Modélisation et simulation multi-échelle prédictive pour la biologie

Modélisation et simulation multi-échelle

prédictive pour la biologie

I Interactions moléculaires faible (Stacking et liaison hydrogène) et leur rôle dans les molécules biologiques;

Outil: Méthodes Quantiques: DFT et méthodes de perturbation

II Développement de modèles à l’échelle mésoscopique pour étudier la thermodynamique de l’ADN;Outil: Modèle de Physique Statistique (thermodynamqiue statistique hors équilibre)

III Développement de modèles à l’échelle macroscopique pour des nanostructures d’ADNOutil: Modèle à deux états

IV Développement d’une nouvelle méthode pour le traitement de la flexibilité des molécules biologiques

Problème: VDW ignorées dans la DFT

Solutions: 2 Stratégies

* Ajouter un terme empirique afin de corriger le comportement longue portée dans les fonctionnelles;

* Une nouvelle génération de fonctionnelle : Méta hybride

I-1 DFT et interaction de van der Waals

Dkhissi, Blossey. Chem. Phys. Lett. 439 (2007) 35-39

H-bond structures of dihydrated AT base pairs Stacking structures of dihydrated AT base pairs

The preference for S structures of nucleic acids base pairs in an aqueous environment is due to hydrophilic interactions of a rather small amount of water molecules with the base pairs and is not due to a hydrophobic interaction between a large bulk of solvent and base pair as is generally believed .

I-2 Density Functional Theory and Correlated ab Initio Studies on Microhydrated Adenine-Thymine

Dkhissi, Blossey. JPCB. 112 (2008) 9182-9186

The dominant intermolecular interactions of adenine-thymine pairs are hydrogen- bonding and Π-stacking interactions.

Experimentally, In a nonpolar solvent and also in the gas phase the base pairs prefer a planar hydrogen bonded arrangement, whereas in bulk water, the stacked configurations are preferred

HB structures Stacking structuresAT base pair 17 9

AT-H2O 28 23

AT-2(H2O) 36 37

Ab Initio Interaction Energies (kCal/mol) of Selected Structures of the Adenine-Thymine Complex

E (kcal/mol)

0

-58,8

-67,3

-89,3

I-3 Aggregation for the GNNQQNY Peptide: Atomic scale modeling

Aim of the work: Study of the GNNQQNY monomer and dimer to investigate the very first step of -sheet formation

ΔE = -146,76 kcal/molΔE = -70.24 kcal/mol

* Excellent agreement between theoretical and experimental data (Parallel)* The importance of hydrogen bonding in the stabilization energy for formation of the sheets

Renvez, Dkhissi. Biophysical Journal (to be Submitted)

I-3 Aggregation for the GNNQQNY Peptide: Atomic scale modeling

II Stabilité thermodynamique des gènes

Melting domains for H. Sapiens actins

we found very similar melting profiles also in , and actins of other vertebrates as: Canis familiaris (dog), Bos Taurus (cow), Danio Rerio (zebrafish), Gallus Gallus (chicken) etc. . .

The correspondence between thermodynamic boundaries with the introns positions

The sequences (b) and c) which host 5 introns. The two remaining of the total 7 intron correspond to stability boundaries.

Melting domains for animal actins

melting curves for Drosophila Melanogaster (a,b), the fruit fly, and Caenorhabditis

Elegans (c), a worm.

The Drosophila actins have at most one intron in the coding region either in 15-1 or 310-1. These positions differ from the vertebrates positions

The melting analysis however reveals few stabilityboundaries close to the positions 43-3, 86-3, 270-1and 330-3, which are the introns position of vertebratesactins

Melting domains for actin sequences of the A. Thaliana.

The introns positions of actins sequences of higher plants are highly conserved(Litterature), which indicates that these introns date back to the early evolution of plants

In 3 out of the 9 Arabidopsis sequences shown (a, d, f)we find a correspondence of a thermal boundary and an intron at 152-1

As in the Drosophila and C. Elegans sequences in general stability boundaries tend to be found at vertebrates positions 43-3, 86-3,270-1 and 330-3. In few cases the correspondence is very striking, as in Fig (d).

Melting domains for plant actins

Average melting curves from 21 green plant actin genes

As reference four of the most commonly found introns positions for actin genes. The averaging confirms the existence of a sharp stability boundary close to the 43-3 position. Two weaker boundaries are found close to the positions 86-3 and 270-1.

With the 9 sequences from A. Thaliana we have in total 21 plant actin genes. For each sequence the melting curves were calculated and then averaged.

