Baburajeev et al. BMC Cancer (2017) 17:235 DOI 10.1186/s12885-017-3214-8

RESEARCH ARTICLE Open Access

Identification of Novel Class of Triazolo-Thiadiazoles as Potent Inhibitors of HumanHeparanase and their Anticancer Activity

C. P. Baburajeev1†, Chakrabhavi Dhananjaya Mohan2,3†, Shobith Rangappa4, Daniel J. Mason5, Julian E. Fuchs5,Andreas Bender5, Uri Barash6, Israel Vlodavsky6*, Basappa1* and Kanchugarakoppal S. Rangappa2*

Abstract

Background: Expression and activity of heparanase, an endoglycosidase that cleaves heparan sulfate (HS) side chainsof proteoglycans, is associated with progression and poor prognosis of many cancers which makes it an attractive drugtarget in cancer therapeutics.

Methods: In the present work, we report the in vitro screening of a library of 150 small molecules with thescaffold bearing quinolones, oxazines, benzoxazines, isoxazoli(di)nes, pyrimidinones, quinolines, benzoxazines,and 4-thiazolidinones, thiadiazolo[3,2-a]pyrimidin-5-one, 1,2,4-triazolo-1,3,4-thiadiazoles, and azaspiranes againstthe enzymatic activity of human heparanase. The identified lead compounds were evaluated for theirheparanase-inhibiting activity using sulfate [35S] labeled extracellular matrix (ECM) deposited by culturedendothelial cells. Further, anti-invasive efficacy of lead compound was evaluated against hepatocellularcarcinoma (HepG2) and Lewis lung carcinoma (LLC) cells.

Results: Among the 150 compounds screened, we identified 1,2,4-triazolo-1,3,4-thiadiazoles bearingcompounds to possess human heparanase inhibitory activity. Further analysis revealed 2,4-Diiodo-6-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6yl)phenol (DTP) as the most potent inhibitor of heparanaseenzymatic activity among the tested compounds. The inhibitory efficacy was demonstrated by acolorimetric assay and further validated by measuring the release of radioactive heparan sulfatedegradation fragments from [35S] labeled extracellular matrix. Additionally, lead compound significantlysuppressed migration and invasion of LLC and HepG2 cells with IC50 value of ~5 μM. Furthermore, molecular dockinganalysis revealed a favourable interaction of triazolo-thiadiazole backbone with Asn-224 and Asp-62 of the enzyme.

Conclusions: Overall, we identified biologically active heparanase inhibitor which could serve as a lead structure indeveloping compounds that target heparanase in cancer.

Keywords: Heparanase inhibitors, triazolo-thiadiazoles, Metastasis, Anticancer activity

* Correspondence: vlodavsk@mail.huji.ac.il; salundibasappa@gmail.com;rangappaks@yahoo.com†Equal contributors6Cancer and Vascular Biology Research Center, the Bruce Rappaport Facultyof Medicine, Technion, Haifa, Israel1Laboratory of Chemical Biology, Department of Chemistry, BangaloreUniversity, Central College Campus, Palace Road, Bangalore 560001, India2Department of Studies in Chemistry, University of Mysore, Manasagangotri,Mysore 570006, IndiaFull list of author information is available at the end of the article

© The Author(s). 2017 Open Access This articInternational License (http://creativecommonsreproduction in any medium, provided you gthe Creative Commons license, and indicate if(http://creativecommons.org/publicdomain/ze

le is distributed under the terms of the Creative Commons Attribution 4.0.org/licenses/by/4.0/), which permits unrestricted use, distribution, andive appropriate credit to the original author(s) and the source, provide a link tochanges were made. The Creative Commons Public Domain Dedication waiverro/1.0/) applies to the data made available in this article, unless otherwise stated.

Baburajeev et al. BMC Cancer (2017) 17:235 Page 2 of 14

BackgroundThe extracellular matrix (ECM) plays a prime role inmaintaining the architecture and integrity of organs andtissues [1]. Collagen, fibronectin, laminin and severalgrowth factors and cytokines interact with heparan sul-fate proteolglycans (HSPGs) in the ECM and cell surfaceto maintain cellular framework and function [2, 3].Heparanase is the predominant endoglycosidase that cat-alyzes the cleavage of heparan sulfate (HS) polysacchar-ide chains in HSPGs into smaller fragments and therebymodulates the functions of HS [4–10]. Heparanasedegrades the linkage between glucuronic acid and N-sulfo glucosamine residues at restricted sites of HSyielding fragments of 4-7 kDa [6]. Heparanase activitycontributes to disassembly and remodeling of basementmembrane and ECM resulting in upregulated cell migra-tion and invasion and release of HS-bound growth- andangiogenesis- promoting factors [7–9]. Notably, elevatedlevels of heparanase are positively correlated with trig-gered expression of MMP-9, hepatocyte growth factor(HGF) and vascular endothelial growth factor (VEGF)that are entangled with cancer progression [11–13]. To-gether, these and other results critically support the in-timate involvement of heparanase in tumor progressionand encourage the development of heparanase inhibitorsas anti-cancer therapeutics [14–16].Several heparin/HS mimetics were demonstrated as

heparanase inhibitors and some have entered clinicaltrials [8, 15], among these are Muparfostat (PI-88),Roneparstat (SST0001), PG545, and necuparanib (M402)[8, 15]. Muparfostat is a mixture of sulfated di- to hexa-saccharides which progressed to Phase III clinical trial inpost-resection hepatocellular carcinoma. It displayed sig-nificant hematologic side effects when administered withdocetaxel [17, 18]. PG545, a fully sulfated hexasaccharideconjugated with a lipophilic moiety, is a dual inhibitor ofheparanase and angiogenesis, currently in phase-Iclinical trials in patients with advanced solid tumors([19], https://clinicaltrials.gov/ct2/show/NCT02042781).Roneparstat, N-acetylated glycol-split heparin, is inphase I clinical trial in myeloma patients (https://clinicaltrials.gov/ct2/show/study/NCT01764880, [20]. Similarly,necuparanib (glycol-split low molecular weight heparin)is in phase-I/II trial for pancreatic cancer in combinationwith nab-paclitaxel and gemcitabine (https://clinicaltrials.gov/ct2/show/NCT01621243, [21]). Given the diverseeffects of heparin-like compounds, these studies indicatethe significance of designing chemically novel, highlyselective and biologically active heparanase inhibitors topotently target various types of cancers and possibly in-flammatory diseases [8, 15]. Synthesis of heparanase-inhibiting small molecules has been reported [8, 16, 22],but none was advanced to preclinical and clinical studies[8]. We have previously reported the synthesis of various

heterocylces with good anticancer activity [23–29]. Thecurrent saccharide-based compounds are not specific forheparanase leaving open the question as to how much oftheir anti-tumor effect is due specifically to blocking hepar-anase activity. Herein, we screened 150 small moleculeswith the scaffold bearing quinolones, oxazines, benzoxa-zines, isoxazoli(di)nes, pyrimidinones, quinolines, benzoxa-zines, and 4-thiazolidinones, thiadiazolo[3,2-a]pyrimidin-5-one, 1,2,4-triazolo-1,3,4-thiadiazoles, and azaspiranes for in-hibition of human heparanase enzymatic activity. Selectedmolecules were tested for inhibition of cell migration andinvasion. The most effective compound was examined forputative binding modes against the target enzyme usingmolecular docking analysis.

MethodsAll solvents were of analytical grade and reagents werepurchased from Sigma-Aldrich. 1H and 13C NMR spec-tra were recorded on a Varian and Bruker WH-200(400 MHz) spectrometer in CDCl3 or DMSO-d6 as solv-ent, using TMS as an internal standard and chemicalshifts are expressed as ppm. Mass spectra were deter-mined on a Shimadzu LC-MS. High resolution massspectra were determined on a Bruker Daltonics instru-ment. The elemental analyses were carried out using anElemental Vario Cube CHNS rapid Analyzer. The pro-gress of the reaction was monitored by TLC pre-coatedsilica gel G plates.

