lakkis. 2003. Critical
role of the Toll-like receptor signal adaptor protein MyD88 in acute allograft
rejection. The Journal of clinical investigation 111:1571-1578.
172. Barker, C. F., and R. E. Billingham. 1968. The role of afferent
lymphatics in the rejection of skin homografts. The Journal of experimental
medicine 128:197-221.
173. Lakkis, F. G., A. Arakelov, B. T. Konieczny, and Y. Inoue. 2000.
Immunologic 'ignorance' of vascularized organ transplants in the absence of
secondary lymphoid tissue. Nature medicine 6:686-688.
174. Lindahl, K. F., and D. B. Wilson. 1977. Histocompatibility antigen-
activated cytotoxic T lymphocytes. II. Estimates of the frequency and
specificity of precursors. The Journal of experimental medicine 145:508-522.
175. Lechler, R. I., and J. R. Batchelor. 1982. Immunogenicity of
retransplanted rat kidney allografts. Effect of inducing chimerism in the first
recipient and quantitative studies on immunosuppression of the second
recipient. The Journal of experimental medicine 156:1835-1841.
176. Brewer, Y., A. Palmer, D. Taube, K. Welsh, M. Bewick, C. Bindon, G.
Hale, H. Waldmann, F. Dische, V. Parsons, and et al. 1989. Effect of graft
perfusion with two CD45 monoclonal antibodies on incidence of kidney
allograft rejection. Lancet 2:935-937.
177. Merad, M., M. Collin, and J. Bromberg. 2007. Dendritic cell
homeostasis and trafficking in transplantation. Trends in immunology 28:353-
359.
178. Goodnow, C. C. 1997. Chance encounters and organized rendezvous.
Immunological reviews 156:5-10.
179. Karrer, U., A. Althage, B. Odermatt, C. W. Roberts, S. J. Korsmeyer, S.
Miyawaki, H. Hengartner, and R. M. Zinkernagel. 1997. On the key role of
secondary lymphoid organs in antiviral immune responses studied in
alymphoplastic (aly/aly) and spleenless (Hox11(-)/-) mutant mice. The Journal
of experimental medicine 185:2157-2170.
180. Zinkernagel, R. M., S. Ehl, P. Aichele, S. Oehen, T. Kundig, and H.
Hengartner. 1997. Antigen localisation regulates immune responses in a
dose- and time-dependent fashion: a geographical view of immune reactivity.
Immunological reviews 156:199-209.
223
181. Briscoe, D. M., S. I. Alexander, and A. H. Lichtman. 1998. Interactions
between T lymphocytes and endothelial cells in allograft rejection. Current
opinion in immunology 10:525-531.
182. Kreisel, D., A. S. Krupnick, K. R. Balsara, M. Riha, A. E. Gelman, S. H.
Popma, W. Y. Szeto, L. A. Turka, and B. R. Rosengard. 2002. Mouse
vascular endothelium activates CD8+ T lymphocytes in a B7-dependent
fashion. J Immunol 169:6154-6161.
183. Kreisel, D., A. S. Krupnick, A. E. Gelman, F. H. Engels, S. H. Popma,
A. M. Krasinskas, K. R. Balsara, W. Y. Szeto, L. A. Turka, and B. R.
Rosengard. 2002. Non-hematopoietic allograft cells directly activate CD8+ T
cells and trigger acute rejection: an alternative mechanism of allorecognition.
Nature medicine 8:233-239.
184. Pober, J. S., C. G. Orosz, M. L. Rose, and C. O. Savage. 1996. Can
graft endothelial cells initiate a host anti-graft immune response?
Transplantation 61:343-349.
185. Zhou, P., K. W. Hwang, D. Palucki, O. Kim, K. A. Newell, Y. X. Fu, and
M. L. Alegre. 2003. Secondary lymphoid organs are important but not
absolutely required for allograft responses. Am J Transplant 3:259-266.