Melting domains for plant actins

the number of introns and their positions are highly variable in fungi actin genes: their number vary from 0 to 7

A sharp stability boundary close to the 43-3 position and some weaker ones appearing close to positions 270-1 and 330-3 in the case (b). This correlation is absent in the case (c)

Melting domains for fungi actins

Melting curves for the budding yeast Saccharomyces Cerevisiae (a), for Neurospora Crassa (b) and for Candida Albicans (c)

III Y-DNA melting: a short tale of two scales

Molecular Melting

5–CAATGGATCGCGATCCATTG–3

Extrinsic melting of Y-DNA

Dkhissi et al. J. Phys: Conden Matter. 21 (2009) 034115

IV Les Modes Statiques: Une nouvelle méthode pour traiter la fléxibilité

des molécules biologique

Qu'est-que la flexibilité ?Qu'est-que la flexibilité ?

►capacité intrinsèque d'une molécule à changer de conformation en réponse à une contrainte extérieure (environnement, interactions...)

► essentiel pour la prédiction de : ● structures et propriétés de molécules isolées (folding)● formation de complexes macromoléculaires (docking)

Applications Applications

► biologie structurale : prédiction de structures tridimensionnelles

► recherche médicale : étude des interactions, des processus cellulaires et physiologiques

► recherche pharmacologique : criblage de nouveaux médicaments

► nanobiotechnologies : biopuces ...

Traitement actuel de la flexibilité

Prise en compte de la flexibilité Prise en compte de la flexibilité

!! les algorithmes actuels ne considèrent pas la flexibilité totale des systèmes

► docking rigide (à flexibilité implicite) ● soft docking (complémentarité de surface) ● cross docking (échantillons multiples)

► docking semi-rigide (à flexibilité explicite) ● flexibilité partielle (ligand, chaînes latérales, backbone, site actif...)● zones flexibles déterminées par dynamique moléculaire, analyse

vibratoire...

Méthodes coûteuses en ressources informatiquesRésultats peu satisfaisants pour les mouvements de grande

amplitude

Challenge : introduire la flexibilité dans les procédures de docking avec un coût informatique raisonnable

Traitement actuel de la flexibilité

ConceptConcept ► recherche de déformations pertinentes à la fois pour la molécule seule et complexée► pas de calcul de l'état de transition mais seulement des déformations induites par une contrainte extérieure

Méthode Méthode ► calcul de la matrice hessienne A (libre choix du modèle énergétique)► application d'une contrainte B sur chaque atome, dans chaque direction ► solution : déformation moléculaire X (réponse à la contrainte)

A

B

RésoudreA.X + B = 0

Energie

3xN-6 déformations

(3 x N – 6) x (3 x N – 6)

Création et validation d'un logiciel : Flexible

Les modes statiques: Concept et méthodes

Asp25 Asp25'● ●

●Ile50

Forme fermée (en présence d'un

ligand)1HHP

Forme ouverte1TW7

levier

volet

interface

domaine terminal

poches de liaison

site actif

Application au cas de la protéase du VIH-1

Quelques propriétés identifiées :Quelques propriétés identifiées :

► Corrélation site actif / poches de liaison 1, 2, 3

► Influence du domaine terminal et interfacialsur la stabilité du site actif 3, 4

► Corrélation leviers / volets 5

► Fermeture des volets à l'arrimage du ligand 6, 7

► Différences de flexibilité entre protéine ouverte / fermée, 4

moins d'interaction entre monomères

1 Short et al. Biochemistry (2000), 39. 2 Perrymane et al. Protein Science (2004), 13. 3 Harte et al. Proc. Nat. Ac. Sc. USA (1990), 87 . 4 Ishima et al. Structure (1999), 7. 5 Perryman et al. Biopolymers (2006), 82. 6 Hornak et al. PNAS (2006,) 103. 7 Jagodzinski et al. Proceedings of the 46th IEEE Conf. (2007).

Application au cas de la protéase du VIH-1

► Variation de la distance Asp25/Asp25' (modifications du site actif)

● voisins de Asp25 (22-27)● poches de liaison (81-84)● interface (4-9)● extrêmités C et N-terminales (1-3 et 97-99)

Des contraintes appliquées sure les poches de liaison et l'interface modifient le site actif

> 1 Å

< 1 Å et > 0.5 Å

< 0.5 Å

Application au cas de la protéase du VIH-1

Réponse au pincement de tous les couples d'atomes : :

Différences protéine fermée / ouverte :

Disparition de séquences de l'interface

Affaiblissement des interactions inter-monomères

Application au cas de la protéase du VIH-1

Résultats

Une méthode nouvelle et compétitive basée sur le concept “induced-fit”► évaluation de la flexibilité moléculaire

Advantages► considération de la flexibilité totale

► un seul calcul pour le stockage de l'ensemble des déformations (gain de temps)

Perspectives► introduire les effets non linéaires► optimiser l'algorithme► intégrer l'approche des Modes Statiques dans des stratégies nouvelles ou

existantes (prédiction de docking...)

Conclusions