HeparanaseActive heparanase was produced in HEK 293 cells stablytransfected with the human heparanase gene constructin the mammalian pSecTag vector. The enzyme waspurified and kindly provided by Dr. Yi Zhang (Eli Lillyand Company, New York, NY) [30].

CellsMouse Lewis lung carcinoma (LLC; ATCC Cat. number:CRL-1642), human lung carcinoma (HCC827; ATCCCat. number: CRL-2868), and human hepatocellular car-cinoma (HepG2, Hep3B; ATCC Cat. number: HB-8065and HB-8064, respectively) cell lines were obtained fromthe American Type Culture Collection and workingstocks did not exceed four passages. The cell lines haverecently been tested for mycoplasma contamination andauthenticated using the Promega PowerPlex 16 HS kit.Cells were cultured in Dulbecco’s Modified Eagle’sMedium (DMEM) supplemented with glutamine, pyru-vate, antibiotics and 10% fetal calf serum in a humidifiedatmosphere containing 5% CO2 at 37 °C.

Real-time PCRTotal RNA was extracted with TRIzol (Sigma) and RNA(1 μg) was amplified using one step PCR amplification

Baburajeev et al. BMC Cancer (2017) 17:235 Page 3 of 14

kit, according to the manufacturer’s (ABgene, Epsom, UK)instructions. The PCR primer sets utilized were: i) mouseheparanase - Forward: 5′ TTTGCAGCTGGCTTTATGTG 3′, Reverse: 5′ GTCTGGGCCTTTCACTCTTG 3′(207 nucleotides); ii) mouse GAPDH - Forward: 5′ AGAACATCATCCCTGCATCC 3′, Reverse: 5′ AGCCGTATTCATTGTCATACC 3′ (348 nucleotides); iii) human hepara-nase - Forward: 5′ CCAGCCGAGCCACATCGCTC 3′,Reverse: 5′ ATGAGCCCCAGCCTTCTCCAT 3′ (550nucleotides); iv) human GAPDH - Forward: 5′ ACAGTTCTAATGCTCAGTTGCTC 3′; Reverse: 5′ TTGCCTCATCACCACTTCTATT 3′ (360 nucleotides).

Preparation of Sulphated CeriaHydrous cerium oxide was prepared by the hydrolysis ofcerium (III) nitrate hexahydrate with 1:1 ammonia. Cer-ium (III) nitrate was dissolved in double distilled water.To this clear solution, dilute (1:1) aqueous ammonia wasadded drop-wise from a burette with vigorous stirringuntil the pH of the solution reached 8.The solution was boiled for 15 min and allowed to

stand overnight. The mother liquor was then decantedand the precipitate was washed several times with dis-tilled water till it is completely free of nitrate ions whichwas confirmed by brown ring test. The precipitate wasfiltered and dried overnight at 383 K for 16 h. The hy-droxide obtained was sieved to get particles of 75-100 μm mesh size and immersed in (1:1) H2SO4 solution(2 mL/g) and subjected to stirring for 4 h. Excess waterwas evaporated and the resulting sample was oven driedat 383 K for 16 h, calcined at 823 K for 5 h and storedin vacuum desiccator.

General procedure for Microwave synthesis of 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thiol (2)A mixture of methylbenzoate (1 mmol) and hydrazine hy-drate (1 mmol) in 20 mL ethanol was irradiated in micro-wave at 700 W in a specially designed Teflon vesselcontaining lead acetate, until all the starting material wasconsumed (1-2 min, as monitored by TLC). To the abovemixture (0.006 mmol) of KOH, CS2 (1 mmol) was addedand further irradiated at 700 W for 1 min. Finally, hydra-zine hydrate (2 mmol) was added drop wise to the abovemixture and continued the irradiation at 700 W until awhite solid appeared at the bottom (2-3 min). The leadacetate worked as a trap for H2S that was evolved duringreaction. The solid obtained was dissolved in water (15-20 mL) and acidified with conc. HCl. The separated solidwas filtered, dried and recrystallized to obtain pure 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thiol. Yield 78%, m.p.232-234 °C; IR (KBr) γ/cm

−1: 3310.07 (NH2 stretch),3071.36 (aromatic CH stretch), 1472.38 (tautomericC = S). 1H NMR: (400 MHz, DMSO-d6). δ:7.6-7.5 (m, 2H,ArH), 7.34-7.2 (m, 3H, ArH), 5.14 (s, 2H, NH2).

General procedure for the synthesis of 6-substituted-3-phenyl-(1,2,4)-triazolo(3,4-b)(1,3,4-thiadiazole (4a-4 h) byusing SCeTo a mixture of 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thiol (1 mmol) and (3a-h) (1 mmol) in DMF (10 mL),SCe (20 mol%) and POCl3 (0.1 mmol) were added. Thereaction mixture was refluxed for 10 h. Completion ofthe reaction was monitored by TLC and the catalyst wasfiltered and washed with water. Solvent was removedunder reduced pressure and crushed ice was added tothe concentrated mass. The pH of reaction mixture wasadjusted to 8.0 using K2CO3 and KOH. The solid ob-tained was separated by filtration, washed with excesswater, dried and recrystallized using appropriate solvent.

General procedure for the synthesis of 2-hydroxy-3,5-diiodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benza-mide (5a) and 2-hydroxy-5-iodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide (5b)To 3a (1 eq) in DMF, EDC (1.1 eq) and HOBt (1.1 eq)was added and stirred at room temperature for 30 min.It was followed by the addition of amine (2) and stirredfor 2 h. After completion of the reaction, it was dilutedwith water and the obtained solid was filtered and re-crystallized in appropriate solvent.

2,4-Diiodo-6-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3,4]thiadiazol-6yl)phenol (4a, DTP)Yellow colored solid; 1H NMR (400 MHz, DMSO-d6)8.37-8.35 (d, 2H), 8.26 (s, 1H), 7.85 (s, 1H), 7.69-7.63 (m,2H), 7.54-7.52 (d, 1H), 4.92 (s, 1H); 13C NMR (DMSO-d6); 165.53, 154.53, 149.29, 148.83, 140.98, 137.51,133.83, 132.45, 129.11, 128.64, 123.10, 122.44, 120.72,96.18, 85.11; HRMS Calcd 568.840; Found: 568.840(M + Na)+; Anal. Calcd for C15H8I2N4OS: C, 32.99; H,1.48; N, 10.26; Found: C, 33.00; H, 1.49; N, 10.28.

6-(4-(1H-Imidazol-1-yl)phenyl)-3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazole (4b)Pale yellow colored solid; 1H NMR (400 MHz, DMSO-d6) δ: 8.46-8.44 (d, 2H), 7.81-7.77 (m, 2H), 7.53-7.49 (m,3H), 7.39-7.34 (m, 3H), 7.27-7.24 (m, 2H); 13C NMR(DMSO-d6); 161.55, 149.29, 148.53, 140.98, 137.18,137.11, 133.83, 132.48, 131.97, 129.11, 128.64, 128.18,123.10, 122.43, 120.27; LCMS (MM:ES + APCI) 345.2(M + H)+. Anal. Calcd for C18H12N6S: C, 62.77; H, 3.51;N, 24.40; Found: C, 62.79; H, 3.53; N, 24.43.

4-Iodo-2-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6-yl)phenol (4c, ITP)Yellow colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.44-8.42 (d, 2H), 8.08-8.06 (d, 2H), 8.02-8.00 (m, 1H),7.95-7.91 (m, 1H), 7.71 (s, 1H), 7.16-7.14 (d, 1H), 4.92 (s,1H); 13C NMR (DMSO-d6) δ: 164.19, 159.73, 152.02,

Baburajeev et al. BMC Cancer (2017) 17:235 Page 4 of 14

147.46, 138.26, 133.27, 131.64, 129.40, 127.70, 124.93,120.48, 119.82, 118.66, 88.23; HRMS Calcd 442.943; Found:442.943 (M + Na)+; Anal. Calcd for C15H9IN4OS: C, 42.87;H, 2.16; N, 13.33; Found: C, 42.89; H, 2.17; N, 13.35.