186. Ochando, J. C., C. Homma, Y. Yang, A. Hidalgo, A. Garin, F. Tacke, V.
Angeli, Y. Li, P. Boros, Y. Ding, R. Jessberger, G. Trinchieri, S. A. Lira, G. J.
Randolph, and J. S. Bromberg. 2006. Alloantigen-presenting plasmacytoid
dendritic cells mediate tolerance to vascularized grafts. Nature immunology
7:652-662.
187. Jiang, S., O. Herrera, and R. I. Lechler. 2004. New spectrum of
allorecognition pathways: implications for graft rejection and transplantation
tolerance. Current opinion in immunology 16:550-557.
188. Sawyer, G. J., R. Dalchau, and J. W. Fabre. 1993. Indirect T cell
allorecognition: a cyclosporin A resistant pathway for T cell help for antibody
production to donor MHC antigens. Transplant immunology 1:77-81.
189. Dalchau, R., J. Fangmann, and J. W. Fabre. 1992. Allorecognition of
isolated, denatured chains of class I and class II major histocompatibility
complex molecules. Evidence for an important role for indirect allorecognition
in transplantation. European journal of immunology 22:669-677.
224
190. Fangmann, J., R. Dalchau, and J. W. Fabre. 1992. Rejection of skin
allografts by indirect allorecognition of donor class I major histocompatibility
complex peptides. The Journal of experimental medicine 175:1521-1529.
191. Muro, M., S. Llorente, M. J. Gonzalez-Soriano, A. Minguela, L.
Gimeno, and M. R. Alvarez-Lopez. 2006. Pre-formed donor-specific
alloantibodies (DSA) detected only by luminex technology using HLA-coated
microspheres and causing acute humoral rejection and kidney graft
dysfunction. Clinical transplants:379-383.
192. Feucht, H. E. 2003. Complement C4d in graft capillaries -- the missing
link in the recognition of humoral alloreactivity. Am J Transplant 3:646-652.
193. Solez, K., R. B. Colvin, L. C. Racusen, B. Sis, P. F. Halloran, P. E. Birk,
P. M. Campbell, M. Cascalho, A. B. Collins, A. J. Demetris, C. B.
Drachenberg, I. W. Gibson, P. C. Grimm, M. Haas, E. Lerut, H. Liapis, R. B.
Mannon, P. B. Marcus, M. Mengel, M. J. Mihatsch, B. J. Nankivell, V.
Nickeleit, J. C. Papadimitriou, J. L. Platt, P. Randhawa, I. Roberts, L. Salinas-
Madriga, D. R. Salomon, D. Seron, M. Sheaff, and J. J. Weening. 2007. Banff
'05 Meeting Report: differential diagnosis of chronic allograft injury and
elimination of chronic allograft nephropathy ('CAN'). Am J Transplant 7:518-
526.
194. Valujskikh, A., and P. S. Heeger. 2000. CD4+ T cells responsive
through the indirect pathway can mediate skin graft rejection in the absence of
interferon-gamma. Transplantation 69:1016-1019.
195. Valujskikh, A., O. Lantz, S. Celli, P. Matzinger, and P. S. Heeger. 2002.
Cross-primed CD8(+) T cells mediate graft rejection via a distinct effector
pathway. Nature immunology 3:844-851.
196. Isik, F. F., T. O. McDonald, M. Ferguson, E. Yamanaka, and D.
Gordon. 1992. Transplant arteriosclerosis in a rat aortic model. The American
journal of pathology 141:1139-1149.
197. Mennander, A., S. Tiisala, J. Halttunen, S. Yilmaz, T. Paavonen, and P.
Hayry. 1991. Chronic rejection in rat aortic allografts. An experimental model
for transplant arteriosclerosis. Arterioscler Thromb 11:671-680.
198. Plissonnier, D., B. I. Levy, J. L. Salzmann, D. Nochy, J. Watelet, and J.
B. Michel. 1991. Allograft-induced arterial wall injury and response in
normotensive and spontaneously hypertensive rats. Arterioscler Thromb
11:1690-1699.