6-(((R)-Tetrahydro-2H-pyran-2-yl)(phenyl)methyl)-3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazole (4d)White colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.25-8.16 (d, 2H), 8.06 (m, 1H), 7.78-7.76 (m, 1H), 7.62-7.60 (m, 1H), 7.27-7.15 (m, 4H), 4.58-4.53 (m, 2H), 3.88-3.84 (m, 2H), 1.78-1.73 (m, 4H), 1.50-1.45 (m, 2H); 13CNMR (DMSO-d6) δ: 164.56, 149.30, 143.93, 141.04,137.49, 132.82, 132.41, 130.23, 129.10, 128.10, 120.70,80.11, 71.09, 43.59, 30.41, 30.33, 21.48; LCMS(MM:ES + APCI) 377.2 (M + H)+; Anal. Calcd forC21H20N4OS: C, 67.00; H, 5.35; N, 14.88; Found: C,67.02; H, 5.37; N, 14.90.

2-(3-Phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6yl)-1-p-tolylethanone (4e)White colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.43-8.41 (m, 2H), 8.03-7.99 (m, 3H), 7.92 (m, 1H), 7.69(m, 1H), 7.40-7.38 (m, 2H), 4.1 (s, 2H), 2.42 (m, 3H); 13CNMR (DMSO-d6) δ:192.83, 164.18, 159.42, 151.99,146.87, 137.47, 132.28, 130.26, 125.66, 123.38, 121.01,120.89, 48.13, 21.13; HRMS Calcd 357.078; Found:357.078 (M + Na)+. Anal. Calcd for C18H14N4OS: C,64.65; H, 4.22; N, 16.75; Found: C, 64.67; H, 4.25; N,16.77.

6-(3-4-Dimethoxybenzyl)-3-phenyl-[1, 2, 4]triazolo[3,4-b][1,3, 4]thiadiazole (4f)Yellow colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.2 (d, 2H), 7.6-7.4 (m, 3H), 7.0 (s, 1H), 6.9 (d, 2H), 4.4(s, 2H), 3.8 (s, 6H); LCMS (MM:ES + APCI) 353.2(M + H)+; Anal.Calcd for C18H16N4O2S: C, 61.35; H,4.58; N, 15.90; Found: C, 61.39; H 4.59; N, 15.93.

3-(3-Phenyl–[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6-yl-)phenol (4 g)White colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.32-8.31 (m, 2H), 8.13 (s, 1H), 7.94-7.87 (m, 3H), 7.65-7.59 (m, 2H), 7.46 (m, 1H), 4.91 (s, 1H); LCMS(MM:ES + APCI) 295.2 (M + H)+; Anal. Calcd forC15H10N4OS: C, 61.21; H, 3.42; N, 19.04; Found: C,61.23; H, 3.44; N, 19.07.

3-Phenyl-6-styryl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazole(4 h)White colored solid; 1H NMR (400 MHz, DMSO-d6) δ:8.25-8.22(d, 2H), 7.92-7.87 (m, 2H), 7.73-7.55 (m, 4H),7.32-7.26 (m, 2H), 6.45-6.42 (m, 2H); 13C NMR (DMSO-d6) δ: 164.84, 159.58, 153.39, 145.42, 139.89, 131.08,131.04, 130.53, 130.42, 130.31, 129.09, 125.84, 125.47,

118.08, 116.18, 115.90; HRMS Calcd 327.067; Found:327.067 (M + Na)+; Anal. Calcd for C17H12N4S: C, 67.O8;H, 3.97; N, 18.41; Found: C, 67.09; H, 3.99; N, 18.44.

2-Hydroxy-3,5-diiodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide (5a, HTP)Pale yellow colored solid; 1H NMR (400 MHz, DMSO-d6) δ: 14.64 (s, NH), 12.30 (s, NH), 8.48 (s, 1H), 8.40 (s,1H), 8.24-8.15 (m, 3H), 7.81-7.78 (m, 2H), 4.73 (s, 1H);13C NMR (DMSO-d6) δ:181.47, 173.23, 153.47, 147.94,145.12, 136.38, 134.36, 131.13, 129.09, 128.78,128.21, 126.02, 125.58, 90.79, 72.33; HRMS Calcd586.851; Found: 586.851 (M + Na)+; Anal.Calcd forC15H10I2N4O2S: C, 31.94; H, 1.79; N, 9.93; Found: C,31.96; H, 1.81; N, 9.93.

2-Hydroxy-5-iodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide (5b)Pale yellow colored solid; 1H NMR (400 MHz,DMSO-d6) δ: 12.5 (s, NH), 8.5 (s, 1H), 8.4 (m, 1H),8.1 (m,1H), 7.8 (m, 3H), 7.6 (m,1H), 4.6 (s, 1H);LCMS (MM:ES + APCI) 438.4 (M + H)+; Anal. Calcdfor C15H11IN4O2S: C, 41.11; H, 2.53; N, 12.78; Found:C, 41.12; H, 2.56; N, 12.80.Spectral data of the compounds are presented in

Additional file 1: Figure S1.

Colorimetric heparanase assayThe assay, carried out in 96 well microplates, measuresthe appearance of the disaccharide product ofheparanase-catalyzed fondaparinux cleavage, colorimet-rically using the tetrazolium salt WST-1 [31]. Briefly,assay solutions (100 μL) are composed of 40 mM so-dium acetate buffer (pH 5.0) and 100 mM fondaparinux(Arixtra) with or without increasing concentrations ofinhibitor. Recombinant heparanase was added to a finalconcentration of 140 pM, to start the assay. The platesare incubated at 37 °C for 18 h and the reaction isstopped by the addition of 100 μL solution containing1.69 mM 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST-1) in 0.1 MNaOH. The plates are developed at 60 °C for 60 min,and the absorbance is measured at 584 nm. In eachplate, a standard curve constructed with D-galactose asthe reducing sugar standard is prepared in the same buf-fer and volume over the range of 2–100 μM [31].

ECM degradation heparanase assayThe semi-quantitative heparanase assay was performedas described previously [32, 33]. Briefly, metabolicallysulfate [35S] labeled ECM deposited by cultured endo-thelial cells and coating the surface of 35 mm tissue cul-ture dishes [33], is incubated (3 h, 37 °C, pH 6.0, 1 mLfinal volume) with recombinant human heparanase

Baburajeev et al. BMC Cancer (2017) 17:235 Page 5 of 14

(200 ng/mL) in the absence and presence of candidatesmall molecules. The ECM was also incubated (24 h,37 °C, pH 6.0) with cell lysates (200 μg protein/dish)prepared by 3 cycles of freeze and thaw in reaction buf-fer, as described [32]. To evaluate the occurrence ofproteoglycan degradation, the incubation medium is col-lected and applied for gel filtration on Sepharose 6B col-umns (0.9 × 30 cm). Fractions (0.2 mL) are eluted withPBS and counted for radioactivity. The excluded volume(Vo) is marked by blue dextran and the total includedvolume (Vt) by phenol red. Degradation fragments ofHS side chains are eluted from Sepharose 6B at0.5 < Kav < 0.8 (fractions 12-25) [32].

In vitro cytotoxicity assayThe antiproliferative effect of the compounds againstLLC (Lewis lung carcinoma) and HepG2 (hepatocellularcarcinoma) cells was determined by the MTT dye up-take method as described previously [34–36]. Briefly,cells (2.5 × 104/mL) were incubated in triplicate in a 96-well plate, in the presence of varying concentrations oftest compounds at a volume of 0.2 mL, for different timeintervals at 37 °C. Thereafter, 20 μL MTT solution(5 mg/mL in PBS) was added to each well. After 2 h in-cubation at 37 °C, 0.1 mL lysis buffer (20% SDS, 50%dimethylformamide) was added and incubated for 1 h at37 °C, and the optical density (OD) at 570 nm was mea-sured using a plate reader.

In vitro trans-well invasion/migration assayInvasion of cells (LLC, HepG2) across a Matrigel™coated membrane or migration through control un-coated inserts was assessed using 24-well plates (BD Bio-sciences, 8 μm pore size, insert size: 6.4 mm) accordingto the manufacturer’s protocol and as described earlier[37–39]. Briefly, single cell suspensions (1 × 106 cells/mL) were prepared by detaching and resuspending thecells in DMEM containing 0.1% BSA. Before adding thecells, the chambers were rehydrated for 2 h in anincubator at 37 °C. The lower chambers were filled with600 μL DMEM containing chemo-attractant (10% FBS).After seeding the cells (2 × 105 in 200 μL of serum-freemedium) into the upper chamber of triplicate wells with

Scheme 1 Schematic representation of new heparanase inhibitors used in700 watt; ii) SCe (20 mol%), DMF, 10 h

or without increasing concentrations of compounds, thechambers were incubated for 24 h (LLC) and 48 h(HepG2) at 37 °C. The non-invaded cells were removedfrom the upper surface of the membrane by scrub-bing and cells that migrated through the filter werefixed, stained with Diff Quick solution, counted byexamination of at least five microscopic fields andphotographed.

ResultsChemical synthesis and characterizationIn recent years, solid acid catalysts have gained consider-able attention due to their high efficiency, eco-friendly,longer catalyst life, negligible equipment corrosion andtheir reusability. In present work we report the synthesisof novel 1,2,4-triazolo-1,3,4-thiadiazoles bearing com-pounds via sulfated ceria mediated cycalization reaction[40–42]. Initially we synthesized the sulphated ceria(SCe) catalyst as reported previously [43]. The powderedX-ray diffraction (PXRD), Burner- Ememett-Teller (BET)and Scanning Electron microscope patterns of SCematched with the standard material.The experimental strategy for the synthesis of starting

material 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thiol (2)was achieved by Microwave method as reported recently(Scheme 1, i) [36]. In order to synthesize the novel1,2,4-triazolo-1,3,4-thiadiazoles, we focused on the effi-ciency of SCe in cyclisation reaction. To optimise the re-action conditions, we attempted reaction in thecombination of 2 and 3-oxo-3-(p-tolyl)propanoic acid(3e) as a model reaction in different concentrations ofSCe and the results are summarised in Additional file 1:Table S1. The ideal system for the cyclization was foundto be 20 mol% of SCe in DMF (Additional file 1: TableS1, entry 8). We also observed incomplete conversions,when SCe was lower than 20 mol%, despite of longerreaction time. From the above reaction, we examinedthe generality of method by synthesizing series of 1,2,4-triazolo-1,3,4-thiadiazoles molecules (Scheme 1, ii).

Influence of SCe on cyclizationThe modification of SCe with anions such as sulphateions forms a super acidic catalyst which effectively catal-yses the cyclization. Majority of reactions completed

this study. i) hydrazine hydrate, ethanol, MWI; CS2 and KOH, 5-6 min at

Scheme 2 Plausible mechanism of cyclization and synthesis of title compounds

Baburajeev et al. BMC Cancer (2017) 17:235 Page 6 of 14

within 10 h and undissolved SCe was separated by sim-ple filtration and finally furnished the product in goodyield (Additional file 1: Table S1).

Plausible mechanismThe First step involves the protonation of acid followedby dehydration and simultaneous attack of nitrogen lonepair to the electron deficient acylium ion to form anintermediate. In the second step, the intermediateundergoes neighboring group participation with nucleo-philic sulphur, which leads to the formation of C-S bondby the elimination of water molecule (Scheme 2). Finally,deprotonation results in the formation of the title prod-ucts (4a-h).

Scheme 3 Synthetic scheme for the preparation of N-amino-triazole-amides. i) HOBt/EDC, DMF, RT, 2 h. R1 = 3a, 3c

Re-usability of acid catalyst systemExperiment was performed to study the recyclability ofthe SCe system employing 2 with 3e to yield compound4e (Scheme 1). After each run, catalyst was removed byfiltration from the reaction mixture, washed thoroughlywith acetone, dried and activated at 823 K and taken fornext cycle. We observed significant reduction in theyield of the product after second run (Additional file 1:Table S2). It is important to note that this system isrecyclable twice with the isolated yields above 70%.Further, we synthesized the amide derivatives of 2 with

corresponding mono and di iodo salicylic acid (3a and3c) via HOBt/EDC amide formation reactions (Scheme3) which resulted in the products 2-hydroxy-3,5-diiodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide(5a) and 2-hydroxy-5-iodo-N-(3-phenyl-5-thioxo-1H-1,2,4-

triazol-4(5H)-yl)benzamide (5b). The compounds obtainedwere characterized by 1H NMR, 13C NMR, and mass spec-tral analysis (Additional file 1: Figure S1 – Spectral data).Detailed chemical characterization of the newly synthesizedcompounds is provided in the ‘methods’ section.

In vitro screening of the small molecule library forinhibition of the catalytic activity of human heparanaseInitially we screened the entire library of small moleculeswith diverse structures for their in vitro inhibitory activ-ity against recombinant human heparanase at differentconcentrations up to 20 μg/mL. We used a 96-wellbased colorimetric assay that measures the ability of re-combinant heparanase to degrade fondaparinux (heparinderived pentasaccharide) in solution [31]. The assaymeasures the appearance of a disaccharide product offondaparinux cleavage, using the tetrazolium salt WST-1[31]. Compounds bearing triazolo-thiadiazole backbonedisplayed significant inhibitory activity, 2,4-Diiodo-6-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6yl)phe-nol (DTP) being the lead and consistently active

Baburajeev et al. BMC Cancer (2017) 17:235 Page 7 of 14

structure followed by 2-hydroxy-3,5-diiodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide (HTP)and 4-iodo-2-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3,4]thiadiazol-6-yl)phenol (ITP) (Fig. 1a).In order to better resemble the in vivo situation, we

applied as substrate metabolically sulfate [Na235SO4] la-

beled extracellular matrix (ECM) deposited by culturedendothelial cells [32]. This naturally produced substrateclosely resembles the subendothelial basement mem-brane in its composition, biological function and barrierproperties. Years of experience revealed that compoundsthat effectively inhibit the enzyme in this assay are alsoeffective in preclinical animal models [20, 44, 45]. Thissemi-quantitative assay measures release of radioactiveheparan sulfate (HS) degradation fragments from an in-soluble extracellular matrix (ECM) that is firmly boundto a culture dish [32, 33]. Briefly, the ECM substrate isincubated with recombinant human heparanase in theabsence and presence of candidate small molecules. Theincubation medium is collected and subjected to gel

Fig. 1 a Screening of compounds for inhibition of heparanase enzymaticactivity applying the Fondaparinux heparanase assay. PC, positive control= N-(4-{[4-(1H-Benzoimidazol-2-yl)-arylamino]-methyl}-phenyl)-benzamide[22]. b Lead molecules which exhibited inhibitory activity against humanheparanase were validated using a semi-quantitative assay that measuresrelease of radioactive heparan sulfate fragments from an insolubleextracellular matrix as described in ‘Methods’ section. Briefly, sulfate [35S]labeled ECM was incubated (6 h, 37 °C, pH 6.0) with recombinant humanheparanase (200 ng/mL) in the absence and presence of 10 μg/mL of thetest compounds. Sulfate labeled material released into the incubationmedium was subjected to gel filtration on Sepharose 6B. Compound DTPeffectively inhibited the cleavage and release of heparan sulfatedegradation fragments

filtration on Sepharose 6B. Degradation fragments ofheparan sulfate side chains are eluted at 0.5 < Kav < 0.8,whereas nearly intact HSPG is eluted next to the voidvolume [32]. As demonstrated in Fig. 1b, compoundDTP (10 μg/mL) completely inhibited the release of hep-aran sulfate degradation fragments. The other structuralanalogs were less effective (not shown). Thus, we haveidentified heparanase-inhibiting lead compound from arandom screen of bioactive compounds.