225
199. Schmitz-Rixen, T., J. Megerman, R. B. Colvin, A. M. Williams, and W.
M. Abbott. 1988. Immunosuppressive treatment of aortic allografts. J Vasc
Surg 7:82-92.
200. Battle, T., J. F. Arnal, M. Challah, and J. B. Michel. 1994. Selective
isolation of rat aortic wall layers and their cell types in culture--application to
converting enzyme activity measurement. Tissue & cell 26:943-955.
201. Allaire, E., C. Guettier, P. Bruneval, D. Plissonnier, and J. B. Michel.
1994. Cell-free arterial grafts: morphologic characteristics of aortic isografts,
allografts, and xenografts in rats. J Vasc Surg 19:446-456.
202. Gomes, D., L. Louedec, D. Plissonnier, M. C. Dauge, D. Henin, M.
Osborne-Pellegrin, and J. B. Michel. 2001. Endoluminal smooth muscle cell
seeding limits intimal hyperplasia. J Vasc Surg 34:707-715.
203. Pober, J. S. 2002. Aortic interposition grafts: a model of rejection or
rejection of the model? Am J Transplant 2:201-202.
204. Plissonnier, D., D. Nochy, P. Poncet, C. Mandet, N. Hinglais, J. Bariety,
and J. B. Michel. 1995. Sequential immunological targeting of chronic
experimental arterial allograft. Transplantation 60:414-424.
205. Plissonnier, D., G. Amichot, J. Lecagneux, M. Duriez, D. Gentric, and
J. B. Michel. 1993. Additive and synergistic effects of a low-molecular-weight,
heparin-like molecule and low doses of cyclosporin in preventing arterial graft
rejection in rats. Arterioscler Thromb 13:112-119.
206. Lagaaij, E. L., G. F. Cramer-Knijnenburg, F. J. van Kemenade, L. A.
van Es, J. A. Bruijn, and J. H. van Krieken. 2001. Endothelial cell chimerism
after renal transplantation and vascular rejection. Lancet 357:33-37.
207. Shi, C., W. S. Lee, Q. He, D. Zhang, D. L. Fletcher, Jr., J. B. Newell,
and E. Haber. 1996. Immunologic basis of transplant-associated
arteriosclerosis. Proceedings of the National Academy of Sciences of the
United States of America 93:4051-4056.
208. Russell, P. S., C. M. Chase, and R. B. Colvin. 1997. Alloantibody- and
T cell-mediated immunity in the pathogenesis of transplant arteriosclerosis:
lack of progression to sclerotic lesions in B cell-deficient mice. Transplantation
64:1531-1536.
209. Russell, P. S., C. M. Chase, H. J. Winn, and R. B. Colvin. 1994.
Coronary atherosclerosis in transplanted mouse hearts. II. Importance of
humoral immunity. J Immunol 152:5135-5141.
226
210. Kolb, F., D. Heudes, C. Mandet, D. Plissonnier, M. Osborne-Pellegrin,
J. Bariety, and J. B. Michel. 1996. Presensitization accelerates allograft
arteriosclerosis. Transplantation 62:1401-1410.
211. Plissonnier, D., M. Henaff, P. Poncet, E. Paris, F. Tron, C. Thuillez, and
J. B. Michel. 2000. Involvement of antibody-dependent apoptosis in graft
rejection. Transplantation 69:2601-2608.
212. Hu, Y., F. Davison, B. Ludewig, M. Erdel, M. Mayr, M. Url, H. Dietrich,
and Q. Xu. 2002. Smooth muscle cells in transplant atherosclerotic lesions
are originated from recipients, but not bone marrow progenitor cells.
Circulation 106:1834-1839.
213. Shimizu, K., S. Sugiyama, M. Aikawa, Y. Fukumoto, E. Rabkin, P.
Libby, and R. N. Mitchell. 2001. Host bone-marrow cells are a source of donor
intimal smooth- muscle-like cells in murine aortic transplant arteriopathy.