Heparanase activity in various hepatocellular and lungcarcinoma cell linesHeparanase expression (RT-PCR) (Fig. 2a) and enzym-atic activity (Fig. 2b) were examined in various hepato-cellular carcinoma (human HepG2, Hep3B) and lungcarcinoma (human HCC827, mouse LLC) cell lines. Arelatively low expression level and enzymatic activitywere noted in HepG2 cells as compared to the other celllines which exhibited moderate-high heparanase

Fig. 2 Heparanase expression and activity in various hepatocellular andlung carcinoma cell lines. Mouse Lewis lung carcinoma (LLC), humanlung carcinoma (HCC827 = HCC), and human hepatocellular carcinoma(HepG2, Hep3B) cells maintained in culture were subjected to RT-PCR (a)and heparanase activity (b) assays, as described in ‘Methods’

Table 1 Characterization and anti-proliferative activity of the newly synthesized small molecules that are used for the in vitro heparanaseenzyme inhibition studies

Baburajeev et al. BMC Cancer (2017) 17:235 Page 8 of 14

Baburajeev et al. BMC Cancer (2017) 17:235 Page 9 of 14

enzymatic activity (Fig. 2b). HepG2 human hepatocellularcarcinoma and LLC mouse Lewis lung carcinoma cellslines were selected for further experimentation, represent-ing human and mouse cells expressing low (HepG2) andmoderate-high (LLC) enzymatic activity, respectively.

DTP suppresses the proliferation of LLC and HepG2 cellsGiven the overexpression of heparanase in hepatocellu-lar and lung carcinoma cancer cell lines, we next ana-lyzed the effect of triazolo-thiadiazoles on LLC (LewisLung carcinoma) and HepG2 (hepatocellular carcinoma)cell proliferation using the MTT assay [46–48].Paclitaxel and DMSO were used as reference drug andvehicle control, respectively. Among the tested triazolo-thiadiazoles, DTP was found to exert an antiproliferativeeffect with IC50 value of 11.9 and 8.3 μM against LLCand HepG2, respectively (Table 1). Thus, structure activ-ity relationship of the lead anticancer agent revealed thatphenolic and iodine substituents on the core triazolo-thiadiazole nucleus were found to increase the inhibitoryactivity towards the proliferation of cancer cells. Not-ably, the exo-conjugation to the triazolo-thiadiazolecore structure also enhances the cytotoxicity. The

Fig. 3 Effect of DTP on LLC cell migration and Invasion. LLC cells were platedMatrigel coat) (a) and invasion (with Matrigel coat) (b) were measured as desheparin (100 μg/mL) on cell migration and invasion is demonstrated by repregraphs. Data are represented as mean ± S.E. *P < 0.1; **P < 0.05. ***P < 0.01

hydrophobic substituents on the core structure werefound to be ineffective against proliferation of cancercells.

DTP inhibits migration and invasion of LLC cellsThe involvement of heparanase in cancer metastasis isclearly demonstrated in various types of cancer [9, 14, 32].We investigated the effect of DTP on LLC and HepG2 cellmigration and invasion applying trans-well filters (8 μMpore size) that were either uncoated or coated with Matri-gel, respectively. LLC (Fig. 3) and HepG2 (Fig. 4) cells mi-grated through uncoated filters and invaded throughMatrigel in response to stimulation with FBS. DTPsignificantly suppressed cell migration (Figs. 3a and4a) and invasion (Figs. 3b and 4b) in a dosedependent manner, yielding nearly 50% inhibition at5 μM. This effect is likely attributed to inhibition ofheparanase enzymatic activity by DTP. Heparin wasused as positive control.

Rationalizing SAR trends via protein-ligand interactionsIn order to perform virtual screening, a recently pub-lished X-ray crystal structure for human heparanase was

on BD BioCoat™ chambers (BD Biosciences) and cell migration (withoutcribed in ‘Methods’. The effect of lead compound DTP (1–10 μM) orsentative photomicrographs (magnification: ×10) and the respective bar

Fig. 4 Effect of DTP on HepG2 cell migration and Invasion. HepG2 cells were plated on BD BioCoat™ chambers (BD Biosciences) and cell migration (withoutMatrigel coat) (a) and invasion (with Matrigel coat) (b) were measured as described in ‘Methods’. The effect of lead compound DTP (1–10 μM) or heparin(100 μg/mL) on cell migration and invasion is demonstrated by representative photomicrographs (magnification: ×5) and the respective bar graphs. Data arerepresented as mean ± S.E. *P < 0.05

Baburajeev et al. BMC Cancer (2017) 17:235 Page 10 of 14

obtained from the Protein Data Bank (PDB:5E97; Glyco-side Hydrolase ligand structures 1, 1.63 Å resolution)[49]. The structure was loaded into MOE [50] and cor-rected using the Structure Preparation tool before run-ning Protonate 3D. The Site Finder tool identified theactive site containing Glu-343 and Glu-225 that wereidentified as the catalytic nucleophile and acid-base ofHeparanase [45, 49]. Compound structures were loadedinto MOE and energy minimised before carrying outrigid receptor docking (triangle matcher, London dGForcefield refinement, GBVI/WSA dG rescoring).The 52 docked poses that included the three active

compounds DTP, HTP, and ITP did not appear toexplain the experimentally observed trend in SAR. How-ever, docking results revealed a similar interaction pat-tern between active compounds ITP and DTP, withposes that interact favourably with both Asn-224 andAsp-62 due to the triazolo-thiadiazole backbone (Fig. 5).For compound HTP, this interaction profile was foundto be slightly less favourable, interacting instead withAsn-224 and the active site acid-base Glu-343.Although these compounds do not appear to be more

favourable than the other docked compunds, the

presence of iodine substituents found on all hit com-pounds may preferentially lower the phenols’ pKA suffi-ciently to allow for deprotonation of the ligands inprotein environment.

DiscussionHuman heparanase is an endoglucuronidase that cleavesheparan sulfate chains thereby regulating multiple bio-logical activities that together enhance tumor growth,metastasis and angiogenesis [7–10, 14, 32]. Heparanaseis expressed by most types of cancer and has emerged asa valid target for anti-cancer therapy [8, 15]. Heparanaserepresents a druggable target because: (i) there is only asingle enzymatically active heparanase expressed inhumans, (ii) the enzyme is present in low levels in nor-mal tissues but dramatically elevated in tumors where itis associated with poor prognosis and reduced postoper-ative survival time, and (iii) heparanase deficient miceappear normal [51]. Thus, properly designed heparanaseinhibitors will likely have few, if any, negative sideeffects. Development of heparanase inhibitors hasfocused predominantly on carbohydrate-based com-pounds with heparin-like properties [8, 15, 44]. These

Fig. 5 Selected docked poses for active compounds DTP, HTP and ITP (a, b and c, respectively), showing similar active site interaction modes. DTPand ITP are shown to interact with both Asn-224 and Asp-62 via the triazolo-thiadiazole backbone, and HTP is shown to interact with Asn-224 and theactive site acid-base Glu-343

Baburajeev et al. BMC Cancer (2017) 17:235 Page 11 of 14

compounds bind to the heparin-binding domains thatflank the enzyme active site of heparanase thereby inhi-biting cleavage of heparan sulfate. Four different heparinmimics are currently in clinical trials in human cancerpatients. However all of these mimics have the disadvan-tage that they are not specific for heparanase and likelyinteract with different heparin-binding proteins with un-known consequences and off target effects [8, 15].Therefore, even if they prove efficacious in patients itwill be impossible to attribute their effect solely toheparanase inhibition. In addition three of the fourmimics are heterogeneous in their structure addingfurther to their uncertainty as viable drugs for use inhumans [8]. A number of heparanase-inhibiting smallmolecules were reported [8, 16, 22], but none enteredclinical testing.Heparanase expressed in cancer cells and cells of the

tumor microenvironment provides a most appropriatetherapeutic molecular target and could serve a decisiverole in cancer regime. In addition to remodeling ofECM, human heparanase regulates multiple signalingcascades involved in tumor cell survival, angiogenesisand metastasis [7, 8, 14, 15, 44, 52]. The positivecorrelation of heparanase with progression of malignan-cies makes it an attractive target in the treatment ofcancer. It is hoped that our identification of a lead

molecule and the recently resolved crystal structure ofthe heparanase protein [49] will accelerate rational de-sign of heparanase-inhibiting small molecules endowedwith considerably improved binding affinity, specificity,pharmacokinetics and efficacy in xenograft cancermodels. Selected molecules exerting little or no side ef-fects will then be examined for oral availability and anticancer effect in combination with currently availabletreatments, applying patient derived xenograft modelsand, at a later stage, animal models of other diseasesshown to be causally related to heparanase [53–58].

ConclusionsIn a search for small molecule inhibitors that can inter-fere with the catalytic activity of human heparanase, wereport the synthesis and biological evaluation of a libraryof synthetic small molecules and identification oftriazolo-thiadiazole derivative as a potent inhibitor ofhuman heparanase. The identified lead structure dis-played antiproliferative activity and suppressed the mi-gration and invasion of cancer cells in correlation withinhibition of heparanase enzymatic activity. Furtherdevelopment of this novel class of heparanase inhibitorsand optimization to maximize their affinity, pharmaco-kinetics and oral availability will provide a uniqueopportunity for development of innovative anti-cancer

Baburajeev et al. BMC Cancer (2017) 17:235 Page 12 of 14

therapeutics. Moreover, because heparanase helps drivethe progression of other diseases (e.g., diabetes, diabeticnephropathy, arthritis, colitis, sepsis, atherosclerosis)[53–58], these drugs hold potential to impact publichealth.

Additional file

Additional file 1: Table S1. Optimisation of mol% of SCe catalyst, andselection of medium for cyclization reaction. To optimize the reactionconditions for the synthesis of novel 1,2,4-triazolo-1,3,4-thiadiazoles, the reactionwas performed in combination of 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thioland 3-oxo-3-(p-tolyl)propanoic acid as a model reaction in differentconcentrations of SCe and solvent. The optimal system for cyclization was20 mol% of SCe in DMF. Table S2. Evaluation of the reuse of SCe for cyclizationreaction. The recyclability of the SCe system was evaluated by employing 4-amino-5-phenyl-4 h-1,2,4-triazole-3-thiol with 3-oxo-3-(p-tolyl)propanoic acid toyield 2-(3-Phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6yl)-1-p-tolylethanone.The catalyst was removed by filtration after each run and thoroughly washedwith acetone, dried and activated at 823 K and taken for the next cycle. Therewas a significant reduction in the yield of the product after the second runusing SCe. Figure S1. Spectral data. Scanned copy of 1H NMR, 13C NMR, andmass spectra of the indicated compounds. (DOCX 4202 kb)

AbbreviationsBSA: Bovine serum albumin; DMEM: Dulbecco’s Modified Eagle Medium;DTP: 2,4-Diiodo-6-(3-phenyl-[1, 2, 4]triazolo[3,4-b][1, 3, 4]thiadiazol-6yl)phenol;ECM: Extracellular matrix; HGF: Hepatocyte growth factor; HS: Heparan Sulfate;HSPG: heparan sulphate proteolglycan; HTP: 2-Hydroxy-3,5-diiodo-N-(3-phenyl-5-thioxo-1H-1,2,4-triazol-4(5H)-yl)benzamide; ITP: 4-Iodo-2-(3-phenyl-[1, 2,4]triazolo[3,4b][1, 3, 4]thiadiazol-6-yl)phenol.; LLC: Lewis lung carcinoma;MOE: Molecular operating environment; MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NMR: Nuclear magnetic resonance; OD: Opticaldensity; SAR: Structural activity relationship; SCe: sulphated ceria; TLC: Thin layerchromatography; VEGF: Vascular endothelial growth factor

AcknowledgementsCPB thanks S. Jayasree for her guidance in synthesizing the catalyst. IV thanksS. Feld for excellent technical assistance.

FundingThis research was supported by the Israel Science Foundation (ISF) and theUniversity Grants Commission (UGC) India, awarded to IV and KSR within theISF-UGC joint research program framework (grant No. 2277/15). The researchwas also supported by University Grants Commission (41-257-2012-SR), VisionGroup Science and Technology, Department of Science and Technology (NO.SR/FT/LS-142/2012) to Basappa. KSR thanks DST Indo-Korea [INT/Indo-Korea/122/2011-12] and Institution of Excellence, University of Mysore for financialsupport. CDM thanks the University of Mysore for Department of Science andTechnology-Promotion of University Research and Scientific Excellence (DST-PURSE) Research Associate fellowship. IV is a research Professor of the IsraelCancer Research Fund (ICRF). The funding agencies did not participate in thedesign of the study and collection, analysis and interpretation of data and inwriting the manuscript.

Availability of data and materialsAll data generated or analyses during this study are included in this articleand its Additional file 1.

Authors’ contributionsCPB, CDM, SR, DJM, JEF, UB and B carried out the chemistry, biological andmolecular studies. CDM, AB, IV, B and KSR interpreted the results and assistedin manuscript preparation. AB, IV, B and KSR provided the tools, reagents forresearch and prepared the manuscript. All authors read and approved thefinal manuscript.

Competing interestsThe authors declare that they have no competing interests.

Ethics approval and consent to participateThis study does not involve animal studies and human data.

Consent for publicationNot applicable.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations.

Author details1Laboratory of Chemical Biology, Department of Chemistry, BangaloreUniversity, Central College Campus, Palace Road, Bangalore 560001, India.2Department of Studies in Chemistry, University of Mysore, Manasagangotri,Mysore 570006, India. 3Department of Studies in Molecular Biology,University of Mysore, Manasagangotri, Mysore 570006, India.4Adichunchanagiri Institute for Molecular Medicine, BG Nagara, NagamangalaTaluk, Mandya district-571448, India. 5Centre for Molecular Informatics,Department of Chemistry, University of Cambridge, Lensfield Road,Cambridge, UK. 6Cancer and Vascular Biology Research Center, the BruceRappaport Faculty of Medicine, Technion, Haifa, Israel.

Received: 25 February 2016 Accepted: 22 March 2017

References1. Lu P, Takai K, Weaver VM, Werb Z. Extracellular Matrix Degradation and

Remodeling in Development and Disease. Cold Spring Harb Perspect Biol.2011; 3(12):10.1101/cshperspect.a005058 a005058.

2. Bernfield M, Gotte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J, Zako M.Functions of cell surface heparan sulfate proteoglycans. Ann Review Biochem.1999;68:729–77.

3. Iozzo RV, Sanderson RD. Proteoglycans in cancer biology, tumourmicroenvironment and angiogenesis. J Cell Mol Med. 2011;15(5):1013–31.

4. McKenzie EA. Heparanase: a target for drug discovery in cancer andinflammation. Brit J Pharmacol. 2007;151(1):1–14.

5. Li JP, Vlodavsky I. Heparin, heparan sulfate and heparanase in inflammatoryreactions. Thromb Haemost. 2009;102(5):823–8.