Nature medicine 7:738-741.
214. Kratz, A., A. Campos-Neto, M. S. Hanson, and N. H. Ruddle. 1996.
Chronic inflammation caused by lymphotoxin is lymphoid neogenesis. The
Journal of experimental medicine 183:1461-1472.
215. Demetris, A. J., N. Murase, Q. Ye, F. H. Galvao, C. Richert, R. Saad,
S. Pham, R. J. Duquesnoy, A. Zeevi, J. J. Fung, and T. E. Starzl. 1997.
Analysis of chronic rejection and obliterative arteriopathy. Possible
contributions of donor antigen-presenting cells and lymphatic disruption. The
American journal of pathology 150:563-578.
216. Eliska, O., M. Eliskova, and P. Mirejovsky. 1986. Lymph vessels of the
transplanted kidney. Nephron 44:136-141.
217. Ruggiero, R., R. Fietsam, Jr., G. A. Thomas, J. Muz, R. H. Farris, T. A.
Kowal, J. L. Myles, L. W. Stephenson, and F. A. Baciewicz, Jr. 1994.
Detection of canine allograft lung rejection by pulmonary lymphoscintigraphy.
The Journal of thoracic and cardiovascular surgery 108:253-258.
218. Kerjaschki, D., H. M. Regele, I. Moosberger, K. Nagy-Bojarski, B.
Watschinger, A. Soleiman, P. Birner, S. Krieger, A. Hovorka, G. Silberhumer,
P. Laakkonen, T. Petrova, B. Langer, and I. Raab. 2004. Lymphatic
neoangiogenesis in human kidney transplants is associated with
immunologically active lymphocytic infiltrates. J Am Soc Nephrol 15:603-612.
219. Angeli, V., F. Ginhoux, J. Llodra, L. Quemeneur, P. S. Frenette, M.
Skobe, R. Jessberger, M. Merad, and G. J. Randolph. 2006. B cell-driven
227
lymphangiogenesis in inflamed lymph nodes enhances dendritic cell
mobilization. Immunity 24:203-215.
220. Mebius, R. E. 2003. Organogenesis of lymphoid tissues. Nature
reviews 3:292-303.
221. Randall, T. D., D. M. Carragher, and J. Rangel-Moreno. 2008.
Development of secondary lymphoid organs. Annual review of immunology
26:627-650.
222. Cyster, J. G. 2005. Chemokines, sphingosine-1-phosphate, and cell
migration in secondary lymphoid organs. Annual review of immunology
23:127-159.
223. Lee, Y. C. 2005. The involvement of VEGF in endothelial permeability:
a target for anti-inflammatory therapy. Curr Opin Investig Drugs 6:1124-1130.
224. Lemstrom, K. B., R. Krebs, A. I. Nykanen, J. M. Tikkanen, R. K.
Sihvola, E. M. Aaltola, P. J. Hayry, J. Wood, K. Alitalo, S. Yla-Herttuala, and
P. K. Koskinen. 2002. Vascular endothelial growth factor enhances cardiac
allograft arteriosclerosis. Circulation 105:2524-2530.
225. Bornstein, P. 2001. Thrombospondins as matricellular modulators of
cell function. The Journal of clinical investigation 107:929-934.
226. Haviv, F., M. F. Bradley, D. M. Kalvin, A. J. Schneider, D. J. Davidson,
S. M. Majest, L. M. McKay, C. J. Haskell, R. L. Bell, B. Nguyen, K. C. Marsh,
B. W. Surber, J. T. Uchic, J. Ferrero, Y. C. Wang, J. Leal, R. D. Record, J.
Hodde, S. F. Badylak, R. R. Lesniewski, and J. Henkin. 2005.