6. Peterson SB, Liu J. Multi-faceted substrate specificity of heparanase. MatrixBiol. 2013;32(5):223–7.

7. Arvatz G, Shafat I, Levy-Adam F, Ilan N, Vlodavsky I. The heparanase systemand tumor metastasis: is heparanase the seed and soil? Cancer MetastasisRev. 2011;30(2):253–68.

8. Rivara S, Milazzo FM, Giannini G. Heparanase: a rainbow pharmacologicaltarget associated to multiple pathologies including rare diseases. Fut MedChem. 2016;8(6):647–80.

9. Vlodavsky I, Beckhove P, Lerner I, Pisano C, Meirovitz A, Ilan N, Elkin M.Significance of heparanase in cancer and inflammation. CancerMicroenviron. 2012;5(2):115–32.

10. Vreys V, David G. Mammalian heparanase: what is the message? J CellularMol Med. 2007;11(3):427–52.

11. Zetser A, Bashenko Y, Edovitsky E, Levy-Adam F, Vlodavsky I, Ilan N. Heparanaseinduces vascular endothelial growth factor expression: correlation with p38phosphorylation levels and Src activation. Cancer Res. 2006;66(3):1455–63.

12. Ramani VC, Yang Y, Ren Y, Nan L, Sanderson RD. Heparanase plays a dualrole in driving hepatocyte growth factor (HGF) signaling by enhancing HGFexpression and activity. J Biol Chem. 2011;286(8):6490–9.

13. Purushothaman A, Chen L, Yang Y, Sanderson RD. Heparanase stimulationof protease expression implicates it as a master regulator of the aggressivetumor phenotype in myeloma. J Biol Chem. 2008;283(47):32628–36.

14. Ilan N, Elkin M, Vlodavsky I. Regulation, function and clinical significance ofheparanase in cancer metastasis and angiogenesis. Int J Biochem & Cell Biol.2006;38(12):2018–39.

15. Pisano C, Vlodavsky I, Ilan N, Zunino F. The potential of heparanase as atherapeutic target in cancer. Biochem Pharmacol. 2014;89(1):12–9.

16. Simizu S, Ishida K, Osada H. Heparanase as a molecular target of cancerchemotherapy. Cancer Sci. 2004;95(7):553–8.

17. Khasraw M, Pavlakis N, McCowatt S, Underhill C, Begbie S, de Souza P,Boyce A, Parnis F, Lim V, Harvie R, et al. Multicentre phase I/II study ofPI-88, a heparanase inhibitor in combination with docetaxel in patients

Baburajeev et al. BMC Cancer (2017) 17:235 Page 13 of 14

with metastatic castrate-resistant prostate cancer. Annals Oncol.2010;21(6):1302–7.

18. https://clinicaltrials.gov/ct2/show/record/NCT01402908.19. Dredge K, Hammond E, Handley P, Gonda TJ, Smith MT, Vincent C, Brandt

R, Ferro V, Bytheway I. PG545, a dual heparanase and angiogenesis inhibitor,induces potent anti-tumour and anti-metastatic efficacy in preclinicalmodels. Br J Cancer. 2011;104(4):635–42.

20. Ritchie JP, Ramani VC, Ren Y, Naggi A, Torri G, Casu B, Penco S, Pisano C,Carminati P, Tortoreto M, et al. SST0001, a chemically modified heparin,inhibits myeloma growth and angiogenesis via disruption of theheparanase/syndecan-1 axis. Clin Cancer Res. 2011;17(6):1382–93.

21. Zhou H, Roy S, Cochran E, Zouaoui R, Chu CL, Duffner J, Zhao G, Smith S,Galcheva-Gargova Z, Karlgren J, et al. M402, a Novel Heparan SulfateMimetic, Targets Multiple Pathways Implicated in Tumor Progression andMetastasis. PLoS One. 2011;6(6):e21106.

22. Xu Y-J, Miao H-Q, Pan W, Navarro EC, Tonra JR, Mitelman S, Camara MM,Deevi DS, Kiselyov AS, Kussie P, et al. N-(4-{[4-(1H-Benzoimidazol-2-yl)-arylamino]-methyl}-phenyl)-benzamide derivatives as small moleculeheparanase inhibitors. Bioorganic & Med Chem Lett. 2006;16(2):404–8.

23. Keerthy HK, Mohan CD, Sivaraman Siveen K, Fuchs JE, Rangappa S,Sundaram MS, Li F, Girish KS, Sethi G. Basappa et al. Novel syntheticbiscoumarins target tumor necrosis factor-alpha in hepatocellular carcinomain vitro and in vivo. J Biol Chem. 2014;289(46):31879–90.

24. Bharathkumar H, Mohan CD, Ananda H, Fuchs JE, Li F, Rangappa S,Surender M, Bulusu KC, Girish KS, Sethi G, et al. Microwave-assistedsynthesis, characterization and cytotoxic studies of novel estrogen receptoralpha ligands towards human breast cancer cells. Bioorganic & Med ChemLett. 2015;25(8):1804–7.

25. Rakesh KS, Jagadish S, Vinayaka AC, Hemshekhar M, Paul M, Thushara RM,Sundaram MS, Swaroop TR, Mohan CD, Basappa, et al. A new ibuprofenderivative inhibits platelet aggregation and ROS mediated plateletapoptosis. PloS one. 2014;9(9):107182.

26. Roopashree R, Mohan CD, Swaroop TR, Jagadish S, Raghava B, Balaji KS,Jayarama S. Basappa, Rangappa KS. Novel synthetic bisbenzimidazole thattargets angiogenesis in Ehrlich ascites carcinoma bearing mice. Bioorganic& Med Chem Lett. 2015;25(12):2589–93.

27. Keerthy HK, Garg M, Mohan CD, Madan V, Kanojia D, Shobith R,Nanjundaswamy S, Mason DJ, Bender A, Basappa, et al. Synthesis andcharacterization of novel 2-amino-chromene-nitriles that target Bcl-2 inacute myeloid leukemia cell lines. PLoS One. 2014;9(9):e107118.

28. Mohan CD, Srinivasa V, Rangappa S, Mervin L, Mohan S, Paricharak S, Baday S,Li F, Shanmugam MK, Chinnathambi A, et al. Trisubstituted-Imidazoles InduceApoptosis in Human Breast Cancer Cells by Targeting the Oncogenic PI3K/Akt/mTOR Signaling Pathway. PLoS One. 2016;11(4):e0153155.

29. Baburajeev CP, Mohan CD, Patil GS, Rangappa S, Pandey V, Sebastian A, FuchsJE, Bender A, Lobie PE. Basappa et al. Nano-cuprous oxide catalyzed one-potsynthesis of a carbazole-based STAT3 inhibitor: a facile approach viaintramolecular C-N bond formation reactions. RSC Adv. 2016;6(43):36775–85.

30. Blich M, Golan A, Arvatz G, Sebbag A, Shafat I, Sabo E, Cohen-Kaplan V,Petcherski S, Avniel-Polak S, Eitan A, et al. Macrophage activation byheparanase is mediated by TLR-2 and TLR-4 and associates with plaqueprogression. Arteriosclerosis Thromb & Vascular Biol. 2013;33(2):e56–65.

31. Hammond E, Li CP, Ferro V. Development of a colorimetric assay forheparanase activity suitable for kinetic analysis and inhibitor screening. AnalBiochem. 2010;396(1):112–6.

32. Vlodavsky I, Friedmann Y, Elkin M, Aingorn H, Atzmon R, Ishai-Michaeli R,Bitan M, Pappo O, Peretz T, Michal I, et al. Mammalian heparanase: genecloning, expression and function in tumor progression and metastasis.Nature Med. 1999;5(7):793–802.

33. Vlodavsky I. Preparation of Extracellular Matrices Produced by CulturedCorneal Endothelial and PF-HR9 Endodermal Cells. Curr protocols Cell Biol.1999; 10.14. 11-10.14. 14.