Thrombospondin-1 mimetic peptide inhibitors of angiogenesis and tumor
growth: design, synthesis, and optimization of pharmacokinetics and
biological activities. Journal of medicinal chemistry 48:2838-2846.
227. Looney, R. J., J. H. Anolik, D. Campbell, R. E. Felgar, F. Young, L. J.
Arend, J. A. Sloand, J. Rosenblatt, and I. Sanz. 2004. B cell depletion as a
novel treatment for systemic lupus erythematosus: a phase I/II dose-
escalation trial of rituximab. Arthritis and rheumatism 50:2580-2589.
228. Edwards, J. C., L. Szczepanski, J. Szechinski, A. Filipowicz-
Sosnowska, P. Emery, D. R. Close, R. M. Stevens, and T. Shaw. 2004.
Efficacy of B-cell-targeted therapy with rituximab in patients with rheumatoid
arthritis. The New England journal of medicine 350:2572-2581.
229. Anolik, J. H., D. Campbell, R. E. Felgar, F. Young, I. Sanz, J.
Rosenblatt, and R. J. Looney. 2003. The relationship of FcgammaRIIIa
228
genotype to degree of B cell depletion by rituximab in the treatment of
systemic lupus erythematosus. Arthritis and rheumatism 48:455-459.
230. Gong, Q., Q. Ou, S. Ye, W. P. Lee, J. Cornelius, L. Diehl, W. Y. Lin, Z.
Hu, Y. Lu, Y. Chen, Y. Wu, Y. G. Meng, P. Gribling, Z. Lin, K. Nguyen, T.
Tran, Y. Zhang, H. Rosen, F. Martin, and A. C. Chan. 2005. Importance of
cellular microenvironment and circulatory dynamics in B cell immunotherapy.
J Immunol 174:817-826.
231. Baddoura, F. K., I. W. Nasr, B. Wrobel, Q. Li, N. H. Ruddle, and F. G.
Lakkis. 2005. Lymphoid neogenesis in murine cardiac allografts undergoing
chronic rejection. Am J Transplant 5:510-516.
232. Takabayshi, K., M. Corr, T. Hayashi, V. Redecke, L. Beck, D. Guiney,
D. Sheppard, and E. Raz. 2006. Induction of a homeostatic circuit in lung
tissue by microbial compounds. Immunity 24:475-487.
233. Takabayshi, K., M. Corr, T. Hayashi, V. Redecke, L. Beck, D. Guiney,
D. Sheppard, and E. Raz. 2008. Retraction. Induction of a homeostatic circuit
in lung tissue by microbial compounds. Immunity 28:724.
234. Matzinger, P. 2007. Friendly and dangerous signals: is the tissue in
control? Nature immunology 8:11-13.
235. Havran, W. L., J. M. Jameson, and D. A. Witherden. 2005. Epithelial
cells and their neighbors. III. Interactions between intraepithelial lymphocytes
and neighboring epithelial cells. Am J Physiol Gastrointest Liver Physiol
289:G627-630.
236. Hayday, A., E. Theodoridis, E. Ramsburg, and J. Shires. 2001.
Intraepithelial lymphocytes: exploring the Third Way in immunology. Nature
immunology 2:997-1003.
237. Bendelac, A., M. Bonneville, and J. F. Kearney. 2001. Autoreactivity by
design: innate B and T lymphocytes. Nature reviews 1:177-186.
238. Moffett, A., and C. Loke. 2006. Immunology of placentation in eutherian
mammals. Nature reviews 6:584-594.
239. Flajnik, M. F., K. Miller, and L. Du Pasquier. 2003. Evolution of the
Immune System. In Fundamental Immunology, 5th ed. W. Paul, ed. Lippincott
Williams & Wilkins, Philadelphia. 519-570.
240. Krammer, P. H., R. Arnold, and I. N. Lavrik. 2007. Life and death in
peripheral T cells. Nature reviews 7:532-542.
229
241. Rolls, H. K., K. Kishimoto, V. M. Dong, B. M. Illigens, M. Sho, M. H.
Sayegh, G. Benichou, and E. V. Fedoseyeva. 2002. T-cell response to
cardiac myosin persists in the absence of an alloimmune response in
recipients with chronic cardiac allograft rejection. Transplantation 74:1053-
1057.
242. Azimzadeh, A. M., S. Pfeiffer, G. S. Wu, C. Schroder, H. Zhou, G. L.
Zorn, 3rd, M. Kehry, G. G. Miller, M. L. Rose, and R. N. Pierson, 3rd. 2005.
Humoral immunity to vimentin is associated with cardiac allograft injury in
nonhuman primates. Am J Transplant 5:2349-2359.
243. Sumpter, T. L., and D. S. Wilkes. 2004. Role of autoimmunity in organ
allograft rejection: a focus on immunity to type V collagen in the pathogenesis
of lung transplant rejection. Am J Physiol Lung Cell Mol Physiol 286:L1129-
1139.
244. Joosten, S. A., Y. W. Sijpkens, V. van Ham, L. A. Trouw, J. van der
Vlag, B. van den Heuvel, C. van Kooten, and L. C. Paul. 2005. Antibody
response against the glomerular basement membrane protein agrin in
patients with transplant glomerulopathy. Am J Transplant 5:383-393.
245. Hermine, O., F. Lefrere, J. P. Bronowicki, X. Mariette, K. Jondeau, V.
Eclache-Saudreau, B. Delmas, F. Valensi, P. Cacoub, C. Brechot, B. Varet,
and X. Troussard. 2002. Regression of splenic lymphoma with villous
lymphocytes after treatment of hepatitis C virus infection. The New England
journal of medicine 347:89-94.
246. Montalban, C., A. Santon, D. Boixeda, and C. Bellas. 2001. Regression
of gastric high grade mucosa associated lymphoid tissue (MALT) lymphoma
after Helicobacter pylori eradication. Gut 49:584-587.
247. Roulland, S., F. Suarez, O. Hermine, and B. Nadel. 2008.
Pathophysiological aspects of memory B-cell development. Trends in
immunology 29:25-33.
248. Mariette, X. 2001. Lymphomas complicating Sjogren's syndrome and
hepatitis C virus infection may share a common pathogenesis: chronic
stimulation of rheumatoid factor B cells. Annals of the rheumatic diseases
60:1007-1010.
249. Mazzucchelli, L., A. Blaser, A. Kappeler, P. Scharli, J. A. Laissue, M.
Baggiolini, and M. Uguccioni. 1999. BCA-1 is highly expressed in Helicobacter
230
pylori-induced mucosa-associated lymphoid tissue and gastric lymphoma.
The Journal of clinical investigation 104:R49-54.
250. Bakker, N. A., G. W. van Imhoff, E. A. Verschuuren, and W. J. van
Son. 2007. Presentation and early detection of post-transplant
lymphoproliferative disorder after solid organ transplantation. Transpl Int
20:207-218.
251. Shealy, D. J., and S. Visvanathan. 2008. Anti-TNF antibodies: lessons
from the past, roadmap for the future. Handbook of experimental
pharmacology:101-129.
252. Vincenti, F. 2008. Costimulation blockade in autoimmunity and
transplantation. The Journal of allergy and clinical immunology 121:299-306;
quiz 307-298.
253. Sykes, M., and B. Nikolic. 2005. Treatment of severe autoimmune
disease by stem-cell transplantation. Nature 435:620-627.
254. Kawai, T., A. B. Cosimi, T. R. Spitzer, N. Tolkoff-Rubin, M.
Suthanthiran, S. L. Saidman, J. Shaffer, F. I. Preffer, R. Ding, V. Sharma, J.
A. Fishman, B. Dey, D. S. Ko, M. Hertl, N. B. Goes, W. Wong, W. W.
Williams, Jr., R. B. Colvin, M. Sykes, and D. H. Sachs. 2008. HLA-
mismatched renal transplantation without maintenance immunosuppression.
The New England journal of medicine 358:353-361.
255. Gotsman, I., A. Shlomai, R. Alper, E. Rabbani, D. Engelhardt, and Y.
Ilan. 2001. Amelioration of immune-mediated experimental colitis: tolerance
induction in the presence of preexisting immunity and surrogate antigen
bystander effect. The Journal of pharmacology and experimental therapeutics
297:926-932.
256. Verbeek, R., K. van der Mark, E. F. Wawrousek, A. C. Plomp, and J.
M. van Noort. 2007. Tolerization of an established alphaB-crystallin-reactive
T-cell response by intravenous antigen. Immunology 121:416-426.
257. Katakai, T., T. Nomura, H. Gonda, M. Sugai, Y. Agata, A. Nishio, T.
Masuda, S. Sakaguchi, and A. Shimizu. 2006. Spontaneous large-scale
lymphoid neogenesis and balanced autoimmunity versus tolerance in the
stomach of H+/K+-ATPase-reactive TCR transgenic mouse. J Immunol
177:7858-7867.
231
258. Wolf, S. D., B. N. Dittel, F. Hardardottir, and C. A. Janeway, Jr. 1996.
Experimental autoimmune encephalomyelitis induction in genetically B cell-
deficient mice. The Journal of experimental medicine 184:2271-2278.
259. Mauri, C., D. Gray, N. Mushtaq, and M. Londei. 2003. Prevention of
arthritis by interleukin 10-producing B cells. The Journal of experimental
medicine 197:489-501.
260. Yanaba, K., J. D. Bouaziz, K. M. Haas, J. C. Poe, M. Fujimoto, and T.
F. Tedder. 2008. A regulatory B cell subset with a unique CD1dhiCD5+
phenotype controls T cell-dependent inflammatory responses. Immunity
28:639-650.
261. Mizoguchi, A., E. Mizoguchi, H. Takedatsu, R. S. Blumberg, and A. K.
Bhan. 2002. Chronic intestinal inflammatory condition generates IL-10-
producing regulatory B cell subset characterized by CD1d upregulation.
Immunity 16:219-230.
262. Fillatreau, S., D. Gray, and S. M. Anderton. 2008. Not always the bad
guys: B cells as regulators of autoimmune pathology. Nature reviews 8:391-
397.
263. Fillatreau, S., C. H. Sweenie, M. J. McGeachy, D. Gray, and S. M.
Anderton. 2002. B cells regulate autoimmunity by provision of IL-10. Nature
immunology 3:944-950.
264. Lampropoulou, V., K. Hoehlig, T. Roch, P. Neves, E. Calderon Gomez,
C. H. Sweenie, Y. Hao, A. A. Freitas, U. Steinhoff, S. M. Anderton, and S.
Fillatreau. 2008. TLR-activated B cells suppress T cell-mediated
autoimmunity. J Immunol 180:4763-4773.
265. Duddy, M., M. Niino, F. Adatia, S. Hebert, M. Freedman, H. Atkins, H.
J. Kim, and A. Bar-Or. 2007. Distinct effector cytokine profiles of memory and
naive human B cell subsets and implication in multiple sclerosis. J Immunol
178:6092-6099.
266. Duval, A., M. Raphael, C. Brennetot, H. Poirel, O. Buhard, A. Aubry, A.
Martin, A. Krimi, V. Leblond, J. Gabarre, F. Davi, F. Charlotte, F. Berger, G.
Gaidano, D. Capello, D. Canioni, D. Bordessoule, J. Feuillard, P. Gaulard, M.
H. Delfau, S. Ferlicot, V. Eclache, S. Prevot, C. Guettier, P. C. Lefevre, F.
Adotti, and R. Hamelin. 2004. The mutator pathway is a feature of
immunodeficiency-related lymphomas. Proceedings of the National Academy
of Sciences of the United States of America 101:5002-5007.