34. Bharathkumar H, Mohan CD, Rangappa S, Kang T, Keerthy HK, Fuchs JE,Kwon NH, Bender A, Kim S. Basappa et al. Screening of quinoline, 1,3-benzoxazine, and 1,3-oxazine-based small molecules against isolatedmethionyl-tRNA synthetase and A549 and HCT116 cancer cellsincluding an in silico binding mode analysis. Organic & Biomol Chem.2015;13(36):9381–7.

35. Ashwini N, Garg M, Mohan CD, Fuchs JE, Rangappa S, Anusha S, SwaroopTR, Rakesh KS, Kanojia D, Madan V, et al. Synthesis of 1,2-benzisoxazoletethered 1,2,3-triazoles that exhibit anticancer activity in acute myeloid

leukemia cell lines by inhibiting histone deacetylases, and inducing p21 andtubulin acetylation. Bioorg & Medicinal Chem. 2015;23(18):6157–65.

36. Baburajeev CP, Dhananjaya Mohan C, Ananda H, Rangappa S, Fuchs JE,Jagadish S, Sivaraman Siveen K, Chinnathambi A, Ali Alharbi S, Zayed ME,et al. Development of Novel Triazolo-Thiadiazoles from Heterogeneous"Green" Catalysis as Protein Tyrosine Phosphatase 1B Inhibitors. ScientificReports. 2015;5:14195.

37. Mohan CD, Bharathkumar H, Bulusu KC, Pandey V, Rangappa S, Fuchs JE,Shanmugam MK, Dai X, Li F, Deivasigamani A, et al. Development of anovel azaspirane that targets the Janus kinase-signal transducer andactivator of transcription (STAT) pathway in hepatocellular carcinomain vitro and in vivo. J Biol Chem. 2014;289(49):34296–307.

38. Basappa M. S, Kavitha CV, Purushothaman A, Nevin KG, Sugahara K,Rangappa KS. A small oxazine compound as an anti-tumor agent: a novelpyranoside mimetic that binds to VEGF, HB-EGF, and TNF-alpha. Cancer Lett.2010;297(2):231–43.

39. Sulaiman NB, Mohan CD, Basappa S, Pandey V, Rangappa S, BharathkumarH, Kumar AP, Lobie PE, Rangappa KS. An azaspirane derivative suppressesgrowth and induces apoptosis of ER-positive and ER-negative breast cancercells through the modulation of JAK2/STAT3 signaling pathway. Int J Oncol.2016;49(3):1221–9.

40. Hara M, Yoshida T, Takagaki A, Takata T, Kondo JN, Hayashi S, Domen K. Acarbon material as a strong protonic acid. Angew Chem Int Ed.2004;43(22):2955–8.

41. Toda M, Takagaki A, Okamura M, Kondo JN, Hayashi S, Domen K, Hara M. Greenchemistry: biodiesel made with sugar catalyst. Nature. 2005;438(7065):178.

42. Mo X, López DE, Suwannakarn K, Liu Y, Lotero E, Goodwin JG, Lu C.Activation and deactivation characteristics of sulfonated carbon catalysts. JCatalysis. 2008;254(2):332–8.

43. Devi KS, Jayashree S. Modified ceria as a substitute for sulfuric acid in the liquidphase nitration of toluene. React Kinet Mech Catal. 2013;108(1):183–92.

44. Vlodavsky I, Ilan N, Naggi A, Casu B. Heparanase: structure, biologicalfunctions, and inhibition by heparin-derived mimetics of heparan sulfate.Curr Pharm Des. 2007;13(20):2057–73.

45. Hulett MD, Hornby JR, Ohms SJ, Zuegg J, Freeman C, Gready JE, Parish CR.Identification of active-site residues of the pro-metastatic endoglycosidaseheparanase. Biochemistry. 2000;39(51):15659–67.

46. Neelgundmath M, Dinesh KR, Mohan CD, Li F, Dai X, Siveen KS, Paricharak S,Mason DJ, Fuchs JE, Sethi G, et al. Novel synthetic coumarins that targetsNF-kappaB in Hepatocellular carcinoma. Bioorganic & Med Chem Lett.2015;25(4):893–7.

47. Anusha S, Anandakumar BS, Mohan CD, Nagabhushana GP, Priya BS,Rangappa KS. Basappa, T CG. Preparation and use of combustion-derivedBi2O3 for the synthesis of heterocycles with anti-cancer properties bySuzuki-coupling reactions. RSC Adv. 2014;4(94):52181–8.

48. Anusha S, Mohan CD, Ananda H, Baburajeev CP, Rangappa S, Mathai J,Fuchs JE, Li F, Shanmugam MK, Bender A, et al. Adamantyl-tethered-biphenylic compounds induce apoptosis in cancer cells by targeting Bclhomologs. Bioorg Med Chem Lett. 2016;26(3):1056–60.

49. Wu L, Viola CM, Brzozowski AM, Davies GJ. Structural characterization ofhuman heparanase reveals insights into substrate recognition. Nature StrucBiol. 2015;22(12):1016–22.

50. C. C. G. Molecular Operating Environment version 2014.0901.51. Zcharia E, Jia J, Zhang X, Baraz L, Lindahl U, Peretz T, Vlodavsky I, Li JP.

Newly generated heparanase knock-out mice unravel co-regulation ofheparanase and matrix metalloproteinases. PLoS One. 2009;4(4):e5181.

52. Fux L, Ilan N, Sanderson RD, Vlodavsky I. Heparanase: busy at the cellsurface. Trends Bioch Sci. 2009;34(10):511–9.

53. Parish CR, Freeman C, Ziolkowski AF, He YQ, Sutcliffe EL, Zafar A, Rao S,Simeonovic CJ. Unexpected new roles for heparanase in Type 1 diabetesand immune gene regulation. Matrix Biol. 2013;32(5):228–33.

54. Gil N, Goldberg R, Neuman T, Garsen M, Zcharia E, Rubinstein AM, vanKuppevelt T, Meirovitz A, Pisano C, Li JP, et al. Heparanase is essential forthe development of diabetic nephropathy in mice. Diabetes.2012;61(1):208–16.

55. Li RW, Freeman C, Yu D, Hindmarsh EJ, Tymms KE, Parish CR, Smith PN.Dramatic regulation of heparanase activity and angiogenesis geneexpression in synovium from patients with rheumatoid arthritis. Arthritis &Rheumatism. 2008;58(6):1590–600.

56. Lerner I, Hermano E, Zcharia E, Rodkin D, Bulvik R, Doviner V, Rubinstein AM,Ishai-Michaeli R, Atzmon R, Sherman Y, et al. Heparanase powers a chronic

Baburajeev et al. BMC Cancer (2017) 17:235 Page 14 of 14

inflammatory circuit that promotes colitis-associated tumorigenesis in mice.J Clin Invest. 2011;121(5):1709–21.

57. Schmidt EP, Yang Y, Janssen WJ, Gandjeva A, Perez MJ, Barthel L, ZemansRL, Bowman JC, Koyanagi DE, Yunt ZX, et al. The pulmonary endothelialglycocalyx regulates neutrophil adhesion and lung injury duringexperimental sepsis. Nature Med. 2012;18(8):1217–23.

58. Vlodavsky I, Blich M, Li JP, Sanderson RD, Ilan N. Involvement of heparanasein atherosclerosis and other vessel wall pathologies. Matrix Biol.2013;32(5):241–51.

• We accept pre-submission inquiries

• Our selector tool helps you to find the most relevant journal

• We provide round the clock customer support

• Convenient online submission

• Thorough peer review

• Inclusion in PubMed and all major indexing services

• Maximum visibility for your research

Submit your manuscript atwww.biomedcentral.com/submit

Submit your next manuscript to BioMed Central and we will help you at every step: