Embed Size (px)
Citation preview
© Sarah-Kim Bisson, 2020
Les inhibiteurs de la voie Wnt dans un modèle animal d'insuffisance rénale chronique avec calcification
vasculaire
Mémoire
Sarah-Kim Bisson
Maîtrise en médecine expérimentale - avec mémoire
Maître ès sciences (M. Sc.)
Québec, Canada
Les inhibiteurs de la voie Wnt dans un modèle animal
d’insuffisance rénale chronique avec calcification
vasculaire
Mémoire
Sarah-Kim Bisson
Sous la direction de :
Dr Fabrice Mac-Way, directeur de recherche
III
Résumé
En insuffisance rénale chronique (IRC), on observe un déséquilibre minéral qui est associé au
développement d’un remodelage osseux anormal et de calcification vasculaire, un processus qui est
semblable à la formation osseuse car il implique une trans-différenciation de cellules musculaires lisses
vasculaires en cellules ostéoblastiques semblables à celles retrouvées dans l’os. Un lien a été rapporté
entre le remodelage osseux ralenti et la calcification vasculaire en IRC mais la cause de ce lien demeure
mal comprise. Nous avons étudié l’implication des inhibiteurs de la voie Wnt dans ce lien dans un modèle
d’IRC chez le rat avec calcification vasculaire induite par un supplément de calcium, phosphore et
vitamine D (Ca/P/vitD). Les animaux IRC+Ca/P/vitD présentaient de la calcification vasculaire, un
remodelage osseux ralenti, un défaut de minéralisation et des niveaux sériques et vasculaires d’inhibiteurs
de la voie Wnt élevés. La présence dans le vaisseau calcifié d’un inhibiteur de la voie Wnt de source
ostéocytaire, la sclérostine, suggère que les cellules ostéoblastiques acquièrent un phénotype ostéocytaire.
De plus, les inhibiteurs de la voie Wnt produits par le vaisseau pourraient avoir des conséquences sur
l’os, ce qui cadrerait avec la formation ralentie et le défaut de minéralisation observés. Les inhibiteurs de
la voie Wnt en circulation pourraient aussi avoir des effets vasculaires puisque les vaisseaux calcifiés
présentaient des signes d’inhibition de la voie Wnt/β-caténine, les niveaux d’inhibiteurs de la voie Wnt
ne semblant toutefois pas associés à un ralentissement de la calcification. Nos résultats mettent donc en
lumière une implication potentielle des inhibiteurs de la voie Wnt dans le lien entre l’os et le vaisseau en
IRC.
IV
Abstract
Chronic kidney disease (CKD) patients suffer from a dysregulation of minerals levels which is associated
with abnormal bone remodeling and vascular calcification, a process similar to bone formation in that it
implies the trans-differentiation of vascular smooth muscle cells into osteoblast-like cells. A link was
reported between decreased bone formation and vascular calcification in CKD, but the cause of this link
remains unclear. We have studied the involvement of Wnt pathway inhibitors in this process in a rat
model of CKD with vascular calcification induced by a calcium, phosphorus and vitamin D supplement
(Ca/P/vitD). CKD+Ca/P/vitD rats presented with vascular calcification, decreased bone turnover,
defective mineralization and increased levels of circulating and vascular Wnt inhibitors. The expression
by the calcified vessel of sclerostin, a Wnt inhibitor typically produced by osteocytes, suggests that
vascular osteoblast-like cells could acquire an osteocytic phenotype as osteoblasts do in bone. Moreover,
vascular Wnt inhibitors could have consequences on bone and contribute to the decrease in bone
formation and the mineralization defect. The high circulating levels of Wnt inhibitors could also have
vascular effects, which is supported by the fact that the Wnt/β-catenin pathway appears to be inhibited
in the calcified vessels despite the fact that high levels of Wnt inhibitors were not correlated with a
decrease in the severity of vascular calcification. Our results therefore suggest an implication of Wnt
pathway inhibitors in the bone-vessels link that is frequently observed in CKD.
V
Table des matières
Résumé .................................................................................................................................................................... III
Abstract ................................................................................................................................................................... IV
Table des matières ................................................................................................................................................... V
Liste des figures ..................................................................................................................................................... IX
Liste des tableaux ..................................................................................................................................................... X
Liste des abréviations ............................................................................................................................................ XI
Remerciements .................................................................................................................................................... XIII
Avant-Propos ...................................................................................................................................................... XIV
Introduction .............................................................................................................................................................. 1
La régulation du métabolisme phosphocalcique ............................................................................ 1
Le calcitriol .................................................................................................................................. 1
La parathormone ......................................................................................................................... 2
FGF23........................................................................................................................................... 3
α-Klotho ....................................................................................................................................... 4
Le métabolisme minéral osseux normal ......................................................................................... 4
L’ostéoclaste et la résorption osseuse ........................................................................................ 5
L’ostéoblaste et la formation osseuse ........................................................................................ 5
L’ostéoblaste et la minéralisation osseuse ................................................................................. 6
Le ratio MEPE/PHEX et la minéralisation osseuse ...................................................................... 7
L’ostéocyte et la régulation du remodelage osseux ................................................................... 7
La voie Wnt/β-caténine ................................................................................................................... 8
La voie Wnt/β-caténine ............................................................................................................... 8
Les ligands Wnt ........................................................................................................................... 9
L’activation de la voie .................................................................................................................. 9
Le complexe de phosphorylation ................................................................................................ 9
L’inactivation du complexe de phosphorylation ......................................................................... 9
Les inhibiteurs de la voie Wnt/β-caténine ................................................................................ 10
VI
La régulation de la production d’inhibiteurs de la voie Wnt..................................................... 11
Régulation de la différentiation et de l’activité ostéoblastique par la voie Wnt/β-caténine ... 11
La voie Wnt/β-caténine ostéocytaire ........................................................................................ 12
Le rôle de la PTH dans le métabolisme minéral osseux ................................................................ 12
La PTH intermittente ................................................................................................................. 12
La PTH continue ......................................................................................................................... 13
L’insuffisance rénale chronique .................................................................................................... 13
L’IRC ........................................................................................................................................... 13
Le Ca et le P en IRC .................................................................................................................... 14
La PTH en IRC ............................................................................................................................. 14
FGF23 en IRC ............................................................................................................................. 15
α-Klotho en IRC ......................................................................................................................... 16
Les inhibiteurs de la voie Wnt en IRC ........................................................................................ 16
L’os en IRC ..................................................................................................................................... 16
Les anomalies osseuses en IRC .................................................................................................. 16
Le déséquilibre minéral et les anomalies osseuses................................................................... 17
Les inhibiteurs ........................................................................................................................... 17
L’os hyperparathyroïde ............................................................................................................. 19
L’os adynamique ....................................................................................................................... 20
L’ostéomalacie .......................................................................................................................... 21
L’anomalie osseuse mixte ......................................................................................................... 21
La calcification vasculaire en IRC ................................................................................................... 21
Mécanisme de la calcification vasculaire .................................................................................. 21
Causes possibles de la calcification vasculaire .......................................................................... 22
Les inhibiteurs ........................................................................................................................... 23
Le lien entre les anomalies osseuses et vasculaires .................................................................. 23
Les traitements disponibles pour l’IRC .......................................................................................... 24
La greffe rénale ......................................................................................................................... 24
La dialyse ................................................................................................................................... 24
Les chélateurs de phosphore .................................................................................................... 25
Les suppléments de vitamine D ................................................................................................ 26
Les calcimimétiques .................................................................................................................. 26
La parathyroïdectomie et la supplémentation en PTH ............................................................. 27
VII
Cibler la voie Wnt/β-caténine ................................................................................................... 27
Comprendre le lien entre la voie Wnt et les anomalies osseuses et vasculaires ......................... 28
Chapitre 1 : Questions et hypothèses .................................................................................................................. 29
Chapitre 2 : Une supplémentation haute en calcium, phosphate et calcitriol mène à un phénotype
ostéocytaire dans les vaisseaux calcifiés et à un défaut de minéralisation osseuse chez le rat insuffisant
rénal chronique. ...................................................................................................................................................... 30
2.1 Résumé .................................................................................................................................... 31
2.2 Abstract ................................................................................................................................... 32
2.3 Article ...................................................................................................................................... 33
2.3.1 Introduction...................................................................................................................... 33
2.3.2 Material and methods ...................................................................................................... 34
2.3.3 Results .............................................................................................................................. 36
2.3.4 Discussion ......................................................................................................................... 38
2.3.5 Acknowledgements .......................................................................................................... 41
2.3.6 Author contributions ........................................................................................................ 41
2.3.7 Conflict of interest ............................................................................................................ 41
2.3.8 References ........................................................................................................................ 42
2.3.9 Figure legends .................................................................................................................. 45
2.3.10 Figures ............................................................................................................................ 47
2.3.11 Tables ............................................................................................................................. 51
2.3.12 Supplementary materials ............................................................................................... 53
Chapitre 3 : Analyses supplémentaires ................................................................................................................ 56
3.1 Transcription et expression de gènes ..................................................................................... 56
3.1.1 Dans le sérum ................................................................................................................... 57
3.1.2 Dans l’os ........................................................................................................................... 58
3.1.3 Dans le vaisseau calcifié ................................................................................................... 60
3.2 Corrélations ............................................................................................................................. 61
3.2.1 Cause de l’excrétion accrue du phosphore ...................................................................... 62
3.2.2 Causes de l’élévation d’inhibiteurs de la voie Wnt .......................................................... 63
3.2.3 Corrélations entre la structure et la biochimie dans l’os ................................................. 66
Chapitre 4 : Discussion .......................................................................................................................................... 67
4.1 Cause de l’excrétion accrue du phosphore ............................................................................. 67
VIII
4.2 Causes de l’élévation d’inhibiteurs de la voie Wnt ................................................................. 68
4.3 Liens os-vaisseau ..................................................................................................................... 70
4.4 Implication de la voie Wnt/β-caténine dans la calcification vasculaire .................................. 70
4.5 Causes du défaut de minéralisation ........................................................................................ 72
4.6 Causes de la formation osseuse ralentie................................................................................. 73
4.7 Cause du défaut de résorption ................................................................................................ 74
Conclusion ............................................................................................................................................................... 75
Bibliographie ........................................................................................................................................................... 76
Annexe 1 : Implication de la voie Wnt/β-caténine dans l’ostéodystrophie rénale ...................................... 95
IX
Liste des figures 1.1 Métabolisme du calcium, du phosphore et du calcitriol……………………………………………p.3 1.2 Effets de FGF23 et facteurs affectant sa production……………………………………………...p.4 1.3 Facteurs affectant la formation et la résorption osseuse…………………………………………..p.7 1.4 Activation et inactivation de la voie Wnt dans un ostéoblaste…………………………………….p.11 1.5 Effets de l’IRC sur le métabolisme phosphocalcique et le remodelage osseux…………………….p.15 1.6 Illustration des mécanismes par lesquels l’IRC et certains traitements induisent les anomalies osseuses……………………………………………………………………………………………p.19 1.7 Marqueurs indiquant la présence de différentiation ostéoblastique, et possiblement ostéocytaire, dans le vaisseau calcifié…………………………………………………………………………………...p.22 2.1 Vascular calcification in the thoracic aorta p.47 2.2 Immunofluorescence analysis of osteocytes markers in the thoracic aorta p.47 2.3 Proteins expression of Wnt signalling pathway in thoracic aortas p.48 2.4 Cortical parameters of tibia bone in the different groups p.48 2.5 Bone histomorphometry results and representative histological images of tibia bone p.49 2.6 mRNA expression of osteocytes markers in the femur p.50 3.1 Niveaux sériques de RANKL p.57 3.2 Transcription de gènes dans l’os p.58 3.3 Transcription de gènes dans le vaisseau p.60 3.4 Transcription des SFRPs dans le vaisseau p.61
X
Liste des tableaux 2.1 Biochemical parameters between groups p.51 2.2 Bone dynamic parameters between groups p.52 2.3 Supplementary Table 1: Sequence of the primers used for qRT-PCR amplification p.53 2.4 Supplementary Table 2: Aorta and bone mRNA transcript expression between groups p.54 2.5 Supplementary Table 3: Correlations of cortical and trabecular bone parameters with vascular calcification p.55 3.1 Amorces utilisées pour le qRT-PCR p.56 3.2 Corrélations entre P et protéines phosphaturiques……………………………………………....p.62 3.3 Corrélations entre sclérostine et Ca/P sériques p.63 3.4 Corrélations entre Dkk1 et ses activateurs potentiels p.63 3.5 Corrélation entre sclérostine et PTH p.64 3.6 Corrélations entre la calcification et les inhibiteurs de la voie Wnt circulants . p.64 3.7 Corrélation entre la sévérité de la calcification vasculaire et les inhibiteurs de la voie Wnt p.65 3.8 Corrélations entre les protéines ostéocytaires en circulation et leur production vasculaire p.65 3.9 Corrélation entre l’aire corticale et la transcription osseuse de Lrp4 p.66
XI
Liste des abréviations
APC: Adenomatous Polyposis Coli
ASBMR: American Society for Bone and Mineral Research
BFR-BS: Bone Formation Rate-Bone Surface
BMP2: Bone Morphogenetic Protein 2
BV/TV: Bone Volume on Total Volume
Ca: Calcium
CIHR: Canadian Institutes of Health Research
CK1: Casein Kinase 1
CKD: Chronic Kidney Disease
CMLV: Cellules Musculaires Lisses Vasculaires
CTL : Control
dL/BS : Double Label Surface/Bone Surface
DMP1 : Dentin Matrix Acidic Phosphoprotein 1
Dvl: Dishevelled
ELISA: Enzyme-Linked Immunosorbent Assay
FGF23: Fibroblast Growth Factor 23
FGFR1: Fibroblast Growth Factor Receptor 1
FRQ-S: Fonds de Recherche du Québec-Santé
Fzd: Frizzled
GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase
GSK3β: Glycogen Synthase Kinase 3
IRC: Insuffisance Rénale Chronique
Lef: Lymphoid Enhancer-Binding Factor
Lrp5/6: Lipoprotein Receptor-Related Protein 5/6
MAR: Mineralization Apposition Rate
M-CSF: Macrophage Colony-Stimulating Factor
MEPE: Matrix Extracellular Phosphoglycoprotein
MEPE-ASARM: Matrix Extracellular Phosphoglycoprotein-Acidic Serine Aspartate-Rich Motif
MS/BS: Mineralization Surface/Bone Surface
MS/OS: Mineralization Surface/Osteoid Surface
OcN/BV: Osteoclast Number per Bone Volume
OPG: Ostéoprotégérine
Oth: Osteoid Thickness
XII
OV/BV: Osteoid Volume per Bone Volume
P: Phosphore
PBS: Phosphate-Buffered Saline
PKA: Protein Kinase A
PTH: Parathormone
PTHR1: Parathyroid Hormone Receptor 1
qRT-PCR: Quantitative Retrotranscription-Polymerase Chain Reaction
RANK: Receptor Activator of Nuclear Factor
RANKL: Receptor Activator of Nuclear Factor kB Ligand
RunX2: Runt Related Transcription Factor 2
SDS-PAGE: Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis
SEM: Standard Error of the Mean
sL/BS: Single Label Surface/Bone Surface
TbN: Trabecular Number
TbTh: Trabecular Thickness
TCF: T-cell Factor
TNF: Tumor Necrosis Factor
VDR: Vitamin D Receptor
VitD: Vitamine D
XIII
Remerciements
J’aimerais tout d’abord remercier mon directeur de recherche, le Dr Fabrice Mac-Way, pour m’avoir accordé
sa confiance lors de mon premier stage dans son laboratoire il y a quatre ans et pour m’avoir encouragé à me
dépasser au cours des trois années suivantes.
Je remercie aussi mes collègues de laboratoire pour la belle ambiance de travail que j’ai eu la chance d’avoir
chaque jour, et je remercie en particulier Visal Ung pour m’avoir appris tout ce que je devais savoir pour
travailler en laboratoire, Sylvain Picard pour son enthousiasme contagieux pour l’histologie et la pathologie et
Richard Larivière pour toujours avoir été présent pour répondre à mes questions.
Je tiens également à remercier les organismes qui m’ont offert un support financier au cours des dernières
années : La fondation du CHU de Québec, le Fonds de Recherche Québec-Santé et les Instituts de Recherche
en Santé du Canada.
Enfin, je ne peux terminer sans remercier mes proches pour avoir cru en moi, et en particulier mes parents
Gilbert et Chantale qui ont toujours encouragé ma curiosité, m’ont inculqué de bonnes valeurs et m’ont toujours
supportée.
XIV
Avant-Propos
Rédigé dans le cadre de ma maîtrise en médecine expérimentale, ce mémoire par insertion d’article contient
deux publications récentes de notre laboratoire dont je suis l’auteure principale.
La première, High calcium, phosphate and calcitriol supplementation leads to an osteocyte‑like phenotype in calcified vessels and
bone mineralisation defect in uremic rats, est présenté sous sa forme intégrale et en langue anglaise originale au
chapitre 3. Elle a été publiée le 30 mars 2018 dans le Journal of Bone and Mineral Metabolism au terme de
quelques années de travail. En effet, avant d’entamer ma maîtrise dans le laboratoire du Dr Fabrice Mac-Way,
j’avais déjà effectué 2 stages d’été dans ce même laboratoire au cours desquels j’ai eu l’occasion de débuter
l’analyse de nos échantillons. J’ai ainsi participé à l’obtention des résultats pour l’article, à leur interprétation et
à l’écriture de l’article. Les co-auteur Roth-Visal Ung, Sylvain Picard et Danika Valade ont aussi participé à
l’obtention des résultats et à leur analyse alors que Roth-Visal Ung et Fabrice Mac-Way, mon directeur de
maîtrise, ont aussi participé à l’écriture. Le protocole animal, qui est le résultat d’une collaboration entre
plusieurs chercheurs, a été développé par Mohsen Agharazii, Richard Larivière et Fabrice Mac-Way avant
mon arrivée au laboratoire.
Le second article, intitulé Role of the Wnt/β-Catenin Pathway in Renal Osteodystrophy, est inclus en annexe car il
s’agit essentiellement d’un approfondissement de certains sujets abordés dans l’introduction. Il s’agit d’un
article de revue en anglais disponible en libre accès que j’ai rédigé au cours de ma maîtrise et qui a été publié
dans le International Journal of Endocrinology le 2 avril 2018. Roth-Visal Ung et le Dr Mac-Way m’ont guidé tout
au long du processus de recherche et d’écriture et ont apporté des modifications avant la soumission au
journal.
Pour finir, j’ai eu l’occasion de collaborer avec d’autres étudiants du Dr Fabrice Mac-Way sur d’autres projets
de recherche, ce qui m’a amené à être co-auteure sur deux autres articles. Mon rôle dans l’écriture de ces
articles a principalement consisté à obtenir et interpréter des résultats.
I. High calcium, phosphate and calcitriol supplementation leads to an osteocyte-like phenotype in calcified vessels and bone mineralisation defect in uremic rats. Auteurs: Sarah-Kim Bisson, Roth-Visal Ung, Sylvain Picard, Danika Valade, Mohsen Agharazii, Richard Larivière, Fabrice Mac-Way. Journal: Journal of Bone and Mineral Metabolism Statut de l’article: Publié en mars 2018
XV
II. Role of the Wnt/β-Catenin Pathway in Renal Osteodystrophy Auteurs: Sarah-Kim Bisson, Roth-Visal Ung, Fabrice Mac-Way Journal: International Journal of Endocrinology Statut de l’article: Publié en mai 2018
III. New bone biopsy sectioning approach for histomorphometry and molecular biology Auteurs: Sylvain Picard, Roth-Visal Ung, Sarah-Kim Bisson, Fabrice Mac-Way. Journal: Journal of Bone and Mineral Research Statut de l’article: Publié en décembre 2017
IV. FGF23-klotho axis, bone fractures and arterial stiffness in dialysis: a case-control study Auteurs: Louis-Charles Desbiens, Aboubacar Sidibé, Roth-Visal Ung, Catherine Fortier, Michaël Munger, Yue-Pei Wang, Sarah-Kim Bisson, Mohsen Agharazii, Karine Marquis, Fabrice Mac-Way Journal: Osteoporosis International Statut de l’article: Publié en juin 2018
1
Introduction
L’insuffisance rénale chronique (IRC), qui consiste en une perte de fonction rénale irréversible, affecte
plusieurs systèmes du corps humain et cause de nombreuses pathologies secondaires. On peut penser entre
autres aux problèmes osseux et à la calcification vasculaire, deux problèmes interreliés qui diminuent la qualité
de vie des patients et augmentent leur risque de mortalité. Le lien entre l’IRC et ces deux problèmes étant mal
compris, il existe peu de thérapies efficaces pour freiner le développement de problèmes osseux et vasculaires
chez les patients. La présente introduction a pour but de présenter le fonctionnement normal du métabolisme
minéral osseux, puis d’exposer comment l’IRC dérègle ce métabolisme et cause des problèmes osseux et
vasculaires tout en mettant en lumière les mécanismes moins bien compris que nous avons tenté d’élucider
dans nos recherches effectuées dans un modèle de rat IRC supplémenté en calcium, phosphore et vitamine
D. Elle porte plus particulièrement sur le rôle que pourrait jouer la voie Wnt dans le développement des
anomalies osseuses et de la calcification vasculaire et sur le lien entre l’os et le vaisseau en IRC, ainsi que sur la
possibilité que des cellules ostéocytaires soient présentes dans le vaisseau calcifié.
La régulation du métabolisme phosphocalcique
De la matrice osseuse où on les retrouve ensemble sous forme de cristaux d’hydroxyapatite aux cellules
musculaires où ils sont indispensables au processus de contraction, le calcium (Ca) et le phosphore (P) sont
deux éléments qui jouent des rôles essentiels et dont les niveaux doivent être soigneusement régulés. Bien que
ce soit l’intestin qui serve de porte d’entrée à ces deux minéraux, c’est plutôt le rein qui en est le principal
régulateur, éliminant les surplus par l’urine et produisant des facteurs régulant directement ou indirectement
leur absorption intestinale, leur excrétion et leur déposition dans l’os. Si une régulation inadéquate des niveaux
de Ca et de P pourrait mener à de la calcification vasculaire en cas d’excès, une déficience pourrait quant à elle
fragiliser l’os en nuisant à sa minéralisation. L’os, en plus de son rôle structurel crucial, est aussi la plus
importante réserve de calcium et de phosphore de l’organisme. En cas de déséquilibre du métabolisme
phosphocalcique qui requiert de puiser dans les réserves osseuses, une partie de la force structurelle de l’os peut
être sacrifiée au profit du rétablissement de l’équilibre. On parle alors de résorption osseuse, soit une
dégradation de l’os pour en libérer les minéraux. Plusieurs facteurs qui régulent l’absorption et l’excrétion du
calcium et du phosphore régulent également la résorption osseuse.
Le calcitriol L’un des facteurs produit par le rein et régulant les niveaux de Ca et de P est le calcitriol, ou 1,25-
dihydroxycholécalciférol. Mieux connu comme étant la forme active de la vitamine D, le calcitriol est produit
par le rein à partir du 25-hydroxycalciférol, un précurseur qui nécessite plusieurs étapes à produire. Le processus
2
débute avec la forme retrouvée dans l’alimentation, le cholécalciférol, qui peut aussi être fabriqué par exposition
de pré-vitamine D au soleil au niveau de la peau. Le cholécalciférol passe d’abord au foie, où une enzyme
nommée 25-hydroxylase la convertit en 25-hydroxycalciférol. Ce dernier se rend ensuite aux reins pour être
hydroxylé par la 1-α-hydroxylase, ce qui constitue l’étape d’activation finale de la vitamine D 1. Le calcitriol ainsi
formé peut ensuite se rendre à l’intestin pour stimuler l’absorption alimentaire du Ca, et dans une moindre
mesure du P, ou encore stimuler la réabsorption rénale du calcium et sa libération de l’os 2. Outre sa régulation
du Ca et du P, le calcitriol semble nécessaire à un bon fonctionnement du métabolisme osseux puisque les
souris sans 1-α-hydroxylase ni récepteur de la vitamine D (VDR) présentent des anomalies de la formation et
de la résorption osseuse même si leurs niveaux de Ca et P sont maintenus normaux par d’autres moyens 3.
Comme le calcitriol est un élément central du métabolisme phosphocalcique, l’activité de la 1-α-hydroxylase est
soigneusement régulée par plusieurs facteurs, à commencer par le calcitriol lui-même, qui l’inhibe pour former
une boucle de rétrocontrôle négative 3. Si la concentration de calcitriol demeure trop élevée, une enzyme
nommée 24-hydroxylase peut l’hydroxyler une dernière fois pour entraîner sa dégradation en acide calcitroïque
qui est par la suite éliminé dans la bile 1.
La parathormone Une autre composante fondamentale du métabolisme phosphocalcique est la parathormone
(PTH). Produite par les glandes parathyroïdes en réponse à une baisse des niveaux de Ca et de calcitriol ou à
une hausse des niveaux de P et supprimée par les conditions inverses, son but est de rétablir l’équilibre en
modulant à la fois l’absorption du Ca, l’excrétion du P et l’entreposage de ces deux minéraux dans l’os 4. Pour
augmenter les niveaux de Ca, elle en augmente l’absorption intestinale en stimulant la 1-a-hydroxylase dans le
rein tout en supprimant l’activité de la 24-hydroxylase 3, 5 et elle augmente également la réabsorption rénale du
calcium 6. Le contraire est observé pour le phosphore, dont la réabsorption rénale est inhibée pour en stimuler
l’excrétion. C’est plus précisément la suppression de l’expression du transporteur de P NaPi-2a dans le tubule
proximal qui permet à la PTH de réduire les niveaux de P 7. La PTH régule également la déposition et la
libération de Ca et de P dans l’os, ce qui permet d’utiliser les réserves osseuses de minéraux pour maintenir des
niveaux circulants stables. Les mécanismes plus précis seront approfondis dans la section 1.4.
3
Fig. 1.1 Métabolisme du calcium, du phosphore et du calcitriol
FGF23 Une autre hormone systémique régulant les niveaux de Ca et de P est le Fibroblast Growth factor 23
(FGF23), une protéine de 32 kDa produite principalement par l’os 8. Comme la PTH, il stimule l’excrétion du
P excédentaire en diminuant l’expression du transporteur NaPi-2a dans le tubule rénal proximal, mais son effet
sur le calcitriol et le Ca est inversé 8, 9. En effet, contrairement à PTH, FGF23 a pour but de diminuer les niveaux
de Ca, but qu’il atteint en supprimant l’activité et la transcription de la 1-α-hydroxylase tout en augmentant celle
de la 24-hydroxylase 8. Comme le calcitriol augmente aussi l’absorption du P en parallèle à celle du Ca, cette
action de FGF23 contribue à renforcer son rôle de suppression du P. FGF23 diminue également les niveaux
de Ca et de calcitriol en supprimant la PTH, ce qu’il fait en se liant au récepteur Fibroblast Growth Factor
Receptor 1 (FGFR1) des glandes parathyroïdes, tel que démontré in vitro et in vivo 10, 11. De plus, tout comme
la PTH, FGF23 agit sur le métabolisme minéral osseux par des mécanismes qui seront vus à la section 1.2. La
production de FGF23 est principalement régulée par le calcitriol, la PTH et le Ca. Bien que FGF23 soit
généralement augmenté en situation d’hyperphosphatémie, le P ne semble pas l’activer directement, ou du
moins pas de façon marquée 12. À titre d’exemple, une élévation du P sanguin n’a que peu d’effet sur FGF23 si
les niveaux de PTH sont maintenus bas 13. On observe par contre un effet synergique lorsque le P et le calcitriol
sont tous deux élevés 14. Le calcitriol est quant à lui un activateur direct qui entraîne la transcription de FGF23
de façon dose-dépendante en se liant au VDR présent à la surface des ostéoblastes 12, 14, 15. L’hyperparathyroïdie,
qui est une situation de surproduction de PTH, semble aussi activer la production de FGF23. La PTH peut agir
de façon directe en se liant au récepteur Parathyroid Hormone Receptor 1 (PTHR1) à la surface des
ostéoblastes, ou encore indirectement en stimulant sur la production de calcitriol qui stimulera à son tour
FGF23 16. Finalement, le Ca semble aussi activer la production de FGF23 indépendamment de la PTH et du
4
calcitriol puisque la délétion du VDR n’affecte pas son action stimulante et que l’hypocalcémie supprime FGF23
même si la PTH demeure élevée 13, 17. Toutefois, une brève élévation de Ca ne semble pas avoir d’effet sur
FGF23 chez l’humain 18.
Fig. 1.2 Effets de FGF23 et facteurs affectant sa production
α-Klotho Pour exercer ses actions sur le Ca et le P, FGF23 doit se lier à la fois à son récepteur membranaire
FGFR et à son co-récepteur, α-Klotho. Cette protéine est principalement produite par le rein et d’autres tissus-
cibles de FGF23 comme les glandes parathyroïdes et il en existe deux formes principales, soit une forme
transmembranaire et une forme circulante 19. Cette seconde forme, plus courte, peut résulter d’un clivage ou
d’une variation de transcription. Toutefois, c’est la forme transmembranaire qui semble la plus importante pour
permettre la liaison de FGF23 à son récepteur 8. Il a été proposé que la forme circulante pourrait agir seule et
inhiber la réabsorption du phosphate dans le rein en agissant sur les transporteurs NaPi-2a, rendant son action
comparable à celle de FGF23, mais cette affirmation est controversée 8, 20, 21. α-Klotho semble également agir
en collaboration avec FGF23 pour induire la production de ce dernier dans l’os 22. FGF23 est par ailleurs un
inhibiteur d’α-Klotho, ce qui pourrait avoir pour but d’atténuer les effets de FGF23 ou d’éviter une trop grande
élimination du P si α-Klotho a bel et bien le même effet que FGF23 sur l’excrétion du P 8. Au contraire,
α-Klotho est activé par le calcitriol comme l’était FGF23, et aussi par le P, ce qui est compréhensible considérant
qu’il doit être produit lorsque l’action de FGF23 est requise 19, 23.
Le métabolisme minéral osseux normal
5
Les os constituent une réserve importante de Ca et de P qui peut être utilisée pour réguler les niveaux sanguins
en parallèle à la modulation de l’absorption et de l’excrétion. Comme mentionné précédemment, la résorption
osseuse permet de libérer les minéraux, alors que la formation osseuse permet de déposer le Ca et le P dans les
cristaux d’hydroxyapatite qui confèrent sa dureté à l’os. L’alternance entre la résorption et la formation osseuse
constitue le remodelage osseux et permet à l’os d’augmenter sa solidité ou de fournir du Ca et du P. Le taux de
remodelage dépend de l’activité des différentes cellules osseuses, dont les 3 types principaux sont les
ostéoclastes, les ostéoblastes et les ostéocytes.
L’ostéoclaste et la résorption osseuse Les cellules responsables de dégrader l’os pour en changer l’architecture ou
en libérer le Ca et le P sont les ostéoclastes, de grosses cellules multinucléées issues de la lignée des macrophages
et retrouvées à la surface de l’os. La différenciation de cellules pré-ostéoclastiques mononucléées et leur fusion
subséquente pour former les ostéoclastes a lieu en réponse à deux facteurs. Le premier est le niveau du facteur
de croissance Macrophage Colony Stimulating Factor (M-CSF) dans leur environnement alors que le deuxième est le
ratio RANKL/OPG 24. RANKL, ou Receptor Activator of Nuclear Factor kB Ligand, est une protéine de la
superfamille des Tumor Necrosis Factors (TNF) qui se lie aux récepteurs Receptor Activator of Nuclear Factor
(RANK) à la surface des ostéoclastes, alors qu’OPG, ou ostéoprotégérine, est une protéine qui capte le RANKL
pour empêcher son action. RANKL peut être trouvé sous forme membranaire ou sécrétée, les deux formes
ayant pour effet de stimuler la différenciation et l’activité ostéoclastique 25. Le ratio entre RANKL et OPG est
régulé principalement par la PTH, qui agit sur les ostéoblastes et les ostéocytes pour stimuler leur production
de RANKL et inhiber celle d’OPG 26, 27. Le calcitriol augmente également le remodelage en se liant au VDR à
la surface des ostéoblastes, ce qui augmente la production de RANKL 3. Le calcitriol semble même
indispensable à la formation d’ostéoclastes puisque l’absence de calcitriol ou de son récepteur empêche la
différenciation ostéoclastique 3, 28. Une partie de l’effet stimulant qu’a la PTH sur RANKL pourrait d’ailleurs
passer par son effet positif sur le calcitriol 3. Par contre, une partie des effets du calcitriol sur l’activité
ostéoclastique pourrait être due à l’hypocalcémie puisqu’une supplémentation en Ca rétablit un taux de
résorption normale dans une autre étude 29. Le stress mécanique, induit par exemple par l’activité physique,
semble plutôt inhiber l’activité des ostéoclastes en augmentant la production ostéoblastique d’OPG 30.
L’ostéoblaste et la formation osseuse Les ostéoblastes sont des cellules dérivées de pré-ostéoblastes eux-mêmes
issus de cellules souches mésenchymateuses. Une fois différenciés, ils se consacrent à la formation de matrice
osseuse et à sa minéralisation 31. Comme les ostéoclastes, ils se trouvent à la surface de l’os. Ces deux types
cellulaires sont d’ailleurs souvent regroupés à l’intérieur d’unités de remodelage, qui sont des emplacements de
la surface osseuse où la résorption ostéoclastique est rapidement suivie par la formation de nouveau matériel
6
osseux 32. Les ostéoblastes produisent plusieurs molécules régulatrices du métabolisme minéral osseux telles
que FGF23, α-Klotho, RANKL et OPG 19, 25. Plusieurs facteurs régulent le nombre d’ostéoblastes et leur
sécrétion de matrice osseuse, à commencer par Runt Related Transcription Factor 2 (RunX2) et osterix, dont
l’expression est régulée par la voie Wnt/β-caténine 33. Cette voie essentielle à la différenciation ostéoblastique
sera vue plus en détails sous peu. Le calcitriol semble également augmenter le nombre et l’activité des
ostéoblastes chez le rat, sans pour autant que la minéralisation ne soit pareillement augmentée 34.
L’ostéoblaste et la minéralisation osseuse Une fois la matrice osseuse sécrétée, l’ostéoblaste débute sa
minéralisation, un processus sensible facilement inhibé par différentes conditions. L’inhibition de la
minéralisation mène à l’accumulation de matériel ostéoïde, qui est de l’os non minéralisé et donc moins résistant.
Parmi les activateurs de la minéralisation, on compte le facteur de transcription Bone Morphogenetic Protein
2 (BMP2), qui était aussi impliqué dans la formation osseuse 35. Quant aux inhibiteurs, FGF23 et son co-
récepteur α-Klotho semblent en faire partie. En effet, l’élévation de l’un ou de l’autre est associée à
l’ostéomalacie, une pathologie caractérisée par l’accumulation de matériel ostéoïde. Il en résulte une diminution
de densité osseuse indépendante des niveaux de Ca et de P 36-39. Si FGF23 est clairement associé à une
minéralisation réduite, l’association du calcitriol avec la minéralisation est plus variable. S’il est trop élevé dans
l’environnement ostéoblastique, le calcitriol inhibe la minéralisation et mène à l’accumulation de matériel
ostéoïde 29, 34, 40, mais l’absence totale de calcitriol mène aussi à l’accumulation d’ostéoïde en raison d’une
déficience en Ca et P 28, 41. La suppression de la production de calcitriol par FGF23 pourrait d’ailleurs contribuer
à son effet sur la minéralisation, mais FGF23 inhibe tout de même la minéralisation in vitro indépendamment
du calcitriol 8, 36, 37. À des niveaux plus modérés, le calcitriol peut au contraire stimuler la minéralisation, agissant
à la fois sur l’activité ostéoblastique et la disponibilité des minéraux 42.
7
Fig. 1.3 Facteurs affectant la formation et la résorption osseuse
Le ratio MEPE/PHEX et la minéralisation osseuse
Le ratio entre deux protéines osseuses retrouvées dans les ostéoblastes et les ostéocytes, Matrix Extracellular
Phosphoglycoprotein (MEPE) et Phosphate Regulating Endopeptidase Homolog X-linked (PHEX), est aussi
connu pour affecter la minéralisation 8. La protéine MEPE peut être clivée pour produire un peptide
comportant un motif ASARM (MEPE-ASARM) qui est ensuite libéré dans l’environnement osseux, où sa
forme phosphorylée se lie à l’hydroxyapatite et nuit ainsi à la minéralisation 43. Quant à PHEX, il s’agit d’une
protéine membranaire retrouvée dans les cellules de la lignée ostéoblastique qui peut se lier à MEPE pour éviter
son clivage, mais qui est en retour inhibée par MEPE-ASARM 43, 44. Un ratio MEPE/PHEX élevé peut donc
nuire à la minéralisation mais il influence également la production de FGF23 dans l’ostéoblaste mature. En
effet, PHEX est un inhibiteur local de FGF23, ce qui fait de MEPE-ASARM un activateur indirect de FGF23
43. Les niveaux de MEPE ont d’ailleurs été associés positivement à ceux de FGF23 44, 45.
L’ostéocyte et la régulation du remodelage osseux L’ostéoblaste atteint le stade terminal de sa différenciation lorsqu’il
se retrouve entouré de la matrice osseuse qu’il a sécrétée et minéralisée. Ce n’est qu’une faible proportion des
ostéoblastes qui connaissent ce destin, la majorité entrant en apoptose avant d’être entourés de matrice ou
8
demeurant à la surface de l’os pour y devenir des cellules bordantes 31, 44, 46. Devenu un ostéocyte, l’ostéoblaste
cesse de former de l’os, tel qu’illustré par sa faible production de phosphatase alcaline, et produit plutôt des
régulateurs du remodelage osseux 47. Comme 90% des cellules osseuses sont des ostéocytes, cette population
cellulaire est une source importante de molécules régulatrices 47. Les ostéocytes ont aussi de plus gros noyaux
que les ostéoblastes et ils communiquent entre eux par des prolongements cytoplasmiques qui se terminent en
jonctions communicantes, ce qui leur permet de coordonner la production de protéines régulatrices 44. Outre
leurs différences morphologiques et leur activité, les ostéocytes se distinguent aussi des ostéoblastes par le type
de molécules qu’ils produisent. Bien que certains composés soient communs aux deux types cellulaires, comme
RANKL, OPG ou FGF23, d’autres comme la sclérostine, un inhibiteur de formation osseuse, ou la
podoplanine, une protéine impliquée dans la formation de dendrites, sont plus spécifiques aux ostéocytes 44. Le
fait qu’ils soient confinés à des espaces restreints et relié entre eux par des dendrites fait des ostéocytes des
cellules idéales pour détecter les changements de pression ou de tension dans l’os et ensuite signaler aux autres
types cellulaires moins sensibles au stress mécanique qu’ils doivent former ou dégrader l’os 48. Bien que certains
ostéocytes puissent possiblement contacter directement les ostéoclastes par leurs prolongements
cytoplasmiques, il est plus probable qu’ils communiquent en sécrétant du RANKL soluble 49. Par exemple, un
abaissement de la pression sur les ostéocytes augmente la production de RANKL dans les ostéocytes eux-
mêmes, mais aussi dans les ostéoblastes via les jonctions communicantes, ce qui stimule l’ostéoclastogénèse 47,
50. Il a aussi été suggéré que RANKL stimule la production ostéocytaire de M-CSF, le deuxième facteur
nécessaire à la différenciation ostéoclastique, et que le calcitriol supprime la production d’OPG dans l’ostéocyte,
facilitant l’action de RANKL 46, 47, 51. Enfin, l’apoptose ostéocytaire semble aussi stimuler la résorption en faisant
augmenter les niveaux de RANKL 46. Pour ce qui est de leur régulation de la formation osseuse, les ostéocytes
produisent des inhibiteurs de la voie Wnt/β-caténine comme la sclérostine et Dickkopf-1 (Dkk1), deux
molécules qui inhibent la différentiation ostéoblastique.
La voie Wnt/β-caténine
La voie Wnt/β-caténine L’activation de la voie Wnt/β-caténine dans les pré-ostéoblastes est une étape essentielle
de la différentiation ostéoblastique. L’activation de cette voie mène à la stabilisation de la β-caténine, un facteur
de transcription qui stimule la transcription de gènes ostéoblastiques comme RunX2 et osterix 33. Lorsque
l’activation a lieu à grande échelle, il en résulte une hausse de la différentiation ostéoblastique et donc une
augmentation de la masse osseuse 52. Au contraire, l’inhibition généralisée de cette voie mène à la
phosphorylation de la β-caténine par un complexe de phosphorylation, ce qui entraîne sa dégradation par le
protéasome, freinant la différenciation ostéoblastique et la formation osseuse 53. L’article de revue présenté en
annexe contient une description plus détaillée des rôles de la voie Wnt dans le métabolisme minéral osseux et
de son implication dans les anomalies osseuses en IRC.
9
Les ligands Wnt L’activation de cette voie dans le pré-ostéoblaste se fait généralement par l’un des ligands Wnt,
qui sont des protéines de 350 à 400 acides aminés 54. Ce ne sont pas tous les Wnt qui jouent un rôle prédominant
dans la différentiation ostéoblastique et la formation osseuse, mais ce semble être le cas de Wnt1, Wnt3A,
Wnt5A, Wnt7B et Wnt10B 33, 55.
L’activation de la voie Les ligands Wnt en circulation activent la voie Wnt/β-caténine en se liant à la fois au
récepteur Frizzled (Fzd), un récepteur couplé aux protéines G, et au co-récepteur Lipoprotein receptor-related
protein 5 ou 6 (Lrp5/6) 56. Cela a pour effet de rapprocher les deux protéines transmembranaires, entraînant la
phosphorylation de Fzd, ce qui permet le recrutement d’une protéine nommée Dishevelled (Dvl) 57. Lrp5/6 est
ensuite phosphorylé par un mécanisme inconnu qui pourrait impliquer Dvl, permettant d’y recruter le complexe
de phosphorylation responsable d’initier la dégradation de la β-caténine 58. C’est plus précisément l’axine
contenue dans ce complexe qui se lie au récepteur 56, 57. Lrp6 semble plus facilement phosphorylé que Lrp5, ce
qui pourrait expliquer le fait qu’il a une plus grande capacité à activer la voie
Wnt/β-caténine 58.
Le complexe de phosphorylation Le complexe de phosphorylation recruté au niveau du co-récepteur Lrp5/6 est
formé de 4 protéines et a normalement pour fonction de phosphoryler la β-caténine pour qu’elle soit ensuite
dégradée 56, 59. Les 4 protéines sont la Glycogène synthase kinase 3 (GSK3β), la Caséine kinase 1 (CK1),
l’Adenomatous Polyposis Coli (APC) et l’axine, ces deux dernières ayant principalement une fonction
structurelle 54. Lorsque la voie est inactive, le complexe est libre dans le cytoplasme du pré-ostéoblaste. GSK3β
phosphoryle l’axine afin de la stabiliser, une étape nécessaire à la phosphorylation subséquente de la β-caténine
60. GSK3β, conjointement avec CK1, phosphoryle aussi la β-caténine au niveau des sérines 33, 37 et 45 et de la
thréonine 41 54, 61. Ces groupements phosphate permettent à une ubiquitine ligase E3 d’ubiquitinyler la
β-caténine, qui est ensuite dégradée par le protéasome 59.
L’inactivation du complexe de phosphorylation Si le complexe est lié à Lrp5/6 plutôt que libre, il devient inactif et
la voie est activée. Le complexe se lie également à Dvl, ce qui a pour effet d’empêcher la phosphorylation de
l’axine par GSK3β 54, 60. Le complexe inactif contient toujours une molécule de β-caténine phosphorylée, mais
celle-ci ne peut pas être ubiquitinylé et subséquemment dégradée et demeure donc à l’intérieur du complexe 62.
10
Il en résulte une saturation des complexes de phosphorylation alors que la β-caténine, produite de façon
constitutive, continue de s’accumuler dans le cytoplasme avant d’être transportée au noyau cellulaire 62. Sur
l’ADN, elle se lie au T-cell factor (TCF) et au Lymphoid enhancer-binding factor (Lef) pour activer la
transcription de gènes nécessaires à la différenciation ostéoblastique comme RunX2 56, 63. Un autre gène notable
induit pas l’activation de la voie Wnt/β-caténine est l’axine2, une variante de l’axine moins efficace pour la
phosphorylation de la β-caténine mais également sensible à la régulation par Dvl 64. Cela pourrait permettre de
garder la voie activée à long terme tout en modérant l’intensité de l’activation.
Les inhibiteurs de la voie Wnt/β-caténine Il existe deux grandes catégories de molécules qui inhibent l’activité de
la voie Wnt/β-caténine: Les protéines qui se lient à Lrp5/6 pour l’empêcher de se complexer à Fzd, dont font
partie la sclérostine et Dkk1, et celles qui imitent le récepteur Fzd pour capter les ligands Wnt circulants, comme
les Secreted Frizzled-Related Proteins (SFRPs) 46, 65-67. Si les premières sont principalement ostéocytaires, les
secondes sont produites plus globalement. La sclérostine est plus spécifique à l’os que Dkk1, tel qu’illustré par
le fait que la délétion de ce dernier chez la souris mène à la mort puisqu’il est nécessaire au développement alors
que la délétion de sclérostine affecte surtout l’os 68. Elle a tout de même quelques effets extrasquelettiques,
comme une élévation des niveaux de vitamine D et de phosphore en circulation et des niveaux plus bas de
FGF23, cette dernière observation pouvant expliquer les deux autres 69. Elle régule aussi le ratio MEPE/PHEX
en stimulant le premier tout en inhibant le second, ce qui fait d’elle un inhibiteur de minéralisation potentiel 43,
70. Lrp4, une protéine apparentée à Lrp5/6, pourrait faire partie d’une troisième catégorie d’inhibiteurs de la
voie Wnt. Cette protéine, sans être un inhibiteur de la voie Wnt par elle-même, facilite l’action de la sclérostine
et de Dkk1 sur leurs cellules-cibles 71, 72. Si elle est mutée chez l’humain, on observe une formation osseuse
exagérée semblable à celle qui est observée quand la sclérostine est inactivée 73. Principalement exprimée par
les ostéoblastes, cette protéine transmembranaire est structurellement similaire à Lrp5/6 en ce qu’elle peut lier
sclérostine et Dkk1, mais elle en diffère de par le fait qu’elle ne peut pas activer la voie Wnt/β-caténine 71, 72.
Considérant son affinité pour les inhibiteurs de la voie Wnt, sa fonction proposée est de retenir la sclérostine
et Dkk1 près du site où ils doivent agir 72, 74.
11
Fig. 1.4 : Activation et inactivation de la voie Wnt dans un ostéoblaste Lorsque la voie est inactive (gauche)
la β-caténine est dégradée alors que si la voie est active, la β-caténine n’est pas dégradée et peut activer la
transcription de gènes
La régulation de la production d’inhibiteurs de la voie Wnt Les ostéocytes sont une source importante de Dkk1 et
la source principale de sclérostine. Leur sécrétion peut être activée ou inhibée par plusieurs facteurs. La
production de sclérostine est généralement augmentée par une diminution de la pression mécanique exercée
sur le réseau ostéocytaire, ce qui permet de réduire la formation osseuse lorsqu’elle n’est pas nécessaire 75. Le
calcitriol, que l’ostéocyte peut détecter grâce aux VDR présents dans son cytoplasme et son noyau, augmente
également la transcription de sclérostine 76-78. Le calcitriol pourrait aussi augmenter la transcription de
sclérostine en supprimant la PTH, l’un de ses inhibiteurs connus 76. En effet, la PTH supprime la production
de sclérostine et de Dkk1 dans l’os, possiblement pour que la résorption accrue soit compensée par plus de
formation osseuse 16, 27, 79, 80. Comme la PTH est également produite en réponse à l’hyperphosphatémie, cette
suppression pourrait aussi viser à augmenter la déposition de P dans l’os. Le phosphate est d’ailleurs lui-même
associé à la suppression de la sclérostine et de Dkk1 in vitro 81. Finalement, à l’inverse d’un relâchement, une
augmentation de la pression ressentie par les ostéocytes supprime la production et de Dkk1 de sclérostine pour
que l’os soit solidifié par une formation accrue 50, 82.
Régulation de la différentiation et de l’activité ostéoblastique par la voie Wnt/β-caténine Tel que mentionné
précédemment, des niveaux élevés de β-caténine dans les tissus osseux sont associés à une augmentation de la
différentiation et de la survie ostéoblastique qui se traduit par un gain de masse osseuse 46, 52. Outre les gènes
12
impliqués dans la différentiation comme RunX2 et osterix, la β-caténine semble aussi activer la production de
FGF23 et d’OPG, alors qu’elle supprime celle de RANKL 83, 84. La diminution du ratio RANKL/OPG causée
par l’accumulation de β-caténine est associée à une suppression de la différenciation ostéoclastique et donc de
la résorption, ce qui contribue au gain net de masse osseuse 51, 53, 83, 85, 86. On observe l’inverse si les niveaux de
β-caténine sont bas, et ce de façon plus prononcée dans l’os trabéculaire que dans l’os cortical 31, 83. Enfin,
l’activation de la voie Wnt/β-caténine stimule la minéralisation de la matrice par les ostéoblastes 33. Bien que
l’activité de la voie Wnt/β-caténine soit un déterminant important de la différenciation ostéoblastique, d’autres
facteurs l’influencent, comme le facteur de croissance BMP-2 87.
La voie Wnt/β-caténine ostéocytaire En plus d’inhiber la formation osseuse et d’augmenter la résorption, la
sclérostine semble freiner la maturation des ostéoblastes en ostéocytes, sans compter que l’inhibition de la voie
Wnt/β-caténine semble nuire à la survie de ces derniers 46, 70. Même dans les ostéocytes matures, la voie
Wnt/β-caténine est présente et elle influence le métabolisme osseux. À preuve, l’activation de Lrp5 ou
β-caténine spécifiquement dans l’ostéocyte augmente la formation osseuse même si ces cellules ne sécrètent
plus de matrice osseuse, alors que la délétion de Lrp5 dans ces mêmes cellules diminue le gain osseux en réponse
à un stress mécanique 46, 51, 88. On observe aussi dans l’ostéocyte le même effet stimulant de la β-caténine sur
OPG que dans l’ostéoblaste, mais contrairement à ce qu’on observait dans ce dernier, RANKL est aussi
augmenté et fait en sorte que le ratio RANKL/OPG est en faveur de la résorption 51, 89.
Le rôle de la PTH dans le métabolisme minéral osseux
La PTH intermittente Il a déjà été mentionné que la PTH a des effets pro-résorptifs sur l’os, mais elle peut aussi
avoir d’autres effets sur l’os selon qu’elle soit élevée à court ou à long terme. Si l’augmentation de PTH est
brève, soit environ 1 heure par jour, on observe une augmentation de la formation et de la densité osseuse, ce
qui est principalement dû à une augmentation du nombre, de la densité et de la survie ostéoblastique 47, 90, 91.
Ces effets anaboliques de la PTH sur l’os semblent impliquer l’activation de la voie Wnt/β-caténine puisqu’ils
ne sont plus observés si Lrp6 est systématiquement supprimé 92. En effet, il a été montré que la PTH peut se
lier à la fois à Lrp6 et à son récepteur PTHR1 sur les cellules ostéoblastiques et qu’il en résulte une activation
de la Protéine Kinase A (PKA), une enzyme qui a la capacité de phosphoryler Lrp6 et d’ainsi activer la voie
Wnt/β-caténine de façon non-canonique 93. Ce mécanisme ne semble activé que si la PTH est élevée de façon
intermittente et il ne semble pas permettre la phosphorylation de Lrp5 malgré la similarité de ce dernier avec
Lrp6 93, 94.
13
La PTH continue Au contraire, une élévation continue de quatre heures ou plus par jour mène plutôt à une
perte nette d’os malgré la formation accrue en raison d’une augmentation de la résorption 91, 95. En effet, la PTH
fait augmenter le ratio RANKL/OPG dans les ostéoblastes et les ostéocytes à plus long terme 26, 80. La
résorption, qui affecte particulièrement l’os cortical, est intensive mais localisée et elle mène à la formation de
tunnels osseux 90, 96. L’élévation maintenue de la PTH mène également à une différenciation incomplète des
pré-ostéoblastes, qui se comportent alors comme des fibroblastes tant que les niveaux de PTH demeurent
élevés 96.
L’insuffisance rénale chronique
L’IRC Comme mentionné plus tôt, le rein joue un rôle central dans la gestion des niveaux de Ca et de P. Il
n’est donc pas étonnant qu’une perte de fonction rénale se traduise par des conséquences sérieuses sur le
métabolisme minéral et l’os. C’est ce qu’on observe en insuffisance rénale chronique (IRC), une maladie
caractérisée par une perte de fonction rénale irréversible qui mène à de la fragilité osseuse. On observe
également de la calcification vasculaire chez les patients souffrant d’IRC, ce qui représente une autre
conséquence du déséquilibre phosphocalcique. On parle plus précisément d’IRC lorsque le taux de filtration
rénale, qui est normalement plus haut que 90 mL/min/1.73 m2, passe sous 60 ml/min/1.73 m2. Un diagnostic
d’IRC peut aussi être appliqué lorsque le taux de filtration est plus haut que 60 ml/min/1.73 m2 mais que des
dommages rénaux sont observables 97. La sévérité de la maladie rénale est classifiée en 5 stades : Le stade 1, où
la fonction rénale est maintenue mais où l’on peut observer de l’albuminurie et des dommages rénaux, le stade
2, où la fonction rénale est légèrement réduite sans qu’il y ait de conséquences sérieuses, le stade 3, où le taux
de filtration passe sous 60 ml/min/1.73m2 et où l’on commence à observer des effets plus sérieux qui doivent
être traités, le stade 4, où la fonction rénale est drastiquement réduite et où la dialyse est pratiquée dans 20%
des cas et enfin le stade 5, où le taux de filtration est si bas que la dialyse est généralement inévitable 97, 98. La
plupart des patients vont décéder avant d’atteindre ce dernier stade, le risque de mortalité augmentant
exponentiellement alors que la fonction rénale diminue 98, 99. La principale cause de mortalité en IRC est la
maladie cardiovasculaire, incluant la calcification vasculaire 100. La proportion de la population souffrant d’IRC
est en constante augmentation en raison de l’obésité, du diabète et des mauvaises habitudes de vie comme le
manque d’exercice, si bien qu’on prévoit qu’elle sera de 16.7% chez les américains de plus de 30 ans en 2030 97,
101, 102. Au Canada en 2013, il a été estimé que c’est 3 000 000 de personnes qui souffraient d’IRC consciemment
ou non, ce qui correspond à 12.5% de la population, soit à peu près la même proportion que dans la population
mondiale en général 103, 104. Par contre, des 3 millions de personnes souffrant d’IRC au Canada, seulement 730
000 environ avaient une IRC de stade 3 ou plus 103.
14
Le Ca et le P en IRC Parmi les anomalies du métabolisme minéral osseux souvent retrouvées en IRC, on note
une élévation du phosphore, une surexpression de la sclérostine et de FGF23, de l’hyperparathyroïdie et une
déficience en Ca et en calcitriol. La perte de masse rénale fonctionnelle en IRC entraîne une diminution de la
production de calcitriol, si bien qu’environ 35% des patients souffrent d’une déficience avant même l’élévation
de la PTH et du phosphore et s’ajoute à cela l’effet suppresseur de FGF23 et du P sur la 1-α-hydroxylase 1, 105-
108. L’IRC est aussi associée à une diminution de l’expression du VDR dans les tissus-cibles du calcitriol,
amplifiant les effets de la déficience 107. La déficience en calcitriol en IRC est associée à plus de mortalité et à
une progression plus rapide de la maladie, alors que les patients avec de plus hauts niveaux voient au contraire
leurs chances de survie améliorées et la progression de leur IRC ralentie 1, 109-111. La déficience en calcitriol
affecte aussi négativement l’absorption du Ca, ce qui peut mener à de l’hypocalcémie dans certains cas,
particulièrement aux stades plus avancés de la maladie 112. La déficience en Ca et en calcitriol a pour effet de
stimuler la production de PTH, mais cela n’est pas toujours suffisant pour rétablir les niveaux de Ca et de
calcitriol, d’abord en raison de la perte de masse rénale et des autres facteurs qui limite la production de calcitriol
mais aussi en raison d’une diminution globale de l’expression du récepteur PTHR1 qui mène à une résistance à
la PTH 113. Il n’est donc pas étonnant que de la vitamine D ou des molécules semblables soient souvent
prescrites aux patients IRC. Dans ce cas précis, on peut éventuellement observer de l’hypercalcémie puisque
les reins excrètent moins bien le Ca à partir du stade 3 de l’IRC 112. Le P est aussi moins excrété, faisant en sorte
qu’il s’accumule progressivement dans la circulation malgré une légère diminution initiale causée par la
déficience en calcitriol 4, 108. De plus, une fois l’hyperphosphatémie établie, elle intensifie la suppression de la
1-α-hydroxylase et stimule la production de PTH 114. Elle est de plus associée à un plus fort taux de mortalité
spontanée et cardiovasculaire, à la calcification vasculaire et à la progression de l’IRC, l’effort supplémentaire
déployé par les reins pour éliminer le phosphore contribuant à les endommager 22, 115-119. À l’inverse, une
restriction de l’apport en phosphore semble suffisante pour rétablir une partie de la fonction rénale chez le rat
115.
La PTH en IRC Au cours de la progression de l’IRC, l’hyperphosphatémie, la déficience en calcitriol et
l’hypocalcémie qui en découle mène au développement d’hyperparathyroïdie secondaire 108, 120. Dans cette
pathologie, les glandes parathyroïdes deviennent hyperplasiques et moins sensibles à la régulation par le calcium
et le calcitriol 114, 120. Si 17% des patients en souffrent aux stades plus précoces, c’est jusqu’à 85% des patients
qui en sont atteints au stade terminal 119. À ce stade, même l’hyperparathyroïdie ne permet plus de maintenir
des niveaux convenables de P car les reins endommagés n’arrivent plus à en excréter l’excès 121.
L’hyperparathyroïdie peut même contribuer à l’hyperphosphatémie en stimulant la libération de P osseux par
les ostéoclastes, ce qui a aussi pour effet d’affaiblir l’os 122. Ainsi, bien que la PTH ait pour but de rétablir
l’équilibre minéral au départ, son élévation continue peut avoir des conséquences négatives comme la
15
calcification vasculaire et l’accélération du remodelage osseux. Son association avec la mortalité et le risque de
fractures suit ainsi une courbe en U, les risques étant augmentés lorsque la concentration s’éloigne de la valeur
normale 110, 123, 124. Des traitements visant à augmenter la concentration de calcitriol et de calcium ou à diminuer
celle de phosphore peuvent être administrés pour maintenir des niveaux de PTH sécuritaires. Dans notre étude,
du calcium, du phosphore et de la vitamine D seront administrés aux animaux IRC, ce qui devrait diminuer les
niveaux de PTH.
FGF23 en IRC Les niveaux de FGF23 sont particulièrement élevés aux stades avancés de l’IRC mais sont tout
de mêmes augmentés dès le début de la maladie, principalement en réaction à l’hyperphosphatémie et
l’hyperparathyroïdie mais peut-être aussi en raison de la diminution d’α-Klotho, de l’élévation de sclérostine, de
l’inflammation et de la déficience en fer qui sont souvent observées en IRC 125-127. L’élévation de FGF23 semble
par contre avoir lieu avant toute élévation importante de P ou de PTH, ce qui pourrait suggérer que FGF23
contribue à maintenir leurs niveaux normaux pendant un certain temps 22, 106, 126, 128. Il n’est par contre pas
certain que FGF23 soit très efficace à supprimer la PTH en IRC, d’une part parce que son co-récepteur
α-Klotho est moins exprimé et d’autre part parce que les glandes parathyroïdes expriment moins le récepteur
de FGF23 FGFR1 pour une raison inconnue 8, 129, 130. FGF23 semble même contribuer à l’hyperparathyroïdie
en IRC en raison de sa suppression de la production de calcitriol 128, 131, 132. Une fois l’hyperparathyroïdie établie,
elle a un effet stimulant clair sur la production de FGF23, tel qu’illustré par le fait qu’une parathyroïdectomie
permet de l’éviter ou de la renverser 16, 133. FGF23 a parfois été associé à la mortalité en IRC, mais d’autres
sources ne rapportent aucun lien 110. Pour expliquer cela, il a été suggéré que l’effet de FGF23 sur la survie
pourrait dépendre de la sévérité de l’IRC. En effet, l’inhibition hâtive de FGF23 est dommageable car elle fait
augmenter les niveaux de calcitriol, calcium et phosphore et stimule du coup le développement de calcification
vasculaire. Au contraire, l’inhibition plus tardive de FGF23 est bénéfique car elle réduit les risques de mortalité
et de fractures qui sont généralement associés à FGF23 au stade terminal, sans compter que l’inhibition de
FGF23 ne mène pas à une élévation de la calcification vasculaire à ce stade car les reins produisent plus
difficilement le calcitriol 126, 132.
Fig. 1.5 Effets de l’IRC sur le métabolisme phosphocalcique et le remodelage osseux
16
α-Klotho en IRC Au contraire de FGF23, α-Klotho voit sa production diminuée dans le rein et les glandes
parathyroïdes dès le début de l’IRC, ce qui pourrait contribuer à l’élévation hâtive de FGF23 130, 134-136. La raison
de cette diminution demeure inconnue, mais elle semble associée à la sévérité de l’atteinte rénale 137. Ce pourrait
être FGF23 lui-même qui inhibe son co-récepteur, ou encore la déficience en calcitriol qui diminuerait son
expression 8, 138. L’observation que l’administration d’un analogue de vitamine D permet d’augmenter
l’expression de α-Klotho dans les reins et les glandes parathyroïdes de rats IRC supporte cette seconde
hypothèse 139.
Les inhibiteurs de la voie Wnt en IRC Il a été rapporté dans de nombreuses études que les niveaux sanguins de
sclérostine sont augmentés en IRC. Élevés dès le stade 3, ils continuent d’augmenter alors que la fonction rénale
se détériore et pourraient donc jouer un rôle dans la fragilité osseuse dont souffrent les patients IRC 82, 140, 141.
Bien que la cause de l’élévation soit encore inconnue, une corrélation positive avec les niveaux de phosphore
circulants a été observée dans un certain nombre d’études 140, 142-145. Cette corrélation positive a aussi été
observée avec FGF23 dans certains cas 143, 145. De façon générale, la PTH corrèle plutôt inversement avec la
sclérostine puisqu’elle en inhibe la production 144, 146-149, mais ce lien n’est pas présent dans toutes les études 150,
151. De plus, les niveaux de sclérostine continuent à augmenter malgré l’hyperparathyroïdie 140, 152, 153. Dans
certaines études, les niveaux de sclérostine semblent positivement liés à une diminution de mortalité toute-cause
et cardiovasculaire 149, 150, 154, alors qu’ils sont plutôt associés positivement à la mortalité 155 et aux événements
cardiovasculaires dans d’autres 156. Une méta-analyse récente a quant à elle pour conclusion qu’il n’y a aucun
lien entre la mortalité et les niveaux de sclérostine 157. L’implication d’autres inhibiteurs de la voie
Wnt/β-caténine comme Dkk1 a aussi été étudiée mais les résultats sont plus variables 142, 148. Comme la
sclérostine, Dkk1 a été rapporté comme étant augmenté par l’hyperphosphatémie en IRC, et ses niveaux
semblent aussi corréler avec FGF23 142, 148. Une étude récente montre d’ailleurs la stimulation directe de la
production de Dkk1 par FGF23 en culture et in vivo 158. Il y a par contre peu d’études rapportant qu’il soit
augmenté en IRC de façon générale 82, 148, 159. Dans notre modèle de rat IRC, nous nous attendons à observer
une élévation de sclérostine dans la circulation des animaux, et possiblement de Dkk1 également.
L’os en IRC
Les anomalies osseuses en IRC En IRC, les désordres du métabolisme minéral mènent à des anomalies osseuses
qui peuvent mener à leur tour à une fragilité osseuse accrue. Le risque de fractures est augmenté dès les premiers
stades de la maladie et peut être 4.4 fois plus élevé que dans la population générale au stade le plus avancé 160-
163. À ce stade, 5 à 10% des patients subiront au moins une fracture par période de 3 ans et devront faire face
aux conséquences sur la survie qui y sont associées 164. Les patients dialysés subissant une fracture de la hanche
17
ont effectivement 2 fois plus de risques de décéder des suites de ladite fracture qu’une personne ne souffrant
pas d’IRC et ont aussi de moins bonnes chances de survie à long terme, 64% des patients subissant une fracture
au stade terminal de l’IRC décédant dans l’année suivante 123, 161, 165.
Le déséquilibre minéral et les anomalies osseuses Les anomalies osseuses en IRC sont le fruit de multiples facteurs.
D’abord, la perte de capacité de filtration rénale fait en sorte que le P s’accumule en circulation, et des niveaux
élevés de P ont été associés à des caractéristiques osseuses négatives comme un volume trabéculaire réduit et
une perte de connectivité au niveau de l’os trabéculaire, ce qui semble être réversible si les niveaux de P sont
maintenus sous contrôle 117, 166. L’hyperphosphatémie pourrait aussi détériorer l’architecture osseuse en
entraînant l’apoptose des ostéoblastes et des ostéocytes, ce qui freine la formation osseuse 142. Ensuite, des
niveaux bas de calcitriol sont aussi associés à un plus grand risque de fracture de la hanche, en partie car ils
entraînent une diminution de l’expression du VDR, ce qui est associé à une diminution de la formation osseuse
167, 168. La déficience en calcitriol, et par extension en Ca, stimule de plus la production de PTH, qui a des effets
considérables sur l’os en stimulant la résorption osseuse et en causant une pathologie osseuse nommée os
hyperparathyroïde qui sera vue plus en détails plus tard. Toute tentative de rétablir des niveaux de PTH
normaux, que ce soit par l’administration de calcitriol ou de calcium ou par l’administration de chélateurs de
phosphore, peut avoir un trop grand effet suppresseur et mener à un ralentissement du remodelage osseux, ce
qui est tout aussi délétère pour la structure osseuse qu’un remodelage accéléré 107. FGF23 a aussi des effets
osseux en IRC. Alors que certaines sources rapportent que c’est seulement aux stades plus avancés qu’on
observe une hausse de la transcription de FGF23 dans l’os chez la souris, une augmentation a été observée dès
les premiers stades de la maladie dans les os de patients et elle se poursuit au cours de la progression de l’IRC
152, 169. Des niveaux élevés en circulation sont associés à un plus grand risque de fractures chez les patients. Une
étude animale nous renseigne sur le mécanisme possible en rapportant que FGF23 et associé à une perte de
volume et à un amincissement de l’os 170. Néanmoins, d’autres études chez l’humain rapportent une moins
grande quantité d’os non minéralisé chez les patients au stade terminal de la maladie, indiquant que FGF23
encouragerait la minéralisation en IRC 171, 172.
Les inhibiteurs de la voie Wnt et les anomalies osseuses La voie Wnt/β-caténine a tendance à être inhibée dans l’os
en IRC, ce qui pourrait contribuer à ralentir le remodelage osseux 173. Il a en effet été observé que la voie
Wnt/β-caténine est inhibée dans les ostéocytes de souris IRC et que les niveaux de β-caténine phosphorylée, et
donc destinée à être dégradée pour prévenir l’activation de la voie Wnt/β-caténine, ont tendance à être
augmentés dans les os de patients IRC 152, 174. Dans le modèle de souris IRC, des niveaux plus élevés de
sclérostine ont été observés en parallèle à l’inhibition de la voie Wnt/β-caténine, suggérant que les inhibiteurs
18
de la voie Wnt pourraient être responsables de cette dernière 174. En induisant la production de sclérostine chez
des rats IRC parathyroïdectomisés par l’administration d’une diète haute en phosphore, Ferreira et al. ont
observé une réduction du remodelage et du volume osseux, ce qui met en lumière le fait que
l’hyperphosphatémie peut avoir un effet délétère sur l’os sans passer par la PTH 142. Dans un autre modèle
d’IRC avec hypoparathyroïdie, la suppression de la sclérostine semble augmenter le volume et la minéralisation
trabéculaire, suggérant que ces deux processus sont perturbés par la sclérostine 175. Des observations semblables
ont été faites chez l’humain, des patients ayant plus de sclérostine en circulation exprimant moins de
phosphatase alcaline dans une étude, ce qui est indicateur d’une formation osseuse ralentie 150. La sclérostine
corrélait aussi inversement avec le remodelage osseux dans d’autres études, et elle serait même un prédicteur de
perte osseuse 146, 176, 177. Étonnamment, un lien positif a été découvert entre la sclérostine et la densité minérale
osseuse en IRC, ce qui semble à première vue en désaccord avec les effets négatifs précédemment mentionnés
mais qui pourrait dériver du fait qu’une masse osseuse plus grande contient plus d’ostéocytes sécrétant la
sclérostine 150, 151, 176, 178. Ce lien positif a aussi été observé en dehors du contexte de l’IRC chez la femme
ménopausée et la même explication a été avancée 179. Pour ce qui est de Dkk1, quelques études n’ont observé
aucun lien entre Dkk1 et les paramètres osseux en IRC, et le même constat a été fait chez la femme ménopausée
146, 178, 179. Une étude rapporte toutefois un lien inverse avec la densité osseuse chez les patients pré-dialysés 151.
Pour ce qui est de notre modèle animal, nous émettons l’hypothèse que l’expression de sclérostine et de Dkk1
sera élevée dans l’os, ce qui pourrait contribuer à ralentir le remodelage osseux.
Selon la combinaison de facteurs influençant le remodelage osseux qui sont présents, différentes anomalies
osseuses peuvent être observées. Elles sont classifiées en quatre catégories : l’os hyperparathyroïde, l’os
adynamique, l’ostéomalacie et l’anomalie osseuse mixte.
19
Fig. 1.6 Illustration des mécanismes par lesquels l’IRC et certains traitements induisent les anomalies
osseuses (issu de l’article en annexe)
L’os hyperparathyroïde La déficience en calcitriol et l’hyperphosphatémie retrouvées lorsque l’IRC n’est pas
traitée mènent tous deux à l’hyperparathyroïdie, ce qui accélère le remodelage osseux dans un effort pour
équilibrer les niveaux de Ca et de P. L’anomalie osseuse résultant de ce remodelage accéléré se nomme os
hyperparathyroïde. Bien que l'hyperparathyroïdie ne soit généralement pas apparente au tout début de la
maladie, les niveaux de PTHR1 dans l’os sont augmentés assez tôt, augmentant la production de RANKL en
réponse à la PTH 152. Ce RANKL active les ostéoclastes, qui sont alors plus gros et plus nombreux et qui
creusent dans l’os des tunnels facilement reconnaissables sur une biopsie 136, 180, 181. L’activation des ostéoclastes
peut aussi être détectée par une augmentation osseuse des niveaux de TRAP, une enzyme impliquée dans la
résorption 136. C’est en général l’os cortical qui est le plus touché par ce remodelage accéléré 182. Bien que le
remodelage accéléré puisse être observé peu importe les niveaux de PTH, il s’agit de l’anomalie prédominante
lorsque les niveaux de PTH dépassent 300 pg/mL 183. Au contraire, des niveaux de PTH inférieurs à 150 pg/mL
sont généralement associés à une suppression du remodelage 166, 183, 184. Dans le contexte de l’IRC stade 5, la
National Kidney Foundation recommande toutefois de maintenir les valeurs de PTH à une valeur équivalent à
20
2 à 9 fois la valeur normale puisque l’hyperparathyroidie constitue une adaptation aux perturbations de l’IRC
malgré les problèmes qu’elle peut amener 185. L’os hyperparathyroïde est associé à un léger risque de fractures
mais ce risque est inférieur à ce qui serait observé en hypoparathyroïdie 123. Le remodelage accéléré est aussi
associé à un plus haut risque de mortalité, autant toutes causes confondues que cardiovasculaire, et à des
douleurs persistantes 186. Les traitements pour cette anomalie, qui seront vus plus en détail à la section 1.8,
impliquent la normalisation des niveaux de PTH, notamment via la régulation du P.
L’os adynamique Caractérisé par un ralentissement du remodelage, l’os adynamique est souvent le fruit d’une
trop grande suppression de la PTH. Sur une biopsie osseuse, on le reconnaît à une formation osseuse ralentie
et un faible nombre d’ostéoblastes et d’ostéoclastes qui n’affectent toutefois pas la minéralisation 184, 187. Des
niveaux de PTH inférieurs à 100 pg/mL peuvent également être une bonne indication de la présence de cette
anomalie, mais une biopsie osseuse demeure la méthode diagnostique la plus fiable 184, 188. De nos jours, l’os
adynamique est généralement l’anomalie la plus fréquente aux premiers stades de l’IRC, avant même que la
PTH ne soit dramatiquement altérée, et il constitue jusqu’à 70% des anomalies osseuses au stade terminal 166,
184, 189-192. Elle était précédemment moins fréquente que l’hyperparathyroïdie mais elle a gagné en prévalence
depuis que la PTH est mieux contrôlée 187. En effet, la suppression de la PTH qui est généralement à la source
de l’os adynamique peut être due aux suppléments de calcium et de vitamine D qui sont donnés aux patients
193, 194. On s’attend donc à l’observer chez les rats recevant un supplément de vitamine D dans notre étude. La
PTH pourrait également être supprimée par FGF23, qui est surexprimée en IRC 10, 106. Par contre, le fait de
rétablir les niveaux de PTH ne semble pas toujours suffire à normaliser le remodelage osseux, suggérant que
d’autres facteurs pourraient supprimer ce dernier 117. Une explication possible est que l’os pourrait développer
une résistance à la PTH en raison d’une expression diminuée de PTHR1 107, 189. La sclérostine, dont les niveaux
augmentent tôt en IRC, pourrait aussi contribuer à ralentir le remodelage en bloquant la formation osseuse 166.
Par contre, il est à noter que l’inhibition de la voie Wnt/β-caténine osseuse et une hausse de la production de
sclérostine peuvent être observées dans des situations où le remodelage est accéléré et ne sont donc pas
spécifiques à l’os adynamique 174. Pour ce qui est des conséquences plus concrètes du remodelage ralenti, les
risques de fractures sont augmentés plus drastiquement par l’os adynamique que par l’os hyperparathyroïde
parce que l’os n’est pas remodelé assez rapidement pour permettre l’adaptation à de nouvelles contraintes, que
les microfractures mettent plus de temps à être réparées et que l’os est moins dense 181, 184, 189, 195. Tout comme
l’os hyperparathyroïde, l’os adynamique est associé à des douleurs osseuses et à une mortalité accrue 189. Il est
aussi traité par une normalisation des niveaux de PTH, ce qui peut être obtenu par une limitation de l’apport
en calcium et en vitamine D 167, 184.
21
L’ostéomalacie L’ostéomalacie, une pathologie osseuse caractérisée par un retard de minéralisation, semble plutôt
se développer aux stades plus avancés de la maladie. À ce moment, la déficience en calcitriol se fait plus sévère
et entraîne une diminution du Ca disponible pour minéraliser l’os et l’os est plus résistant à l’action de la PTH
131, 196. La surexpression de FGF23, un inhibiteur de minéralisation, pourrait aussi contribuer à cette anomalie,
et l’acidose métabolique souvent observée en IRC est aussi associée à l’ostéomalacie 37, 197. Tout comme dans
le cas de l’os adynamique, le nombre d’ostéoblastes et d’ostéoclastes est réduit, mais on observe en plus un
épaississement du matériel ostéoïde 181. Étant rarement observée dans les stades les moins sévères de la maladie,
cette anomalie est plus rare que les deux précédentes 181, 187. L’os est encore plus fragilisé qu’en présence d’os
adynamique et le risque de fracture est donc plus élevé 181. Le fait de rétablir les niveaux de Ca et de P peut
éliminer les signes d’ostéomalacie chez le rat même en l’absence de calcitriol, mais il pourrait être possible de
donner de la vitamine D pour obtenir cet effet, comme c’est le cas dans un contexte non-IRC 41, 198, 199. Un
anticorps ciblant FGF23 semble aussi permettre de restaurer une partie de la production de calcitriol chez le
rat IRC 131.
L’anomalie osseuse mixte Dans certains cas, l’atteinte osseuse peut être plus difficile à classifier. Par exemple, on
pourrait observer à la fois un remodelage accéléré et un défaut de minéralisation. On parle alors d’anomalie
osseuse mixte 181. Cette anomalie est plus fréquente que l’ostéomalacie, représentant 18% des cas d’anomalies
osseuses en insuffisance rénale terminale dans une étude 192. Les patients qui en souffrent peuvent ressentir des
douleurs osseuses et sont plus à risque de fractures 191. Sa cause la plus probable est une combinaison
d’hyperparathyroïdie qui stimule le remodelage et d’une déficience en calcitriol qui complique l’absorption du
calcium nécessaire à la minéralisation, et ce sont donc ces deux problèmes que les traitements visent à corriger
196.
La calcification vasculaire en IRC
Les maladies cardiovasculaires sont la principale cause de mortalité en IRC et sont également associées à la
progression de la maladie, leur prévalence augmentant en parallèle avec la perte de fonction rénale 100, 200-202. La
calcification vasculaire en particulier est associée à la mortalité et aux accidents cardiovasculaires, autant aux
stades terminale qu’avant le début de la dialyse 203-206. Elle touche de 40 à 70% des patients IRC aux stades 3-4
et jusqu’à 85% au stade 5 207.
Mécanisme de la calcification vasculaire Dans notre étude, la supplémentation des rats IRC en Ca et P a pour but
d’induire la calcification vasculaire. Bien que la calcification vasculaire soit associée à une concentration trop
22
élevée de Ca et de P en circulation, elle n’est pas causée par une précipitation passive de ces deux minéraux
dans la paroi vasculaire 208. Il semblerait que ce soient plutôt des conditions propres à l’IRC, incluant les niveaux
de Ca et de P, qui stimulent la trans-différenciation de cellules musculaires lisses de la media vasculaire (CMLV)
en cellules ostéoblastiques. Ces cellules sécrètent de la matrice osseuse et des protéines typiquement osseuses
comme RunX2 et l’ostéopontine 208, 209. La séquence plus précise semble débuter par une surexpression de
BMP2, qui active la signalisation Wnt, entraînant la transcription de facteurs de différentiation ostéoblastique
comme RunX2 210, 211. Les CMLV acquérant alors un phénotype plus près de l’ostéoblaste que de la cellule
musculaire lisse, elles sont surnommées « osteoblast-like cells ». Il a été proposé que ces cellules pourraient
éventuellement acquérir un phénotype ostéocytaire et produire des protéines propres aux ostéocytes, ce qui
constituait l’une de nos hypothèses de recherche. Ces cellules exprimeraient alors des marqueurs ostéocytaires
comme DMP-1 et les inhibiteurs de la voie Wnt sclérostine et Dkk1. Nous nous intéresserons d’ailleurs à la
possibilité que ces protéines influencent le développement de la calcification vasculaire, par exemple en freinant
la déposition d’os dans le vaisseau.
Fig. 1.7 : Marqueurs indiquant la présence de différentiation ostéoblastique, et possiblement
ostéocytaire, dans le vaisseau calcifié
Causes possibles de la calcification vasculaire Le principal facteur associé au développement de calcification
vasculaire en IRC semble être l’élévation de P, une diète haute en P induisant l’activation de la voie
Wnt/β-caténine, la transcription de RunX2 et ultimement la différentiation ostéoblastique des CMLV 208, 211,
212. Une explication possible au lien entre P et la calcification est que le P stimulerait la différenciation
ostéoblastique en se liant aux récepteurs du P Pit-1 et Pit-2 à la surface des CMLV 118, 213. Par ailleurs, la délétion
de FGF23 peut mener à la calcification des tissus mous par l’élévation de P qu’elle induit 8. Toutefois, bien que
l’élévation de FGF23 semble prévenir l’hyperphosphatémie dans une certaine mesure, elle n’empêche pas la
calcification de se développer 212. Elle semble même associée à plus de calcification indépendamment des
23
niveaux de phosphate chez les patients IRC, et aussi à plus d’événements cardiovasculaires 214, 215. Son
co-récepteur α-Klotho semble quant à lui contrer la progression de la calcification, possiblement en permettant
à FGF23 de stimuler l’excrétion du P 134, 216, 217. Le calcium semble quant à lui également lié positivement à
l’ossification du vaisseau, mais il agirait plus probablement en stimulant l’apoptose des CMLV ou en facilitant
l’action du P sur celles-ci 213, 218. Les niveaux de calcitriol semblent aussi liés positivement à la calcification, ce
qui s’explique en partie par le fait qu’ils augmentent les niveaux de P et de Ca, mais pourrait aussi résulter d’une
action stimulatrice directe du calcitriol sur la minéralisation tel qu’observé in vitro 219. Par contre, la déficience
en calcitriol est aussi associée à la calcification vasculaire 220. La PTH a aussi été associée à la calcification, ce
qui pourrait s’expliquer par le Ca et le P qui sont libérés dans la circulation lorsque le remodelage est accéléré
221-223. Parmi d’autres facteurs augmentés par l’IRC et associés positivement à la calcification vasculaire, on
compte BMP2 et OPG 224-226. Les mécanismes menant à la calcification vasculaire en IRC demeurent somme
toute mal compris, ce qui complique le développement de traitements préventifs.
Les inhibiteurs de la voie Wnt et la calcification vasculaire Les inhibiteurs de la voie Wnt sont maintenant
soupçonnés de contribuer au processus de calcification vasculaire. La présence de calcification des vaisseaux et
de la valve aortique est généralement associée de plus hauts niveaux de sclérostine sérique 147, 225, 227-229, bien
quelques études ont plutôt observé une corrélation inverse entre la sclérostine et la calcification 144, 150, 230.
Lorsque la calcification est présente, sa sévérité semble associée à de plus faibles niveaux de sclérostine dans
une étude 229, mais une autre ne rapporte aucun lien 227. Comme il a été rapporté que les vaisseaux calcifiés des
souris et des patients sont une source de sclérostine, une explication possible au lien entre la calcification et
cette protéine est que les vaisseaux calcifiés produisent la sclérostine qui se retrouve dans la circulation, mais
que les hauts niveaux de la protéine qui s’en suivent peuvent prévenir la progression de la calcification 227, 231.
De plus, l’observation d’une protéine proprement ostéocytaire dans la paroi vasculaire calcifiée suggère
fortement qu’on y retrouverait des cellules au phénotypes ostéocytaires résultant d’une différenciation terminale
des cellules ostéoblastiques 231. Pour ce qui est de Dkk1, il a été associé à une diminution de la sévérité de la
calcification dans diverses pathologies humaines et semblerait agir en prévenant l’induction de RunX2 par
l’hyperphosphatémie 82, 211. Nous nous attendons donc à voir de la sclérostine et possiblement Dkk1 dans les
vaisseaux calcifiés de nos rats IRC, ce qui pourrait jouer un rôle dans l’évolution de la calcification.
Le lien entre les anomalies osseuses et vasculaires On observe en IRC un phénomène aussi présent dans la
population vieillissante, soit une association positive entre la fragilité osseuse et le développement de
calcification vasculaire 207, 232. Par exemple, des patients souffrant de de calcification vasculaire plus sévère
auront une plus faible densité osseuse et auront tendance à subir plus de fractures 207, 208. Ce lien, qui est encore
24
mal compris, est un sujet central de notre étude. Nous nous attendons à voir un lien inverse entre la calcification
vasculaire et la sévérité de l’atteinte osseuse chez nos animaux. La présence d’os adynamique semble
particulièrement associée à la présence de calcification vasculaire, alors que cette dernière est moins fréquente
quand les niveaux de PTH et le nombre d’ostéoclastes sont plus élevés 184, 233. Cette association s’explique en
partie par le fait que le remodelage est trop lent pour que l’os puisse emmagasiner les surplus de Ca et de P, qui
demeurent donc dans la circulation et stimulent la calcification 234. Il est aussi possible que des protéines
anormalement produites par l’os ou le vaisseau contribuent au lien. La sclérostine est un exemple de protéine
qui pourrait être impliqué dans ce lien puisque des niveaux sériques élevés ont été associés à la fois à la
calcification aortique sévère, à une densité minérale osseuse diminuée et à une épaisseur corticale réduite chez
des patients en dialyse 178, 235. La sclérostine produite dans le vaisseau calcifié pourrait donc inhiber la formation
osseuse en IRC et ainsi contribuer au lien os-vaisseau 231. FGF23 est une autre protéine osseuse qui a été associée
à la calcification vasculaire dans certains cas, ce qui en fait une autre explication potentielle au lien os-vaisseau
214, 236.
Les traitements disponibles pour l’IRC
La greffe rénale Malgré la grande variété de médicaments et de suppléments disponibles pour traiter les
symptômes de l’IRC, il n’existe pas de traitement parfait permettant de rétablir la fonction rénale tout en
annulant les effets négatifs subis par l’os et le vaisseau. La greffe rénale est toutefois ce qui s’en rapproche le
plus. Suite à la transplantation d’un rein provenant d’un donneur décédé ayant consenti au don d’organe ou
d’une personne en santé qui accepté de faire don d’un de ses reins, on observe le rétablissement d’une bonne
partie de la fonction rénale, incluant la production de calcitriol 237. Les atteintes osseuses peuvent devenir moins
sévères ou changer de catégorie, l’os hyperparathyroïde étant moins souvent observé suite à la greffe 238. Les
niveaux de PTH mettent par contre un certain temps à revenir à la normale, faisant en sorte qu’ils suractivent
le remodelage osseux et la production de calcitriol un certain temps après la greffe, menant à une hypercalcémie
et une hyperphosphatémie temporaires 237. Bien que la persistance des anomalies du métabolisme minéral
osseux expliquent une partie des anomalies osseuses observées suite à la greffe, la cause majeure de ces dernière
est plutôt les médicaments qui sont donnés pour éviter le rejet du greffon 237. En effet, les divers traitements
qui sont administrés pour éviter le rejet, comme les glucocorticoïdes, la cyclosporine, le tacrolimus, la
prednisone et la rapamycine, ont tous des effets perturbateurs connus sur la formation, la résorption ou la
minéralisation osseuse 239-241.
La dialyse La dialyse consiste à compenser une partie des effets négatifs de la perte de filtration rénale en retirant
certaines composantes du plasma par filtration. La méthode la plus fréquente est l’hémodialyse, qui consiste à
25
faire passer le sang dans une machine à l’intérieur de laquelle une membrane poreuse permet aux surplus de Ca,
de P et d’autres petites molécules de diffuser par osmose dans un liquide appelé dialysat situé de l’autre côté de
la membrane. Cette méthode prend quelques heures et doit être répété quelques fois par semaine, à l’hôpital ou
chez le patient. Une autre méthode, la dialyse péritonéale, consiste plutôt à injecter le dialysat dans l’espace
péritonéal du patient et à laisser les minéraux et autres molécules en circulation diffuser dans ce liquide 242.
Malgré l’évolution de ces techniques, elles ne permettent toujours pas d’éviter les désordres du métabolisme
minéral osseux, la calcification vasculaire et les fractures à long terme 123, 124, 148.
Les chélateurs de phosphore En parallèle au remplacement de la filtration rénale par la greffe ou la dialyse, d’autres
traitements peuvent être donnés pour réguler les niveaux de Ca, P et calcitriol. Une méthode simple consiste à
modifier l’alimentation du patient afin d’éviter les carences ou les excès de minéraux. Par exemple, un patient
souffrant d’hyperparathyroïdie se verra d’abord prescrire une restriction de phosphore alimentaire, mais cela
est rarement suffisant 243. Une autre façon de limiter les effets négatifs de l’hyperphosphatémie est de prescrire
au patient des chélateurs de phosphore. Ces molécules, administrées de façon orale, captent le phosphore dans
l’intestin pour en limiter l’absorption et donc les effets négatifs comme l’hyperparathyroïdie, la calcification
vasculaire, l’excès de FGF23 et les dommages rénaux 244, 245. De façon générale, ces chélateurs sont associés à
une meilleure survie chez les patients dialysés 246. Il en existe plusieurs types, chacun ayant des avantages et des
inconvénients. Il est toutefois à noter que le fait qu’ils existent ne signifie pas nécessairement qu’ils sont
disponibles pour les patients au Canada, certains ayant un coût prohibitif ou n’ayant pas encore été approuvés
en raison du manque d’études à leur sujet 247. Les plus communs, dont font partie le carbonate de calcium et
l’acétate de calcium, sont à base de calcium et captent le phosphore très efficacement. Par contre, ils constituent
une charge supplémentaire de calcium qui augmente les risques de calcification vasculaire et donc de mortalité
chez les patients, en plus d’augmenter les niveaux de FGF23 et d’entraîner un risque d’hypoparathyroïdie qui
pourrait mener à l’os adynamique 184, 246, 248-250. C’est ce qui a poussé la recherche vers d’autres types de
chélateurs, comme les sévélamers, les chélateurs à base de lanthane et les chélateurs à base de fer. Bien que
généralement moins efficace pour la captation du P, ils pourraient présenter certains avantages par rapport aux
chélateurs calciques, comme une diminution des niveaux de FGF23 et de sclérostine en plus de ceux de
phosphore et de PTH, ainsi qu’une diminution du taux de mortalité, et ce même s’ils sont donnés conjointement
avec des chélateurs à base de calcium 245, 251, 252. Fait à base de résine, les sévélamers captent un peu moins de P
que le carbonate de calcium et sont parfois associés à des problèmes gastro-intestinaux 249. Le risque d’aggraver
la calcification vasculaire est par contre moindre, et l’hydrochlorure de sévélamer semble induire plus de
formation osseuse et améliorer les caractéristiques de l’os trabéculaire chez les patients par rapport au carbonate
de calcium 248, 253. Les chélateurs à base de fer, comme l’oxyhydroxyde ferrique, entouré de glucides, sont aussi
efficaces que les sévélamers sans être associés à des problèmes gastro-intestinaux 249. Toutefois, une faible
26
proportion du chélateur peut être absorbée, ce qui peut représenter un risque pour les patients ayant déjà un
surplus de fer 249. Le carbonate de lanthane est une autre option, et elle a l’avantage d’être aussi efficace à capter
le P que les chélateurs à base de calcium sans pour autant faire augmenter les niveaux de Ca. Le lanthane semble
par contre se déposer dans l’os et d’autres organes, ce qui pourrait entraîner des problèmes de nature encore
inconnue à plus long terme 254.
Les suppléments de vitamine D Les niveaux de calcium, de calcitriol et de PTH peuvent quant à eux être rétablis
par l’administration de vitamine D alimentaire, de calcitriol ou de l’un de leurs analogues 255. Ces suppléments
sont associés à une meilleure survie et à un remodelage plus lent si leur dose est contrôlée de façon à supprimer
la PTH sans faire augmenter le Ca et le P trop drastiquement, faisant en sorte que la moitié de la population
IRC non-dialysée s’en voit prescrire 186, 247, 256. Ils peuvent aussi être combinés à du Ca pour augmenter la densité
minérale osseuse de patients souffrant d’ostéomalacie 199. D’autres études, chez l’animal cette fois, rapportent
toutefois que leur utilisation pour réguler la PTH ne permet pas de retrouver un remodelage osseux normal et
peut causer une élévation de FGF23 et de la calcification vasculaire même à petites doses 219, 257, 258.
L’administration de calcitriol peut aussi mener à l’os adynamique 184, 189, 246. Le calcitriol peut être donné sous
forme orale ou intraveineuse, cette dernière méthode semblant plus efficace 255. Il est aussi possible de donner
du cholécalciférol pour encourager la production de calcitriol par le rein 186, et une troisième possibilité consiste
à donner un analogue de calcitriol comme le paricalcitol, le doxercalciférol ou l’alfacalcidol, qui ont été créés
pour supprimer la PTH sans trop augmenter l’absorption du Ca et du P 107, 186. Il n’y a toujours pas de preuves
définitives que tous les analogues de vitamine D sont plus sécuritaires que le calcitriol en termes
d’hypercalcémie, mais la plupart semblent augmenter la survie et limiter l’augmentation de Ca et P en circulation
par rapport au calcitriol 4, 107, 256, 259-262. Le paricalcitol semble particulièrement efficace pour réduire les risques
de calcification vasculaire tandis que le doxercalciférol semble au contraire ne pas prévenir l’élévation de Ca et
de P 219.
Les calcimimétiques Les patients peuvent aussi recevoir des calcimimétiques comme le cinacalcet, ce qui permet
d’activer le récepteur du Ca des glandes parathyroïdes pour supprimer la PTH sans faire augmenter la
concentration de Ca, limitant du coup les risques de calcification vasculaire 4, 122, 243, 260, 263. De plus, les
calcimimétiques n’ont pas le même effet stimulant sur FGF23 que le Ca et le calcitriol, menant à une diminution
de FGF23 bénéfique pour la survie cardiovasculaire puisque FGF23 est associé à des problèmes
cardiovasculaire comme l’hypertrophie du ventricule gauche 13, 126, 258. La prescription de cinacalcet est d’ailleurs
associée à une diminution du risque d’accidents cardiovasculaires et du besoin de recourir à une
parathyroïdectomie mais ne semble pas réduire le risque de fractures et de mortalité 264-266.
27
La parathyroïdectomie et la supplémentation en PTH Malgré tous les traitements précédemment mentionnés, une
majorité de patients IRC non-dialysés n’atteignent pas les cibles de PTH recommandées 247. Dans un cas
extrême où rien ne viendraient pas à bout de l’hyperparathyroïdie, il est possible de procéder à une chirurgie
pour enlever une partie ou la totalité des quatre glandes parathyroïdes 267. L’ablation de la totalité des glandes
signifie que le patient devra prendre des suppléments de Ca et de vitamine D pour le restant de ses jours, mais
contrairement à une parathyroïdectomie partielle, cette chirurgie évite le risque d’un retour de
l’hyperparathyroïdie qui nécessiterait une nouvelle chirurgie associée à un risque de mortalité 267. Une option
intermédiaire consiste à enlever les glandes puis à retransplanter quelques morceaux de tissu à un autre endroit
du corps, généralement le bras, pour réduire temporairement leur fonction et faciliter leur surveillance 267.
Malgré son caractère invasif, la parathyroïdectomie semble somme toute réduire la mortalité à long terme 268.
Si l’on observe au contraire de l’hypoparathyroïdie et un remodelage ralenti, un analogue de PTH comme le
tériparatide peut être donné pour stimuler la formation osseuse 266.
Cibler la voie Wnt/β-caténine Sachant qu’elles sont possiblement impliquées dans les anomalies osseuses en IRC,
il serait éventuellement intéressant de cibler certaines composantes de la voie Wnt/β-caténine pour augmenter
la formation osseuse et le remodelage. Les activateurs, récepteurs et inhibiteurs constituent des cibles plus
intéressantes que les composantes intracellulaires de la voie car elles sont plus spécifiques à l’os 55. Des études
récentes chez l’animal se sont attardées aux effets de traitements à base d’anticorps ciblant les inhibiteurs de la
voie Wnt en IRC. Peu d’études ont été faites en IRC, mais chez des souris en santé, l’anticorps contre Dkk1
permet d’accélérer la guérison suite à une fracture en activant la voie Wnt/β-caténine 269. Dans un modèle de
souris diabétique avec IRC, l’administration d’anti-Dkk1 en combinaison avec des chélateurs de phosphore a
amélioré les caractéristiques osseuses et empêché le développement de calcification vasculaire mais en raison
des caractéristiques spécifiques au modèle animal il est difficile d’affirmer que ces effets positifs sont
généralisables à la population IRC 159. Un anticorps ciblant la sclérostine, le romosozumab, a permis d’améliorer
les paramètres de structure et de solidité dans de nombreuses études utilisant des modèles animaux
d’ostéoporose alors qu’un autre anti-sclérostine a permis d’augmenter la formation osseuse chez l’humain 270,
271. Dans un modèle génétique d’IRC chez le rat, il a été observé qu’un anticorps contre la sclérostine permet
d’augmenter le volume osseux et la minéralisation de l’os trabéculaire, mais seulement si le remodelage n’était
pas accéléré par de hauts niveaux de PTH 175. Cela peut s’expliquer par le fait que de hauts niveaux de PTH
étaient associés à une suppression de la sclérostine dans cette étude, réduisant l’impact positif d’un anticorps
ciblant cette protéine 175.
28
Comprendre le lien entre la voie Wnt et les anomalies osseuses et
vasculaires
Les recherches ayant mené à ce mémoire avaient pour but principal de mesurer l’implication de la voie Wnt
dans le développement des anomalies osseuses et vasculaires en IRC. Pour observer les interactions complexes
entre les différents tissus lors de la maladie, nous avons utilisé un modèle animal, soit des rats Wistar mâles
ayant subi une néphrectomie partielle (retrait de 5/6e de la masse rénale) et recevant une diète enrichie en Ca et
P ainsi que des injections de vitamine D. Ce modèle, qui induit chez l’animal une hypoparathyroïdie et un
remodelage ralenti, a précédemment été utilisé dans notre laboratoire ainsi que dans de nombreuses autres
études. Il présente l’avantage d’être le plus communément utilisé, ce qui facilite la comparaison aux résultats de
d’autres études 272. En revanche, les deux chirurgies que le rat doit subir augmentent les risques de perdre des
animaux, demandent des compétences spécialisées et représentent des coûts supplémentaires. Un autre modèle
animal populaire pour étudier l’IRC est le modèle adénine, dans lequel les rats reçoivent de l’adénine pour
induire une perte de fonction rénale. Bien que ce modèle présente l’avantage de ne pas nécessiter de procédure
chirurgicale, on ne connaît pas bien les effets que l’adénine pourrait avoir sur d’autres organes que le rein, faisant
en sorte qu’il serait difficile d’affirmer hors de tout doute qu’une anomalie osseuse ou vasculaire dans ce modèle
est causée par l’IRC plutôt que par l’adénine. De plus, il semble mener à un éventuel déclin de l’animal aux
alentours de 6 semaines, limitant la durée d’étude de ces animaux 273. Comme nous voulions étudier l’interaction
entre différents systèmes et que nous avions déjà l’expertise nécessaire pour réaliser le modèle de néphrectomie
5/6e, nous avons opté pour ce dernier.
Par souci de cohérence avec la littérature, les animaux utilisés dans notre étude étaient de sexe mâle. En effet,
la majorité des études utilisant le modèle de néphrectomie 5/6e utilisent des rats mâles puisque l’œstrogène,
présent en plus grande quantité chez les femelles, joue un rôle important dans métabolisme minéral osseux.
L’utilisation de rats femelles ajouterait donc une variable à une équation déjà complexe. Il serait toutefois
envisageable de répéter l’étude sur des rats femelle pour voir si des différences sont présentes, surtout
considérant le fait que plus de femmes que d’hommes souffrent d’IRC 275.
Afin de limiter l’utilisation d’animaux, un nombre optimal de sujets a été déterminé avant le début de l’étude.
Ce nombre, qui correspond à 2 groupes contrôles de 8 rats chacun et 2 groupes néphrectomisés de 12 rats
chacun, tient compte du fait que les rats néphrectomisés sont plus à risque de mortalité en raison de la procédure
chirurgicale. Il permet également d’enlever des rats aux résultats anormaux au besoin puisque selon un calcul
statistique basé sur les résultats de protocoles antérieurs, il suffirait de 6 rats dans chaque groupe détecter des
différences significatives avec la plupart des tests effectués.
29
Chapitre 1 : Questions et hypothèses
Q1- Quelles anomalies du métabolisme minéral osseux et des vaisseaux sont présentes dans notre modèle?
H1- Le supplément de calcium, phosphore et vitamine D administré aux rats IRC devrait induire la calcification
vasculaire et supprimer la production de PTH. Il devrait en résulter un ralentissement de la formation et de la
résorption osseuse typiques de l’os adynamique. De plus, les niveaux de sclérostine et de Dkk1 devraient être
élevés dans la circulation et pourraient également ralentir la formation osseuse.
Q2- Quel est le lien entre les anomalies osseuses et vasculaires en IRC?
H2- Un lien négatif devrait être observé entre la densité osseuse et la sévérité de la calcification vasculaire,
conformément à ce qui est rapporté dans la littérature. Les cellules ostéoblastiques du vaisseau calcifié devraient
se différencier en cellules ostéocytaires et produire des inhibiteurs de la voie Wnt comme sclérostine et Dkk1,
qui pourraient agir sur l’os. Des protéines régulatrices produites par l’os devraient également influencer
l’évolution de la calcification vasculaire, celle-ci se développant par un processus semblable à la formation
osseuse.
Q3- La voie Wnt/β-caténine dans l’os et le vaisseau est-elle activée ou inhibée en IRC?
H3- Des niveaux plus bas de marqueurs d’activité Wnt devraient être présents dans l’os et le vaisseau et il devrait
y avoir une corrélation négative entre la sévérité de la calcification et les niveaux de sclérostine et de Dkk1.
30
Chapitre 2 : Une supplémentation haute en calcium, phosphate et
calcitriol mène à un phénotype ostéocytaire dans les vaisseaux
calcifiés et à un défaut de minéralisation osseuse chez le rat insuffisant
rénal chronique.
Titre original: High calcium, phosphate and calcitriol supplementation leads to an osteocyte‑like phenotype
in calcified vessels and bone mineralisation defect in uremic rats
Auteurs: Sarah‑Kim Bisson1, Roth‑Visal Ung1, Sylvain Picard1, Danika Valade1, Mohsen Agharazii1, Richard
Larivière1, Fabrice Mac‑Way1
1 Axe Endocrinologie et Néphrologie, Centre de recherche de l’Hôtel-Dieu de Québec, CHU de Québec, Faculté et
Département de Médecine, Université Laval.
Statut de publication: Article publié dans le Journal of Bone and Mineral Metabolism le 30 mars 2018.
© The Japanese Society for Bone and Mineral Research and Springer Japan KK, part of Springer Nature 2018
Statut d’auteur: Auteur principal
Contribution: Obtention des résultats, analyses, écriture
Auteur de correspondance :
Fabrice Mac‑Way
fabrice.mac‑[email protected]
31
2.1 Résumé
Nous avons mesuré l’expression de marqueurs ostéocytaires dans un modèle d’IRC avec calcification vasculaire
chez le rat et nous avons regardé si l’expression de ces marqueurs était liée aux anomalies de la microarchitecture
et de la minéralisation osseuse. L’IRC a été induite par une néphrectomie 5/6 alors que la calcification a été
induite par une diète haute en calcium et phosphore et par un supplément de vitamine D (Ca/P/vitD). Le
groupe IRC+Ca/P/vitD (n=12) a été comparé à un groupe IRC+diète normale (n=12), un groupe
contrôle+diète normale (n=8) et un groupe contrôle+Ca/P/vitD (n=8). Les animaux IRC+Ca/P/vitD ont
développé calcification vasculaire, hypoparathyroïdie et une élévation sérique de sclérostine, Dkk1 et FGF23.
Sclérostine et Dkk1 étaient aussi surexprimés dans le vaisseau. Finalement, les animaux IRC+Ca/P/vitD
présentaient aussi un défaut de minéralisation qui pourrait être dû au supplément de calcitriol. D’autres études
devront être effectuées pour comprendre ce qui cause le défaut de minéralisation.
32
2.2 Abstract
A link between vascular calcification and bone anomalies has been suggested in chronic kidney disease (CKD)
patients with low bone turnover disease. We investigated the vascular expression of osteocyte markers in
relation to bone microarchitecture and mineralization defects in a model of low bone turnover CKD rats with
vascular calcification. CKD with vascular calcification was induced by 5/6 nephrectomy followed by high
calcium and phosphate diet, and vitamin D supplementation (Ca/P/VitD). CKD + Ca/P/VitD group (n = 12)
was compared to CKD + normal diet (n = 12), control + normal diet (n = 8) and control + Ca/P/VitD
supplementation (n = 8). At week 6, tibia, femurs and the thoracic aorta were analysed by Micro-Ct,
histomorphometry and for expression of osteocyte markers. High Ca/P/VitD treatment induced vascular
calcification only in CKD rats, suppressed serum parathyroid hormone levels and led to higher sclerostin,
DKK1 and FGF23 serum levels. Expression of sclerostin, DKK1 and DMP1 but not FGF23 were increased
in calcified vessels from CKD + Ca/P/VitD rats. Despite low parathyroid hormone levels, tibia bone cortical
thickness was significantly lower in CKD + Ca/P/VitD rats as compared to control rats fed a normal diet,
which is likely the result of radial growth impairment. Finally, Ca/P/VitD treatment in CKD rats induced a
bone mineralization defect, which is likely explained by the high calcitriol dose. In conclusion, Ca/P/VitD
supplementation in CKD rats induces expression of osteocyte markers in vessels and bone mineralisation
anomalies. Further studies should evaluate the mechanisms of high dose calcitriol-induced bone mineralisation
defects in CKD.
33
2.3 Article
2.3.1 Introduction
The anomalies of bone, mineral and vascular calcification characterize the chronic kidney disease-mineral and
bone disorder (CKD-MBD), and define the bone-vessels axis anomalies that typically affect CKD patients
[1, 2]. On one hand, vascular calcification is now recognized as a highly regulated process where there is a
trans-differentiation of vascular smooth muscle cells into osteoblast-like cells (bone forming cells) that mainly
occurs in CKD and diabetes population [3, 4]. On the other hand, bone disorders in CKD are characterized by
anomalies of bone mass, turnover and mineralisation that predispose to bone fragility [5, 6]. Both vascular and
bone anomalies contribute to the high burden of bone fractures, cardiovascular morbidity and mortality in the
CKD population [7–10].
In the last 15 years, treatment of high bone turnover (secondary hyperparathyroidism) with calcium and
calcitriol may have contributed to the over-suppression of parathyroid hormone (PTH) and the development
of low bone turnover disease in CKD patients [11]. Indeed, the prevalence of low bone turnover or adynamic
bone disease (ABD) has been steadily increasing with a prevalence range from 5 to 40% in pre-dialysis and
from 10 to 50% in dialysis patients [12, 13]. ABD has then been associated with development of vascular
calcification in CKD population [14, 15], but the pathophysiological mechanisms underlying this bone-vessels
axis anomalies remain unknown [12].
Recently, osteocytes, the most abundant cells in the bone, have emerged as important actors in CKD-MBD. In
addition to fibroblast growth factor 23 (FGF-23) and dentin matrix acidic phosphoprotein 1 (DMP1), new
osteocyte markers have been suggested to be involved in the development of CKD-MBD. These include
sclerostin and Dickkopf-related protein 1 (DKK1), which are highly expressed by the osteocytes and are known
inhibitors of bone formation through repression of the Wnt/β-catenin pathway. These proteins could play a
role in the development of ABD and vascular calcification in CKD [16–19], but how they could lead to the
development of CKD-MBD in the context of low bone turnover is currently unknown.
Using the same model of CKD rats with vascular calcification as we previously reported [20, 21], the objectives
of this study were: (1) to evaluate whether calcified vessels from CKD rats with low bone turnover disease
express osteocytes markers and proteins that could affect bone metabolism and (2) to determine the anomalies
of bone microarchitecture and mineralisation in relation to vascular calcification. We show that vascular
34
calcification is associated with increased expression of osteocyte markers and decreased Wnt activation in the
vessels. We also show that CKD animals with vascular calcification develop a bone mineralization defect, which
is likely explained by the high dose of calcitriol supplementation.
2.3.2 Material and methods
Animal experiments The animal protocol was conducted in accordance with the guidelines of the Canadian
Council of Protection of Animals and was approved by the local Animal Care Committee. Male Wistar rats
weighing 200–225 g were purchased from Charles River (Saint-Constant, Quebec, Canada) and were allowed
free access to standard rat chow and tap water in temperature and humidity control conditions with a 12-h
dark/light cycle. CKD was induced by renal mass reduction with 5/6 nephrectomy as previously performed
[20, 21]. Low bone turnover with low PTH and vascular calcification were induced by a high calcium (1.2%)
and phosphate (1.2%) diet (Harlan Teklab, Madison, WI, USA), combined with 1,25-dihydroxyvitamin D3
subcutaneous injections (0.5 μg/kg 3 times per week) (Ca/P/VitD). Four groups of animals were studied: (1)
control + normal chow (n = 8); (2) control + Ca/P/VitD (n = 8); (3) CKD + normal chow (n = 12) and; (4)
CKD + Ca/P/VitD (n = 12). The animals were sacrificed after 4–6 weeks according to the health status of
CKD + Ca/P/VitD rats. Before sacrifice, a 24-h urine sample was collected using individual metabolic cages.
In order to evaluate the bone dynamic parameters, intraperitoneal tetracycline injections were given to all rats
at two different periods (first dose at 50 mg/kg and second dose at 20 mg/kg), 5 days apart. The animals were
anesthetized with isoflurane, exsanguinated, and serum was collected and frozen for biochemical analyses. The
thoracic aorta, tibiae and femurs were harvested and fixed in buffered formalin for histological analysis or snap
frozen and kept at − 80 °C until extraction for qRT-PCR and western blot analysis.
Biochemical parameters and mineral metabolism Serum calcium, phosphorus, creatinine, urea, and urinary calcium,
phosphorus and creatinine concentrations were determined with an autoanalyzer system (Ilab 1800, Lexington,
MA, USA). Serum intact PTH and FGF23 (Immunotopics, San Clemente, CA, USA), total sclerostin (R&D
Systems, Minneapolis, MN, USA) and DKK1 levels (Enzo Life Sciences, Farmingdale, NY, USA) were
determined with ELISA kits according to the manufacturer’s protocol.
Quantification of vascular calcification with Von Kossa staining The thoracic aorta was fixed for 24 h, dehydrated and
embedded in paraffin as previously described [20, 21]. Five μm thick sections were deparaffinized and
rehydrated before staining for arterial calcification with 5% silver nitrate and light exposure, followed with 5%
sodium thiosulfate, and counterstained with nuclear fast red. Quantification was performed on three different
35
fields at magnification of 20× using the ImagePro-Plus analysis software (Media Cybernetics, Silver Spring,
MD, USA).
Immunofluorescence and qRT-PCR analysis of Wnt inhibitors and Wnt ligands in vessels and bone Immunofluorescence
analysis of the thoracic aorta was performed as previously reported [20]. Briefly, 5 μm thick sections of paraffin-
embedded aorta were deparaffinized and rehydrated. The heat-induced epitope retrieval method was used to
unmask the antigens and the tissues were incubated in blocking serum (10% fetal bovine serum in phosphate
buffered saline). The slides were incubated overnight with primary antibodies against DKK1 (Abcam,
Cambridge, MA, USA), FGF23 (Bioss, Woburn, MA, USA), DMP1 (LifeSpan Biosciences, Seattle, WA, USA)
or sclerostin (Biorbyt, Cambridge, UK). They were then washed in PBS before incubation with alexa fluor 594
anti-rabbit or anti-mouse secondary antibodies (Invitrogen, Waltham, MA, USA). Fluorescence images were
examined at 20× magnification and quantified using the ImagePro-Plus analysis software (Media Cybernetics,
Rockville, MD, USA). For qRT-PCR analysis, bone marrow was first flushed out from the femur by
centrifugation. Aortas and bones were then put in TRIzol reagent (Life Technologies, Waltham, MA, USA) and
crushed using a Precellys 24 homogenizer equipped with a Cryolys cooler (Bertin Technologies, Montigny-Le-
Bretonneux, France). qRT-PCR gene expression analysis was performed on a Stratagene Mx3005P (Agilent
Technologies, Santa Clara, CA, USA) qRT-PCR system using Perfecta SYBR Green SuperMix, low ROX
(Quanta Biosciences, Gaithersburg, MD, USA) with primers designed using NCBI Primer Blast algorithm
(blast.ncbi.nlm.nih.goc/Blast.cgi, Online resource 1). Gene of interest expression, relative to three reference
genes (B2m, Hprt1 and EEf1a1), was calculated based on the threshold cycle (Ct) using the Pfaffl formula [22].
Western blot analysis of Wnt pathway in vessels To better evaluate the components of the Wnt pathway, protein
expression of glycogen synthase kinase 3 (GSK-3β) and β-catenin were assessed in the thoracic aorta. The
thoracic aorta proteins were extracted using TRIzol (Life Technologies, Waltham, MA, USA) and were kept in
Laemmli Buffer 2× until SDS-PAGE analysis in Tris–Glycine Buffer. Primary antibodies against GSK-3β,
phopho-GSK-3β (ser9), β-catenin and phospho-β-catenin (ser33/37) (Cell Signaling technology, Danvers, MA,
USA) were used for immunodetection (LI-COR Biosciences, Lincoln, NE, USA). GAPDH (Novus Biologicals,
Littleton, CO, USA) was used as sample normalization protein. Differences in protein concentration were
quantified in Odyssey Imager (LI-COR Biosciences, Lincoln, NE, USA).
Assessment of bone cortical microarchitecture Tibiae bone of each rat were scanned in a Micro-CT scanner (eXplore
Locus, GE Healthcare Canada) at a resolution of 27 μm. Images analysis allowed the evaluation of cortical bone
36
parameters: cortical volume, area, bone mineral density, bone mineral content, thickness, inner and outer
perimeter using an automatic bone analysis software (eXplore MicroView from GE Healthcare, Canada).
Bone histomorphometry analysis The tibia bone specimens were fixed in 70% ethanol, dehydrated in acetone and
embedded in pure methyl methacrylate at low temperature as described by Chappard et al. [23]. Four non-serial
5 μm thick sections were cut on each tibia using a Microm-355S microtome (Rankin Biomedical Corporation,
MI, USA). The sections remained unstained or stained with modified Goldner’s trichrome for measurement of
dynamic and static parameters, respectively, using a semi-automated image analysis system (Bioquant Meg IV
System; R & M Biometrics, TE, USA) and a SummaSketch II (Summagraphics, Austin, TX, USA) digitizing
tablet in conjunction with an Olympus BX45 microscope (Olympus, Richmond Hill, ON, Canada) and Infinity
2-2C CCD color camera (Lumenera Corporation, Ottawa, ON, Canada). All results were derived from
two-dimensional primary measurements (tissue volume or area, bone volume or area and bone surface)
performed in the secondary spongiosa. In order to take into account the potential effect of age on bone
parameters, the primary spongiosa and the growth plate thickness were measured in all rats. All the
abbreviations used are as proposed by the ASBMR Histomorphometry Nomenclature Committee [24, 25].
Data analysis The results are expressed as means ± SEM. Values were compared using Kruskal–Wallis followed
by Mann-Whitney U tests using the SPSS program (SPSS, Chicago, IL, USA). Spearman’s rank correlation was
used to assess the association between vascular calcification and mRNA transcript levels, bone
microarchitecture and histomorphometry parameters. A value of p < 0.05 was considered statistically
significant.
2.3.3 Results
Kidney function and mineral metabolism Serum and urinary parameters are shown in Table 1. As expected, serum
creatinine and urea were higher whereas creatinine clearance was lower in CKD rats as compared to control
groups. Urinary phosphate was also increased in rats supplemented with Ca/P/VitD. This probably explains
why serum calcium and phosphate were comparable between groups except for the CKD + Ca/P/VitD group
in which creatinine clearance was further declined. As expected, PTH level was significantly diminished in both
control and CKD rats supplemented with Ca/P/VitD.
37
Vascular calcification develops only in CKD + Ca/P/VitD rats Extensive media vascular calcification assessed by
Von Kossa staining was detected only in CKD + Ca/P/VitD showing 5.79% of calcification in thoracic aorta’s
surface (Fig. 1). None of the other experimental groups developed vascular calcification in the thoracic aorta.
Increased vascular expression of sclerostin, DKK1 and DMP1, and serum levels of sclerostin, DKK1 and FGF23 in CKD +
Ca/P/VitD rats Immunofluorescence analysis from the thoracic aortas revealed that both sclerostin, DKK1
and DMP1 but not FGF23 expression were significantly increased in CKD + Ca/P/VitD rats as compared to
the other groups (Fig. 2). In agreement with their vascular expression, serum sclerostin and DKK1 levels were
also significantly elevated in CKD + Ca/P/VitD rats (Table 1).
Wnt signalling components in the vessel Analysis of the Wnt pathway components in the thoracic aorta indicated that
both total and phosphorylated β-catenin (ser33/37) were decreased in CKD rats given either normal or high
Ca/P/VitD supplementation as compared to control groups (Fig. 3). Phosphorylated GSK-3β (ser9), which is
inactive and cannot lead to β-catenin degradation, was decreased only in CKD supplemented with high
Ca/P/VitD. These results suggest that there is suppression of the Wnt pathway in the vessels in CKD animals
with vascular calcification. This is further supported by a decreased vascular transcription of AXIN2, which is
a Wnt target gene, in the group with vascular calcification (Online resource 2). Transcript levels of several Wnt
ligands (WNT3A, WNT5A, WNT10B, WNT11) and Fzd receptors (FZD1, FZD3, FZD7, FZD9) did not
show differences between groups (Online resource 2). However, the severity of vascular calcification negatively
correlated with expression of WNT5A (R − 0.680, p = 0.005) and Wnt receptor FZD7 (R − 0.622, p = 0.013).
Cortical bone parameters are abnormal in CKD and directly associated with vascular calcification in CKD + Ca/P/VitD rats
Cortical bone volume and area were significantly reduced in both CKD groups as compared to CTL or
CTL + Ca/P/ VitD (Fig. 4), while cortical bone thickness was significantly reduced only in CKD + Ca/P/VitD
rats as compared to the control groups. The reduced bone cortical thickness was also associated with lowered
inner and outer cortical perimeter. In CKD + Ca/P/VitD group, bone cortical thickness, inner perimeter and
cortical area were inversely correlated with vascular calcification (Online resource 3), which reinforces the
current understanding that bone alterations occur simultaneously with vascular disease in CKD.
CKD + Ca/P/VitD rats have a low bone turnover and a mineralisation defect In order to investigate the trabecular bone
anomalies, we performed static and dynamic histomorphometry analysis both in primary and secondary
38
spongiosa. Analysis of the secondary spongiosa showed that trabecular bone volume (BV/TV), thickness
(TbTh) and number (TbN) were significantly increased in CKD rats with Ca/P/VitD as compared to the other
groups (p < 0.05, Fig. 5). These changes in trabecular parameters were mainly associated with a significant
increase in osteoid volume (OV/BV) and thickness (Oth) (Fig. 5). Dynamic bone parameters performed on
trabecular bone revealed lower mineralisation surface, bone formation rate and mineral apposition rate in CKD
+ Ca/P/VitD rats, which confirms low bone turnover and mineralisation defect in this group (Table 2).
Osteoclast number (OcN/BV), which reflects bone resorption activity, was also suppressed in CKD +
Ca/P/VitD rats (Fig. 5). To better characterize the bone anomalies in our growing rats, further analysis revealed
significant accumulation of the trabecular primary spongiosa bone in CKD + Ca/P/VitD (0.958 ± 0.237 vs
0.123 ± 0.009 μm for CKD + normal diet) while the growth plate thickness was not different between groups
(0.233 ± 0.005 vs 0.228 ± 0.022 μm in CKD vs CKD + Ca/P/VitD, respectively).
Bone expression of FGF‑23 and DKK1, but not sclerostin and DMP1, is increased in CKD + Ca/P/VitD rats Bone
FGF23 mRNA levels were significantly higher in CKD + Ca/P/VitD as compared to control, while DKK1
expression was significantly higher in both CKD and CKD + Ca/P/VitD (Fig. 6). However, sclerostin and
DMP1 mRNA levels in bone were comparable between groups.
Wnt signalling components in the bone There were no differences in the bone transcription levels of Wnt ligands
(WNT3A, WNT5A, WNT10B, WNT11), Fzd receptors (FZD1, FZD3, FZD7, FZD9) and AXIN2 between
groups (Online resource 2). However, the degree of vascular calcification correlated with bone transcript levels
of all investigated Wnt activators, namely WNT3A (R 0.667, p = 0.042), WNT5A (R 0.789, p = 0.004), WNT10
(R 0.642, p = 0.033) and WNT11 (R = 0.642, p = 0.033), and also with FZD3 transcript levels (R 0.780, p =
0.005).
2.3.4 Discussion
In the present study, we have used our established model of CKD rats with vascular calcification [20, 21] in
order to study the expression of osteocyte markers and Wnt pathway proteins in the vessels as well as the
anomalies of bone microarchitecture and mineralization. We found that: (1) Ca/P/VitD supplementation in
CKD rats induced an osteocyte- like phenotype in the calcified vessels and changes in Wnt pathway activity;
(2) CKD rats treated with Ca/P/ VitD develop a mineralization defect, which may translate to higher bone
fragility.
39
Due to the high prevalence of low bone turnover disease in CKD patients, a major concern about its association
with vascular calcification has been raised [26]. In this study, despite lower PTH levels in control + Ca/P/VitD
rats, the low bone remodeling state was observed only in CKD + Ca/P/VitD animals, which means that there
is clearly a favorable environment in CKD that predisposes to low bone turnover. Sclerostin and DKK1, two
soluble proteins that are highly expressed by the osteocytes and known to inhibit bone formation could
contribute to the low bone turnover in CKD as their blood levels and vascular expression are increased only in
CKD + Ca/P/VitD animals [27–29]. In accordance with the higher vascular levels of sclerostin and DKK1,
the Wnt pathway appeared to be suppressed in the calcified vessels as phosphorylated GSK-3β (ser 9), which
is inactive, was decreased, and Wnt target gene AXIN2 was less transcribed. Further findings that support a
lowering of the Wnt activity in the calcified vessels are the negative correlations between vascular calcification
and transcription of Wnt5A and Fzd7, respectively a Wnt activator and a Wnt receptor. Since activation of the
Wnt pathway in the vessels has been shown to promote vascular calcification [30], sclerostin and DKK1
therefore seem to play a compensatory role to inhibit vascular calcification in CKD. It is worth mentioning that
both total and phosphorylated β-catenin were also decreased in calcified aorta from CKD + Ca/P/VitD
animals, which at first view may suggest an upregulation of the Wnt pathway. However, we measured
cytoplasmic β-catenin while measurement of the nuclear component would have been necessary to correctly
interpret levels of β-catenin.
Interestingly, vascular expression of FGF23 was not increased in the group with extensive vascular calcification
(CKD + Ca/P/VitD) despite a dramatically increased serum level. These findings suggest that FGF23 serum
levels in CKD mainly originate from the bone and not from vessels. In contrast with our findings in the vessels,
the bone tissue levels of sclerostin transcripts were not different as compared to control groups while DKK1
transcript levels were higher in CKD animals. These higher levels could be attributed to the high phosphate
diet or to the elevated FGF23 levels, both having been associated with increased DKK1 production [31, 32].
As expected, the bone transcription of FGF23 was increased significantly in CKD + Ca/P/VitD animals. The
positive correlation between vascular calcification and WNT3A, WNT5A, WNT10, WNT11 and FZD3 (five
proteins involved in β-catenin stabilisation during vascular calcification) transcription in bone suggests a
possible protective mechanism to avoid further bone deterioration by Wnt inhibitors in CKD. The fact that
bone transcription of Axin2 was not increased in CKD + Ca/P/VitD animals suggests however that these
changes may not be sufficient to increase Wnt/β-catenin activity.
40
In this study, cortical bone thickness, mineral content, and inner and outer perimeter were significantly
decreased in CKD + Ca/P/VitD rats, which is likely the result of the calcitriol supplementation. Indeed,
previous studies reported that treatment with calcitriol led to decreased cortical thickness and growth plate
defects in non-CKD rats [33], and to growth alteration and reduced cortical thickness in CKD rats [34, 35]. In
our study, bone turnover was actually low, suggesting that the cortical anomalies are likely due to defects in
radial growth and not increased remodeling. With regards to the trabecular compartment and regardless of the
effect of PTH, some studies have shown that calcium and/or calcitriol supplementation was associated with
higher trabecular bone volume in different models of CKD and non-CKD rats [33, 36]. A particularly
interesting observation in our study was the occurrence of bone mineralization defects in CKD + Ca/P/VitD
rats, likely induced by the high dose of calcitriol supplementation. Wronski et al. have previously treated rats
with daily calcitriol for 13 days and have found an accumulation of osteoid bone and prolongation of
mineralization lag time [37]. These findings were recently confirmed by Lieben et al. who showed that calcitriol
suppressed bone matrix mineralization by stimulating the transcription of genes encoding mineralisation
inhibitors [38]. Finally, in a 5/6 nephrectomy model supplemented with calcitriol but not calcium, De Schutter
et al. have also observed areas of impaired bone mineralization even though evident osteomalacia was not
described [39]. Therefore, the combination of low PTH, high serum calcium and high-dose calcitriol seems
deleterious to bone by inducing a mineralization defect despite lowering of bone turnover parameters. While
calcitriol is widely used for the treatment of CKD-MBD [40], the beneficial effects of lowering PTH levels with
calcitriol treatment on bone strength still remains to be proven [41, 42]. Future studies should therefore evaluate
the direct role of osteocyte markers in the development of bone mineralization defects in CKD [43, 44].
Our study has limitations. First, we tried to replicate human CKD-MBD where calcitriol and calcium are
frequently used in association. However, we recognize that the high dose of calcitriol used in our study as well
as the phosphate supplementation are usually not given to CKD patients. The deleterious effect of calcitriol on
bone mineralization is probably a matter of dose and further studies are necessary to better understand this.
Secondly, CKD rats treated with Ca/P/VitD had a lower creatinine clearance than CKD rats not treated with
Ca/P/VitD, which could have been related to the high phosphate diet. However, since the difference is only
minimal, we do not think it may have influenced the results of our study. Finally, calcitriol supplementation has
been previously reported to induce vascular calcification through upregulation of osteoblastic transcription
factors in CKD animals [45]. Hence, it is always possible that the described vascular phenotype in our study
has occurred independently of the bone turnover status when high dose calcitriol is given to induce vascular
calcification.
41
In conclusion, we used calcium, phosphate and calcitriol to induce vascular calcification and low bone turnover
in CKD rats to mimic CKD-MBD in humans. Our findings support the involvement of the Wnt pathway in
vascular calcification and strengthen the importance of conducting studies to evaluate the bone effects of
current treatments for CKD-MBD.
2.3.5 Acknowledgements
Dr. Mac-Way holds a scholarship from FRQ-S (Grant no. 32661) and KRESCENT program from the
CIHR-Kidney Foundation of Canada. This study was supported by a grant from the Kidney Foundation of
Canada (Grant no. KFOC160013) and from the Department of Medicine and la Fondation du CHU de Québec
from Université Laval. Dr. Agharazii holds a research chair in nephrology from Université Laval.
2.3.6 Author contributions
MA, RL and FMW conceived and designed the study. SKB and FMW performed the statistical analyses. SKB,
DV and RVU conducted animal experimentations, tissue specimens handling, and interpreted the findings. SP
and FMW were in charge of the bone histomorphometry analysis. SKB and FMW wrote the first draft and
revised all subsequent versions. All authors provided their input, expertise and critical review of the paper. All
authors read and approved the final version of the paper. FMW had full access to the data and takes
responsibility for the integrity and accuracy of the data analysis.
2.3.7 Conflict of interest
All authors have no conflicts of interest.
42
2.3.8 References
1. (2009) KDIGO clinical practice guideline for the diagnosis, evaluation, prevention, and treatment of chronic kidney disease-mineral and bone disorder (CKD-MBD). Kidney Int Suppl S1–S130
https ://doi.org/10.1038/ki.2009.188 2. Cozzolino M, Urena-Torres P, Vervloet MG, Brandenburg V, Bover J, Goldsmith D, Larsson TE,
Massy ZA, Mazzaferro S, ERA-EDTA C-MWGo (2014) Is chronic kidney disease-mineral bone disorder (CKD-MBD) really a syndrome? Nephrol Dial Transplant 29:1815–1820. https ://doi.org/10.1093/ndt/gft51 4
3. Shanahan CM, Cary NR, Salisbury JR, Proudfoot D, Weissberg PL, Edmonds ME (1999) Medial localization of mineralization regulating proteins in association with Monckeberg’s sclerosis: evidence for smooth muscle cell-mediated vascular calcification. Circulation 100:2168–2176
4. Goodman WG, London G, Amann K, Block GA, Giachelli C, Hruska KA, Ketteler M, Levin A, Massy Z, McCarron DA, Raggi P, Shanahan CM, Yorioka N, Vascular Calcification Work G (2004) Vascular calcification in chronic kidney disease. Am J Kidney Dis 43:572–579
5. Stehman-Breen C (2004) Osteoporosis and chronic kidney disease. Semin Nephrol 24:78–81 6. Nickolas TL, Stein E, Cohen A, Thomas V, Staron RB, McMahon DJ, Leonard MB, Shane E (2010)
Bone mass and microarchitecture in CKD patients with fracture. J Am Soc Nephrol 21:1371–1380. https ://doi.org/10.1681/ASN.2009121208
7. Foley RN, Parfrey PS, Sarnak MJ (1998) Epidemiology of cardiovascular disease in chronic renal disease. J Am Soc Nephrol 9:S16–S23
8. Watanabe R, Lemos MM, Carvalho AB, Rochitte CE, Santos RD, Draibe SA, Canziani ME (2012) The association between coronary artery calcification progression and loss of bone density in non-dialyzed CKD patients. Clin Nephrol 78:425–431. https ://doi.org/10.5414/CN107515
9. Toussaint ND, Lau KK, Strauss BJ, Polkinghorne KR, Kerr PG (2008) Associations between vascular calcification, arterial stiffness and bone mineral density in chronic kidney disease. Nephrol Dial Transplant 23:586–593. https ://doi.org/10.1093/ndt/gfm66 0
10. Hak AE, Pols HA, van Hemert AM, Hofman A, Witteman JC (2000) Progression of aortic calcification is associated with metacarpal bone loss during menopause: a population-based longitudinal study. Arterioscler Thromb Vasc Biol 20:1926–1931
11. Drueke TB, Massy ZA (2016) Changing bone patterns with progression of chronic kidney disease. Kidney Int 89:289–302. https ://doi.org/10.1016/j.kint.2015.12.004
12. Andress DL (2008) Adynamic bone in patients with chronic kidney disease. Kidney Int 73:1345–1354. https ://doi.org/10.1038/ ki.2008.60
13. Malluche HH, Monier-Faugere MC (1992) Risk of adynamic bone disease in dialyzed patients. Kidney Int Suppl 38:S62–S67
14. London GM, Marty C, Marchais SJ, Guerin AP, Metivier F, de Vernejoul MC (2004) Arterial calcifications and bone histomorphometry in end-stage renal disease. J Am Soc Nephrol 15:1943–1951
15. Frazao JM, Martins P (2009) Adynamic bone disease: clinical and therapeutic implications. Curr Opin Nephrol Hypertens 18:303– 307. https ://doi.org/10.1097/MNH.0b013e32832c4df 0
16. Pelletier S, Dubourg L, Carlier MC, Hadj-Aissa A, Fouque D (2013) The relation between renal function and serum sclerostin in adult patients with CKD. Clin J Am Soc Nephrol 8:819–823. https ://doi.org/10.2215/CJN.07670 712
17. Ferreira JC, Ferrari GO, Neves KR, Cavallari RT, Dominguez WV, Dos Reis LM, Graciolli FG, Oliveira EC, Liu S, Sabbagh Y, Jorgetti V, Schiavi S, Moyses RM (2013) Effects of dietary phosphate on adynamic bone disease in rats with chronic kidney disease—role of sclerostin? PLoS One 8:e79721. https ://doi. org/10.1371/journal.pone.0079721PON E-D-13-17719
18. de Oliveira RA, Barreto FC, Mendes M, dos Reis LM, Castro JH, Britto ZM, Marques ID, Carvalho AB, Moyses RM, Jorgetti V (2015) Peritoneal dialysis per se is a risk factor for sclerostin-associated adynamic bone disease. Kidney Int 87:1039–1045. https ://doi.org/10.1038/ki.2014.372
43
19. Bover J, Urena P, Brandenburg V, Goldsmith D, Ruiz C, DaSilva I, Bosch RJ (2014) Adynamic bone disease: from bone to vessels in chronic kidney disease. Semin Nephrol 34:626–640. https ://doi.org/10.1016/j.semne phrol.2014.09.008
20. Gauthier-Bastien A, Ung RV, Lariviere R, Mac-Way F, Lebel M, Agharazii M (2013) Vascular remodeling and media calcification increases arterial stiffness in chronic kidney disease. Clin Exp Hypertens. https ://doi.org/10.3109/10641963.2013.804541
21. Agharazii M, St-Louis R, Gautier-Bastien A, Ung RV, Mokas S, Lariviere R, Richard DE (2015) Inflammatory cytokines and reactive oxygen species as mediators of chronic kidney disease-related vascular calcification. Am J Hypertens 28:746–755. https ://doi.org/10.1093/ajh/hpu225
22. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45
23. Chappard D, Palle S, Alexandre C, Vico L, Riffat G (1987) Bone embedding in pure methyl methacrylate at low temperature preserves enzyme activities. Acta Histochem 81:183–190. https ://doi.org/10.1016/S0065-1281(87)80012-0
24. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR (1987) Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 2:595–610. https ://doi.org/10.1002/jbmr.5650020617
25. Dempster DW, Compston JE, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR, Parfitt AM (2013) Standardized nomenclature, symbols, and units for bone histomorphometry: a 2012 update of the report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res28:2–17. https ://doi.org/10.1002/jbmr.1805
26. Moe SM (2006) Vascular calcification and renal osteodystrophy relationship in chronic kidney disease. Eur J Clin Investig 36:51– 62. https ://doi.org/10.1111/j.1365-2362.2006.01665.x
27. Vervloet MG, Massy ZA, Brandenburg VM, Mazzaferro S, Cozzolino M, Urena-Torres P, Bover J, Goldsmith D, ERA-EDTA C-MWGo (2014) Bone: a new endocrine organ at the heart of chronic kidney disease and mineral and bone disorders. Lancet Diabetes Endocrinol 2:427–436. https ://doi.org/10.1016/S2213-8587(14)70059-2
28. Brandenburg VM, D’Haese P, Deck A, Mekahli D, Meijers B, Neven E, Evenepoel P (2015) From skeletal to cardiovascular disease in 12 steps—the evolution of sclerostin as a major player in CKD-MBD. Pediatr Nephrol. https ://doi.org/10.1007/s00467-015-3069-7
29. Burgers TA, Williams BO (2013) Regulation of Wnt/beta-catenin signaling within and from osteocytes. Bone 54:244–249. https ://doi.org/10.1016/j.bone.2013.02.022
30. Cai T, Sun D, Duan Y, Wen P, Dai C, Yang J, He W (2016) WNT/beta-catenin signaling promotes VSMCs to osteogenic transdifferentiation and calcification through directly modulatingRunx2 gene expression. Exp Cell Res 345:206–217. https ://doi.org/10.1016/j.yexcr.2016.06.007
31. Ferreira JC, Ferrari GO, Neves KR, Cavallari RT, Dominguez WV, dos Reis LM, Graciolli FG, Oliveira EC, Liu SG, Sabbagh Y, Jorgetti V, Schiavi S, Moyses RMA (2013) Effects of dietary phosphate on adynamic bone disease in rats with chronic kidney disease—role of sclerostin? PLoS One 8:7. https ://doi.org/10.1371/journ al.pone.0079721
32. Carrillo-Lopez N, Panizo S, Alonso-Montes C, Roman-Garcia P, Rodriguez I, Martinez-Salgado C, Dusso AS, Naves M, Cannata-Andia JB (2016) Direct inhibition of osteoblastic Wnt pathway by fibroblast growth factor 23 contributes to bone loss in chronic kidney disease. Kidney Int 90:77–89. https ://doi.org/10.1016/j.kint.2016.01.024
33. Idelevich A, Kerschnitzki M, Shahar R, Monsonego-Ornan E (2011) 1,25(OH)(2)D-3 alters growth plate maturation and bone architecture in young rats with normal renal function. PLoS One 6:14. https ://doi.org/10.1371/journal.pone.0020772
34. Hopper TAJ, Wehrli FW, Saha PK, Andre JB, Wright AC, Sanchez CP, Leonard MB (2007) Quantitative microcomputed tomography assessment of intratrabecular, intertrabecular, and cortical bone architecture in a rat model of severe renal osteodystrophy. J Comput Assist Tomogr 31:320–328. https ://doi.org/10.1097/01.rct.00002 38007.19258.3d
44
35. Parfitt AM (1997) The hyperparathyroidism of chronic renal failure: a disorder of growth. Kidney Int 52:3–9. https ://doi.org/10.1038/ki.1997.297
36. Diaz MN, Rodriguez AR, Martin JLF, Arias MS, Rodriguez PM, Cannata Andia JB (2007) Effects of estradiol, calcitriol and both treatments combined on bone histomorphometry in rats with chronic kidney disease and ovariectomy. Bone 41:614–619. https://doi.org/10.1016/j.bone.2007.06.026
37. Wronski TJ, Halloran BP, Bikle DD, Globus RK, Morey-Holton ER (1986) Chronic administration of 1,25-dihydroxyvitamin D3: increased bone but impaired mineralization. Endocrinology 119:2580–2585. https ://doi.org/10.1210/endo-119-6-2580
38. Lieben L, Masuyama R, Torrekens S, Van Looveren R, Schrooten J, Baatsen P, Lafage-Proust MH, Dresselaers T, Feng JQ, Bonewald LF, Meyer MB, Pike JW, Bouillon R, Carmeliet G (2012) Normocalcemia is maintained in mice under conditions of calcium malabsorption by vitamin D-induced inhibition of bone mineralization. J Clin Investig 122:1803–1815. https ://doi.org/10.1172/JCI45890
39. De Schutter TM, Behets GJ, Jung S, Neven E, D’Haese PC, Querfeld U (2012) Restoration of bone mineralization by cinacalcet is associated with a significant reduction in calcitriol-induced vascular calcification in uremic rats. Calcif Tissue Int 91:307–315. https ://doi.org/10.1007/s00223-012-9635-0
40. Wesseling-Perry K, Salusky IB (2013) Chronic kidney disease: mineral and bone disorder in children. Semin Nephrol 33:169–179. https ://doi.org/10.1016/j.semne phrol.2012.12.017
41. Newman CL, Tian N, Hammond MA, Wallace JM, Brown DM, Chen NX, Moe SM, Allen MR (2016) Calcitriol suppression of parathyroid hormone fails to improve skeletal properties in an animal model of chronic kidney disease. Am J Nephrol 43:20–31. https ://doi.org/10.1159/000444423
42. Fortier C, Mac-Way F, De Serres SA, Marquis K, Douville P, Desmeules S, Lariviere R, Agharazii M (2014) Active vitamin D and accelerated progression of aortic stiffness in hemodialysis patients: a longitudinal observational study. Am J Hypertens 27:1346–1354. https ://doi.org/10.1093/ajh/hpu057
43. Atkins GJ, Rowe PS, Lim HP, Welldon KJ, Ormsby R, Wijenayaka AR, Zelenchuk L, Evdokiou A, Findlay DM (2011) Sclerostin is a locally acting regulator of late-osteoblast/preosteocyte differentiation and regulates mineralization through a MEPE-ASARM-dependent mechanism. J Bone Miner Res 26:1425–1436. https ://doi.org/10.1002/jbmr.345
44. Shalhoub V, Ward SC, Sun B, Stevens J, Renshaw L, Hawkins N, Richards WG (2011) Fibroblast growth factor 23 (FGF23) and α-Klotho stimulate osteoblastic MC3T3.E1 cell proliferation and inhibit mineralization. Calcif Tissue Int 89:140–150. https ://doi.org/10.1007/s00223-011-9501-5
45. Jung S, Querfeld U, Muller D, Rudolph B, Peters H, Kramer S (2012) Submaximal suppression of parathyroid hormone ameliorates calcitriol-induced aortic calcification and remodeling and myocardial fibrosis in uremic rats. J Hypertens 30:2182–2191. https ://doi.org/10.1097/HJH.0b013e3283 57c049
45
2.3.9 Figure legends
Fig. 2.1 Vascular calcification in the thoracic aorta. Von Kossa staining showing extensive media
calcification of thoracic aorta only in CKD + Ca/P/VitD rats. a Representative image of vessels from control
groups and CKD rats fed with normal diet showing no aortic calcification; b CKD rats with Ca/P/VitD
supplementation showing extensive thoracic aorta calcification; c quantification of vascular calcification by Von
Kossa in the different groups. CKD chronic kidney disease, Ca/P/Vit D calcium, phosphorus and vitamin D
supplementation. A**, B**, C**, p < 0.001 vs CTL, CTL + Ca/P/VitD and CKD, respectively.
Fig. 2.2 Immunofluorescence analysis of osteocytes markers in the thoracic aorta. There is increased
expression of sclerostin (a4 and a5), DKK1 (c4 and c5) and DMP1 (e4 and e5) in the thoracic aortas of
CKD+Ca/P/VitD rats as compared to the other groups. FGF23 expression (b5) is higher but not statistically
significant. CKD: chronic kidney disease; CTL: control; Ca/P/VitD: calcium, phosphorus and vitamin D
supplementation. A, B, C, p < 0.05 vs CTL, CTL + Ca/P/VitD and CKD, respectively.
Fig. 2.3 Proteins expression of Wnt signalling pathway in thoracic aortas. Total and
Ser33/37-phosphorylated β-catenin (a–c), total and Ser9-phosphorylated GSK-3β (d–f). Both protein levels of
total and phosphorylated β-catenin are decreased in CKD and CKD + Ca/P/VitD while only the
phosphorylated GSK-3β is decreased in CKD + Ca/P/VitD animals. The decreased expression of
phosphorylated GSK-3β suggests that there is suppression of the Wnt pathway alongside the increase in Wnt
inhibitors in the calcified vessels. Each lane represents one rat and 4 images of blots each containing a maximum
of 14 lanes were analyzed to calculate fold change. CKD chronic kidney disease, CTL control, Ca/P/VitD
calcium, phosphorus and vitamin D supplementation. A, B, C, p < 0.05 vs CTL, CTL + Ca/P/VitD and CKD,
respectively.
Fig. 2.4 Cortical parameters of tibia bone in the different groups. Cortical microarchitecture is significantly
affected in chronic kidney disease rats with vascular calcification. CKD chronic kidney disease, CTL control,
Ca/P/VitD calcium, phosphorus and vitamin D supplementation. A, p < 0.05 vs. CTL; B, p < 0.05 vs.
CTL + Ca/P/VitD; C, p < 0.05 vs. CKD.
Fig. 2.5 Bone histomorphometry results and representative histological images of tibia bone.
Histomorphometry analysis showed significantly increased trabecular bone volume (a), thickness (b), number
(c), osteoid bone (d, e) and decreased osteoclasts number (f) in CKD + Ca/P/VitD rats. g, h CKD + Ca/P/VitD
rats showing increased trabecular and osteoid (arrows) bone in primary and secondary spongiosa typical of
mineralisation defect. i, j Control rats showing normal trabecular bone. Left panel: ×20 magnification; right
46
panel: ×40 magnification. CKD chronic kidney disease, CTL control, Ca/P/VitD calcium, phosphorus and
vitamin D supplementation, BV/TV bone volume/tissue volume, TbTh trabecular thickness, TbN trabecular
number, OV/BV osteoid volume/bone volume, OTh osteoid thickness, OcN/BV osteoclast number/bone
volume. A, p < 0.05 vs. CTL; B, p < 0.05 vs CTL + Ca/P/VitD; C, p < 0.05 vs CKD.
Fig. 2.6 mRNA expression of osteocytes markers in the femur. DKK1 transcription levels are significantly
increased only in the CKD and CKD + Ca/P/VitD (c), while FGF23 transcription levels are only increased in
the CKD + Ca/P/VitD group (b). Sclerostin and DMP1 gene expression appears to follow the same pattern
as DKK1 but there is no significant difference between groups (a, d). CKD chronic kidney disease, CTL control,
Ca/P/VitD calcium, phosphorus and vitamin D supplementation. A, C, p < 0.05 vs CTL and CKD,
respectively.
47
2.3.10 Figures
Fig. 2.1 Vascular calcification in the thoracic aorta
Fig. 2.2 Immunofluorescence analysis of osteocytes markers in the thoracic aorta
48
Fig. 2.3 Proteins expression of Wnt signalling pathway in thoracic aortas
Fig. 2.4 Cortical parameters of tibia bone in the different groups
49
Fig. 2.5 Bone histomorphometry results and representative histological images of tibia bone
50
Fig. 2.6 mRNA expression of osteocytes markers in the femur
51
2.3.11 Tables
Table 2.1 Biochemical parameters between groups
CTL
(n = 8)
CTL + Ca/P/vitD
(n = 8)
CKD
(n = 12)
CKD + Ca/P/vitD
(n = 12)
Serum urea (mmol/L) 7.2 ± 0.4 7.3 ± 0.3 14.8 ± 0.4a 14.2 ± 1.4a
Serum creatinine (μmol/L) 22.6 ± 1.2 18.6 ± 1.0 49.3 ± 2.6a 70.1 ± 3.9a,b
Creatinine clearance
(mL/min)
5.0 ± 0.6 5.9 ± 0.3 1.9 ± 0.1a 1.0 ± 0.1a,b
Serum phosphate
(mmol/L)
2.25 ± 0.15 1.99 ± 0.08 2.21 ± 0.06 2.74 ± 0.18a,b
Serum calcium (mmol/L) 2.44 ± 0.04 2.39 ± 0.02 2.45 ± 0.03 2.45 ± 0.09
Urinary calcium (mg/d) 0.027 ± 0.004 0.181 ± 0.074 0.068 ± 0.009 0.142 ± 0.033
Urinary phosphate (mg/d) 0.833 ± 0.081 3.547 ± 0.284c 0.878 ± 0.099a 2.200 ± 0.153a,b
Serum PTH (pg/mL) 312 ± 56 61 ± 6b,c 378 ± 43 13 ± 3b,c
Serum sclerostin (pg/mL) 294 ± 15 324 ± 37 363 ± 26 758 ± 58a,b
Serum DKK1 (pg/mL) 407 ± 227 406 ± 26 570 ± 48a,b 1281 ± 136a,b,c
Serum FGF-23 (pg/mL) 515 ± 156 1159 ± 267 789 ± 166 37397 ± 3198a,b,c
Values are expressed as mean ± SD
CKD chronic kidney disease, CTL control, Ca/P/VitD calcium, phosphorus and vitamin D supplementation, DKK1
Dickkopf-related protein 1, FGF-23 fibroblast growth factor-23, PTH parathormone.
a p < 0.05 vs. CTL and CTL + Ca/P/VitD
b p < 0.05 vs. CKD
c p < 0.05 vs. CTL
52
Table 2.2 Bone dynamic parameters between groups
CTL
(n = 8)
CTL +
Ca/P/vitD
(n = 8)
CKD
(n = 12)
CKD +
Ca/P/vitD
(n = 12)
MS/BS (%) 2.3 ± 1.2 7.5 ± 9.2 5.7 ± 1.5 1.3 ± 0.6
MAR (μm/day) 1.30 ± 0.21 1.40 ± 0.18 1.30 ± 0.44 0.63 ± 0.64
BFR-BS
(mm3/mm2/year)
0.03 ± 0.02 0.09 ± 0.11 0.08 ± 0.05 0.01 ± 0.01
MS/OS (%) 11.0 ± 8.4 3.4 ± 0.1 8.2 ± 8.3 0.3 ± 0.3
sL/BS (%) 1.7 ± 0.5 4.8 ± 5.3 6.0 ± 1.7 1.7 ± 0.6
dL/BS (%) 1.2 ± 1.0 5.0 ± 6.4 2.6 ± 2.5 0.2 ± 0.3
Values are expressed as mean ± SD
CKD: chronic kidney disease, CTL: control, Ca/P/VitD: calcium, phosphorus and vitamin D supplementation, BFR-BS:
bone formation rate-bone surface, dL/BS: double label surface/bone surface, MAR: mineralization apposition rate,
MS/BS: mineralization surface/bone surface, MS/OS: mineralization surface/osteoid surface, sL/BS: single label
surface/bone surface.
53
2.3.12 Supplementary materials
Table 2.3 Supplementary Table 1: Sequence of the primers used for qRT-PCR amplification
Gene Protein Primer sequence 5’-3’ (S/AS) NCBI reference Ta
(°C)
SOST Sclerostin GTACATGCAGCCTTCGTTGC
GTACTCGGACACGTCTTTGGT
NM_030584.1 55
DKK1 Dickkopf-related
protein 1
CCCTCTGACCACAGCCATTT
AGAGCCTTCTTGCCCTTTGG
NM_001106350.1 55
FGF23 FGF23 TGGATCGTATCACTTCAGCCC
GTAGCCGTTCTCTAGCGTCC
NM_130754.1 55
DMP1 DMP-1 AAACAGTGCCCAAGATACCC
TCCTACCCGATATTCCTCACT
NM_203493.1 55
Wnt3a Wnt3A CTCAAACGGAGACAGGTAAG
AGATAGAGCAGTACCTCTGG
NM_001107005.2 55
Wnt5a
Wnt5A CTACTGTTGTGCCTCTCTATTC
CCCTTGCTTTCTTCCCATAA
NM_022631.2 55
Wnt10B Wnt10B CGTGTGTAAGTGAAGGTGAG
ACCGAAATCCGAGCAAAG
NM_001108111.1 55
Wnt11 Wnt11 CTTTATTCCTCAGGGACATTCT
AGATATGGTATGGGCTGGT
NM_080401.1 55
Fzd1 Fzd1 GCGGACTGTAGAGGAAGTA
GGAAGAACCTGAAGGAATTGA
NM_021266.3 55
Fzd3 Fzd3 CAGGCACAGTAGTTCTCATC
CTGGTTCCATCCTCTTCAATAA
NM_153474.1 55
Fzd5 Fzd5 GCACAGCCACATTCACTAT
CCATGCCAAAGAAGTAGACTAA
NM_173838.1 55
Fzd7 Fzd7 GGATATTGCCTACAACCAGAC
GGTGCGTACATAGAGCATAAG
NM_001271185.1 55
Fzd9 Fzd9 CGGCACCAATACAGAGAAG
TGAGGCGTTCGTAAACATAG
NM_153305.1 55
Axin2 Axin2 GCCACCAAGACCTACATAAG
CAGAAGTCAAGAACACCTGATA
NM_024355.1 55
Hprt1a HPRT CAGTCCCAGCGTCGTGATTAG
ATCCAGCAGGTCAGCAAAGAA
NM_012583.2 55
Eef1a1 Eef1a1 AAGAAGCTGGAAGATGGCCC
ACTGTCTGCCTCATGTCACG
NM_175838.1 55
54
B2ma β2M TCGGTGACCGTGATCTTT
TATCTGAGGTGGGTGGAAC
NM_012512.2 55
Table 2.4 Supplementary Table 2: Aorta and bone mRNA transcript expression between groups
CTL CTL+Ca/P/vitD CKD CKD+Ca/P/vitD
Aorta mRNA
expression
(ratio)
Wnt3A 1.00 ± 0.53 0.40 ± 0.26 1.30 ± 0.71 0.94 ± 0.29
Wnt5A 1.00 ± 0.08 1.81 ± 0.40 1.20 ± 0.09 0.83 ± 0.11
Wnt10B 1.00 ± 0.24 1.76 ± 0.62 2.12 ± 0.60 1.58 ± 0.34
Wnt11 1.00 ± 0.36 1.57 ± 0.46 2.90 ± 1.44 0.68 ± 0.32
Fzd1 1.00 ± 0.19 1.93 ± 0.33 1.41 ± 0.27 1.57 ± 0.21
Fzd3 1.00 ± 0.29 3.65 ± 0.59 a 2.89 ± 0.80 2.02 ± 0.40
Fzd7 1.00 ± 0.25 2.01 ± 0.57 1.29 ± 0.19 1.46 ± 0.20
Fzd9 1.00 ± 0.37 1.81 ± 0.66 1.24 ± 0.24 0.74 ± 0.11
Axin2 1.00 ± 0.16 1.23 ± 0.38 1.25 ± 0.18 0.62 ± 0.07 a,b,c
Bone mRNA
expression
(ratio)
Wnt3A 1.00 ± 0.53 1.01 ± 0.50 1.56 ± 0.96 3.65 ± 1.11
Wnt5A 1.00 ± 0.25 1.72 ± 0.26 1.54 ± 0.39 2.27 ± 0.54
Wnt10B 1.00 ± 0.27 2.13 ± 1.14 1.40 ± 0.24 1.86 ± 0.36
Wnt11 1.00 ± 0.45 1.53 ± 0.93 2.02 ± 0.92 2.40 ± 0.95
Fzd1 1.00 ± 0.35 3.06 ± 0.98 4.15 ± 0.85 3.08 ± 0.66
Fzd3 1.00 ± 0.49 0.71 ± 0.25 1.34 ± 0.59 2.65 ± 0.83
Fzd7 1.00 ± 0.30 1.48 ± 0.38 1.81 ± 0.49 1.57 ± 0.25
Fzd9 1.00 ± 0.29 1.79 ± 0.68 2.35 ± 1.01 1.88 ± 0.63
Axin2 1.00 ± 0.62 1.20 ± 0.49 2.24 ± 0.89 2.08 ± 0.75
Values are expressed as mean ± SEM
CTL: Control; CKD: chronic kidney disease; Ca/P/vitD: calcium, phosphorus and vitamin D supplementation
Significant difference, a p < 0.05 vs CTL, b p < 0.05 vs CTL +Ca/P/vitD, c p < 0.05 vs CKD
55
Table 2.5 Supplementary Table 3. Correlations of cortical and trabecular bone parameters with
vascular calcification
BV/TV: Bone volume/Tissue volume; BMC: bone mineral content; BMD: bone mineral density; MS/BS: mineralized
surface/Bone surface; OV/TV: osteoid volume/Tissue volume; OV/BV: osteoid volume/Bone volume; OTh: osteoid
thickness; OS/BS: osteoid surface/Bone surface.
Bone parameters Correlation coefficient P
Cortical BV/TV -0.337 0.201
Cortical BMC -0.307 0.247
Cortical BMD -0.099 0.717
Mean cortical thickness -0.615* 0.011
Cortical inner perimeter -0.508* 0.045
Cortical outer perimeter 0.063 0.818
Cortical bone area -0.714** 0.002
Trabecular BV/TV 0.093 0.733
Trabecular Thickness 0.036 0.899
Trabecular Number -0.007 0.980
Trabecular Space -0.145 0.607
Trabecular MS/BS -0.600 0.400
Trabecular OV/TV -0.200 0.800
Trabecular OV/BV -0.800 0.200
Trabecular OTh -0.200 0.800
Trabecular OS/BS -0.200 0.800
56
Chapitre 3 : Analyses supplémentaires
De nombreux résultats de transcription de gènes et d’expression de protéines ont également été obtenus au
cours de ma maîtrise et des corrélations ont été observées entre les niveaux de transcrits pour certains gènes et
d’autres paramètres mesurés. Ces résultats pourraient constituer le point de départ pour de futures études
concernant la voie Wnt de l’os et du vaisseau en IRC, et plus particulièrement l’influence des inhibiteurs de la
voie Wnt sur le développement des pathologies osseuses et vasculaires. Les tests statistiques effectués dans
cette section sont soit le test de Kruskal-Wallis suivi d’un post-test de Dunn’s pour déterminer la présence de
différences entre les moyennes des groupes, soit un test de Spearman pour déterminer si une corrélation est
présente entre 2 variables. Ces tests visant à trouver de nouvelles pistes d’étude, aucune correction du seuil de
significativité n’a été faite pour tenir compte des comparaisons multiples. Cela réduit le risque d’erreur de type
2, c’est-à-dire passer à côté d’un résultat significatif, mais augmente les risques d’erreur de type I, c’est-à-dire de
rejeter l’hypothèse nulle alors qu’il n’y avait pas de différence ou de corrélation entre deux groupes. Il faut donc
voir ces résultats comme le point de départ pour d’autres études plus poussées et non comme une preuve
absolue. Je mettrai l’accent ici sur les résultats qui semblent plus prometteurs et sur leur intérêt pour de futur
études.
3.1 Transcription et expression de gènes
Table 3.1 Amorces utilisées pour le qRT-PCR
Gène Protéine Séquence de l’amorce 5’-3’ (S/AS) Référence NCBI Ta
(°C)
LRP4 Lrp4 CCCAAACCAGCCATGTATAA
CCCTCTACAATCTTGATCTTCTC
NM_031322.3 55
LRP5 Lrp5 CTGCTGTAGACTTCCAGTTCTC
TGGTTCAGGTAGGTCTGTTTG
NM_001106321.2 55
LRP6 Lrp6 GTGGTAGAGTTCGGCTTAGATTAC
GACACCTCAATGCGATTTGTT
NM_001107892.1 55
KL α-Klotho CGACGAGGACTCTTCTATGT
GGGAAGCCATTGTTCTCTATC
NM_031336.1 55
RUNX2 RunX2 GGACCGACACAGCCATATAAA
GCCTCATTCCCTAACCTGAAA
NM_001278483.1 55
57
BGLAP Ostéocalcine GGGCAGTAAGGTGGTGAATAG
TCCAAGTCCATTGTTGAGGTA
NM_013414.1 55
CTNNB1 β-caténine TATGCGGCTGCTGTTCTATT
TCTGTCCTGAAGAGGGAA
NM_053357.2 55
MEPE MEPE AGGATGCGGAAGAATCTAAAG
CATTACCAAGACTGTGAGAAGA
NM_024142.1 52
PHEX PHEX CTCTTCAGGTTTGGAGTCTATT
TGACTGTATGCCATCTTTGT
NM_013004.1 52
RANKL RANKL GAAGACACAGAAGCACTACC
CCACGAACCTTCCATCATAG
NM_057149.1 53
Tnfrsf11b OPG GCAGAGAGTGTAGAGAGGATAA
CAGAGGTCAATGTCTTGGATG
NM_012870.2 53
SFRP1 SFRP1 GTCCGAGTAGTTCTTCTTCTTC
AATGCTGCCTCTGGATTG
NM_001276712.1 60
SFRP2 SFRP2 CTCTTTGGTCAGTCTGTTGG
AGAGGGAGCCTTTGAGATAA
NM_001100700.1 60
SFRP3 SFRP3 GCTACACAGAAGACCTATTTCC
GTTTACCAGTGATGCCTTTAGA
NM_001100527.1 60
SFRP4 SFRP4 CGGAAGATGTGAAGTGGATAG
CAGGGCTCAGATGTTTACAG
NM_053544.1 60
3.1.1 Dans le sérum
RANKL
CTL
CTL+C
a/P/v
itD IRC
IRC+C
a/P/v
itD
0
20
40
60
80
100 a** a*
Co
ncen
trati
on
(p
g/m
l)
a* : p<0.05 par rapport à CTL; a** : p<0.005 par rapport à CTL.
58
Fig. 3.1 Niveaux sériques de RANKL Les niveaux de RANKL, un marqueur de remodelage osseux qui
stimule l’activité et la différenciation des ostéoclastes, sont élevés dans les groupes IRC et IRC+Ca/P/vitD.
Alors que le premier groupe présente des niveaux de PTH élevés qui peuvent expliquer cette surexpression de
RANKL, la PTH est plutôt supprimée dans le deuxième groupe et il faut donc chercher ailleurs la cause de
l’élévation de RANKL.
3.1.2 Dans l’os
Lrp4
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
c*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
LRP5
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4
5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
LRP6
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0
2.5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
Klotho
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
2
4
6
8
10
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
RunX2
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4
5a*
c*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
Ostéocalcine
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
-catenin
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0
2.5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
MEPE
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
PHEX
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
2
4
6
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
RANKL
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
OPG
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
20
40
60 a*
c*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
A B C D
E F G
H I J K
a* : p<0.05 par rapport à CTL; c* p<0.05 par rapport à IRC
Fig. 3.2 Transcription de gènes dans l’os: Cette figure regroupe les résultats de 11 analyses qPCR sur des
gènes impliqués dans la régulation du remodelage et du métabolisme osseux. A-Lrp4, qui amplifie l’action des
inhibiteurs de la voie Wnt, est moins exprimé en IRC si un supplément de Ca/P/vitD est donné. B-Lrp5, un
récepteur de la voie Wnt/β-caténine, ne semble pas être exprimé différemment entre les groupes. C-Lrp6,
l’autre récepteur pouvant permettre l’activation de la voie Wnt/β-caténine, ne semble pas non plus affecté par
59
les traitements. D- L’expression d’α-Klotho, le co-récepteur qui permet à FGF23 d’agir sur ses cellules-cibles,
ne semble pas altérée par l’IRC. E-RunX2, un marqueur de différenciation ostéoblastique, est augmenté par
L’IRC seule mais pas si un supplément de Ca/P/vitD est donné. F- L’ostéocalcine, un autre marqueur de
formation osseuse, n’est pas augmenté par l’IRC. G-La β-caténine, un marqueur d’activité Wnt/β-caténine,
n’est pas plus transcrite dans un groupe que dans les autres, ce qui ne renseigne toutefois pas sur son taux de
dégradation par le complexe de phosphorylation ou la quantité présente dans le cytosol. H, I- MEPE, une
protéine qui peut augmenter la production de FGF23 et inhiber la minéralisation dans certaines circonstances,
n’est pas affectée significativement par l’IRC, tout comme PHEX, la protéine qu’elle inhibe pour activer la
transcription de FGF23. J- La transcription de RANKL semble somme toute très basse dans les os de tous les
groupes. La moyenne des trois derniers groupes est augmentée par quelques individus ayant des niveaux plus
élevés mais la plupart ne présente aucune expression. Comme des résultats semblables ont été obtenus pour les
qPCR dans le vaisseau, cela pourrait indiquer une défectuosité au niveau d’une des amorces utilisées pour
l’amplification. K-Pour ce qui est d’OPG, on observe une augmentation marquée dans les os du groupe IRC,
ce qui est inattendu considérant qu’on s’attendait à ce que ces animaux aient de hauts niveaux de PTH et donc
un remodelage accéléré. De même, les niveaux d’OPG sont plus bas dans le groupe IRC+Ca/P/vitD malgré
la PTH supprimée.
60
3.1.3 Dans le vaisseau calcifié
Lrp4
CTL
CTL
+ C
a/P/vitD IR
C
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
LRP5
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4 a*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
LRP6
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0 a*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
Klotho
CTL
CTL
+ C
a/P/vitD IR
C
IRC+C
a/P/v
itD
0
1
2
3
4
c*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
RANKL
CTL
CTL
+ C
a/P/vitD IR
C
IRC+C
a/P/v
itD
0
1
2
3
4
5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
OPG
CTL
CTL
+ C
a/P/vitD IR
C
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0
2.5
b*b*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
RUNX2
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4 a*
a*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
Osteocalcine
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
4
5
a*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
MEPE
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0
1
2
3
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
PHEX
CTL
CTL
+Ca/P/v
itD IRC
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
2.0
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
A B C D
E F G H
I J
a* : p<0.05 par rapport à CTL; b* : p<0.05 par rapport à CTL+Ca/P/vitD, c* p<0.05 par rapport à IRC
Fig. 3.3 Transcription de gènes dans le vaisseau: Ces résultats de transcription de gènes impliqués dans le
remodelage osseux, obtenus à partir d’échantillons d’aortes, pourraient révéler des informations intéressantes
sur le lien os-vaisseau. A- La transcription de Lrp4 n’est pas changée par l’IRC ou la diète, suggérant que cette
protéine ne serait pas impliquée par une potentielle inhibition de la voie Wnt/β-caténine vasculaire. B- Lrp5,
l’un des récepteurs permettant l’activation de la voie Wnt/β-caténine, est plus transcrit dans l’aorte des animaux
IRC malgré le fait que ceux-ci ne présentent pas de calcification vasculaire. C- Lrp6, suit la même tendance, ses
niveaux d’ARNm étant plus élevés dans l’aorte du groupe IRC. D- La transcription d’α-Klotho, le co-récepteur
de FGF23, est plus haute dans l’aorte du groupe IRC+Ca/P/vitD que dans celle du groupe IRC. E- Tout
comme c’était le cas dans l’os, il n’y a pas de différences de transcription de RANKL dans le vaisseau calcifié
entre les groupes et la variabilité est assez grande à l’intérieur d’un même groupe. F- Par contre, la transcription
d’OPG est diminuée dans les deux groupes IRC par rapport au groupe CTL+Ca/P/vitD, mais pas par rapport
au CTL. G- La transcription de RunX2, un facteur de différenciation ostéoblastique exprimé lorsque la voie
Wnt/β-caténine est active, est augmentée dans les aortes des deux groupes IRC. H- La transcription de MEPE,
61
qui contribue à inhiber la minéralisation, n’est pas différente entre les groupes. I- Bien qu’il y ait une tendance
vers une réduction dans le groupe IRC+Ca/P/vitD, PHEX semble transcrit au même niveau dans tous les
groupes. J- L’ostéocalcine, normalement produite par les ostéoblastes, est plus transcrite seulement dans les
aortes du groupe IRC.
SFRP1
CTL
CTL +
Ca/
P/vitD IR
C
IRC+C
a/P/v
itD
0.0
0.5
1.0
1.5
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
SFRP2
CTL
CTL+C
a/P/v
itD IRC
IRC+C
a/P/v
itD
0
2
4
6
a*,c*
a*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
SFRP3
CTL
CTL +
Ca/
P/vitD IR
C
IRC+C
a/P/v
itD
0
1
2
3
a*
c*
Niv
eau
x d
'AR
Nm
rela
tifs
(ra
tio
)
SFRP4
CTL
CTL +
Ca/
P/vitD IR
C
IRC+C
a/P/v
itD
0
1
2
3
4N
iveau
x d
'AR
Nm
rela
tifs
(ra
tio
)
A B
C D
a* : p<0.05 par rapport à CTL; c* p<0.05 par rapport à IRC
Fig. 3.4 Transcription des SFRPs dans le vaisseau: Bien que nous ayons concentré notre attention sur la
sclérostine et Dkk1, d’autres inhibiteurs de la voie Wnt moins étudiés comme les SFRPs pourraient être
impliqués dans les anomalies vasculaires en IRC. A, D- Le niveau de transcription de SFRP1 et SFRP4 est le
même pour tous les groupes. B-SFRP2 est quant à lui plus transcrit dans les deux groupes IRC que dans le
groupe CTL. C- Finalement, SFRP3 est seulement plus transcrit dans le groupe IRC.
3.2 Corrélations
Une fois tous ces résultats supplémentaires obtenus, nous avons effectué dans le groupe IRC+Ca/P/vitD une
recherche de corrélations entre différents paramètres qui présentaient des liens entre eux dans la littérature. Les
corrélations qui sont présentées ici peuvent renforcer d’autres observations que nous avons faites ou servir de
62
point de départ pour de nouvelles pistes de réflexion mais comme elles ne tiennent compte que du groupe
IRC+Ca/P/vitD (n≤16), la prudence est de mise pour leur interprétation. Elles ne garantissent pas un lien
direct entre les deux paramètres corrélés et c’est pourquoi elles n’ont pour la plupart pas été incluses dans
l’article à l’exception de celles présentées à la table 3.4 et de celles entre le degré de calcification et la transcription
de protéines osseuses et vasculaires qui sont mentionnées dans l’article. Ces corrélations ont été obtenues dans
SPSS par une analyse de corrélation bivariée non-paramétrique (Spearman) avec un test de significativité
bilatéral.
3.2.1 Cause de l’excrétion accrue du phosphore
Plusieurs facteurs peuvent agir sur le rein pour augmenter l’excrétion du P en IRC : PTH, FGF23, et même
l’inhibiteur de la voie Wnt SFRP4 276. Pourtant, il n’existe aucune corrélation entre ces 3 paramètres et le P dans
le groupe IRC+Ca/P/vitD, qu’on regarde le P sanguin ou son excrétion fractionnelle :
Table 3.2 Corrélations entre P et protéines phosphaturiques
PTH
sérique
FGF23
sérique
ARNm FGF23
osseux
ARNm
SFRP4 os
P sanguin
Rho de
Spearman 0.039 0.485 -0.771 0.133
Significativité
(2-tailed) 0.889 0.057 0.072 -0.327
Excrétion
fractionnelle
du P
Rho de
Spearman 0.453 0.525 0.100 -0.327
Significativité
(2-tailed) 0.104 0.054 0.873 0.326
Il y a donc lieu de se demander si d’autres paramètres pourraient corréler avec les niveaux de phosphore ou
avec son excrétion fractionnelle. En recherchant des corrélations avec tous les paramètres mesurés, peu d’entre
elles ressortent du lot. La créatinine plasmatique est le principal paramètre associé avec le P sanguin (0.592,
63
sig. 0.016) et l’excrétion fractionnelle du P (0.692, sig. 0.006), indiquant que l’accumulation et l’excrétion accrue
du P dépend principalement de la fonction rénale.
3.2.2 Causes de l’élévation d’inhibiteurs de la voie Wnt
Table 3.3 : Corrélations entre sclérostine et Ca/P sériques
Calcium
sérique
Phosphore
sérique
FGF23
sérique
Sclérostine
sérique
Rho de
Spearman 0.626 0.335 0.776
Significativité
(2-tailed) 0.009 0.204 0.000
Les niveaux de sclérostine corrèlent avec ceux de calcium avec une significativité p<0.01 alors qu’il n’y a pas de
corrélation entre la sclérostine et le P. Ils corrèlent également avec les niveaux de FGF23
Table 3.4 Corrélations entre Dkk1 et ses activateurs potentiels
Phosphore
sérique
Calcium
sérique
FGF23
sérique
Dkk1
sérique
Rho de
Spearman 0.447 0.671 0.809
Significativité
(2-tailed) 0.083 0.004 0.000
Les niveaux de Dkk1 corrèlent fortement avec ceux de FGF23 (p<0.001). De plus, comme la sclérostine, Dkk1
corrèle avec le calcium (p <0.01) mais pas avec le phosphore.
64
Table 3.5 Corrélation entre sclérostine et PTH
PTH
sérique
Sclérostine
sérique
Rho de
Spearman -0.084
Significativité
(2-tailed) 0.766
Contrairement à ce qui est rapporté dans la littérature, nous n’observons pas de lien inverse entre la sclérostine
et la PTH, possiblement car la PTH est supprimée dans le groupe étudié.
Table 3.6 Corrélations entre la calcification et les inhibiteurs de la voie Wnt circulants
Sclérostine
sérique
Dkk1
sérique
Présence de
calcification
vasculaire
Rho de
Spearman 0.504 0.644
Significativité
(2-tailed) 0.046 0.007
La présence de calcification vasculaire corrèle positivement avec les niveaux de sclérostine (p<0.05) et de Dkk1
(p <0.01), ce qui pourrait suggérer que le vaisseau contribue aux niveaux élevés présents dans le sérum.
65
Table 3.7 Corrélation entre la sévérité de la calcification vasculaire et les inhibiteurs de la voie Wnt
Sclérostine
sérique
Dkk1
sérique
Marquage
Von Kossa
Rho de
Spearman 0.716 0.669
Significativité
(2-tailed) .002 0.005
La sclérostine et le Dkk1 sérique corrèlent positivement avec la sévérité de la calcification vasculaire. Il faudrait
faire des études approfondies pour déterminer si la production vasculaire accrue est responsable de ce lien ou
si c’est plutôt la production osseuse qui augmente à mesure que l’IRC et la calcification vasculaire progressent.
Table 3.8 Corrélations entre les protéines ostéocytaires en circulation et leur production vasculaire
Sclérostine
vasculaire
Dkk1
vasculaire
FGF23
vasculaire
ARNm
FGF23 os
Sclérostine
Sérique
Rho de Spearman .429
Significativité (2-tailed) .337
Dkk1
sérique
Rho de Spearman .379
Significativité (2-tailed) .164
FGF23
sérique
Rho de Spearman 0.657 0.943
Significativité (2-tailed) 0.011 0.005
Par contre, les niveaux sériques de sclérostine ne corrèlent pas avec leur expression dans le vaisseau, ce qui va
à l’encontre de l’hypothèse selon laquelle les vaisseaux calcifiés contribuent aux niveaux sériques de façon
66
significative. Par contre, FGF23 dans le sérum corrèle avec les niveaux dans le vaisseau (sig. <0.05), indiquant
que le vaisseau pourrait contribuer à augmenter les niveaux de FGF23 et donc augmenter ceux de Dkk1. L’os
semble toutefois être une source plus importante de FGF23, les niveaux de celui-ci dans le sérum corrélant avec
la transcription osseuse (sig. <0.01).
3.2.3 Corrélations entre la structure et la biochimie dans l’os
Table 3.9 Corrélation entre l’aire corticale et la transcription osseuse de Lrp4
ARNm Lrp4 os
Aire corticale
(micro-CT)
Rho de
Spearman -0.580
Significativité
(2-tailed) 0.048
Une transcription accrue de Lrp4 dans l’os est associée à une réduction de l’aire corticale déterminée par
tomodensitométrie du fémur, ce qui suggère que cette protéine pourrait contribuer à inhiber la voie
Wnt/β-caténine dans l’os et ainsi freiner la formation osseuse. Il n’y a pas de corrélations entre les autres
paramètres osseux et les résultats de qPCR dans l’os, possiblement en raison du nombre réduit d’individus ayant
eu leurs os à la fois scannés au micro-CT et analysés par qPCR (n=12 sur un total de 16).
67
Chapitre 4 : Discussion
Cette section constitue un approfondissement de la discussion de l’article présenté à la section 3. Elle tient
compte des résultats supplémentaires de la section 4 et met l’accent sur des hypothèses à explorer, des
différences avec la littérature et des questions qui demeurent sans réponse plutôt que sur les conclusions plus
définitives que nous tirons de nos résultats.
4.1 Cause de l’excrétion accrue du phosphore
Le modèle d’IRC avec calcification vasculaire induite par Ca/P/vitD est un modèle intéressant pour étudier le
lien entre l’os et le vaisseau calcifié en IRC mais il possède également des caractéristiques qui lui sont propres
qui font que les résultats obtenus ne sont pas toujours en accord avec ceux retrouvés dans la littérature. Par
exemple, comme avancé dans l’article, la forte dose de vitamine D donnée aux animaux pourraient induire un
défaut de minéralisation qui ne serait pas normalement présent chez les patients IRC. De plus, la forte
suppression de PTH induite chez les animaux rend plus difficile l’étude des effets de la PTH sur la calcification
vasculaire et la minéralisation osseuse. Cela explique certaines différences qu’on observe entre nos résultats et
ceux d’autres auteurs, comme le fait que le P ne corrèle pas avec FGF23 ou PTH dans notre étude alors que
celle de Moe et al. (2011) rapporte une corrélation positive entre le P et FGF23 136. Cela peut s’expliquer par le
fait que l’activation de la production de FGF23 par le P doit passer par la PTH, qui est supprimée par Ca et
vitD dans notre cas 13, 136. Ce sont d’ailleurs ces deux suppléments qui sont la cause la plus probable de l’élévation
de FGF23 et non pas le P. FGF23 pourrait tout de même contribuer à augmenter l’excrétion du P, mais il ne
semble pas y avoir de corrélation entre l’excrétion fractionnelle du P et les niveaux de FGF23.
Une autre piste que nous n’avons pas étudiée pour expliquer l’excrétion accrue du P dans le groupe
IRC+Ca/P/vitD est une élévation d’α-Klotho dans le rein induite par la vitamine D qui aurait pu augmenter
l’action phosphaturique de FGF23, tel que rapporté par Tsujikawa et al. (2003) 277. Bien que nous n’ayons pas
de mesures d’expression d’α-Klotho dans le rein, nous en avons pour les niveaux d’ARNm dans l’os. Il en
ressort que les animaux ayant reçu un supplément de vitD n’ont pas plus de α-Klotho dans leurs os, mais il
n’est pas possible d’affirmer qu’il en est de même pour le rein.
Le principal déterminant de l’excrétion du P semble être une diminution de la fonction rénale. La corrélation
entre les niveaux de P et la perte de fonction rénale s’explique par le fait que le P augmente à mesure qu’il est
moins éliminé par le rein, mais aussi par le fait que l’excès de P endommage le rein et contribue en lui-même à
68
la progression de l’IRC 117. Cet effet nocif du P pourrait aussi expliquer que la clairance de la créatinine soit plus
basse dans le groupe IRC+Ca/P/vitD que dans le groupe IRC malgré que tous deux aient subi la même
chirurgie rénale au départ.
4.2 Causes de l’élévation d’inhibiteurs de la voie Wnt
Dans le groupe IRC+Ca/P/vitD, une forte hausse des niveaux de sclérostine et de Dkk1 en circulation est
observée. Cela est en accord avec plusieurs autres articles rapportant une telle élévation en IRC 82, 140, 141, 159, et
en désaccord avec quelques autres qui ne rapportaient aucun lien entre Dkk1 et la perte de fonction rénale 148,
151. Plusieurs facteurs propres au groupe IRC+Ca/P/vitD pourraient expliquer ces observations. De plus, Dkk1
est aussi légèrement augmenté dans le groupe IRC, suggérant qu’un facteur présent dans les deux groupes IRC
mais davantage dans le groupe IRC+Ca/P/vitD régule son expression.
Un facteur présent dans les groupes IRC+Ca/P/vitD mais pas dans le groupe IRC est la forte dose de vitamine
D, ce qui pourrait faire d’elle un facteur influençant la production de sclérostine. Il a d’ailleurs été rapporté que
la vitamine D induit la production de sclérostine dans les ostéoblastes en culture et chez les patients IRC, mais
le fait qu’il n’y ait pas d’élévation de sclérostine dans le sérum du groupe CTL+Ca/P/vitD va contre l’hypothèse
selon laquelle la vitamine D contribuerait à l’élévation d’inhibiteurs de la voie Wnt en IRC dans notre modèle
76, 77.
Un autre facteur qui aurait pu activer la production de sclérostine est la forte suppression de PTH induite par
le Ca/vitD. En effet, la PTH est un inhibiteur de sclérostine et de Dkk1 et plusieurs études rapportent un lien
inverse entre la sclérostine et la PTH 16, 144, 146-149. Une partie de l’effet de la vitamine D sur la sclérostine pourrait
d’ailleurs passer par sa suppression de PTH 76. Sa suppression aurait donc pu déréguler la production de
sclérostine et de Dkk1 dans le groupe IRC+Ca/P/vitD, mais encore une fois, nous n’observons pas d’élévation
de sclérostine dans le groupe CTL+Ca/P/vitD malgré une suppression comparable de PTH. Nous n’observons
pas non plus la corrélation inverse entre la sclérostine et la PTH qui a souvent été rapportée, ce qui est tout de
même en accord avec une autre étude chez des patients IRC 151.
Un troisième facteur présent dans le groupe IRC+Ca/P/vitD et ayant pu stimuler la production d’inhibiteurs
de la voie Wnt est le supplément de phosphate qui, bien qu’aussi présent dans le groupe CTL+Ca/P/vitD, a
seulement mené à une élévation du P sérique chez les animaux néphrectomisés. Selon Ferreira et al. (2013), une
diète haute en phosphate peut induire une hausse des niveaux de sclérostine chez des animaux néphrectomisés
69
et parathyroïdectomisés, ce qui est très semblable à notre modèle d’IRC avec hypoparathyroïdie, sans compter
que plusieurs autres études rapportent un lien entre P et sclérostine en IRC 140, 142-145, 151. Nous n’observons
toutefois pas de corrélation entre le P et la sclérostine sériques dans le groupe IRC+Ca/P/vitD, et il en est de
même pour Dkk1.
Le Ca sérique, au contraire, corrèle positivement à la fois avec la sclérostine et le Dkk1 dans le groupe
IRC+Ca/P/vitD. Cela est inattendu puisque plusieurs études rapportent plutôt qu’il n’y a pas de lien entre la
sclérostine et le calcium 76, 140, 176, 278 et il en va de même pour Dkk1 146, 151. Une étude chez des patients IRC
rapporte toutefois un lien positif entre la sclérostine et le Ca comme celui que nous avons observé 146. Le Ca
n’est pas significativement plus élevé dans le sérum du groupe IRC+Ca/P/vitD ni plus éliminé dans l’urine,
mais il est tout de même possible que les niveaux soient périodiquement plus élevés et qu’ils stimulent la
production de sclérostine à ce moment.
Bien que le calcium corrèle positivement avec la sclérostine, il y a un autre paramètre qui corrèle plus fortement
avec la protéine : FGF23. Cette protéine, activée par le calcium et la vitamine D, pourrait expliquer le lien
apparent entre le calcium et les deux inhibiteurs de la voie Wnt que nous avons étudiés. En effet, la littérature
rapporte plusieurs corrélations positives entre FGF23 et la sclérostine ou Dkk1 143, 145, 148. L’activation directe
de la production de Dkk1 par FGF23 a même récemment été décrite et le mécanisme est relativement bien
compris 158. Ainsi, l’élévation de FGF23 est une piste intéressante pour expliquer la surproduction d’inhibiteurs
de la voie Wnt dans le groupe IRC+Ca/P/vitD. Le fait qu’il n’y ait pas d’élévation significative de FGF23 dans
le groupe CTL+Ca/P/vitD pourrait s’expliquer par le fait que ces animaux gèrent plus facilement leurs niveaux
de calcium. D’autres facteurs pourraient également contribuer à l’élévation de FGF23 en IRC, comme une
déficience en son co-récepteur α-Klotho, ou l’expression de FGF23 dans le vaisseau calcifié 279. Nous avons
d’ailleurs observé une corrélation non seulement entre les niveaux de FGF23 circulants et la transcription
osseuse de FGF23 mais aussi entre le FGF23 circulant et son expression dans le vaisseau calcifié.
Comme nous l’avons exposé dans l’article, les vaisseaux calcifiés peuvent produire la sclérostine et Dkk1, et
ainsi possiblement contribuer aux niveaux circulants de ces protéines tel que rapporté in vitro et in vivo 227, 231.
Supportant cette hypothèse, les animaux du groupe IRC+Ca/P/vitD qui ont développé de la calcification
vasculaire ont tendance à avoir de plus hauts niveaux de sclérostine et de Dkk1 dans leur sérum, ce qui est en
accord avec d’autres études 227-229. Comme de hauts niveaux de calcium encouragent le développement de
calcification vasculaire, ce mécanisme pourrait représenter une autre voie par laquelle le calcium augmenterait
indirectement l’expression de sclérostine et de Dkk1. Par contre, les niveaux circulants de sclérostine et de Dkk1
ne corrèlent pas avec leur expression dans le vaisseau dans le groupe IRC+Ca/P/vitD, contrairement à ce
qu’on observait pour FGF23.
70
4.3 Liens os-vaisseau
Malgré l’absence de corrélation entre les niveaux circulants et les niveaux d’expression vasculaire d’inhibiteurs
de la voie Wnt, une partie du lien os-vaisseau en IRC pourrait être expliquée par le fait que les vaisseaux calcifiés
produisent des inhibiteurs de la voie Wnt qui ralentissent la formation osseuse en inhibant la différenciation
ostéoblastique. Des niveaux plus élevés de β-caténine phosphorylée, indicateurs d’une inhibition de la voie
Wnt/β-caténine, ont d’ailleurs été mesurés dans des os de patients au dernier stade de l’IRC 152, ce qui ne cadre
pas avec certains de nos résultats. D’abord, tel que rapporté dans l’article présenté au chapitre 3, la sévérité de
la calcification vasculaire dans le groupe IRC+Ca/P/vitD corrélait avec la transcription osseuse de quelques
activateurs et récepteurs de la voie Wnt/β-caténine. Lrp4 était également moins transcrit que dans le groupe
IRC. Cela suggérerait une activation de la voie dans l’os, soit le contraire de ce que nous observons au niveau
histologique. Il se pourrait donc que les niveaux d’inhibiteurs de la voie Wnt soient assez élevés pour supplanter
les efforts de l’os pour activer la voie Wnt/β-caténine. Cette interprétation du lien os-vaisseau suggère qu’il n’y
a pas que la PTH qui soit impliquée dans le lien. En effet, nous avons observé dans notre modèle avec
hypoparathyroïdie un lien inverse entre la sévérité de la calcification et l’épaisseur corticale, ce qui est semblable
au lien inverse rapporté entre la calcification vasculaire et la masse osseuse par Roman-Garcia et al. dans leur
modèle d’hyperparathyroïdie 118.
4.4 Implication de la voie Wnt/β-caténine dans la calcification
vasculaire
L’activité de la voie Wnt/β-caténine dans le vaisseau calcifié a été abordée dans l’article, avec comme conclusion
que la voie semble inactivée car il y a moins de β-caténine et de phospho-GSK-3B (Ser9) et moins de
transcription d’AXIN2 en parallèle avec une augmentation des niveaux d’inhibiteurs de la voie Wnt. D’autres
résultats non présentés dans l’article supportent également ce point de vue. Par exemple, la transcription
aortique de α-Klotho semble plus élevée dans le groupe IRC+Ca/P/vitD que dans le groupe IRC. Bien que
cette protéine soit connue comme un co-récepteur de FGF23, elle joue plusieurs autres rôles et l’un d’entre eux
est d’inhiber la voie Wnt/β-caténine en se liant directement aux ligands Wnt à la manière des SFRPs 280. Si elle
joue aussi ce rôle dans les vaisseaux calcifiés, elle pourrait contribuer à inhiber la voie Wnt/β-caténine. Ensuite,
en comparant le groupe IRC au groupe IRC+Ca/P/vitD, on constate que la voie Wnt/β-caténine semble plus
active dans le premier groupe. Par exemple, la transcription des récepteurs Lrp5 et Lrp6 est augmentée dans les
vaisseaux du groupe IRC, ce qui pourrait indiquer que la perte de fonction rénale prédispose à l’activation de la
voie Wnt/β-caténine vasculaire mais que cette propension à calcifier disparaît une fois la calcification vasculaire
établie. On fait la même observation pour l’ARNm d’ostéocalcine, un gène-cible de la voie Wnt/β-caténine qui
71
est augmenté par L’IRC mais qui retombe à la normale dans le groupe IRC+Ca/P/vitD. Enfin, un autre
gène-cible de la voie Wnt/β-caténine, RunX2, voit sa transcription augmentée dans les deux groupes IRC.
Comme il s’agit d’un facteur de transcription ostéoblastique, cela supporte l’idée que l’IRC sensibilise le vaisseau
à la calcification par un mécanisme inconnu et qu’il suffit ensuite d’un signal comme une élévation du Ca ou du
P pour activer le processus d’ossification.
L’apparente inhibition de la voie Wnt/β-caténine dans les vaisseaux calcifiés pourrait être causée par les
inhibiteurs de la voie Wnt, plus présents dans la circulation et les vaisseaux du groupe IRC+Ca/P/vitD. La
présence de calcification vasculaire et sa sévérité sont d’ailleurs corrélées positivement avec les niveaux
d’inhibiteurs de la voie Wnt en circulation. Si la première observation est en accord avec beaucoup d’autres
sources 147, 225, 227-229, la seconde est en désaccord avec les articles de Wang et al. (2017) et Cai et al. (2016) qui
rapportaient plutôt une diminution de la sévérité de la calcification quand la sclérostine et Dkk1 étaient plus
élevée 211, 229. Les résultats que nous avons obtenus pourraient indiquer que les inhibiteurs de la voie Wnt sont
produits en réaction à la calcification vasculaire dans une tentative d’en freiner la progression, mais que cette
contre-régulation arrive trop tard pour avoir un effet autre qu’une simple inhibition de la voie Wnt/β-caténine
dans un vaisseau déjà sévèrement calcifié. Par contre, comme l’expression de la sclérostine et de Dkk1 dans le
vaisseau ne corrèle pas avec les niveaux en circulation, il n’est pas possible d’affirmer que c’est le vaisseau lui-
même qui produit les inhibiteurs de la voie Wnt pour retarder sa calcification. Il est plus probable que la
production d’inhibiteurs de la voie Wnt dans le vaisseau soit simplement due à la présence de cellules
ostéoblastiques et ostéocytaires produisant ces protéines de façon constitutive.
D’autres inhibiteurs de la voie Wnt qui n’ont pas été mentionnés dans l’article pourraient jouer un rôle dans
l’évolution de la calcification vasculaire, comme les SFRPs. Par exemple, Roman-Garcia et al. (2010)
rapportaient une élévation de la transcription de SFRP1 dans l’aorte de rats IRC supplémentés en P, ce qui
pourrait inhiber la formation osseuse ou la calcification vasculaire 118. Aucun de nos deux modèles d’IRC ne
présentait une telle élévation de SFRP1, mais nous avons observé une élévation de SFRP2 dans les deux groupes
IRC et une élévation de SFRP3 dans le groupe IRC sans diète seulement. L’absence d’élévation de la
transcription de SFRP3 dans le groupe IRC+Ca/P/vitD pourrait être liée au fait que ces animaux présentent
de la calcification vasculaire puisque Shalhoub et al. (2006) rapportent une expression diminuée de SFRP3 au
cours de la calcification de CMLV en culture 281. Si les SFRPs sont classifiés comme des inhibiteurs de la voie
Wnt de par leur capacité à se lier à la protéine Wnt, leurs fonctions semblent plus complexes et variées que
celles de la sclérostine. Par exemple, SFRP3 diminue la prolifération des pré-ostéoblastes in vitro mais
contrairement à ce qui serait attendu d’un inhibiteur de la voie Wnt, il en stimule la différenciation 282. SFRP2
et SFRP4 divergent encore plus de la sclérostine et de Dkk1 en activant la voie Wnt/β-caténine plutôt que de
72
l’inhiber 283. L’élévation de SFRP2 dans les deux groupes IRC pourrait donc contribuer à une activation de la
voie Wnt/β-caténine dans le vaisseau.
D’autres gènes que nous avons analysés ne présentaient pas de différences de transcription ou d’expression
entre les groupes, ce qui a permis d’écarter leur implication dans le processus de calcification vasculaire. Par
exemple, le récepteur Lrp4 n’est pas plus exprimé dans les vaisseaux du groupe IRC+Ca/P/vitD, indiquant
qu’il ne contribue probablement pas à l’inhibition de la voie Wnt/β-caténine que nous observons. Les niveaux
de RANKL et d’OPG ne sont pas non plus augmentés dans les groupes IRC par rapport aux contrôles,
suggérant que le vaisseau calcifié ne produit pas autant de régulateurs de résorption que l’os, dans lequel la
transcription d’OPG était augmentée dans le groupe IRC. Nous observons toutefois une augmentation de la
transcription d’OPG dans les vaisseaux du groupe CTL+Ca/P/vitD par rapport aux deux groupes IRC, ce qui
est étonnant puisqu’il n’y a vraisemblablement pas de cellules ostéoblastiques dans les vaisseaux de ces animaux
qui pourrait produire cette protéine. Les niveaux vasculaires D’ARNm de MEPE, une protéine activée par la
sclérostine 70 et qui nuit à la minéralisation, et ceux de PHEX, un inhibiteur de FGF23 lui-même inhibé par
MEPE, ne sont pas différents entre les groupes et ne jouent donc probablement pas un rôle dans l’évolution
de la calcification ou la production vasculaire de FGF23. Par ailleurs, bien que le marquage de FGF23 n’ait pas
été plus élevé dans le groupe IRC+Ca/P/vitD que dans le CTL, l’intensité de l’expression corrélait avec les
niveaux en circulation dans le groupe IRC+Ca/P/vitD. Ainsi, bien que nous concluions dans l’article que le
vaisseau calcifié n’est pas une source importante de FGF23 par rapport à l’os, il pourrait néanmoins apporter
une contribution.
4.5 Causes du défaut de minéralisation
Les résultats présentés dans l’article montrent un ralentissement du remodelage dans le groupe
IRC+Ca/P/vitD, ce qui se traduit par un ralentissement de la formation, de la minéralisation et de la résorption.
D’autres résultats non inclus dans l’article pourraient éclaircir la cause de ces anomalies. L’article présenté au
chapitre 3 décrit une anomalie de la minéralisation osseuse présente seulement dans le groupe IRC+Ca/P/vitD
et avance que ce défaut pourrait être causé par la forte dose de vitamine D injectée aux animaux combinée avec
le remodelage ralenti. La vitamine D pourrait ralentir la minéralisation en stimulant la production
d’ostéopontine et de pyrophosphate, deux composés qui nuisent à la minéralisation 284. Il s’agit d’une explication
probable, mais d’autres facteurs présents seulement dans le groupe IRC pourraient expliquer le défaut de
minéralisation, comme le FGF23 et la sclérostine présents en abondance dans la circulation.
73
Malgré qu’elle soit principalement connue comme un inhibiteur de formation osseuse, la sclérostine nuit
également à la minéralisation 82. En effet, des cellules ostéoblastiques en culture cessent de minéraliser la matrice
qui les entoure en présence de sclérostine, et ce même si des signaux comme Wnt3A et BMP2 sont aussi
présents 285. Il semblerait que la voie Wnt/β-caténine ne régule pas seulement la formation osseuse mais aussi
la minéralisation, ce qui permettrait à la sclérostine d’inhiber directement la minéralisation en se liant à Lrp5/6
33. D’ailleurs, l’inhibition de la voie Wnt/β-caténine par Dkk1 chez la souris mène aussi à une inhibition de la
minéralisation 286. Il se pourrait donc que la sclérostine et Dkk1 contribuent à l’accumulation d’ostéoïde
observée dans le groupe IRC+Ca/P/vitD. Il est aussi possible que la sclérostine inhibe la minéralisation en
activant la transcription de la protéine MEPE, qui peut être clivée en une forme comportant un motif
défavorable à la minéralisation (MEPE-ASARM), et en supprimant la transcription de PHEX, l’inhibiteur de la
conversion de MEPE en MEPE-ASARM 70. La transcription de MEPE et de PHEX dans l’os ne semble
cependant pas affectée par les niveaux plus élevés de sclérostine dans la circulation du groupe IRC+Ca/P/vitD,
laissant supposer que ce n’est pas par ce mécanisme que la sclérostine inhibe la minéralisation dans ce modèle
si effectivement elle l’inhibe.
FGF23 a aussi été associé à l’inhibition minéralisation in vitro dans la littérature 38, 39. Cette inhibition passe par
un mécanisme encore mal compris, mais il semblerait qu’elle ne soit pas due simplement à la déficience en P
qui est souvent observée quand FGF23 est surexprimé 36. Elle semble être due à un effet direct de FGF23 sur
les ostéoblastes puisque la délétion de son récepteur FGFR1 rétablit la minéralisation 38. Ainsi, comme plusieurs
facteurs présents dans le groupe IRC+Ca/P/vitD pourraient expliquer le défaut de minéralisation, il sera
nécessaire d’éclaircir les liens entre l’architecture osseuse et ces facteurs dans de futures études.
4.6 Causes de la formation osseuse ralentie
Le défaut de formation dans le groupe IRC+Ca/P/vitD pourrait être dû aux inhibiteurs de la voie Wnt présents
en grande quantité dans la circulation, mais il ne semble pas y avoir de corrélation entre les paramètres osseux
et les niveaux de sclérostine et de Dkk1. Il pourrait aussi être dû aux niveaux très bas de PTH, ce dernier
stimulant normalement la formation osseuse, mais on n’observe encore une fois aucun lien entre les niveaux
de PTH et l’architecture osseuse. Il n’y a pas non plus de différences d’expression au niveau des activateurs et
des récepteurs Wnt, de β-caténine ou des gènes cibles ostéocalcine et Axin2. Par contre, l’expression de
quelques marqueurs liés à la voie Wnt/β-caténine semble affectée par la diète donnée aux rats IRC.
En comparant les groupes IRC et IRC+Ca/P/vitD, on constate que la transcription de Lrp4 dans l’os est
diminuée par la diète calcifiante. Comme cette protéine a normalement pour rôle d’amplifier l’effet de la
74
sclérostine et de Dkk1, on pourrait y voir une tentative infructueuse de rétablir un taux de formation osseuse
normale face à la surexpression d’inhibiteurs de la voie Wnt. Par contre, si on regarde seulement le groupe
IRC+Ca/P/vitD, on observe une corrélation négative entre Lrp4 et l’aire corticale, suggérant qu’une plus
grande expression de Lrp4 mène à une perte de surface osseuse en supprimant la formation d’os cortical. La
transcription de RunX2, un gène-cible de Wnt impliqué dans la formation osseuse, est quant à elle diminuée
dans le groupe IRC+Ca/P/vitD par rapport au groupe IRC. Cette inhibition cadre avec une inhibition de la
voie Wnt/β-caténine par sclérostine et Dkk1, ou avec une formation osseuse diminuée en raison des bas
niveaux de PTH. En l’absence de lien clair entre les inhibiteurs de la voie Wnt et l’architecture osseuse, la cause
de la formation osseuse ralentie demeure incertaine.
4.7 Cause du défaut de résorption
Si les niveaux bas de PTH peuvent sembler une explication simple au ralentissement de la résorption osseuse,
les niveaux mesurés de RANKL et d’OPG ne correspondent pas à ce qui serait attendu. En effet, les niveaux
de RANKL en circulation sont pareillement élevés dans les deux groupes IRC indépendamment de leurs
niveaux de PTH. Si c’est probablement l’hyperparathyroïdie qui a fait augmenter la production de RANKL
dans le groupe IRC, c’est peut-être la vitamine D qui en augmenté la production dans le groupe
IRC+Ca/P/vitD en se liant au VDR ostéoblastique 3. Cependant, si RANKL était augmenté par la vitamine
D, son expression devrait être augmentée également dans le groupe CTL+Ca/P/vitD, ce qui n’est pas le cas
ici. Quoi qu’il en soit, l’élévation de RANKL dans le sérum du groupe IRC+Ca/P/vitD ne semble pas
permettre d’accélérer le remodelage. Les niveaux de transcription de RANKL dans l’os ont aussi été évalués
par qPCR mais les résultats sont peu concluants puisque plusieurs individus dans chaque groupe ne semblaient
pas l’exprimer du tout. Cela pourrait être dû à une erreur lors de la conception de l’amorce.
La diminution de l’activité ostéoclastique pourrait aussi être causée par une surexpression d’OPG qui
neutraliserait RANKL, mais il semblerait que la transcription d’OPG soit plus basse dans les os du groupe
IRC+Ca/P/vitD que dans le groupe IRC. On observe ainsi dans le groupe IRC+Ca/P/vitD un ratio
RANKL/OPG inverse à ce qui devrait être observé en présence de bas niveaux de PTH. Si la diminution
d’OPG n’est pas liée aux niveaux de PTH dans le groupe IRC+Ca/P/vitD, elle pourrait résulter d’une
inhibition de la voie Wnt/β-caténine osseuse, dont l’activation fait normalement augmenter les niveaux d’OPG
68, 85, 86. Cela cadrerait avec les autres résultats pointant vers une inhibition de la voie Wnt/β-caténine dans les
os du groupe IRC+Ca/P/vitD. Par contre, le supplément de vitamine D pourrait encore une fois être impliqué
puisqu’il supprime la production d’OPG en plus d’activer celle de RANKL 46, 47, 51.
75
Conclusion
Cette étude a permis non seulement de confirmer quelques hypothèses quant au modèle d’IRC utilisé par notre
laboratoire, mais également de soulever d’autres questionnements pour des études futures. Les animaux du
groupe IRC+Ca/P/vitD ont développé de la calcification vasculaire tel que prévu et ont également vu leur
PTH supprimée, ce qui a contribué au ralentissement de la formation et de la résorption dans les os de ce
groupe. La sclérostine et Dkk1, élevés en circulation, ont aussi pu contribuer à freiner la formation osseuse. Les
os présentaient également un défaut de minéralisation, une observation inattendue qui pourrait être le résultat
d’une trop haute dose de vitamine D, d’une inhibition de la voie Wnt/β-caténine osseuse par sclérostine et
Dkk1 ou encore d’une inhibition directe de la minéralisation par FGF23. L’observation de protéines
ostéocytaires comme la sclérostine et Dkk1 dans le vaisseau calcifié, qui confirme l’hypothèse selon laquelle les
cellules ostéoblastiques du vaisseau acquerraient un phénotype ostéocytaire, pourrait aussi indiquer que le
vaisseau produit des molécules influençant l’os. Cette idée est supportée par les corrélations négatives observées
entre la calcification vasculaire et quelques paramètres osseux et le fait que les animaux du groupe IRC
présentent des signes d’inhibition de la voie Wnt/β-caténine dans l’os, mais il n’y a au final pas de preuve
concrète que ce sont les inhibiteurs de la voie Wnt produits dans le vaisseau qui en sont responsables. De même,
malgré une apparente inhibition de la voie Wnt/β-caténine dans le vaisseau calcifié, nous n’avons pu démontrer
que ce sont des molécules osseuses comme la sclérostine ou Dkk1 qui en sont responsables, ni que cette
inhibition se traduit par un ralentissement de la calcification. Enfin, la cause première de l’élévation des
inhibiteurs de la voie Wnt en IRC n’est toujours pas établie, mais FGF23, le calcium et la vitamine D semblent
être de bons candidats et pourraient donc être éventuellement ciblés pour éviter la perte osseuse.
Dans de futures études, il sera intéressant d’approfondir l’implication de la vitamine D dans les anomalies
osseuses de notre modèle en administrant aux animaux différentes doses de vitamine D. Des résultats
préliminaires de nos plus récentes études suggèrent d’ailleurs qu’une dose plus faible permet de minimiser les
effets négatifs de l’IRC sur l’os observés dans notre modèle. Un autre point qui pourrait être approfondi dans
une étude future serait la description des anomalies osseuses. Nous avons récemment obtenu des images
détaillées de nos os à l’aide du Synchrotron du Canadian Light Source, ce qui nous a permis d’obtenir des
informations plus complètes sur les lacunes ostéocytaires qui pourront faire l’objet d’un futur article. À plus
long terme, il pourrait être intéressant de manipuler directement l’activité de la voie Wnt/β-caténine par des
modifications génétiques ou des anticorps ciblant une composante particulière afin de mieux comprendre le
rôle qu’elle joue dans les anomalies osseuses et vasculaires de l’IRC.
76
Bibliographie
1. Kim CS, Kim SW. Vitamin D and chronic kidney disease. Korean Journal of Internal Medicine 2014; 29:
416-427. 2. DeLuca HF. Overview of general physiologic features and functions of vitamin D. American Journal of
Clinical Nutrition 2004; 80: 1689S-1696S. 3. Dusso AS, Brown AJ, Slatopolsky E. Vitamin D. American Journal of Physiology-Renal Physiology 2005;
289: F8-F28. 4. Llach F, Forero FV. Secondary hyperparathyroidism in chronic renal failure: Pathogenic and clinical
aspects. American Journal of Kidney Diseases 2001; 38: S20-S33. 5. Zierold C, Reinholz GG, Mings JA, et al. Regulation of the porcine 1,25-dihydroxyvitamin D-3-24-
hydroxylase (CYP24) by 1,25-dihydroxyvitamin D-3 and parathyroid hormone in AOK-B50 cells. Archives of Biochemistry and Biophysics 2000; 381: 323-327.
6. Lambers TT, Bindels RJM, Hoenderop JGJ. Coordinated control of renal Ca2+ handling. Kidney
International 2006; 69: 650-654. 7. Weinman EJ, Lederer ED. PTH-mediated inhibition of the renal transport of phosphate.
Experimental Cell Research 2012; 318: 1027-1032. 8. Martin A, David V, Quarles LD. REGULATION AND FUNCTION OF THE FGF23/KLOTHO
ENDOCRINE PATHWAYS. Physiological Reviews 2012; 92: 131-155. 9. Perwad F, Zhang MYH, Tenenhouse HS, et al. Fibroblast growth factor 23 impairs phosphorus and
vitamin D metabolism in vivo and suppresses 25-hydroxyvitamin D-1 alpha-hydroxylase expression in vitro. American Journal of Physiology-Renal Physiology 2007; 293: F1577-F1583.
10. Ben-Dov IZ, Galitzer H, Lavi-Moshayoff V, et al. The parathyroid is a target organ for FGF23 in
rats. Journal of Clinical Investigation 2007; 117: 4003-4008. 11. Krajisnik T, Bjorklund P, Marsel R, et al. Fibroblast growth factor-23 regulates parathyroid hormone
and 1 alpha-hydroxylase expression in cultured bovine parathyroid cells. Journal of Endocrinology 2007; 195: 125-131.
12. Liu SG, Tang W, Zhou JP, et al. Fibroblast growth factor 23 is a counter-regulatory phosphaturic
hormone for vitamin D. Journal of the American Society of Nephrology 2006; 17: 1305-1315. 13. Silver J, Naveh-Many T. FGF-23 and secondary hyperparathyroidism in chronic kidney disease.
Nature Reviews Nephrology 2013; 9: 641-649. 14. Ito M, Sakai Y, Furumoto M, et al. Vitamin D and phosphate regulate fibroblast growth factor-23 in
K-562 cells. American Journal of Physiology-Endocrinology and Metabolism 2005; 288: E1101-E1109. 15. Saito H, Maeda A, Ohtomo S, et al. Circulating FGF-23 is regulated by 1 alpha,25-dihydroxyvitamin
D-3 and phosphorus in vivo. Journal of Biological Chemistry 2005; 280: 2543-2549.
77
16. Lavi-Moshayoff V, Wasserman G, Meir T, et al. PTH increases FGF23 gene expression and mediates the high-FGF23 levels of experimental kidney failure: a bone parathyroid feedback loop. American Journal of Physiology-Renal Physiology 2010; 299: F882-F889.
17. Shimada T, Yamazaki Y, Takahashi M, et al. Vitamin D receptor-independent FGF23 actions in
regulating phosphate and vitamin D metabolism. American Journal of Physiology-Renal Physiology 2005; 289: F1088-F1095.
18. Wesseling-Perry K, Wang HJ, Elashoff R, et al. Lack of FGF23 Response to Acute Changes in Serum
Calcium and PTH in Humans. Journal of Clinical Endocrinology & Metabolism 2014; 99: E1951-E1956. 19. Ersoy FF. A short story of Klotho and FGF23: a deuce of dark side or the savior? International Urology
and Nephrology 2014; 46: 577-581. 20. Hu MC, Shi MJ, Zhang JN, et al. Klotho: a novel phosphaturic substance acting as an autocrine
enzyme in the renal proximal tubule. Faseb Journal 2010; 24: 3438-3450. 21. Bian A, Xing C, Hu MC. Alpha Klotho and phosphate homeostasis. Journal of Endocrinological
Investigation 2014; 37: 1121-1126. 22. Kuro-o M, Moe OW. FGF23-alpha Klotho as a paradigm for a kidney-bone network. Bone 2017; 100:
4-18. 23. Razzaque MS. FGF23, KLOTHO AND VITAMIN D INTERACTIONS: What Have We Learned
from In Vivo Mouse Genetics Studies? In: KuroO M (ed). Endocrine Fgfs and Klothos, vol. 728. Springer-Verlag Berlin: Berlin, 2012, pp 84-91.
24. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature 2003; 423: 337-
342. 25. Boyce BF, Xing LP. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Archives
of Biochemistry and Biophysics 2008; 473: 139-146. 26. Huang JC, Sakata T, Pfleger LL, et al. PTH differentially regulates expression of RANKL and OPG.
Journal of Bone and Mineral Research 2004; 19: 235-244. 27. Bellido T, Saini V, Pajevic PD. Effects of PTH on osteocyte function. Bone 2013; 54: 250-257. 28. Amling M, Priemel M, Holzmann T, et al. Rescue of the skeletal phenotype of vitamin D receptor-
ablated mice in the setting of normal mineral ion homeostasis: Formal histomorphometric and biomechanical analyses. Endocrinology 1999; 140: 4982-4987.
29. Eisman JA, Bouillon R. Vitamin D: direct effects of vitamin D metabolites on bone: lessons from
genetically modified mice. BoneKEy Rep 2014; 3: 499. 30. Kaneuji T, Ariyoshi W, Okinaga T, et al. Mechanisms involved in regulation of osteoclastic
differentiation by mechanical stress-loaded osteoblasts. Biochemical and Biophysical Research Communications 2011; 408: 103-109.
31. Bodine PVN. Wnt signaling control of bone cell apoptosis. Cell Research 2008; 18: 248-253.
78
32. Clarke B. Normal Bone Anatomy and Physiology. Clinical Journal of the American Society of Nephrology 2008; 3: S131-S139.
33. Kubota T, Michigami T, Ozono K. Wnt signaling in bone metabolism. Journal of Bone and Mineral
Metabolism 2009; 27: 265-271. 34. Wronski TJ, Halloran BP, Bikle DD, et al. Chronic administration of 1,25-dihydroxyvitamin D3:
increased bone but impaired mineralization. Endocrinology 1986; 119: 2580-2585. 35. Rawadi G, Vayssiere B, Dunn F, et al. BMP-2 controls alkaline phosphatase expression and
osteoblast mineralization by a Wnt autocrine loop. Journal of Bone and Mineral Research 2003; 18: 1842-1853.
36. Guo YC, Yuan Q. Fibroblast growth factor 23 and bone mineralisation. International Journal of Oral
Science 2015; 7: 8-13. 37. Larsson T, Marsell R, Schipani E, et al. Transgenic mice expressing fibroblast growth factor 23 under
the control of the alpha 1(I) collagen promoter exhibit growth retardation, osteomalacia, and disturbed phosphate homeostasis. Endocrinology 2004; 145: 3087-3094.
38. Shalhoub V, Ward SC, Sun B, et al. Fibroblast Growth Factor 23 (FGF23) and Alpha-Klotho
Stimulate Osteoblastic MC3T3.E1 Cell Proliferation and Inhibit Mineralization. Calcified Tissue International 2011; 89: 140-150.
39. Wang H, Yoshiko Y, Yamamoto R, et al. Overexpression of fibroblast growth factor 23 suppresses
osteoblast differentiation and matrix mineralization in vitro. Journal of Bone and Mineral Research 2008; 23: 939-948.
40. Yamaguchi M, Weitzmann MN. High dose 1,25(OH)(2)D-3 inhibits osteoblast mineralization in
vitro. International Journal of Molecular Medicine 2012; 29: 934-938. 41. Li YC, Amling M, Pirro AE, et al. Normalization of mineral ion homeostasis by dietary means
prevents hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D receptor-ablated mice. Endocrinology 1998; 139: 4391-4396.
42. van Driel M, van Leeuwen JPTM. Vitamin D endocrine system and osteoblasts. BoneKEy reports 2014;
3: 493. 43. Rowe PSN. Regulation of Bone-Renal Mineral and Energy Metabolism: The PHEX, FGF23, DMP1,
MEPE ASARM Pathway. Critical Reviews in Eukaryotic Gene Expression 2012; 22: 61-86. 44. Dallas SL, Prideaux M, Bonewald LF. The Osteocyte: An Endocrine Cell . . . and More. Endocrine
Reviews 2013; 34: 658-690. 45. Zelenchuk LV, Hedge AM, Rowe PSN. Age dependent regulation of bone-mass and renal function
by the MEPE ASARM-motif. Bone 2015; 79: 131-142. 46. Plotkin LI, Bellido T. Osteocytic signalling pathways as therapeutic targets for bone fragility. Nature
Reviews Endocrinology 2016; 12: 593-605. 47. Bellido T. Osteocyte-Driven Bone Remodeling. Calcified Tissue International 2014; 94: 25-34.
79
48. Robling AG, Turner CH. Mechanical Signaling for Bone Modeling and Remodeling. Critical Reviews in Eukaryotic Gene Expression 2009; 19: 319-338.
49. Xiong JH, O'Brien CA. Osteocyte RANKL: New insights into the control of bone remodeling.
Journal of Bone and Mineral Research 2012; 27: 499-505. 50. Moriishi T, Fukuyama R, Ito M, et al. Osteocyte Network; a Negative Regulatory System for Bone
Mass Augmented by the Induction of Rankl in Osteoblasts and Sost in Osteocytes at Unloading. Plos One 2012; 7: 20.
51. Tu XL, Delgado-Calle J, Condon KW, et al. Osteocytes mediate the anabolic actions of canonical
Wnt/beta-catenin signaling in bone. Proceedings of the National Academy of Sciences of the United States of America 2015; 112: E478-E486.
52. Clement-Lacroix P, Ai MR, Morvan F, et al. Lrp5-independent activation of Wnt signaling by lithium
chloride increases bone formation and bone mass in mice. Proceedings of the National Academy of Sciences of the United States of America 2005; 102: 17406-17411.
53. Brandenburg VM, D'Haese P, Deck A, et al. From skeletal to cardiovascular disease in 12 steps-the
evolution of sclerostin as a major player in CKD-MBD. Pediatr Nephrol 2015; 31:195-206. 54. Kobayashi Y, Maeda K, Takahashi N. Roles of Wnt signaling in bone formation and resorption.
Japanese Dental Science Review 2008; 44: 76-82. 55. Krishnan V, Bryant HU, MacDougald OA. Regulation of bone mass by Wnt signaling. Journal of
Clinical Investigation 2006; 116: 1202-1209. 56. Angers S, Moon RT. Proximal events in Wnt signal transduction. Nature Reviews Molecular Cell Biology
2009; 10: 468-477. 57. Cong F, Schweizer L, Varmus H. Wnt signals across the plasma membrane to activate the beta-
catenin pathway by forming oligomers containing its receptors, frizzled and LRP. Development 2004; 131: 5103-5115.
58. MacDonald BT, Semenov MV, Huang H, et al. Dissecting Molecular Differences between Wnt
Coreceptors LRP5 and LRP6. Plos One 2011; 6: 11. 59. Aberle H, Bauer A, Stappert J, et al. beta-catenin is a target for the ubiquitin-proteasome pathway.
Embo Journal 1997; 16: 3797-3804. 60. Yamamoto H, Kishida S, Kishida M, et al. Phosphorylation of Axin, a Wnt signal negative regulator,
by glycogen synthase kinase-3 beta regulates its stability. Journal of Biological Chemistry 1999; 274: 10681-10684.
61. Hino S, Tanji C, Nakayama KI, et al. Phosphorylation of beta-catenin by cyclic AMP-dependent
protein kinase stabilizes beta-catenin through inhibition of its ubiquitination. Molecular and Cellular Biology 2005; 25: 9063-9072.
62. Li VSW, Ng SS, Boersema PJ, et al. Wnt Signaling through Inhibition of beta-Catenin Degradation in
an Intact Axin1 Complex. Cell 2012; 149: 1245-1256.
80
63. Drissi H, Pouliot A, Koolloos C, et al. 1,25-(OH)(2)-vitamin D3 suppresses the bone-related Runx2/Cbfa1 gene promoter. Experimental Cell Research 2002; 274: 323-333.
64. Bernkopf DB, Hadjihannas MV, Behrens J. Negative-feedback regulation of the Wnt pathway by
conductin/axin2 involves insensitivity to upstream signalling. Journal of Cell Science 2015; 128: 33-39. 65. Semenov MV, Tamai K, Brott BK, et al. Head inducer Dickkopf-1 is a ligand for Wnt coreceptor
LRP6. Current Biology 2001; 11: 951-961. 66. Bafico A, Liu GZ, Yaniv A, et al. Novel mechanism of Wnt signalling inhibition mediated by
Dickkopf-1 interaction with LRP6/Arrow. Nature Cell Biology 2001; 3: 683-686. 67. Chen S, Bubeck D, MacDonald BT, et al. Structural and Functional Studies of LRP6 Ectodomain
Reveal a Platform for Wnt Signaling. Developmental Cell 2011; 21: 848-861. 68. Brandenburg VM, D'Haese P, Deck A, et al. From skeletal to cardiovascular disease in 12 steps-the
evolution of sclerostin as a major player in CKD-MBD. Pediatric Nephrology 2016; 31: 195-206. 69. Ryan ZC, Ketha H, McNulty MS, et al. Sclerostin alters serum vitamin D metabolite and fibroblast
growth factor 23 concentrations and the urinary excretion of calcium. Proceedings of the National Academy of Sciences of the United States of America 2013; 110: 6199-6204.
70. Atkins GJ, Rowe PS, Lim HP, et al. Sclerostin Is a Locally Acting Regulator of Late-
Osteoblast/Preosteocyte Differentiation and Regulates Mineralization Through a MEPE-ASARM-Dependent Mechanism. Journal of Bone and Mineral Research 2011; 26: 1425-1436.
71. Chang MK, Kramer I, Huber T, et al. Disruption of Lrp4 function by genetic deletion or
pharmacological blockade increases bone mass and serum sclerostin levels. Proceedings of the National Academy of Sciences of the United States of America 2014; 111: E5187-E5195.
72. Choi HY, Dieckmann M, Herz J, et al. Lrp4, a Novel Receptor for Dickkopf 1 and Sclerostin, Is
Expressed by Osteoblasts and Regulates Bone Growth and Turnover In Vivo. Plos One 2009; 4: 10. 73. Leupin O, Piters E, Halleux C, et al. Bone Overgrowth-associated Mutations in the LRP4 Gene
Impair Sclerostin Facilitator Function. Journal of Biological Chemistry 2011; 286: 19489-19500. 74. Fijalkowski I, Geets E, Steenackers E, et al. A Novel Domain-Specific Mutation in a Sclerosteosis
Patient Suggests a Role of LRP4 as an Anchor for Sclerostin in Human Bone. Journal of Bone and Mineral Research 2016; 31: 874-881.
75. Robling AG, Niziolek PJ, Baldridge LA, et al. Mechanical stimulation of bone in vivo reduces
osteocyte expression of Sost/sclerostin. Journal of Biological Chemistry 2008; 283: 5866-5875. 76. Torino C, Pizzini P, Cutrupi S, et al. Active vitamin D treatment in CKD patients raises serum
sclerostin and this effect is modified by circulating pentosidine levels. Nutrition Metabolism and Cardiovascular Diseases 2017; 27: 260-266.
77. Wijenayaka AR, Yang DQ, Prideaux M, et al. 1 alpha,25-dihydroxyvitamin D-3 stimulates human
SOST gene expression and sclerostin secretion. Molecular and Cellular Endocrinology 2015; 413: 157-167.
81
78. Wijenayaka AR, Prideaux M, Yang DQ, et al. Early response of the human SOST gene to stimulation by 1 alpha,25-dihydroxyvitamin D-3. Journal of Steroid Biochemistry and Molecular Biology 2016; 164: 369-373.
79. Kulkarni NH, Halladay DL, Miles RR, et al. Effects of parathyroid hormone on Wnt signaling
pathway in bone. Journal of Cellular Biochemistry 2005; 95: 1178-1190. 80. Silva BC, Bilezikian JP. Parathyroid hormone: anabolic and catabolic actions on the skeleton. Current
Opinion in Pharmacology 2015; 22: 41-50. 81. Rendenbach C, Yorgan TA, Heckt T, et al. Effects of Extracellular Phosphate on Gene Expression in
Murine Osteoblasts. Calcified Tissue International 2014; 94: 474-483. 82. Evenepoel P, D'Haese P, Brandenburg V. Sclerostin and DKK1: new players in renal bone and
vascular disease. Kidney International 2015; 88: 235-240. 83. Li JF, Bao QW, Chen SX, et al. Different bone remodeling levels of trabecular and cortical bone in
response to changes in Wnt/beta-catenin signaling in mice. Journal of Orthopaedic Research 2017; 35: 812-819.
84. Liu SG, Tang W, Fang JW, et al. Novel Regulators of Fgf23 Expression and Mineralization in Hyp
Bone. Molecular Endocrinology 2009; 23: 1505-1518. 85. Holmen SL, Zylstra CR, Mukherjee A, et al. Essential role of beta-catenin in postnatal bone
acquisition. Journal of Biological Chemistry 2005; 280: 21162-21168. 86. Glass DA, Bialek P, Ahn JD, et al. Canonical Wnt signaling in differentiated osteoblasts controls
osteoclast differentiation. Developmental Cell 2005; 8: 751-764. 87. Mbalaviele G, Sheikh S, Stains JP, et al. beta-catenin and BMP-2 synergize to promote osteoblast
differentiation and new bone formation. Journal of Cellular Biochemistry 2005; 94: 403-418. 88. Cui YJ, Niziolek PJ, MacDonald BT, et al. Lrp5 functions in bone to regulate bone mass. Nature
Medicine 2011; 17: 684-U673. 89. Wijenayaka AR, Kogawa M, Lim HP, et al. Sclerostin Stimulates Osteocyte Support of Osteoclast
Activity by a RANKL-Dependent Pathway. Plos One 2011; 6: e25900. 90. Lotinun S, Sibonga JD, Turner RT. Differential effects of intermittent and continuous administration
of parathyroid hormone on bone histomorphometry and gene expression. Endocrine 2002; 17: 29-36. 91. Shimizu M, Noda H, Joyashiki E, et al. The Optimal Duration of PTH(1-34) Infusion Is One Hour
per Day to Increase Bone Mass in Rats. Biological & Pharmaceutical Bulletin 2016; 39: 625-630. 92. Li CJ, Xing QJ, Yu B, et al. Disruption of LRP6 in Osteoblasts Blunts the Bone Anabolic Activity of
PTH. Journal of Bone and Mineral Research 2013; 28: 2094-2108. 93. Wan M, Yang CZ, Li J, et al. Parathyroid hormone signaling through low-density lipoprotein-related
protein 6. Genes & Development 2008; 22: 2968-2979. 94. Iwaniec UT, Wronski TJ, Liu J, et al. PTH stimulates bone formation in mice deficient in Lrp5.
Journal of Bone and Mineral Research 2007; 22: 394-402.
82
95. Hruska KA. Renal osteodystrophy. Baillieres Clinical Endocrinology and Metabolism 1997; 11: 165-194. 96. Hruska KA, Saab G, Mathew S, et al. Renal osteodystrophy, phosphate homeostasis, and vascular
calcification. Seminars in Dialysis 2007; 20: 309-315. 97. Levey AS, Eckardt KU, Tsukamoto Y, et al. Definition and classification of chronic kidney disease: A
position statement from Kidney Disease: Improving Global Outcomes (KDIGO). Kidney International 2005; 67: 2089-2100.
98. Keith DS, Nichols GA, Gullion CM, et al. Longitudinal follow-up and outcomes among a population
with chronic kidney disease in a large managed care organization. Archives of Internal Medicine 2004; 164: 659-663.
99. Tonelli M, Wiebe N, Culleton B, et al. Chronic kidney disease and mortality risk: A systematic review.
Journal of the American Society of Nephrology 2006; 17: 2034-2047. 100. Thompson S, James M, Wiebe N, et al. Cause of Death in Patients with Reduced Kidney Function.
Journal of the American Society of Nephrology 2015; 26: 2504-2511. 101. Michishita R, Matsuda T, Kawakami S, et al. The Association Between Unhealthy Lifestyle Behaviors
and the Prevalence of Chronic Kidney Disease (CKD) in Middle-Aged and Older Men. Journal of Epidemiology 2016; 26: 378-385.
102. Hoerger TJ, Simpson SA, Yarnoff BO, et al. The Future Burden of CKD in the United States: A
Simulation Model for the CDC CKD Initiative. American Journal of Kidney Diseases 2015; 65: 403-411. 103. Arora P, Vasa P, Brenner D, et al. Prevalence estimates of chronic kidney disease in Canada: results
of a nationally representative survey. Canadian Medical Association Journal 2013; 185: E417-E423. 104. Hill NR, Fatoba ST, Oke JL, et al. Global Prevalence of Chronic Kidney Disease - A Systematic
Review and Meta-Analysis. Plos One 2016; 11: 18. 105. Brown RB, Haq A, Stanford CF, et al. Vitamin D, phosphate, and vasculotoxicity. Canadian Journal of
Physiology and Pharmacology 2015; 93: 1077-1082. 106. Isakova T, Wahl P, Vargas GS, et al. Fibroblast growth factor 23 is elevated before parathyroid
hormone and phosphate in chronic kidney disease. Kidney International 2011; 79: 1370-1378. 107. Martin KJ, Gonzalez EA. Metabolic bone disease in chronic kidney disease. Journal of the American
Society of Nephrology 2007; 18: 875-885. 108. Muntner P, Jones TM, Hyre AD, et al. Association of Serum Intact Parathyroid Hormone with
Lower Estimated Glomerular Filtration Rate. Clinical Journal of the American Society of Nephrology 2009; 4: 186-194.
109. Ravani P, Malberti F, Tripepi G, et al. Vitamin D levels and patient outcome in chronic kidney
disease. Kidney International 2009; 75: 88-95. 110. Shardlow A, McIntyre NJ, Fluck RJ, et al. Associations of fibroblast growth factor 23, vitamin D and
parathyroid hormone with 5-year outcomes in a prospective primary care cohort of people with chronic kidney disease stage 3. Bmj Open 2017; 7: 11.
83
111. Wolf M, Shah A, Gutierrez O, et al. Vitamin D levels and early mortality among incident
hemodialysis patients. Kidney International 2007; 72: 1004-1013. 112. Langman CB, Cannata-Andia JB. Calcium in Chronic Kidney Disease: Myths and Realities
Introduction. Clinical Journal of the American Society of Nephrology 2010; 5: S1-S2. 113. Levine BS, Rodriguez M, Felsenfeld AJ. Serum calcium and bone: effect of PTH, phosphate, vitamin
D and uremia. Nefrologia 2014; 34: 658-669. 114. Cozzolino M, Pasho S, Fallabrino G, et al. Pathogenesis of secondary hyperparathyroidism.
International Journal of Artificial Organs 2009; 32: 75-80. 115. Finch JL, Lee DH, Liapis H, et al. Phosphate restriction significantly reduces mortality in uremic rats
with established vascular calcification. Kidney International 2013; 84: 1145-1153. 116. Kestenbaum B, Sampson JN, Rudser KD, et al. Serum phosphate levels and mortality risk among
people with chronic kidney disease. Journal of the American Society of Nephrology 2005; 16: 520-528. 117. Neves KR, Graciolli FG, dos Reis LM, et al. Adverse effects of hyperphosphatemia on myocardial
hypertrophy, renal function, and bone in rats with renal failure. Kidney International 2004; 66: 2237-2244.
118. Roman-Garcia P, Carrillo-Lopez N, Fernandez-Martin JL, et al. High phosphorus diet induces
vascular calcification, a related decrease in bone mass and changes in the aortic gene expression. Bone 2010; 46: 121-128.
119. Moranne O, Froissart M, Rossert J, et al. Timing of Onset of CKD-Related Metabolic Complications.
Journal of the American Society of Nephrology 2009; 20: 164-171. 120. Slatopolsky E, Brown A, Dusso A. Pathogenesis of secondary hyperparathyroidism. Kidney
International 1999; 56: S14-S19. 121. Rodriguez M, Felsenfeld AJ. PTH, FGF-23 and early CKD. Nephrology Dialysis Transplantation 2008;
23: 3. 122. Drueke TB. Cinacalcet Treatment in Dialysis Patients with Secondary Hyperparathyroidism: Effects
and Open Issues. Therapeutic Apheresis and Dialysis 2008; 12: S2-S12. 123. Coco M, Rush H. Increased incidence of hip fractures in dialysis patients with low serum parathyroid
hormone. American Journal of Kidney Diseases 2000; 36: 1115-1121. 124. Danese MD, Kim J, Doan QV, et al. PTH and the risks for hip, vertebral, and pelvic fractures among
patients on dialysis. American Journal of Kidney Diseases 2006; 47: 149-156. 125. Chathoth S, Al-Mueilo S, Cyrus C, et al. Elevated Fibroblast Growth Factor 23 Concentration:
Prediction of Mortality among Chronic Kidney Disease Patients. Cardiorenal Medicine 2016; 6: 73-82. 126. Fukumoto S. Targeting Fibroblast Growth Factor 23 Signaling with Antibodies and Inhibitors, Is
There a Rationale? Frontiers in Endocrinology 2018; 9: 7.
84
127. Kovesdy CP, Quarles LD. Fibroblast growth factor-23: what we know, what we don't know, and what we need to know. Nephrology Dialysis Transplantation 2013; 28: 2228-2236.
128. Gutierrez O, Isakova T, Rhee E, et al. Fibroblast growth factor-23 mitigates hyperphosphatemia but
accentuates calcitriol deficiency in chronic kidney disease. Journal of the American Society of Nephrology 2005; 16: 2205-2215.
129. Galitzer H, Ben-Dov IZ, Silver J, et al. Parathyroid cell resistance to fibroblast growth factor 23 in
secondary hyperparathyroidism of chronic kidney disease. Kidney International 2010; 77: 211-218. 130. Komaba H, Goto S, Fujii H, et al. Depressed expression of Klotho and FGF receptor 1 in
hyperplastic parathyroid glands from uremic patients. Kidney International 2010; 77: 232-238. 131. Hasegawa H, Nagano N, Urakawa I, et al. Direct evidence for a causative role of FGF23 in the
abnormal renal phosphate handling and vitamin D metabolism in rats with early-stage chronic kidney disease. Kidney International 2010; 78: 975-980.
132. Shalhoub V, Shatzen EM, Ward SC, et al. FGF23 neutralization improves chronic kidney disease-
associated hyperparathyroidism yet increases mortality. Journal of Clinical Investigation 2012; 122: 2543-2553.
133. Sato T, Tominaga Y, Ueki T, et al. Total parathyroidectomy reduces elevated circulating fibroblast
growth factor 23 in advanced secondary hyperparathyroidism. American Journal of Kidney Diseases 2004; 44: 481-487.
134. Hu MC, Shi MJ, Zhang JN, et al. Klotho Deficiency Causes Vascular Calcification in Chronic Kidney
Disease. Journal of the American Society of Nephrology 2011; 22: 124-136. 135. Isakova T, Wolf MS. FGF23 or PTH: which comes first in CKD? Kidney International 2010; 78: 947-
949. 136. Moe SM, Radcliffe JS, White KE, et al. The Pathophysiology of Early-Stage Chronic Kidney Disease-
Mineral Bone Disorder (CKD-MBD) and Response to Phosphate Binders in the Rat. Journal of Bone and Mineral Research 2011; 26: 2672-2681.
137. Kim HR, Nam BY, Kim DW, et al. Circulating alpha-Klotho Levels in CKD and Relationship to
Progression. American Journal of Kidney Diseases 2013; 61: 899-909. 138. Razzaque MS. The dualistic role of vitamin D in vascular calcifications. Kidney International 2011; 79:
708-714. 139. Ritter CS, Zhang S, Delmez J, et al. Differential expression and regulation of Klotho by paricalcitol in
the kidney, parathyroid, and aorta of uremic rats. Kidney International 2015; 87: 1141-1152. 140. Pelletier S, Dubourg L, Carlier MC, et al. The Relation between Renal Function and Serum Sclerostin
in Adult Patients with CKD. Clinical Journal of the American Society of Nephrology 2013; 8: 819-823. 141. Schiavi SC. Sclerostin and CKD-MBD. Current Osteoporosis Reports 2015; 13: 159-165. 142. Ferreira JC, Ferrari GO, Neves KR, et al. Effects of Dietary Phosphate on Adynamic Bone Disease
in Rats with Chronic Kidney Disease - Role of Sclerostin? Plos One 2013; 8: 7.
85
143. Asamiya Y, Yajima A, Shimizu S, et al. Associations between the levels of sclerostin, phosphate, and fibroblast growth factor-23 and treatment with vitamin D in hemodialysis patients with low intact PTH level. Osteoporosis International 2015; 26: 1017-1028.
144. Delanaye P, Krzesinski JM, Warling X, et al. Clinical and Biological Determinants of Sclerostin
Plasma Concentration in Hemodialysis Patients. Nephron Clinical Practice 2014; 128: 127-134. 145. Desjardins L, Liabeuf S, Oliveira RB, et al. Uremic toxicity and sclerostin in chronic kidney disease
patients. Nephrologie & Therapeutique 2014; 10: 463-470. 146. Cejka D, Herberth J, Branscum AJ, et al. Sclerostin and Dickkopf-1 in Renal Osteodystrophy. Clinical
Journal of the American Society of Nephrology 2011; 6: 877-882. 147. Qureshi AR, Olauson H, Witasp A, et al. Increased circulating sclerostin levels in end-stage renal
disease predict biopsy-verified vascular medial calcification and coronary artery calcification. Kidney International 2015; 88: 1356-1364.
148. Yamada S, Tsuruya K, Tokumoto M, et al. Factors associated with serum soluble inhibitors of Wnt--
catenin signaling (sclerostin and dickkopf-1) in patients undergoing peritoneal dialysis. Nephrology 2015; 20: 639-645.
149. Drechsler C, Evenepoel P, Vervloet MG, et al. High levels of circulating sclerostin are associated with
better cardiovascular survival in incident dialysis patients: results from the NECOSAD study. Nephrology Dialysis Transplantation 2015; 30: 288-293.
150. Jean G, Chazot C, Bresson E, et al. High Serum Sclerostin Levels Are Associated with a Better
Outcome in Haemodialysis Patients. Nephron 2016; 132: 181-190. 151. Thambiah S, Roplekar R, Manghat P, et al. Circulating Sclerostin and Dickkopf-1 (DKK1) in
Predialysis Chronic Kidney Disease (CKD): Relationship with Bone Density and Arterial Stiffness. Calcified Tissue International 2012; 90: 473-480.
152. Graciolli FG, Neves KR, Barreto F, et al. The complexity of chronic kidney disease-mineral and bone
disorder across stages of chronic kidney disease. Kidney International 2017; 91: 1436-1446. 153. Wesseling-Perry K, Juppner H. The osteocyte in CKD: New concepts regarding the role of FGF23
in mineral metabolism and systemic complications. Bone 2013; 54: 222-229. 154. Viaene L, Behets GJ, Claes K, et al. Sclerostin: another bone-related protein related to all-cause
mortality in haemodialysis? Nephrology Dialysis Transplantation 2013; 28: 3024-3030. 155. Goncalves FLC, Elias RM, dos Reis LM, et al. Serum sclerostin is an independent predictor of
mortality in hemodialysis patients. Bmc Nephrology 2014; 15: 7. 156. Kanbay M, Siriopol D, Saglam M, et al. Serum Sclerostin and Adverse Outcomes in Nondialyzed
Chronic Kidney Disease Patients. Journal of Clinical Endocrinology & Metabolism 2014; 99: E1854-E1861. 157. Kanbay M, Solak Y, Siriopol D, et al. Sclerostin, cardiovascular disease and mortality: a systematic
review and meta-analysis. International Urology and Nephrology 2016; 48: 2029-2042.
86
158. Carrillo-Lopez N, Panizo S, Alonso-Montes C, et al. Direct inhibition of osteoblastic Wnt pathway by fibroblast growth factor 23 contributes to bone loss in chronic kidney disease. Kidney International 2016; 90: 77-89.
159. Fang Y, Ginsberg C, Seifert M, et al. CKD-induced wingless/integration1 inhibitors and phosphorus
cause the CKD-mineral and bone disorder. J Am Soc Nephrol 2014; 25: 1760-1773. 160. Alem AM, Sherrard DJ, Gillen DL, et al. Increased risk of hip fracture among patients with end-stage
renal disease. Kidney International 2000; 58: 396-399. 161. Jamal SA, West SL, Miller PD. Fracture risk assessment in patients with chronic kidney disease.
Osteoporosis International 2012; 23: 1191-1198. 162. Nickolas TL, McMahon DJ, Shane E. Relationship between moderate to severe kidney disease and
hip fracture in the United States. Journal of the American Society of Nephrology 2006; 17: 3223-3232. 163. Ott SM. Bone disease in CKD. Current Opinion in Nephrology and Hypertension 2012; 21: 376-381. 164. Naylor KL, McArthur E, Leslie WD, et al. The three-year incidence of fracture in chronic kidney
disease. Kidney International 2014; 86: 810-818. 165. Mittalhenkle A, Gillen DL, Stehman-Breen CO. Increased risk of mortality associated with hip
fracture in the dialysis population. American Journal of Kidney Diseases 2004; 44: 672-679. 166. Massy Z, Drueke T. Adynamic bone disease is a predominant bone pattern in early stages of chronic
kidney disease. Journal of Nephrology 2017; 30: 629-634. 167. Andress DL. Adynamic bone in patients with chronic kidney disease. Kidney International 2008; 73:
1345-1354. 168. Ambrus C, Almasi C, Berta K, et al. Vitamin D insufficiency and bone fractures in patients on
maintenance hemodialysis. International Urology and Nephrology 2011; 43: 475-482. 169. Stubbs JR, He N, Idiculla A, et al. Longitudinal evaluation of FGF23 changes and mineral
metabolism abnormalities in a mouse model of chronic kidney disease. Journal of Bone and Mineral Research 2012; 27: 38-46.
170. Liao HW, Hung PH, Hsiao CY, et al. Relationship between Fibroblast Growth Factor 23 and
Biochemical and Bone Histomorphometric Alterations in a Chronic Kidney Disease Rat Model Undergoing Parathyroidectomy. Plos One 2015; 10: 16.
171. Juppner H, Wolf M, Salusky IB. FGF-23: More Than a Regulator of Renal Phosphate Handling?
Journal of Bone and Mineral Research 2010; 25: 2091-2097. 172. Wesseling-Perry K, Pereira RC, Wang HJ, et al. Relationship between Plasma Fibroblast Growth
Factor-23 Concentration and Bone Mineralization in Children with Renal Failure on Peritoneal Dialysis. Journal of Clinical Endocrinology & Metabolism 2009; 94: 511-517.
173. Schiavi SC, Moyses RMA. Turning over renal osteodystrophy dogma: direct actions of FGF23 on
osteoblast beta-catenin pathway. Kidney International 2016; 90: 17-20.
87
174. Sabbagh Y, Graciolli FG, O'Brien S, et al. Repression of osteocyte Wnt/beta-catenin signaling is an early event in the progression of renal osteodystrophy. Journal of Bone and Mineral Research 2012; 27: 1757-1772.
175. Moe SM, Chen NX, Newman CL, et al. Anti-sclerostin antibody treatment in a rat model of
progressive renal osteodystrophy. J Bone Miner Res 2015; 30: 499-509. 176. Ishimura E, Okuno S, Ichii M, et al. Relationship Between Serum Sclerostin, Bone Metabolism
Markers, and Bone Mineral Density in Maintenance Hemodialysis Patients. Journal of Clinical Endocrinology & Metabolism 2014; 99: 4315-4320.
177. Malluche HH, Davenport DL, Cantor T, et al. Bone mineral density and serum biochemical
predictors of bone loss in patients with CKD on dialysis. Clin J Am Soc Nephrol 2014; 9: 1254-1262. 178. Cejka D, Jager-Lansky A, Kieweg H, et al. Sclerostin serum levels correlate positively with bone
mineral density and microarchitecture in haemodialysis patients. Nephrology Dialysis Transplantation 2012; 27: 226-230.
179. Hampson G, Edwards S, Conroy S, et al. The relationship between inhibitors of the Wnt signalling
pathway (Dickkopf-1(DKK1) and sclerostin), bone mineral density, vascular calcification and arterial stiffness in post-menopausal women. Bone 2013; 56: 42-47.
180. Avbersek-Luznik I, Balon BP, Rus I, et al. Increased bone resorption in HD patients: is it caused by
elevated RANKL synthesis? Nephrology Dialysis Transplantation 2005; 20: 566-570. 181. Malluche H, Faugere MC. RENAL BONE-DISEASE 1990 - AN UNMET CHALLENGE FOR
THE NEPHROLOGIST. Kidney International 1990; 38: 193-211. 182. Nickolas TL, Stein EM, Dworakowski E, et al. Rapid cortical bone loss in patients with chronic
kidney disease. J Bone Miner Res 2013; 28: 1811-1820. 183. Barreto FC, Barreto DV, Moyses RM, et al. K/DOQI-recommended intact PTH levels do not
prevent low-turnover bone disease in hemodialysis patients. Kidney Int 2008; 73: 771-777. 184. Cannata-Andia JB, Garcia MR, Alonso CG. Osteoporosis and adynamic bone in chronic kidney
disease. Journal of Nephrology 2013; 26: 73-80. 185. Kidney Disease: Improving Global Outcomes (KDIGO) CKD Work Group. KDIGO 2017 clinical
practice guideline update for the diagnosis, evaluation, prevention, and treatment of chronic kidney disease–mineral and bone disorder (CKD-MBD). Kidney International Supplements 2017; 7: 1–59.
186. Parikh C, Gutgarts V, Eisenberg E, et al. Vitamin D and Clinical Outcomes in Dialysis. Seminars in
Dialysis 2015; 28: 604-609. 187. Hutchison AJ, Whitehouse RW, Boulton HF, et al. CORRELATION OF BONE-HISTOLOGY
WITH PARATHYROID-HORMONE, VITAMIN-D3, AND RADIOLOGY IN END-STAGE RENAL-DISEASE. Kidney International 1993; 44: 1071-1077.
188. Sherrard DJ, Hercz G, Pei Y, et al. The aplastic form of renal osteodystrophy. Nephrology Dialysis
Transplantation 1996; 11: 29-31.
88
189. Brandenburg VM, Floege J: Adynamic bone disease—bone and beyond. In (vol 3), NDT plus, 2008, pp 135-147
190. Malluche HH, Mawad HW, Monier-Faugere MC. Renal Osteodystrophy in the First Decade of the
New Millennium: Analysis of 630 Bone Biopsies in Black and White Patients. Journal of Bone and Mineral Research 2011; 26: 1368-1376.
191. Pei Y, Hercz G, Greenwood C, et al. RISK-FACTORS FOR RENAL OSTEODYSTROPHY - A
MULTIVARIANT ANALYSIS. Journal of Bone and Mineral Research 1995; 10: 149-156. 192. Spasovski GB, Bervoets ARJ, Behets GJS, et al. Spectrum of renal bone disease in end-stage renal
failure patients not yet on dialysis. Nephrology Dialysis Transplantation 2003; 18: 1159-1166. 193. Drueke TB, Massy ZA. Changing bone patterns with progression of chronic kidney disease. Kidney
Int 2016; 89: 289-302. 194. Goodman WG, Ramirez JA, Belin TR, et al. DEVELOPMENT OF ADYNAMIC BONE IN
PATIENTS WITH SECONDARY HYPERPARATHYROIDISM AFTER INTERMITTENT CALCITRIOL THERAPY. Kidney International 1994; 46: 1160-1166.
195. Zayour D, Daouk M, Medawar W, et al. Predictors of bone mineral density in patients on
hemodialysis. Transplantation Proceedings 2004; 36: 1297-1301. 196. Drueke TB, Massy ZA. Changing bone patterns with progression of chronic kidney disease. Kidney
International 2016; 89: 289-302. 197. Mora Palma FJ, Ellis HA, Cook DB, et al. Osteomalacia in patients with chronic renal failure before
dialysis or transplantation. The Quarterly journal of medicine 1983; 52: 332-348. 198. Weinstein RS, Underwood JL, Hutson MS, et al. BONE HISTOMORPHOMETRY IN VITAMIN-
D-DEFICIENT RATS INFUSED WITH CALCIUM AND PHOSPHORUS. American Journal of Physiology 1984; 246: E499-E505.
199. Bhambri R, Naik V, Malhotra N, et al. Changes in bone mineral density following treatment of
osteomalacia. Journal of Clinical Densitometry 2006; 9: 120-127. 200. Foley RN, Parfrey PS, Sarnak MJ. Clinical epidemiology of cardiovascular disease in chronic renal
disease. American Journal of Kidney Diseases 1998; 32: S112-S119. 201. Levin A, Djurdjev O, Barrett B, et al. Cardiovascular disease in patients with chronic kidney disease:
Getting to the heart of the matter. American Journal of Kidney Diseases 2001; 38: 1398-1407. 202. Go AS, Chertow GM, Fan DJ, et al. Chronic kidney disease and the risks of death, cardiovascular
events, and hospitalization. New England Journal of Medicine 2004; 351: 1296-1305. 203. Blacher J, Guerin AP, Pannier B, et al. Arterial calcifications, arterial stiffness, and cardiovascular risk
in end-stage renal disease. Hypertension 2001; 38: 938-942. 204. Eddington H, Sinha S, Kalra PA. Vascular calcification in chronic kidney disease: a clinical review. J
Ren Care 2009; 35 Suppl 1: 45-50.
89
205. London GM, Guerin AP, Marchais SJ, et al. Arterial media calcification in end-stage renal disease: impact on all-cause and cardiovascular mortality. Nephrology Dialysis Transplantation 2003; 18: 1731-1740.
206. Watanabe R, Lemos MM, Manfredi SR, et al. Impact of Cardiovascular Calcification in Nondialyzed
Patients after 24 Months of Follow-up. Clinical Journal of the American Society of Nephrology 2010; 5: 189-194.
207. Toussaint ND, Lau KK, Strauss BJ, et al. Associations between vascular calcification, arterial stiffness
and bone mineral density in chronic kidney disease. Nephrol Dial Transplant 2008; 23: 586-593. 208. Cannata-Andia JB, Rodriguez-Garcia M, Carrillo-Lopez N, et al. Vascular calcifications: Pathogenesis,
management, and impact on clinical outcomes. Journal of the American Society of Nephrology 2006; 17: S267-S273.
209. Steitz SA, Speer MY, Curinga G, et al. Smooth muscle cell phenotypic transition associated with
calcification - Upregulation of Cbfa1 and downregulation of smooth muscle lineage markers. Circulation Research 2001; 89: 1147-1154.
210. Leopold JA. Vascular calcification: Mechanisms of vascular smooth muscle cell calcification. Trends in
Cardiovascular Medicine 2015; 25: 267-274. 211. Cai T, Sun DQ, Duan Y, et al. WNT/beta-catenin signaling promotes VSMCs to osteogenic
transdifferentiation and calcification through directly modulating Runx2 gene expression. Experimental Cell Research 2016; 345: 206-217.
212. El-Abbadi MM, Pai AS, Leaf EM, et al. Phosphate feeding induces arterial medial calcification in
uremic mice: role of serum phosphorus, fibroblast growth factor-23, and osteopontin. Kidney International 2009; 75: 1297-1307.
213. Shanahan CM, Crouthamel MH, Kapustin A, et al. Arterial Calcification in Chronic Kidney Disease:
Key Roles for Calcium and Phosphate. Circulation Research 2011; 109: 697-711. 214. Nasrallah MM, El-Shehaby AR, Salem MM, et al. Fibroblast growth factor-23 (FGF-23) is
independently correlated to aortic calcification in haemodialysis patients. Nephrology Dialysis Transplantation 2010; 25: 2679-2685.
215. Scialla JJ, Xie HL, Rahman M, et al. Fibroblast Growth Factor-23 and Cardiovascular Events in
CKD. Journal of the American Society of Nephrology 2014; 25: 349-360. 216. Chen TL, Mao HJ, Chen C, et al. The Role and Mechanism of alpha-Klotho in the Calcification of
Rat Aortic Vascular Smooth Muscle Cells. Biomed Research International 2015; 2015:194362. 217. Massy ZA, Drueke TB. Vascular calcification. Current Opinion in Nephrology and Hypertension 2013; 22:
405-412. 218. Yang H, Curinga G, Giachelli CM. Elevated extracellular calcium levels induce smooth muscle cell
matrix mineralization in vitro. Kidney International 2004; 66: 2293-2299. 219. Mizobuchi M, Ogata H, Koiwa F, et al. Vitamin D and vascular calcification in chronic kidney
disease. Bone 2009; 45: S26-S29.
90
220. Fusaro M, Gallieni M, Rebora P, et al. Atrial fibrillation and low vitamin D levels are associated with severe vascular calcifications in hemodialysis patients. Journal of Nephrology 2016; 29: 419-426.
221. Coen G. Calcimimetics, parathyroid hormone, and vascular calcification in chronic kidney disease.
Kidney International 2008; 74: 1229-1231. 222. London GM. Mechanisms of arterial calcifications and consequences for cardiovascular function.
Kidney International Supplements 2013; 3: 442-445. 223. Neves KR, Graciolli FG, dos Reis LM, et al. Vascular calcification: Contribution of parathyroid
hormone in renal failure. Kidney International 2007; 71: 1262-1270. 224. Rong S, Zhao XZ, Jin XC, et al. Vascular Calcification in Chronic Kidney Disease is Induced by
Bone Morphogenetic Protein-2 via a Mechanism Involving the Wnt/beta-Catenin Pathway. Cellular Physiology and Biochemistry 2014; 34: 2049-2060.
225. Morena M, Jaussent I, Dupuy AM, et al. Osteoprotegerin and sclerostin in chronic kidney disease
prior to dialysis: potential partners in vascular calcifications. Nephrology Dialysis Transplantation 2015; 30: 1345-1356.
226. Sigrist MK, Levin A, Er L, et al. Elevated osteoprotegerin is associated with all-cause mortality in
CKD stage 4 and 5 patients in addition to vascular calcification. Nephrology Dialysis Transplantation 2009; 24: 3157-3162.
227. Brandenburg VM, Kramann R, Koos R, et al. Relationship between sclerostin and cardiovascular
calcification in hemodialysis patients: a cross-sectional study. Bmc Nephrology 2013; 14: 10. 228. Lv W, Guan LN, Zhang Y, et al. Sclerostin as a new key factor in vascular calcification in chronic
kidney disease stages 3 and 4. International Urology and Nephrology 2016; 48: 2043-2050. 229. Wang XR, Yuan LA, Zhang JJ, et al. Serum sclerostin values are associated with abdominal aortic
calcification and predict cardiovascular events in patients with chronic kidney disease stages 3-5D. Nephrology 2017; 22: 286-292.
230. Claes KJ, Viaene L, Heye S, et al. Sclerostin: Another Vascular Calcification Inhibitor? Journal of
Clinical Endocrinology & Metabolism 2013; 98: 3221-3228. 231. Zhu DX, Mackenzie NCW, Millan JL, et al. The Appearance and Modulation of Osteocyte Marker
Expression during Calcification of Vascular Smooth Muscle Cells. Plos One 2011; 6: e19595. 232. Naves M, Rodriguez-Garcia M, Diaz-Lopez JB, et al. Progression of vascular calcifications is
associated with greater bone loss and increased bone fractures. Osteoporosis International 2008; 19: 1161-1166.
233. London GM, Marty C, Marchais SJ, et al. Arterial calcifications and bone histomorphometry in end-
stage renal disease. Journal of the American Society of Nephrology 2004; 15: 1943-1951. 234. Kurz P, Monierfaugere MC, Bognar B, et al. EVIDENCE FOR ABNORMAL CALCIUM
HOMEOSTASIS IN PATIENTS WITH ADYNAMIC BONE-DISEASE. Kidney International 1994; 46: 855-861.
91
235. Pelletier S, Confavreux CB, Haesebaert J, et al. Serum sclerostin: the missing link in the bone-vessel cross-talk in hemodialysis patients? Osteoporosis international : a journal established as result of cooperation between the European Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA 2015; 26: 2165-2174.
236. Scialla JJ, Lau WL, Reilly MP, et al. Fibroblast growth factor 23 is not associated with and does not
induce arterial calcification. Kidney Int 2013; 83: 1159-1168. 237. Torres A, Lorenzo V, Salido E. Calcium metabolism and skeletal problems after transplantation.
Journal of the American Society of Nephrology 2002; 13: 551-558. 238. Cruz EAS, Lugon JR, Jorgetti V, et al. Histologic evolution of bone disease 6 months after successful
kidney transplantation. American Journal of Kidney Diseases 2004; 44: 747-756. 239. Epstein S. Post-transplantation bone disease: The role of immunosuppressive agents and the
skeleton. Journal of Bone and Mineral Research 1996; 11: 1-7. 240. Julian BA, Laskow DA, Dubovsky J, et al. RAPID LOSS OF VERTEBRAL MINERAL DENSITY
AFTER RENAL-TRANSPLANTATION. New England Journal of Medicine 1991; 325: 544-550. 241. Monier-Faugere MC, Mawad H, Qi QL, et al. High prevalence of low bone turnover and occurrence
of osteomalacia after kidney transplantation. Journal of the American Society of Nephrology 2000; 11: 1093-1099.
242. Conseil d'évaluation des technologies de la santé du Québec (CÉTS): Hémodialyse et dialyse
péritonéale: analyse comparative des rapports coût-efficacité. 1999; Montréal: CETS, 98-3: xi-37. 243. Chauhan V, Kelepouris E, Chauhan N, et al. Current Concepts and Management Strategies in
Chronic Kidney Disease-Mineral and Bone Disorder. Southern Medical Journal 2012; 105: 479-485. 244. Lu KC, Wu CC, Yen JF, et al. Vascular Calcification and Renal Bone Disorders. Scientific World Journal
2014: 20. 245. Wesseling-Perry K, Salusky IB. Chronic Kidney Disease: Mineral and Bone Disorder in Children.
Seminars in Nephrology 2013; 33: 169-179. 246. Melamed ML, Buttar RS, Coco M. CKD-Mineral Bone Disorder in Stage 4 and 5 CKD: What We
Know Today? Advances in Chronic Kidney Disease 2016; 23: 262-269. 247. Gallieni M, De Luca N, Santoro D, et al. Management of CKD-MBD in non-dialysis patients under
regular nephrology care: a prospective multicenter study. Journal of Nephrology 2016; 29: 71-78. 248. Block GA, Spiegel DM, Ehrlich J, et al. Effects of sevelamer and calcium on coronary artery
calcification in patients new to hemodialysis. Kidney International 2005; 68: 1815-1824. 249. Cernaro V, Santoro D, Lacquaniti A, et al. Phosphate binders for the treatment of chronic kidney
disease: role of iron oxyhydroxide. International Journal of Nephrology and Renovascular Disease 2016; 9: 11-19.
250. Sekercioglu N, Thabane L, Martinez JPD, et al. Comparative Effectiveness of Phosphate Binders in
Patients with Chronic Kidney Disease: A Systematic Review and Network Meta-Analysis. Plos One 2016; 11: 18.
92
251. de Oliveira RB, Graciolli FG, dos Reis LM, et al. Disturbances of Wnt/beta-catenin pathway and
energy metabolism in early CKD: effect of phosphate binders. Nephrology Dialysis Transplantation 2013; 28: 2510-2517.
252. Komaba H, Wang M, Taniguchi M, et al. Initiation of Sevelamer and Mortality among Hemodialysis
Patients Treated with Calcium-Based Phosphate Binders. Clinical Journal of the American Society of Nephrology 2017; 12: 1489-1497.
253. Ferreira A, Frazo JM, Monier-Faugere MC, et al. Effects of sevelamer hydrochloride and calcium
carbonate on renal osteodystrophy in hemodialysis patients. Journal of the American Society of Nephrology 2008; 19: 405-412.
254. Pai AB, Conner TA, McQuade CR. Therapeutic use of the phosphate binder lanthanum carbonate.
Expert Opinion on Drug Metabolism & Toxicology 2009; 5: 71-81. 255. Taniguchi M, Tokumoto M, Tsuruya K, et al. Intravenous calcitriol therapy in an early stage prevents
parathyroid gland growth. Nephrology Dialysis Transplantation 2008; 23: 3662-3669. 256. Drueke TB. Which vitamin D derivative to prescribe for renal patients. Current Opinion in Nephrology
and Hypertension 2005; 14: 343-349. 257. Newman CL, Tian NN, Hammond MA, et al. Calcitriol Suppression of Parathyroid Hormone Fails
to Improve Skeletal Properties in an Animal Model of Chronic Kidney Disease. American Journal of Nephrology 2016; 43: 20-31.
258. Sprague SM, Wetmore JB, Gurevich K, et al. Effect of Cinacalcet and Vitamin D Analogs on
Fibroblast Growth Factor-23 during the Treatment of Secondary Hyperparathyroidism. Clinical Journal of the American Society of Nephrology 2015; 10: 1021-1030.
259. Covic A, Voroneanu L, Goldsmith D. The Effects of Vitamin D Therapy on Left Ventricular
Structure and Function - Are These the Underlying Explanations for Improved CKD Patient Survival? Nephron Clinical Practice 2010; 116: C187-C195.
260. Drueke TB. Treatment of secondary hyperparathyroidism with vitamin D derivatives and
calcimimetics before and after start of dialysis. Nephrology Dialysis Transplantation 2002; 17: 20-22. 261. Teng M, Wolf M, Lowrie E, et al. Survival of patients undergoing hemodialysis with paricalcitol or
calcitriol therapy. New England Journal of Medicine 2003; 349: 446-456. 262. Tentori F, Hunt WC, Stidley CA, et al. Mortality risk among hemodialysis patients receiving different
vitamin D analogs. Kidney International 2006; 70: 1858-1865. 263. Moe SM, Cunningham J, Bommer J, et al. Long-term treatment of secondary hyperparathyroidism
with the calcimimetic cinacalcet HCl. Nephrology Dialysis Transplantation 2005; 20: 2186-2193. 264. Evans M, Methven S, Gasparini A, et al. Cinacalcet use and the risk of cardiovascular events,
fractures and mortality in chronic kidney disease patients with secondary hyperparathyroidism. Scientific Reports 2018; 8: 9.
265. Sekercioglu N, Busse JW, Sekercioglu MF, et al. Cinacalcet versus standard treatment for chronic
kidney disease: a systematic review and meta-analysis. Renal Failure 2016; 38: 857-874.
93
266. Ott SM. Therapy for patients with CKD and low bone mineral density. Nature Reviews Nephrology
2013; 9: 681-692. 267. Llach F, Nikakhtar B. Parathyroidectomy in dialysis patients: Indications, surgical approach,
complications and clinical management after surgery. Seminars in Dialysis 1996; 9: 332-338. 268. Kestenbaum B, Andress DL, Schwartz SM, et al. Survival following parathyroidectomy among United
States dialysis patients. Kidney International 2004; 66: 2010-2016. 269. Jin HT, Wang BL, Li J, et al. Anti-DKK1 antibody promotes bone fracture healing through activation
of beta-catenin signaling. Bone 2015; 71: 63-75. 270. Ominsky MS, Boyce RW, Li XD, et al. Effects of sclerostin antibodies in animal models of
osteoporosis. Bone 2017; 96: 63-75. 271. Padhi D, Jang G, Stouch B, et al. Single-Dose, Placebo-Controlled, Randomized Study of AMG 785,
a Sclerostin Monoclonal Antibody. Journal of Bone and Mineral Research 2011; 26: 19-26. 272. Shobeiri N, Adams MA, Holden RM. Vascular Calcification in Animal Models of CKD: A Review.
American Journal of Nephrology 2010; 31: 471-481. 273. Diwan V, Brown L, Gobe GC. Adenine-induced chronic kidney disease in rats. Nephrology 2018; 23:
5-11. 274. Bao YW, Yuan Y, Chen JH, et al. Kidney disease models: tools to identify mechanisms and potential
therapeutic targets. Zoological Research 2018; 39: 72-86. 275. Bikbov B, Perico N, Remuzzi G, et al. Disparities in Chronic Kidney Disease Prevalence among
Males and Females in 195 Countries: Analysis of the Global Burden of Disease 2016 Study. Nephron 2018; 139: 313-318.
276. Berndt T, Craig TA, Bowe AE, et al. Secreted frizzled-related protein 4 is a potent tumor-derived
phosphaturic agent. Journal of Clinical Investigation 2003; 112: 785-794. 277. Tsujikawa H, Kurotaki Y, Fujimori T, et al. Klotho, a gene related to a syndrome resembling human
premature aging, functions in a negative regulatory circuit of vitamin D endocrine system. Molecular Endocrinology 2003; 17: 2393-2403.
278. Bruzzese A, Lacquaniti A, Cernaro V, et al. Sclerostin levels in uremic patients: a link between bone
and vascular disease. Renal Failure 2016; 38: 759-764. 279. Neyra JA, Hu MC. Potential application of klotho in human chronic kidney disease. Bone 2017; 100:
41-49. 280. Tang XW, Wang Y, Fan ZN, et al. Klotho: a tumor suppressor and modulator of the Wnt/beta-
catenin pathway in human hepatocellular carcinoma. Laboratory Investigation 2016; 96: 197-205. 281. Shalhoub V, Shatzen E, Henley C, et al. Calcification inhibitors and Wnt signaling proteins are
implicated in bovine artery smooth muscle cell calcification in the presence of phosphate and vitamin D sterols. Calcified Tissue International 2006; 79: 431-442.
94
282. Chung YS, Baylink DJ, Srivastava AK, et al. Effects of secreted frizzled-related protein 3 on osteoblasts in vitro. Journal of Bone and Mineral Research 2004; 19: 1395-1402.
283. Cho SW, Her SJ, Sun HJ, et al. Differential effects of secreted frizzled-related proteins (sFRPs) on
osteoblastic differentiation of mouse mesenchymal cells and apoptosis of osteoblasts. Biochemical and Biophysical Research Communications 2008; 367: 399-405.
284. Murali SK, Roschger P, Zeitz U, et al. FGF23 Regulates Bone Mineralization in a 1,25(OH) D-2(3)
and Klotho-Independent Manner. Journal of Bone and Mineral Research 2016; 31: 129-142. 285. Thouverey C, Caverzasio J. Sclerostin inhibits osteoblast differentiation without affecting
BMP2/SMAD1/5 or Wnt3a/beta-catenin signaling but through activation of platelet-derived growth factor receptor signaling in vitro. Bonekey Reports 2015; 4: 8.
286. Li J, Sarosi I, Cattley RC, et al. Dkk1-mediated inhibition of Wnt signaling in bone results in
osteopenia. Bone 2006; 39: 754-766.
95
Annexe 1 : Implication de la voie Wnt/β-caténine dans l’ostéodystrophie rénale
Titre original: Role of the Wnt/β-Catenin Pathway in Renal Osteodystrophy
Auteurs: Sarah‑Kim Bisson1, Roth‑Visal Ung1, Fabrice Mac‑Way1
1 Axe Endocrinologie et Néphrologie, Centre de recherche de l’Hôtel-Dieu de Québec, CHU de Québec, Faculté et Département de Médecine, Université Laval, Québec, Canada.
Statut de publication: Article publié dans le International Journal of Endocrinology le 2 avril 2018. © 2018 Sarah-Kim Bisson et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Statut d’auteur: Auteur principal Contribution: Écriture, Figures. Auteur de correspondance :
Fabrice Mac‑Way
fabrice.mac‑[email protected]
96
Résumé La calcification vasculaire et la fragilité osseuse sont deux problèmes de santé qui affectent fréquemment les patients souffrant d’insuffisance rénale chronique (IRC). La fragilité osseuse est le résultat du remodelage osseux anormal et du défaut de minéralisation qui sont souvent présents en IRC. Il a été soulevé que la sclérostine et Dickkopf-related protein 1 pourraient être impliqués dans les anomalies osseuses liées à l’IRC puisque qu’ils inhibent la voie Wnt/β-caténine dans l’os, freinant la formation osseuse. Cette revue se concentre sur les nouvelles connaissances acquises au sujet de la voie Wnt/β-caténine dans l’os, la façon dont l’IRC l’affecte et les répercussions sur la structure osseuse. L’expression des composantes de la voie Wnt/β-caténine et de ses inhibiteurs étant affectée par la perte de fonction rénale, une meilleure compréhension des effets des inhibiteurs de la voie Wnt sur l’os pourrait permettre le développement de nouvelles thérapies visant à prévenir la fragilité osseuse en IRC.
97
Abstract Vascular calcification and bone fragility are common and interrelated health problems that affect chronic kidney disease (CKD) patients. Bone fragility, which leads to higher risk of fracture and mortality, arises from the abnormal bone remodeling and mineralization that are seen in chronic kidney disease. Recently, sclerostin and Dickkopf-related protein 1 were suggested to play a significant role in CKD-related bone disease as they are known inhibitors of the Wnt pathway, thus preventing bone formation. This review focuses on new knowledge about the Wnt pathway in bone, how its function is affected by chronic kidney disease and how this affects bone structure. Expression of components and inhibitors of the Wnt pathway has been shown to be affected by the loss of kidney function, and a better understanding of the bone effects of Wnt pathway inhibitors could allow the development of new therapies to prevent bone fragility in this population.
98
1. Introduction Chronic kidney disease-mineral and bone disorder (CKD-MBD) is a major health issue as it is associated with increased bone fracture risk and development of vascular calcification [1]. In recent years, studies have suggested that the Wnt/β-catenin pathway plays a potential and promising role in CKD-MBD, as the activation of this pathway increases bone formation and Wnt inhibitor levels were shown to be increased in CKD. Studies have then focused on understanding how Wnt inhibitors such as sclerostin and Dickkopf-1 (Dkk1) were involved in the development of bone turnover anomalies and vascular calcification in CKD [2–4]. As of now, the reason why Wnt inhibitor levels are increased in CKD, as well as their exact role in inducing or preventing anomalies of bone turnover, still remains poorly understood. A better comprehension of the Wnt/β-catenin pathway will provide new perspectives for understanding the pathophysiology of CKD-MBD and may pave the way for the development of new targeted treatments. The aim of this review is to discuss the current knowledge on (1) Wnt/β-catenin pathway function and regulation in bone metabolism, (2) the implication of Wnt inhibitors in the development of CKD-related bone anomalies, and (3) the potential benefits of inhibiting Wnt inhibitors to improve bone disease in CKD. We decided to focus our review on bone disease as other excellent review papers already exist on the role of the Wnt/β-catenin pathway in vascular calcification.
2. Mineral Abnormalities in CKD Bone turnover is the result of a tight coordination between bone formation by osteoblasts (OB) and bone resorption by osteoclasts (OC). Osteoclast activity depends on the balance between receptor activator of nuclear factor kappa-B ligand (RANKL) produced by the osteoblasts, which increases OC proliferation and differentiation, and osteoprotegerin (OPG), which binds to RANKL to inhibit osteoclastic activation [5]. The osteocytes, which are the ultimate differentiation stage of osteoblast-lineage cells and the main cellular components of bone, also act as regulators of bone turnover. Indeed, osteocytes allow the bone to adapt to new conditions by variably expressing OPG, RANKL [6], and other proteins that act on OB and OC. In CKD, dysregulation of parathyroid hormone (PTH), which modulates OPG and RANKL, has considerable repercussions on bone turnover (Figure 1). Hypocalcemia develops as a result of decreased renal production of 1,25 (OH)2D, which is necessary for the intestinal absorption of calcium. Concurrently, hyperphosphatemia occurs due to the inability of the failing kidneys to excrete excess phosphorus. Hypocalcemia, hyperphosphatemia, and decreased 1,25 (OH)2D all contribute to the development of secondary hyperparathyroidism, which is meant to normalize levels of serum calcium, phosphate, and 1,25 (OH)2D through its effects on the bone and kidney [7]. If untreated, secondary hyperparathyroidism leads to an increased bone turnover in favor of bone resorption and bone loss [8]. At a very early stage of CKD (glomerular filtration rate < 60–70 ml/mn/1.73m2), there is elevation of fibroblast growth factor 23 (FGF23), a phosphaturic hormone secreted by the osteocytes that also inhibits 1,25 (OH)2D production [9]. The precise causes of its elevation remain unclear, but it seems to be mainly related to 1,25 (OH)2D, hyperphosphatemia, calcium, PTH, and metabolic acidosis [10]. Recent studies also suggest that iron deficiency is associated with high FGF23 levels in a rat model of CKD [11]. 2.1. Types of Bone Diseases in CKD. Renal osteodystrophy is defined by the abnormalities of bone turnover, mineralization, and microarchitecture that affect CKD patients. Classically, four types of bone diseases specific to CKD are defined:
(1) Hyperparathyroidism bone disease is the classical high bone turnover disease that is mainly due to untreated or undertreated secondary hyperparathyroidism. Bone anomalies are characterized by thinning of the cortical bone and accumulation of abnormal trabecular bone [12].
99
(2) Adynamic bone disease (ABD), characterized by low or absent bone formation and resorption, is a common finding in early CKD and especially in predialysis CKD patients with diabetes [13, 14]. The aetiology of ABD is currently unknown but has been associated with oversuppression of PTH levels and development of PTH resistance [14]. Studies have suggested that patients with low PTH levels are more susceptible to fractures [15, 16]. (3) Osteomalacia (OM), defined by slower bone turnover and accumulation of nonmineralized bone matrix, leads to reduced bone strength. In CKD, OM is often secondary to vitamin deficiency, uncontrolled metabolic acidosis, or hypocalcemia, but the exact aetiology is often unknown [17]. (4) Mixed renal osteodystrophy is characterized by a combination of high bone turnover disease and mineralization defects [14].
3. Overview of Wnt/β-Catenin Pathway The Wnt/β-catenin pathway has been recognized as a major regulator of bone formation. Its activation stabilizes β-catenin, a transcription factor that stimulates the production of osteoblastic transcription factors such as Runt-related transcription factor 2 (Runx2) and osterix. Wnt/β-catenin pathway activators such as the Wnt ligands thus raise the number of mineralizing osteoblasts and increase the rate of bone formation [18, 19]. The following section will describe the current knowledge on the role of Wnt/β-catenin pathway in the regulation of osteoblastogenesis. 3.1. Osteoblasts, Wnt/β-Catenin Pathway, and Regulation of the Bone Turnover. The first step in the activation of this pathway is the binding of a Wnt ligand from the extracellular environment to two transmembrane proteins: a Frizzled protein (Fz) acting as the receptor and a low-density lipoprotein receptor-related protein 5 or 6 (Lrp5/6) acting as a coreceptor (Figure 2). Wnt1, Wnt3a, and Wnt10b seem to be the main Wnt ligands that activate osteoblastic differentiation [19]. Upon binding of one of these ligands, Fz and Lrp5/6 are brought together [20]. This causes the recruitment of the protein Disheveled (Dvl), which phosphorylates Lrp5/6. The phosphorylation of the coreceptor leads to the recruitment of Axin, an essential component of the β-catenin phosphorylation complex [21-23]. This complex is necessary for the degradation of β-catenin and is composed of three other proteins: glycogen synthase kinase 3 beta (GSK3B), adenomatous polyposis coli (APC), and casein kinase I (CKI). Following the recruitment of Axin to Lrp5/6, the β-catenin phosphorylation complex binds to Dvl and is destabilized. Dvl blocks the phosphorylation of Axin by GSK3β, which is necessary for phosphorylation of β-catenin by the complex [23]. The unphosphorylated β-catenin is then free to translocate to the nucleus, interact with a T cell factor/lymphoid enhancer factor (Tcf/Lef) element on the DNA, and initiate the transcription of genes involved in osteoblast differentiation. As demonstrated with the use of a GSK3β inhibitor in mice, which inactivates the β-catenin phosphorylation complex, activation of the Wnt/β-catenin pathway results in increased bone mass [24]. Apart from genes involved in osteoblastic differentiation, activation of the Wnt/β-catenin pathway results in upregulation of other genes. Among them is Axin2, a protein that can play a similar role as Axin in the phosphorylation complex. Axin2 is however less susceptible to Dvl regulation than the constitutively expressed Axin, which means that Axin2-containing complexes tend to be less efficient at activating β-catenin signaling despite Wnt activation [25]. This suggests that Axin2 could be part of a negative feedback mechanism that makes cells less sensitive to Wnt ligands without altogether turning off the Wnt/β- catenin pathway. In the absence of Wnt ligands or in the presence of Wnt inhibitors (see related section below), there is a reduced activation of the Wnt/β-catenin pathway. Since the phosphorylation complex is not recruited to Lrp5/6 and Dvl, it will phosphorylate β-catenin in multiple
100
locations through the action of GSK3B and CK1 (Figure 2). These phosphate groups then allow an E3 ubiquitin ligase to mark the β-catenin molecule for degradation by the proteasome [26]. The ensuing reduction in β-catenin levels translates to decreased transcription of osteoblastic differentiation factors, thus reducing bone formation. In addition to its effect on bone formation, studies have shown that activation of the Wnt/β-catenin pathway in osteoblasts was also associated with decreased levels of RANKL and increased levels of OPG, which lead to suppressed bone resorption in mice and lower production of resorption markers in cultured osteoblasts [27, 28]. Conversely, osteoblast-specific deletion of β-catenin was shown to decrease the levels of OPG [29] and to increase RANKL levels, which result in increased bone resorption and deficient mineralization [28]. Production of Wnt activators and inhibitors is therefore a way of balancing bone formation and resorption. 3.2. Osteocytes, Wnt/β-Catenin Pathway, and Regulation of the Bone Turnover. Osteocytes, which originate from terminally differentiated osteoblasts entrapped in the bone matrix they produced, are the main source of Wnt inhibitors sclerostin and Dkk1 in the bone [30, 31]. They have the capacity to communicate with osteoblasts, osteoclasts, and other osteocytes through cytoplasmic prolongations. At the end of these dendrites are gap junctions that allow the osteocytes to obtain nutrients and transmit molecular signals to neighboring cells [32]. Recently, it has been recognized that osteocytes play a major role in the bone mechanotransduction. Indeed, osteocytes form a complex network that senses changes in bone loading and produces proteins that affect osteoclastic and osteoblastic activity. Mechanical unloading of the bone stimulates the production of Wnt inhibitors such as sclerostin by osteocytes and RANKL by osteoblasts in the “unloaded” region, resulting in decreased activation of the Wnt/β-catenin pathway in neighboring cells and increased bone resorption [6, 33]. In contrast, during mechanical loading, the osteocyte network produces less sclerostin, resulting in activation of Wnt/β-catenin signaling in preosteoblasts to increase bone formation [33, 34]. Therefore, the osteocyte network does not only regulate its own production of sclerostin in response to loading but also osteoblastic production of RANKL, which regulates osteoclastic activity. Moreover, activation of the Wnt/β-catenin pathway in osteocytes themselves also results in modification of the RANKL/OPG ratio. Indeed, previous studies have reported that mice lacking β-catenin in osteocytes had more osteoclasts and lower bone mass due to decreased osteocytic RANKL/OPG ratio [35, 36], which is consistent with what was observed in osteoblasts. Conversely, Li et al. found that a constitutive activation of osteocytic β-catenin instead led to a decreased RANKL/OPG ratio [36]. Another study reported different results as overexpression of β-catenin in osteocytes stimulated bone resorption by raising the RANKL/OPG ratio [27]. However, this last observation seems to be true only when sclerostin is also elevated in the osteocytes. 3.3. PTH Affects the RANKL/OPG Ratio through Wnt/β-Catenin Pathway. Continuous secretion of PTH is associated with increased bone turnover in favor of bone resorption through upregulation of RANKL and downregulation of OPG [37, 38]. However, when given intermittently to patients for a short period of time, PTH increases bone turnover in favor of bone formation and is currently used as a treatment for osteoporosis [38, 39]. The mechanisms by which PTH regulates RANKL and OPG production in the bone are not completely understood, but the Wnt/β-catenin pathway is likely to be involved. PTH can bind to its receptor PTH1R and the Wnt coreceptor Lrp6 on the surface of osteoblasts, which results in β-catenin stabilization despite no Wnt ligand being involved (Figure 3). This is explained by the fact that PTH binding activates protein kinase A (PKA), which directly activates osteoblastic RANKL transcription, stabilizes β-catenin, and also phosphorylates Lrp6 [40-42]. Following Lrp6 phosphorylation by PKA, Axin is recruited and β-catenin is further stabilized, as would be observed if the Wnt/β-catenin pathway was activated by a Wnt ligand [40]. Since a rise in β-catenin levels has been associated with decreased RANKL and increased OPG, this may partly counter the upregulating effect of PKA on RANKL [28, 42]. Osteoblastic Lrp6 is required for PKA activation and RANKL upregulation in mice in response to PTH, suggesting that its paralog Lrp5 cannot compensate for its absence [40, 42]. PTH also seems to regulate RANKL production in osteocytes. In a study by O’Brien et al., activation of PTH1R in the osteocytes of mice led to increased bone turnover and bone mass, the first being explained in part by an increase in RANKL expression and the latter by a suppressing effect of PTH on Wnt inhibitor sclerostin, which leads to increased Wnt/β-catenin activity
101
in bone cells [43, 44]. It seems that Lrp5 is necessary for the action of sclerostin, since system-wide deletion in mice prevents the bone anabolic effect of PTH1R activation in osteocytes [43]. PKA could be responsible, at least in part, for the increased RANKL through direct upregulation in osteocytes, as was the case in osteoblasts, but the Wnt/β-catenin pathway could also contribute to the RANKL/OPG ratio. Direct upregulation of β-catenin in osteocytes has been reported to increase OPG in mice as observed in osteoblasts, so it is likely that the downregulation of osteoblastic RANKL by β-catenin could also be observed in osteocytes [29]. 3.4. Lrp5/6 Mediates the Effects of PTH on Osteoblasts and Osteocytes. Lrp6 seems to be necessary for activation of PTH target genes in osteoblasts. Indeed, deletion of Lrp6 prevents both the increased bone formation and resorption that normally result from PTH1R activation in osteoblasts [42]. Lrp6 also seems more important for regulation of bone turnover than Lrp5, as its deletion appears more deleterious to trabecular bone structure and osteoblastic differentiation than that of Lrp5 [45]. This could be explained by the fact that Lrp6, unlike Lrp5, is phosphorylated by PKA following PTH binding, which is a necessary step for β-catenin stabilization in response to PTH [40]. However, Lrp5 still seems to be involved in the anabolic effects of PTH, as its global deletion prevents bone formation when PTH1R is activated in the osteocytes of mice without impacting RANKL production [43]. Since global deletion of Lrp5 does not prevent the anabolic effects of intermittent PTH injections [46, 47], it is possible that the only role of Lrp5 in the PTH anabolic response is to mediate the effects of sclerostin on osteoblasts.
4. Regulation of Bone Metabolism by Wnt/β-Catenin Pathway Inhibitors Wnt inhibitors such as sclerostin, Dkk1, and secreted frizzled-related proteins (SFRPs) are produced by the osteocytes and prevent Wnt/β-catenin pathway activation by two main mechanisms: through competitive binding on its receptor or through their binding to the Wnt ligands (Figure 4) [30]. Wnt inhibitors are therefore highly involved in the coordination of bone formation and resorption. The following sections are meant to explain the current knowledge on the role of these inhibitors in the regulation of bone turnover. 4.1. Sclerostin and Regulation of Bone Turnover. Unlike the other Wnt inhibitors, sclerostin is often thought of as a specifically osteocytic protein [48]. By binding to Lrp5/6, sclerostin prevents the activation of the Wnt/β-catenin pathway in response to the binding of a Wnt ligand. In humans, mutations of the sclerostin gene, SOST, are known to have adverse effects on bone. These mutations, whether they are nonsense, missense, or other, all prevent the secretion of functional sclerostin and typically lead to thicker cortical bone [49]. In humans, the effects are particularly visible in the skull, where the excess bone can crush facial nerves and increase intracranial pressure [50, 51]. In mice, inactivation of SOST leads to increased bone mass through increased activity of the Wnt/β-catenin pathway [52] while activating mutations lead to bone loss [53]. The use of antibodies against sclerostin in animal studies supports these results, since this treatment has resulted in greater bone mass and faster fracture repair as compared to controls [54-56]. In addition to inhibiting osteoblastic differentiation through the Wnt/β-catenin pathway, sclerostin has been shown to negatively regulate the bone morphogenetic protein (BMP) pathway, which is also involved in bone formation [57]. Furthermore, high levels of sclerostin may potentially induce bone mineralization defects as it normally downregulates PHEX (phosphate-regulating neutral endopeptidase), a peptide responsible for maintaining low levels of bone mineralization inhibitor MEPE-ASARM (matrix extracellular phosphoglycoprotein with an acidic-serine and aspartate-rich motif) [58]. In addition to inhibition of bone formation, recent studies have shown that sclerostin might also be an activator of bone resorption by increasing RANKL/OPG ratio in osteocytes [27, 59]. Moreover, sclerostin has been shown to interact with more than a dozen other bone proteins in affinity capture studies, suggesting it could also modulate bone metabolism through other pathways than Wnt/β-catenin [60]. Binding interactions have been reported with the enzyme alkaline phosphatase, the Phex
102
endopeptidase, and the Wnt antagonist SFRP4, but the biological meaning of most of these interactions remains undiscovered [60]. The demonstration that sclerostin has the ability to interact with a wide variety of proteins and that its expression range also includes the heart, kidneys, liver, and lungs reveals the complexity of its role, which is probably not only limited to bone regulation [61]. More recently, Lrp4, which resembles the Wnt coreceptors Lrp5/6 in structure, has been established as an important mediator of the effects of sclerostin. For more than ten years, it has been known that Lrp4 acted as a Wnt inhibitor because of the bone phenotype resulting from its deletion or mutation. These include syndactyly and cranial deformation in mice, cattle, and humans, which are reminiscent of diseases caused by a mutated SOST gene [62-64]. Moreover, cases of sclerosteosis in humans, which are often the result of mutations of the SOST gene, have been attributed to similar disruptions of the LRP4 gene [50]. While the mechanism by which Lrp4 causes Wnt inhibition has remained unclear for years, the implication of the receptor in the development of neuromuscular junctions has been much studied and abundantly described [65, 66]. When targeted by autoantibodies, Lrp4 cannot bind its ligand agrin, which results in faulty neuromuscular junction development that leads to a serious disease called myasthenia gravis [67]. It is only recently that a satisfying explanation has been brought up for the link between Lrp4 mutations and high bone mass. While Lrp4 cannot activate the Wnt pathway like Lrp5/6, it can nonetheless bind sclerostin and has thus been posited to act as an anchor for the protein in bone [68]. This would explain the fact that while Lrp4 deficiency leads to higher serum sclerostin levels, the bone production of sclerostin does not appear increased, Wnt is more activated in osteoblasts, and bone mass increases as a result [69-71]. Lrp4 deletion also leads to decreased RANKL and Dkk1 production, as seen when the Wnt/β-catenin pathway is active [70, 72]. This is further supported by the fact that deletion of the sclerostin-binding domain of Lrp4, or use of anti-Lrp4 antibodies, leads to increased bone formation [71, 73]. 4.2. Dkk1 and Bone Formation. While Dkk1 is highly expressed in osteocytes similarly to sclerostin, it is also produced by osteoblasts and cells involved in embryogenesis [74]. It binds to Lrp5/6 to inhibit Wnt/β-catenin pathway signaling and thus bone formation. Overexpression of Dkk1 in mice has been associated with decreased bone mass and bone formation through inhibition of the Wnt/β-catenin pathway, similar to what is observed when sclerostin is overexpressed [75]. Moreover, constant Dkk1 activation seems to prevent PTH-induced elevation of bone turnover [76]. One allele deletion of the Dkk1 gene is sufficient to induce a marked increase in bone formation in rats [77], but the effects of complete deletion are more complex to study since such mutation prevents animals from reaching the end of their development. Nonetheless, inhibition of Dkk1 using monoclonal antibodies has resulted in increased bone formation, as seen with sclerostin inactivation [78]. Despite Dkk1 also having the capacity to bind Lrp4, it is currently unknown whether or not its levels are affected by Lrp4 deletion [68]. 4.3. SFRPs and Bone Formation. SFRP-1, SFRP-2, and SFRP-4 are produced by a greater variety of cells, including osteoblasts, and seem to have a similar effect on bone as sclerostin and Dkk1 [79]. Their mechanisms of action are however slightly different, since SFRPs normally bind to the Wnt ligands in a decoy receptor fashion [79]. Consistent with what has been observed in cases of increased sclerostin and Dkk1 expression, high SFRP1 expression was shown to be correlated with preosteocytic apoptosis in vitro, whereas SFRP1 deletion in vivo increased osteoblastic survival and trabecular bone volume [80]. Interestingly, by directly binding RANKL, SFRP1 also inhibits osteoclastogenesis [81]. In addition to its inhibitory effect on the Wnt/β-catenin pathway, SFRP4 has previously been shown to increase urinary phosphate excretion when given to parathyroidectomized rats, but a more recent study in which SFRP4 was ablated in mice did not show an effect on phosphorus metabolism, suggesting that the phosphaturic effect might not be observable at normal PTH levels [82, 83].
103
5. Determinants of Wnt Inhibitor Levels Apart from mechanical loading, there are many other factors that can stimulate the production of Wnt inhibitors from osteoblasts and osteocytes. The next section summarizes some of the important factors that have been shown to influence sclerostin, Dkk1, and SFRPs levels. 5.1. PTH Regulates Wnt Inhibitors. PTH is a well-known inhibitor of sclerostin expression in osteocytes [84]. This action probably mediates, at least partially, the anabolic effect of PTH on bone. The exact mechanism behind this inhibition is not well defined, but it might be similar to the upregulation of RANKL, which results from PKA activation. Indeed, it has been determined that sclerostin is a direct target gene of PKA [44]. PTH has also been reported to influence the production of Dkk1 through an unknown mechanism. When PTH was added to cultured preosteoblastic cells or injected to parathyroidectomized rats, Dkk1 levels were decreased [76, 85]. Conversely, it has been reported that postmenopausal women with primary hyperparathyroidism have higher serum Dkk1 levels than controls [86]. It is currently unknown whether PTH has a significant effect on the regulation of Dkk1 levels in normal physiology. 5.2. Age and Gender Affect Dkk1 and Sclerostin Levels. Notably, age and gender have been associated with differences in sclerostin and Dkk1 levels. Women tend to have lower serum sclerostin and higher Dkk1 levels than men, while both serum sclerostin and Dkk1 levels have been reported to increase with age [87, 88]. 5.3. Vitamin D Regulates Sclerostin Levels. In healthy men, supplementation of vitamin D and calcium has been associated with higher sclerostin levels, and observations supporting direct stimulation of sclerostin production by 1,25 (OH)2D have been made in cultured primary osteocytes [89, 90]. In contrast, in the case of vitamin D-deficient women treated with vitamin D3, higher serum levels of 25 (OH) D have been associated with lower sclerostin levels, indicating that health status might affect the regulation process [91]. 5.4. BMP Regulates Sclerostin and Dkk1. Activation of the BMP pathway through upregulation of BMP receptors in osteoblasts leads to higher levels of both sclerostin and Dkk1 [92]. Since sclerostin has been shown to act as a BMP signaling antagonist in osteocytes, this suggests that sclerostin is part of a negative feedback loop aimed at reducing its own production [57].
6. FGF23 Regulates Bone Metabolism FGF23 normally binds to FGFR and its coreceptor α-Klotho in order to induce changes in the kidney, the parathyroid gland, and the bone. The extracellular part of α-Klotho can also be cleaved and enter the circulation, where it mediates FGF23 action on other organs [93]. More recently, FGF23 and its coreceptor α-Klotho have been shown to directly stimulate Dkk1 and sFRP1 production in cultured osteoblastic rat cells, adding to the list of osteocytic proteins that influence bone turnover through Wnt/β-catenin pathway inhibition. Indeed, the binding of FGF23 to its receptor FGFR and the secreted form of its coreceptor Klotho on osteoblasts activates mitogen-activated protein kinase (MAPK) pathway, which leads to increased Dkk1 and sFRP1 production. While increased Dkk1 levels were associated with a decrease in β-catenin levels, sFRP1 did not seem to have the same effect [2]. Through their action on Dkk1, FGF23 and α-Klotho can therefore be considered as indirect Wnt inhibitors. Due to its important role in CKD (see section below), we will explain in the next section the effects of FGF23 on the kidney and the parathyroid gland.
104
6.1. Effects of FGF23 on the Kidney. FGF23 is widely recognized to increase phosphorus excretion by the kidney, decreasing the number of type IIa sodium-phosphate cotransporters in the proximal tubule [94]. FGF23 also inhibits the production of 1,25 (OH)2D by downregulating 1-α-hydroxylase, which hinders the intestinal absorption of calcium and phosphorus [95]. Mice with the absence of FGF23 develop vascular calcification secondary to elevated phosphorus and 1,25 (OH)2D levels [96]. 6.2. PTH and FGF23/Klotho Axis. Another important target organ of FGF23 is the parathyroid gland, where it suppresses PTH production. This inhibition seems to involve its binding to FGFR and α-Klotho, followed by the activation of the MAPK pathway, as demonstrated by loss of PTH inhibition when the pathway was blocked in rats [97]. FGF23 also stimulates the production of α-Klotho in the parathyroid gland, which could be expected to reinforce the inhibition of PTH [97]. Interestingly, PTH also appears to have a regulatory action on FGF23, upregulating its bone production [98]. In this regard, osteocytes seem to play a major role since activation of PTH1R in these cells significantly raises osteocytic FGF23 expression in mice [99]. This stimulatory effect of PTH probably involves the Wnt/β-catenin pathway since concomitant upregulation of sclerostin prevents the rise of FGF23 levels and β-catenin upregulation alone increases FGF23 [99]. Moreover, PTH also upregulates renal production of α-Klotho [100]. The effects of PTH on FGF23 in the bone and on α-Klotho in the kidney are thus a part of a negative feedback loop. 6.3. Vitamin D and Phosphorus Regulate FGF23. While FGF23 has a potent inactivating effect on 1-α-hydroxylase, 1,25 (OH)2D also regulates FGF23 production in vivo and in vitro [101-103]. This action is independent of PTH, as it has been observed in parathyroidectomized rats [100, 103]. In fact, it is thought that part of the action of PTH on FGF23 is through 1,25 (OH)2D upregulation, and an in vitro study has even reported no effect of PTH alone on FGF23 levels in osteoblastic cells [100, 102]. Interestingly, phosphorus does not seem to have a direct influence on FGF23 levels despite the fact that the two often correlate [101, 102]. Instead, it has been suggested that PTH is required to mediate phosphorus action on FGF23, as supported by the fact that parathyroidectomized rats have low FGF23 levels despite high phosphorus levels [100]. The effect of phosphorus on FGF23 also appears to be tied to 1,25 (OH)2D as phosphorus can synergistically increase the effect of 1,25 (OH)2D on FGF23, but does not have any effect in the absence of a functional vitamin D receptor [101, 104]. 6.4. Treatment to Reduce FGF23 Levels. FGF23 has been targeted directly with antibodies in CKD rats with hyperparathyroidism, but unfortunately, the results showed a worsening of hyperphosphatemia and vascular calcification [105]. The increased mortality rates that resulted from this study raised the concern that treatments aiming to reduce FGF23 could do more harm than good especially if phosphorus is not kept within normal values.
7. Role of Wnt Inhibitors in the Development of CKD-MBD Recent studies have associated anomalies of the Wnt/β-catenin pathway with bone disorders and vascular calcification in CKD, thus potentially contributing to CKD-MBD. This section will explain how Wnt inhibitors may negatively affect bone metabolism in CKD. 7.1. CKD Alters the Production of Wnt Inhibitors. A number of studies have now reported an increase in sclerostin, Dkk1, SFRP1, and SFRP4 levels as CKD progresses [2, 106, 107]. Notably, sclerostin levels increase in CKD despite higher renal elimination and have been associated with adynamic bone disease [2, 3, 9, 107–109]. Until now, the reason why Wnt inhibitors are elevated in CKD is unclear while some specific factors related to CKD may influence their levels.
105
7.2. Serum Phosphorus Is Associated with Wnt Inhibitors Levels. High serum phosphorus levels are a hallmark of CKD and are potentially the first responsible for increased Wnt inhibitors [110]. Indeed, serum sclerostin and DKK1 are positively correlated with phosphorus levels in CKD patients [3, 111]. Since FGF23 upregulates Dkk1 and high phosphorus levels are directly correlated with FGF23, phosphorus could increase Dkk1 levels through FGF23 [2]. Phosphorus supplementation also leads to higher levels of sclerostin and Dkk1 transcripts in the tibiae of parathyroidectomized CKD rats, which suggests that the effect is likely not mediated by PTH [109, 112]. While studies have reported a link between the levels of FGF23 and sclerostin in CKD, whether one upregulates the other is currently unknown [111, 113]. As both FGF23 and sclerostin are increased very early in the disease, they could be upregulated by the same unknown factor [9, 107]. 7.3. PTH Inhibits Sclerostin Production in CKD. Recent studies have reported a negative relationship between PTH and sclerostin. Indeed, non-CKD patients with hyperparathyroidism have consistently lower sclerostin levels than patients with normal or suppressed PTH levels [86, 114]. In CKD patients, serum sclerostin also inversely correlates with serum PTH but the sclerostin levels usually remain above those of healthy controls [115, 116]. The fact that both PTH and sclerostin are elevated in CKD may suggest that osteocytes become resistant to the suppressing actions of PTH as part of the development of skeletal PTH resistance [117] or that the unknown upregulator of sclerostin has a stronger effect in uremic condition. 7.4. Sclerostin, Dkk1, SFRP4, and RANKL in CKD. Apart from its recognized suppressing effect on bone formation, inhibition of the Wnt/β-catenin pathway has been associated with an increased RANKL/OPG ratio in non-CKD mice [28, 35, 36, 59]. Considering that Wnt inhibitors are generally upregulated in CKD, which likely contributes to suppression of the Wnt/β-catenin signaling in bone, they could also contribute to the increased levels of RANKL seen in hemodialysis patients [118]. Supporting this idea, in a genetic mouse model of polycystic kidney disease, Wnt/β- catenin pathway suppression was associated with high levels of both serum sclerostin and RANKL [107]. This is consistent with the lower RANKL/OPG ratio that was observed when β-catenin was constitutively activated in non-CKD mice [36] and suggests that sclerostin, by inhibiting the Wnt/β-catenin pathway of osteoblast-lineage cells in CKD, could also lead to increased bone resorption on top of decreased formation. Since the primary recognized role of sclerostin is to inhibit bone formation and increase bone resorption, it was suggested that high levels of sclerostin in CKD would contribute to increase bone fragility. A study by Ferreira et al. has recently shown that parathyroidectomized rats with nephrectomy-induced CKD had high levels of Dkk1 and sclerostin transcripts in their bones, which was associated with low bone formation rates and bone volume [109]. We have also observed increased Dkk1 transcription in the bones of our CKD rat model, which is associated with a decreased mineral content in the tibia (personal data). Finally, a study in a CKD mouse model reported that knocking out the SOST gene did not substantially affect bone structure, the only reported effect was being a decreased number of osteoclasts in the vertebrae, which could potentially be explained by a stimulation of RANKL by sclerostin [119]. In CKD stage 5 patients, high levels of sclerostin were associated with lower bone turnover, indicating that the Wnt inhibitors could contribute to renal osteodystrophy [120-122]. However, despite its association with a low bone turnover, sclerostin levels have also been positively associated with bone mineral density (BMD) in predialysis and dialysis patients, which may reflect the higher number of sclerostin producing osteocytes in patients with higher BMD [4, 122-125]. Meanwhile, serum Dkk1 has been associated with a lower BMD at the femoral neck in predialysis CKD patients [4]. As of today, no studies have evaluated the role of Wnt inhibitors in predicting fracture risk in CKD patients. Serum SFRP4 has been shown to increase when serum sclerostin is progressively downregulated in a mouse model of CKD, suggesting a possible role of SFRP4 in maintaining Wnt inhibition despite suppression of sclerostin [107]. Further studies are needed to better understand the role of SFRPs in regulating bone metabolism during CKD.
106
7.5. Wnt Inhibitors and Vascular Calcification. Vascular calcification is a complex process that involves transdifferentiation of vascular smooth muscle cells into osteoblast-like cells that calcify the vessel walls due to the deposition of bone matrix and mineralization [126]. It has been hypothesized that Wnt inhibitors would have the same suppressing effect on vascular calcification as on bone formation in CKD. In fact, recent studies have reported that low serum sclerostin levels were observed in CKD patients and kidney transplant recipients suffering from arterial calcification, which could suggest a protective effect on the vessels [127, 128]. Moreover, in hemodialysis patients, high sclerostin levels have been associated with a decrease in vascular calcification [125]. In contrast, a significant number of other studies observed a positive correlation between circulating sclerostin levels and vascular and aortic valve calcification in CKD patients [129–134]. These seemingly contradictory findings could reflect a number of pathological mechanisms: (1) sclerostin inhibits osteoblastic differentiation in bone but not osteoblastic transdifferentiation in the vessels; (2) sclerostin-induced decrease in bone turnover may lead to higher circulating calcium and phosphorus levels that stimulate vascular calcification; (3) there might be a shift in the source of sclerostin production in CKD. While the circulating sclerostin produced in the bone might indeed delay the progression of vascular calcification, the calcified vasculature could itself be a major source of sclerostin alongside the bone as the disease progresses, which could explain the positive association between the two; (4) as a corollary, the role of the Wnt inhibitors during progression of CKD could be different from their role in the healthy population, which would explain the variable results in nondialyzed versus dialyzed population. Increased vascular expression of sclerostin has been reported in the calcified aortic valves of CKD patients and the aortas of mice [132, 135] and also by our own observations in thoracic aortas from our CKD rats (personal data). Expression of other Wnt inhibitors, namely, SFRP-1, SFRP-2, and SFRP-4, has also been reported in the calcified vessels of a CKD rat model [132], supporting the idea that the vasculature could be a contributor to serum Wnt inhibitors levels. 7.6. Sclerostin and Survival in CKD. Despite its association with bone anomalies and vascular calcification, reports on the link between serum sclerostin levels and mortality rates are conflicting. While a few studies report that dialysis patients with high serum sclerostin levels have an improved survival rate and a decreased risk of cardiovascular mortality [125, 136, 137], there are also other reports showing a positive or no association of serum sclerostin with all-cause mortality [111, 138, 139] Until now, the association between levels of Wnt inhibitors and mortality in CKD is not well defined.
8. Is There a Role in Targeting Wnt Pathway Inhibitors in CKD-MBD? There is evidence that Wnt inhibitors are associated with bone turnover and mineral density anomalies in CKD and are potentially involved in the development of vascular calcification. However, their exact role still remains to be studied. Antibodies against Wnt inhibitors were proven useful to improve bone parameters in animal models of osteoporosis, fracture, and osteomalacia caused by hypophosphatemic rickets, suggesting they could also have a beneficial effect on bone in CKD [55, 56, 78, 140, 141]. 8.1. Effects of Anti-Sclerostin and Anti-Dkk1 on Bone in CKD. A recent study by Moe et al. using anti-sclerostin antibody in a rat model of CKD induced by genetic polycystic kidney disease has yielded conflicting results. In rats with low PTH, treatment with anti-sclerostin antibodies has succeeded in increasing trabecular bone volume and mineralization, but did not significantly improve bone strength. However, these bone anabolic effects were not observed in animals with high PTH levels, indicating that these antibodies might be useful in low bone turnover state [142]. Encouraging results have also been obtained by Fang et al. with anti-Dkk1 antibodies in mild CKD diabetic mice without hyperparathyroidism. In this model, treatment with anti-Dkk1 antibodies surprisingly also decreased sclerostin levels and improved bone abnormalities [106]. The same two studies as mentioned above showed that treatments with anti-sclerostin and anti-Dkk1 antibodies were associated with a decrease in the severity of vascular calcification, reinforcing the idea that antibodies against
107
Wnt inhibitors might be useful to prevent the onset of CKD-MBD [106, 142]. Nevertheless, treatment with these antibodies alone was not sufficient to prevent all the features of CKD-MBD, notably FGF23 elevation [106]. Simultaneous treatment with phosphate binders in order to avoid hyperphosphatemia and FGF23 elevation is therefore mandatory in order to control CKD-MBD [106]. In brief, the use of antibodies to selectively target abnormally expressed Wnt inhibitors in CKD seems therefore promising in CKD, but their efficacy and safety remain currently unknown. Furthermore, there are still concerns that inhibition of Wnt inhibitors may in fact worsen vascular calcification in human so that further studies need to be conducted before these antibodies could be used in CKD patients. Table 1 summarizes the animal studies that have been conducted regarding anti-sclerostin and anti-Dkk1 and their effects on bone and vascular calcification.
9. Conclusion Our knowledge of how the Wnt/β-catenin pathway is regulated and of how this regulation affects bone turnover in CKD continues to expand, allowing us to better understand the pathophysiologic mechanisms of CKD-MBD. While the handful of studies that have investigated the use of monoclonal antibodies against Wnt inhibitors in CKD yielded encouraging results, the safety of such treatment will have to be thoroughly assessed before their use can be considered in CKD patients. Mechanistic studies in animals and translational studies in humans including iliac crest biopsies will without a doubt allow us to discover new therapeutic treatments in order to improve CKD-related bone disease in the future.
Conflicts of Interest The authors declare that there is no conflict of interest regarding the publication of this paper.
Acknowledgements This work was supported by the Fondation du CHU de Québec from Université Laval, by a Biomedical Project Grant from the Kidney Foundation of Canada (KFOC160013), and by the KRESCENT program from Canadian Institutes of Health Research (CIHR)/Canadian Society of Nephrology (CSN)/Kidney Foundation of Canada (KFOC)/Fonds de Recherche du Québec Santé (FRQS) (KRES150006). Sarah-Kim Bisson holds masters scholarship from Canadian Institutes of Health Research (CIHR) and Fonds de Recherche du Québec Santé (FRQS).
108
Références [1] A. Mittalhenkle, D. L. Gillen, and C. O. Stehman-Breen, “Increased risk of mortality associated with
hip fracture in the dialysis population,” American Journal of Kidney Diseases, vol. 44, no. 4, pp. 672–679, 2004.
[2] N. Carrillo-Lopez, S. Panizo, C. Alonso-Montes et al., “Direct inhibition of osteoblastic Wnt pathway by fibroblast growth factor 23 contributes to bone loss in chronic kidney disease,” Kidney International, vol. 90, no. 1, pp. 77–89, 2016.
[3] S. Pelletier, L. Dubourg, M. C. Carlier, A. Hadj-Aissa, and D. Fouque, “The relation between renal function and serum sclerostin in adult patients with CKD,” Clinical Journal of the American Society of Nephrology, vol. 8, no. 5, pp. 819–823, 2013.
[4] S. Thambiah, R. Roplekar, P. Manghat et al., “Circulating sclerostin and Dickkopf-1 (DKK1) in predialysis chronic kidney disease (CKD): relationship with bone density and arterial stiffness,” Calcified Tissue International, vol. 90, no. 6, pp. 473–480, 2012.
[5] B. F. Boyce and L. P. Xing, “Functions of RANKL/RANK/OPG in bone modeling and remodeling,” Archives of Biochemistry and Biophysics, vol. 473, no. 2, pp. 139–146, 2008.
[6] T. Moriishi, R. Fukuyama, M. Ito et al., “Osteocyte network; a negative regulatory system for bone mass augmented by the induction of Rankl in osteoblasts and Sost in osteocytes at unloading,” PLoS One, vol. 7, no. 6, article e40143, 2012.
[7] F. Mac Way, M. Lessard, and M. H. Lafage-Proust, “Pathophysiology of chronic kidney disease-mineral and bone disorder,” Joint, Bone, Spine, vol. 79, no. 6, pp. 544–549, 2012.
[8] T. L. Nickolas, E. M. Stein, E. Dworakowski et al., “Rapid cortical bone loss in patients with chronic kidney disease,” Journal of Bone and Mineral Research, vol. 28, no. 8, pp. 1811–1820, 2013.
[9] T. Isakova, on behalf of the Chronic Renal Insufficiency Cohort (CRIC) Study Group, P. Wahl et al., “Fibroblast growth factor 23 is elevated before parathyroid hormone and phosphate in chronic kidney disease,” Kidney International, vol. 79, no. 12, pp. 1370–1378, 2011.
[10] A. Martin, V. David, and L. D. Quarles, “Regulation and function of the fgf23/klotho endocrine pathways,” Physiological Reviews, vol. 92, no. 1, pp. 131–155, 2012.
[11] M. R. Hanudel, K. Chua, M. Rappaport et al., “Effects of dietary iron intake and chronic kidney disease on fibroblast growth factor 23 metabolism in wild-type and hepcidin knockout mice,” American Journal of Physiology-Renal Physiology, vol. 311, no. 6, pp. F1369–F1377, 2016.
[12] S. M. Sprague, “Renal bone disease,” Current Opinion in Endocrinology, Diabetes and Obesity, vol. 17, no. 6, pp. 535–539, 2010.
[13] V. Chauhan, E. Kelepouris, N. Chauhan, and M. Vaid, “Current concepts and management strategies in chronic kidney disease-mineral and bone disorder,” Southern Medical Journal, vol. 105, no. 9, pp. 479–485, 2012.
[14] T. B. Drueke and Z. A. Massy, “Changing bone patterns with progression of chronic kidney disease,” Kidney International, vol. 89, no. 2, pp. 289–302, 2016.
[15] K. Atsumi, K. Kushida, K. Yamazaki, S. Shimizu, A. Ohmura, and T. Inoue, “Risk factors for vertebral fractures in renal osteodystrophy,” American Journal of Kidney Diseases, vol. 33, no. 2, pp. 287–293, 1999.
[16] M. Coco and H. Rush, “Increased incidence of hip fractures in dialysis patients with low serum parathyroid hormone,” American Journal of Kidney Diseases, vol. 36, no. 6, pp. 1115–1121, 2000.
[17] F. Mac-Way, L. Azzouz, C. Noel, and M. H. Lafage-Proust, “Osteomalacia induced by vitamin D deficiency in hemodialysis patients: the crucial role of vitamin D correction,” Journal of Bone and Mineral Metabolism, vol. 32, no. 2, pp. 215–219, 2014.
[18] Y. Kobayashi, K. Maeda, and N. Takahashi, “Roles of Wnt signaling in bone formation and resorption,” Japanese Dental Science Review, vol. 44, no. 1, pp. 76–82, 2008.
[19] V. Krishnan, H. U. Bryant, and O. A. Macdougald, “Regulation of bone mass by Wnt signaling,” Journal of Clinical Investigation, vol. 116, no. 5, pp. 1202–1209, 2006.
109
[20] N. S. Tolwinski, M. Wehrli, A. Rives, N. Erdeniz, S. DiNardo, and E. Wieschaus, “Wg/Wnt signal can be transmitted through arrow/LRP5,6 and Axin independently of Zw3/ Gsk3β activity,” Developmental Cell, vol. 4, no. 3, pp. 407–418, 2003.
[21] F. Cong, L. Schweizer, and H. Varmus, “Wnt signals across the plasma membrane to activate the beta-catenin pathway by forming oligomers containing its receptors, frizzled and LRP,” Development, vol. 131, no. 20, pp. 5103–5115, 2004.
[22] B. T. MacDonald, M. V. Semenov, H. Huang, and X. He, “Dissecting molecular differences between Wnt coreceptors LRP5 and LRP6,” PLoS One, vol. 6, no. 8, article e23537, 2011.
[23] H. Yamamoto, S. Kishida, M. Kishida, S. Ikeda, S. Takada, and A. Kikuchi, “Phosphorylation of Axin, a Wnt signal negative regulator, by glycogen synthase kinase-3β regulates its stability,” Journal of Biological Chemistry, vol. 274, no. 16, pp. 10681–10684, 1999.
[24] P. Clement-Lacroix, M. R. Ai, F. Morvan et al., “Lrp5-independent activation of Wnt signaling by lithium chloride increases bone formation and bone mass in mice,” Proceedings of the National Academy of Sciences of the United States of America, vol. 102, no. 48, pp. 17406–17411, 2005.
[25] D. B. Bernkopf, M. V. Hadjihannas, and J. Behrens, “Negative- feedback regulation of the Wnt pathway by conductin/axin2 involves insensitivity to upstream signalling,” Journal of Cell Science, vol. 128, no. 1, pp. 33–39, 2015.
[26] H. Aberle, A. Bauer, J. Stappert, A. Kispert, and R. Kemler, “β-Catenin is a target for the ubiquitin-proteasome pathway,” EMBO Journal, vol. 16, no. 13, pp. 3797–3804, 1997.
[27] X. L. Tu, J. Delgado-Calle, K. W. Condon et al., “Osteocytes mediate the anabolic actions of canonical Wnt/β-catenin signaling in bone,” Proceedings of the National Academy of Sciences of the United States of America, vol. 112, no. 5, pp. E478–E486, 2015.
[28] S. L. Holmen, C. R. Zylstra, A. Mukherjee et al., “Essential role of beta-catenin in postnatal bone acquisition,” Journal of Biological Chemistry, vol. 280, no. 22, pp. 21162–21168, 2005.
[29] D. A. Glass II, P. Bialek, J. D. Ahn et al., “Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation,” Developmental Cell, vol. 8, no. 5, pp. 751–764, 2005.
[30] S. L. Dallas, M. Prideaux, and L. F. Bonewald, “The osteocyte: an endocrine cell and more,” Endocrine Reviews, vol. 34, no. 5, pp. 658–690, 2013.
[31] L. F. Bonewald and M. L. Johnson, “Osteocytes, mechanosensing and Wnt signaling,” Bone, vol. 42, no. 4, pp. 606– 615, 2008.
[32] S. L. York, P. Sethu, and M. M. Saunders, “Impact of gap junctional intercellular communication on MLO-Y4 sclerostin and soluble factor expression,” Annals of Biomedical Engineering, vol. 44, no. 4, pp. 1170–1180, 2016.
[33] A. G. Robling, P. J. Niziolek, L. A. Baldridge et al., “Mechanical stimulation of bone in vivo reduces osteocyte expression of Sost/sclerostin,” Journal of Biological Chemistry, vol. 283, no. 9, pp. 5866–5875, 2008.
[34] J. A. Robinson, M. Chatterjee-Kishore, P. J. Yaworsky et al., “Wnt/β-catenin signaling is a normal physiological response to mechanical loading in bone,” Journal of Biological Chemistry, vol. 281, no. 42, pp. 31720–31728, 2006.
[35] I. Kramer, C. Halleux, H. Keller et al., “Osteocyte Wnt/β-catenin signaling is required for normal bone homeostasis,” Molecular and Cellular Biology, vol. 30, no. 12, pp. 3071–3085, 2010.
[36] J. F. Li, Q. W. Bao, S. X. Chen et al., “Different bone remodeling levels of trabecular and cortical bone in response to changes in Wnt/β-catenin signaling in mice,” Journal of Orthopaedic Research, vol. 35, no. 4, pp. 812–819, 2017.
[37] J. C. Huang, T. Sakata, L. L. Pfleger et al., “PTH differentially regulates expression of RANKL and OPG,” Journal of Bone and Mineral Research, vol. 19, no. 2, pp. 235–244, 2004.
[38] M. Shimizu, H. Noda, E. Joyashiki et al., “The optimal duration of PTH(1-34) infusion is one hour per day to increase bone mass in rats,” Biological & Pharmaceutical Bulletin, vol. 39, no. 4, pp. 625–630, 2016.
[39] M. R. Rubin and J. P. Bilezikian, “Parathyroid hormone as an anabolic skeletal therapy,” Drugs, vol. 65, no. 17, pp. 2481–2498, 2005.
110
[40] M. Wan, C. Z. Yang, J. Li et al., “Parathyroid hormone signaling through low-density lipoprotein-related protein 6,” Genes & Development, vol. 22, no. 21, pp. 2968–2979, 2008.
[41] S. Hino, C. Tanji, K. I. Nakayama, and A. Kikuchi, “Phosphorylation of beta-catenin by cyclic AMP-dependent protein kinase stabilizes beta-catenin through inhibition of its ubiquitination,” Molecular & Cellular Biology, vol. 25, no. 20, pp. 9063–9072, 2005.
[42] C. J. Li, Q. J. Xing, B. Yu et al., “Disruption of LRP6 in osteoblasts blunts the bone anabolic activity of PTH,” Journal of Bone & Mineral Research, vol. 28, no. 10, pp. 2094–2108, 2013.
[43] C. A. O'Brien, L. I. Plotkin, C. Galli et al., “Control of bone mass and remodeling by PTH receptor signaling in osteocytes,” PLoS One, vol. 3, no. 8, article e2942, 2008.
[44] H. Keller and M. Kneissel, “SOST is a target gene for PTH in bone,” Bone, vol. 37, no. 2, pp. 148–158, 2005.
[45] R. C. Riddle, C. R. Diegel, J. M. Leslie et al., “Lrp5 and Lrp6 exert overlapping functions in osteoblasts during postnatal bone acquisition,” PLoS One, vol. 8, no. 5, article e63323, 2013.
[46] U. T. Iwaniec, T. J. Wronski, J. Liu et al., “PTH stimulates bone formation in mice deficient in Lrp5,” Journal of Bone and Mineral Research, vol. 22, no. 3, pp. 394–402, 2007.
[47] K. Sawakami, A. G. Robling, M. R. Ai et al., “The Wnt coreceptor LRP5 is essential for skeletal mechanotransduction but not for the anabolic bone response to parathyroid hormone treatment,” Journal of Biological Chemistry, vol. 281, no. 33, pp. 23698–23711, 2006.
[48] R. L. van Bezooijen, B. A. J. Roelen, A. Visser et al., “Sclerostin is an osteocyte-expressed negative regulator of bone formation, but not a classical BMP antagonist,” Journal of Experimental Medicine, vol. 199, no. 6, pp. 805–814, 2004.
[49] A. H. van Lierop, N. M. Appelman-Dijkstra, and S. E. Papapoulos, “Sclerostin deficiency in humans,” Bone, vol. 96, pp. 51–62, 2017.
[50] M. R. Belkhribchia, C. Collet, J. L. Laplanche, and R. Hassani, “Novel SOST gene mutation in a sclerosteosis patient from Morocco: a case report,” European Journal of Medical Genetics, vol. 57, no. 4, pp. 133–137, 2014.
[51] E. Piters, C. Culha, M. Moester et al., “First missense mutation in the SOST gene causing sclerosteosis by loss of Sclerostin function,” Human Mutation, vol. 31, no. 7, pp. E1526–E1543, 2010.
[52] X. D. Li, M. S. Ominsky, Q. T. Niu et al., “Targeted deletion of the sclerostin gene in mice results in increased bone formation and bone strength,” Journal of Bone and Mineral Research, vol. 23, no. 6, pp. 860–869, 2008.
[53] D. G. Winkler, M. K. Sutherland, J. C. Geoghegan et al., “Osteocyte control of bone formation via sclerostin, a novel BMP antagonist,” EMBO Journal, vol. 22, no. 23, pp. 6267– 6276, 2003.
[54] P. K. Suen, T. Y. Zhu, D. H. K. Chow, L. Huang, L.-Z. Zheng, and L. Qin, “Sclerostin antibody treatment increases bone formation, bone mass, and bone strength of intact bones in adult male rats,” Scientific Reports, vol. 5, no. 1, 2015.
[55] M. S. Ominsky, C. Y. Li, X. D. Li et al., “Inhibition of sclerostin by monoclonal antibody enhances bone healing and improves bone density and strength of nonfractured bones,” Journal of Bone and Mineral Research, vol. 26, no. 5, pp. 1012–1021, 2011.
[56] G. Feng, Z. Chang-Qing, C. Yi-Min, and L. Xiao-Lin, “Systemic administration of sclerostin monoclonal antibody accelerates fracture healing in the femoral osteotomy model of young rats,” International Immunopharmacology, vol. 24, no. 1, pp. 7–13, 2015.
[57] C. Krause, O. Korchynskyi, K. de Rooij et al., “Distinct modes of inhibition by sclerostin on bone morphogenetic protein and Wnt signaling pathways,” Journal of Biological Chemistry, vol. 285, no. 53, pp. 41614–41626, 2010.
[58] G. J. Atkins, P. S. Rowe, H. P. Lim et al., “Sclerostin is a locally acting regulator of late-osteoblast/preosteocyte differentiation and regulates mineralization through a MEPEASARM- dependent mechanism,” Journal of Bone and Mineral Research, vol. 26, no. 7, pp. 1425–1436, 2011.
[59] A. R. Wijenayaka, M. Kogawa, H. P. Lim, L. F. Bonewald, D. M. Findlay, and G. J. Atkins, “Sclerostin stimulates osteocyte support of osteoclast activity by a RANKL-dependent pathway,” PLoS One, vol. 6, no. 10, p. e25900, 2011.
111
[60] H. Devarajan-Ketha, T. A. Craig, B. J. Madden, H. Robert Bergen III, and R. Kumar, “The sclerostin-bone protein interactome,” Biochemical and Biophysical Research Communications, vol. 417, no. 2, pp. 830–835, 2012.
[61] P. Hernandez, C. Whitty, R. John Wardale, and F. M. D. Henson, “New insights into the location and form of sclerostin,” Biochemical and Biophysical Research Communications, vol. 446, no. 4, pp. 1108–1113, 2014.
[62] D. Simon-Chazottes, S. Tutois, M. Kuehn et al., “Mutations in the gene encoding the low-density lipoprotein receptor LRP4 cause abnormal limb development in the mouse,” Genomics, vol. 87, no. 5, pp. 673–677, 2006.
[63] A. Duchesne, M. Gautier, S. Chadi et al., “Identification of a doublet missense substitution in the bovine LRP4 gene as a candidate causal mutation for syndactyly in Holstein cattle,” Genomics, vol. 88, no. 5, pp. 610–621, 2006.
[64] M. Afzal, Q. Zaman, U. Kornak, S. Mundlos, S. Malik, and R. Flottmann, “Novel splice mutation in LRP4 causes severe type of Cenani-Lenz syndactyly syndrome with oro-facial and skeletal symptoms,” European Journal of Medical Genetics, vol. 60, no. 8, pp. 421–425, 2017.
[65] B. Zhang, S. W. Luo, Q. Wang, T. Suzuki, W. C. Xiong, and L. Mei, “LRP4 serves as a coreceptor of agrin,” Neuron, vol. 60, no. 2, pp. 285–297, 2008.
[66] Y. N. Zong, B. Zhang, S. Y. Gu et al., “Structural basis of agrin-LRP4-MuSK signaling,” Genes & Development, vol. 26, no. 3, pp. 247–258, 2012.
[67] O. Higuchi, J. Hamuro, M. Motomura, and Y. Yamanashi, “Autoantibodies to low-density lipoprotein receptor-related protein 4 in myasthenia gravis,” Annals of Neurology, vol. 69, no. 2, pp. 418–422, 2011.
[68] H. Y. Choi, M. Dieckmann, J. Herz, and A. Niemeier, “Lrp4, a novel receptor for Dickkopf 1 and sclerostin, is expressed by osteoblasts and regulates bone growth and turnover in vivo,” PLoS One, vol. 4, no. 11, article e7930, 2009.
[69] I. Fijalkowski, E. Geets, E. Steenackers et al., “A novel domain-specific mutation in a sclerosteosis patient suggests a role of LRP4 as an anchor for sclerostin in human bone,” Journal of Bone & Mineral Research, vol. 31, no. 4, pp. 874–881, 2016.
[70] L. Xiong, J. U. Jung, H. T. Wu et al., “Lrp4 in osteoblasts suppresses bone formation and promotes osteoclastogenesis and bone resorption,” Proceedings of the National Academy of Sciences of the United States of America, vol. 112, no. 11, pp. 3487–3492, 2015.
[71] M. K. Chang, I. Kramer, T. Huber et al., “Disruption of Lrp4 function by genetic deletion or pharmacological blockade increases bone mass and serum sclerostin levels,” Proceedings of the National Academy of Sciences of the United States of America, vol. 111, no. 48, pp. E5187–E5195, 2014.
[72] N. Asai, B. Ohkawara, M. Ito, A. Masuda, N. Ishiguro, and K. Ohno, “LRP4 induces extracellular matrix productions and facilitates chondrocyte differentiation,” Biochemical and Biophysical Research Communications, vol. 451, no. 2, pp. 302–307, 2014.
[73] O. Leupin, E. Piters, C. Halleux et al., “Bone overgrowth-associated mutations in the LRP4 gene impair sclerostin facilitator function,” Journal of Biological Chemistry, vol. 286, no. 22, pp. 19489–19500, 2011.
[74] L. Grotewold, T. Theil, and U. Ruther, “Expression pattern of Dkk-1 during mouse limb development,” Mechanisms of Development, vol. 89, no. 1-2, pp. 151–153, 1999.
[75] J. Li, I. Sarosi, R. C. Cattley et al., “Dkk1-mediated inhibition of Wnt signaling in bone results in osteopenia,” Bone, vol. 39, no. 4, pp. 754–766, 2006.
[76] J. Guo, M. L. Liu, D. H. Yang et al., “Suppression of Wnt signaling by Dkk1 attenuates PTH-mediated stromal cell response and new bone formation,” Cell Metabolism, vol. 11, no. 2, pp. 161–171, 2010.
[77] F. Morvan, K. Boulukos, P. Clement-Lacroix et al., “Deletion of a single allele of the Dkk1 gene leads to an increase in bone formation and bone mass,” Journal of Bone & Mineral Research, vol. 21, no. 6, pp. 934–945, 2006.
[78] H. T. Jin, B. L. Wang, J. Li et al., “Anti-DKK1 antibody promotes bone fracture healing through activation of β-catenin signaling,” Bone, vol. 71, pp. 63–75, 2015.
112
[79] H. Nakajima, M. Ito, Y. Morikawa et al., “Wnt modulators, SFRP-1, and SFRP-2 are expressed in osteoblasts and differentially regulate hematopoietic stem cells,” Biochemical & Biophysical Research Communications, vol. 390, no. 1, pp. 65–70, 2009.
[80] P. V. N. Bodine, “Wnt signaling control of bone cell apoptosis,” Cell Research, vol. 18, no. 2, pp. 248–253, 2008.
[81] K. D. Hausler, N. J. Horwood, Y. Chuman et al., “Secreted frizzled-related protein-1 inhibits RANKL-dependent osteoclast formation,” Journal of Bone and Mineral Research, vol. 19, no. 11, pp. 1873–1881, 2004.
[82] T. Berndt, T. A. Craig, A. E. Bowe et al., “Secreted frizzled-related protein 4 is a potent tumor-derived phosphaturic agent,” Journal of Clinical Investigation, vol. 112, no. 5, pp. 785–794, 2003.
[83] M. Christov, S. Koren, Q. Yuan, R. Baron, and B. Lanske, “Genetic ablation of Sfrp4 in mice does not affect serum phosphate homeostasis,” Endocrinology, vol. 152, no. 5, pp. 2031–2036, 2011.
[84] T. Bellido, A. A. Ali, I. Gubrij et al., “Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis,” Endocrinology, vol. 146, no. 11, pp. 4577–4583, 2005.
[85] N. H. Kulkarni, D. L. Halladay, R. R. Miles et al., “Effects of parathyroid hormone on Wnt signaling pathway in bone,” Journal of Cellular Biochemistry, vol. 95, no. 6, pp. 1178–1190, 2005.
[86] O. Viapiana, E. Fracassi, S. Troplini et al., “Sclerostin and DKK1 in primary hyperparathyroidism,” Calcified Tissue International, vol. 92, no. 4, pp. 324–329, 2013.
[87] P. Dovjak, S. Dorfer, U. Foger-Samwald, S. Kudlacek, R. Marculescu, and P. Pietschmann, “Serum levels of sclerostin and Dickkopf-1: effects of age, gender and fracture status,” Gerontology, vol. 60, no. 6, pp. 493–501, 2014.
[88] U. I. Mödder, K. A. Hoey, S. Amin et al., “Relation of age, gender, and bone mass to circulating sclerostin levels in women and men,” Journal of Bone and Mineral Research, vol. 26, no. 2, pp. 373–379, 2011.
[89] B. Dawson-Hughes, S. S. Harris, L. Ceglia, and N. J. Palermo, “Effect of supplemental vitamin D and calcium on serum sclerostin levels,” European Journal of Endocrinology, vol. 170, no. 4, pp. 645–650, 2014.
[90] A. R. Wijenayaka, D. Q. Yang, M. Prideaux et al., “1α,25-dihydroxyvitamin D 3 stimulates human SOST gene expression and sclerostin secretion,” Molecular and Cellular Endocrinology, vol. 413, pp. 157–167, 2015.
[91] M. Cidem, I. Karacan, N. B. Arat et al., “Serum sclerostin is decreased following vitamin D treatment in young vitamin D-deficient female adults,” Rheumatology International, vol. 35, no. 10, pp. 1739–1742, 2015.
[92] N. Kamiya, T. Kobayashi, Y. Mochida et al., “Wnt inhibitors Dkk1 and Sost are downstream targets of BMP signaling through the type IA receptor (BMPRIA) in osteoblasts,” Journal of Bone and Mineral Research, vol. 25, no. 2, pp. 200–210, 2010.
[93] M. C. Hu, M. Kuro-o, and O. W. Moe, “Secreted klotho and chronic kidney disease,” in Endocrine Fgfs and Klothos, M. Kuro-O, Ed., vol. 728, pp. 126–157, Springer-Verlag Berlin, Berlin, 2012.
[94] J. Gattineni, C. Bates, K. Twombley et al., “FGF23 decreases renal NaPi-2a and NaPi-2c expression and induces hypophosphatemia in vivo predominantly via FGF receptor 1,” American Journal of Physiology-Renal Physiology, vol. 297, no. 2, pp. F282–F291, 2009.
[95] F. Perwad, M. Y. H. Zhang, H. S. Tenenhouse, and A. A. Portale, “Fibroblast growth factor 23 impairs phosphorus and vitamin D metabolism in vivo and suppresses 25-hydroxyvitamin D-1α-hydroxylase expression in vitro,” American Journal of Physiology-Renal Physiology, vol. 293, no. 5, pp. F1577–F1583, 2007.
[96] D. Sitara, M. S. Razzaque, M. Hesse et al., “Homozygous ablation of fibroblast growth factor-23 results in hyperphosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-deficient mice,” Matrix Biology, vol. 23, no. 7, pp. 421–432, 2004.
[97] I. Z. Ben-Dov, H. Galitzer, V. Lavi-Moshayoff et al., “The parathyroid is a target organ for FGF23 in rats,” Journal of Clinical Investigation, vol. 117, no. 12, pp. 4003–4008, 2007.
113
[98] V. Lavi-Moshayoff, G. Wasserman, T. Meir, J. Silver, and T. Naveh-Many, “PTH increases FGF23 gene expression and mediates the high-FGF23 levels of experimental kidney failure: a bone parathyroid feedback loop,” American Journal of Physiology-Renal Physiology, vol. 299, no. 4, pp. F882–F889, 2010.
[99] Y. Rhee, N. Bivi, E. Farrow et al., “Parathyroid hormone receptor signaling in osteocytes increases the expression of fibroblast growth factor-23 in vitro and in vivo,” Bone, vol. 49, no. 4, pp. 636–643, 2011.
[100] I. López, M. E. Rodríguez-Ortiz, Y. Almadén et al., “Direct and indirect effects of parathyroid hormone on circulating levels of fibroblast growth factor 23 in vivo,” Kidney International, vol. 80, no. 5, pp. 475–482, 2011.
[101] M. Ito, Y. Sakai, M. Furumoto et al., “Vitamin D and phosphate regulate fibroblast growth factor-23 in K-562 cells,” American Journal of Physiology-Endocrinology and Metabolism, vol. 288, no. 6, pp. E1101–E1109, 2005.
[102] S. G. Liu, W. Tang, J. P. Zhou et al., “Fibroblast growth factor 23 is a counter-regulatory phosphaturic hormone for vitamin D,” Journal of the American Society of Nephrology, vol. 17, no. 5, pp. 1305–1315, 2006.
[103] H. Saito, A. Maeda, S. Ohtomo et al., “Circulating FGF-23 is regulated by 1α,25-dihydroxyvitamin D3 and phosphorus in vivo,” Journal of Biological Chemistry, vol. 280, no. 4, pp. 2543–2549, 2005.
[104] T. Shimada, Y. Yamazaki, M. Takahashi et al., “Vitamin D receptor-independent FGF23 actions in regulating phosphate and vitamin D metabolism,” American Journal of Physiology-Renal Physiology, vol. 289, no. 5, pp. F1088–F1095, 2005.
[105] V. Shalhoub, E. M. Shatzen, S. C. Ward et al., “FGF23 neutralization improves chronic kidney disease-associated hyperparathyroidism yet increases mortality,” Journal of Clinical Investigation, vol. 122, no. 7, pp. 2543–2553, 2012.
[106] Y. Fang, C. Ginsberg, M. Seifert et al., “CKD-induced wingless/integration1 inhibitors and phosphorus cause the CKD-mineral and bone disorder,” Journal of the American Society of Nephrology, vol. 25, no. 8, pp. 1760–1773, 2014.
[107] Y. Sabbagh, F. G. Graciolli, S. O'Brien et al., “Repression of osteocyte Wnt/β-catenin signaling is an early event in the progression of renal osteodystrophy,” Journal of Bone and Mineral Research, vol. 27, no. 8, pp. 1757–1772, 2012.
[108] D. Cejka, R. Marculescu, N. Kozakowski et al., “Renal elimination of sclerostin increases with declining kidney function,” The Journal of Clinical Endocrinology & Metabolism, vol. 99, no. 1, pp. 248–255, 2014.
[109] J. C. Ferreira, G. O. Ferrari, K. R. Neves et al., “Effects of dietary phosphate on adynamic bone disease in rats with chronic kidney disease - role of sclerostin?,” PLoS One, vol. 8, no. 11, p. e79721, 2013.
[110] H. H. Malluche, H. Mawad, and M. C. Monier-Faugere, “The importance of bone health in end-stage renal disease: out of the frying pan, into the fire?,” Nephrology Dialysis Transplantation, vol. 19, Supplement_1, pp. I9–I13, 2004.
[111] M. Kanbay, D. Siriopol, M. Saglam et al., “Serum sclerostin and adverse outcomes in nondialyzed chronic kidney disease patients,” The Journal of Clinical Endocrinology & Metabolism, vol. 99, no. 10, pp. E1854–E1861, 2014.
[112] T. Isakova and M. S. Wolf, “FGF23 or PTH: which comes first in CKD?,” Kidney International, vol. 78, no. 10, pp. 947–949, 2010.
[113] R. B. de Oliveira, F. G. Graciolli, L. M. dos Reis et al., “Disturbances of Wnt/β-catenin pathway and energy metabolism in early CKD: effect of phosphate binders,” Nephrology Dialysis Transplantation, vol. 28, no. 10, pp. 2510–2517, 2013.
[114] M. S. M. Ardawi, A. M. Al-Sibiany, T. M. Bakhsh, A. A. Rouzi, and M. H. Qari, “Decreased serum sclerostin levels in patients with primary hyperparathyroidism: a cross-sectional and a longitudinal study,” Osteoporosis International, vol. 23, no. 6, pp. 1789–1797, 2012.
[115] P. Delanaye, J. M. Krzesinski, X. Warling et al., “Clinical and biological determinants of sclerostin plasma concentration in hemodialysis patients,” Nephron Clinical Practice, vol. 128, no. 1-2, pp. 127–134, 2014.
114
[116] S. Yamada, K. Tsuruya, M. Tokumoto, H. Yoshida, H. Ooboshi, and T. Kitazono, “Factors associated with serum soluble inhibitors of Wnt-β-catenin signaling (sclerostin and dickkopf-1) in patients undergoing peritoneal dialysis,” Nephrology, vol. 20, no. 9, pp. 639–645, 2015.
[117] K. J. Martin and E. A. Gonzalez, “Metabolic bone disease in chronic kidney disease,” Journal of the American Society of Nephrology, vol. 18, no. 3, pp. 875–885, 2007.
[118] I. Avbersek-Luznik, B. P. Balon, I. Rus, and J. Marc, “Increased bone resorption in HD patients: is it caused by elevated RANKL synthesis?,” Nephrology Dialysis Transplantation, vol. 20, no. 3, pp. 566–570, 2005.
[119] D. Cejka, D. Parada-Rodriguez, S. Pichler et al., “Only minor differences in renal osteodystrophy features between wild-type and sclerostin knockout mice with chronic kidney disease,” Kidney International, vol. 90, no. 4, pp. 828–834, 2016.
[120] D. Cejka, J. Herberth, A. J. Branscum et al., “Sclerostin and Dickkopf-1 in renal osteodystrophy,” Clinical Journal of the American Society of Nephrology, vol. 6, no. 4, pp. 877–882, 2011.
[121] R. A. de Oliveira, F. C. Barreto, M. Mendes et al., “Peritoneal dialysis per se is a risk factor for sclerostin-associated adynamic bone disease,” Kidney International, vol. 87, no. 5, pp. 1039–1045, 2015.
[122] H. H. Malluche, D. L. Davenport, T. Cantor, and M. C. Monier-Faugere, “Bone mineral density and serum biochemical predictors of bone loss in patients with CKD on dialysis,” Clinical Journal of the American Society of Nephrology, vol. 9, no. 7, pp. 1254–1262, 2014.
[123] D. Cejka, A. Jager-Lansky, H. Kieweg et al., “Sclerostin serum levels correlate positively with bone mineral density and microarchitecture in haemodialysis patients,” Nephrology Dialysis Transplantation, vol. 27, no. 1, pp. 226–230, 2012.
[124] E. Ishimura, S. Okuno, M. Ichii et al., “Relationship between serum sclerostin, bone metabolism markers, and bone mineral density in maintenance hemodialysis patients,” The Journal of Clinical Endocrinology & Metabolism, vol. 99, no. 11, pp. 4315–4320, 2014.
[125] G. Jean, C. Chazot, E. Bresson, E. Zaoui, and E. Cavalier, “High serum sclerostin levels are associated with a better outcome in haemodialysis patients,” Nephron, vol. 132, no. 3, pp. 181–190, 2016.
[126] J. A. Leopold, “Vascular calcification: mechanisms of vascular smooth muscle cell calcification,” Trends in Cardiovascular Medicine, vol. 25, no. 4, pp. 267–274, 2015.
[127] K. J. Claes, L. Viaene, S. Heye, B. Meijers, P. d'Haese, and P. Evenepoel, “Sclerostin: another vascular calcification inhibitor?,” The Journal of Clinical Endocrinology & Metabolism, vol. 98, no. 8, pp. 3221–3228, 2013.
[128] P. Evenepoel, E. Goffin, B. Meijers et al., “Sclerostin serum levels and vascular calcification progression in prevalent renal transplant recipients,” The Journal of Clinical Endocrinology & Metabolism, vol. 100, no. 12, pp. 4669–4676, 2015.
[129] S. Pelletier, C. B. Confavreux, J. Haesebaert et al., “Serum sclerostin: the missing link in the bone-vessel cross-talk in hemodialysis patients?,” Osteoporosis International, vol. 26, no. 8, pp. 2165–2174, 2015.
[130] W. Lv, L. N. Guan, Y. Zhang, S. Q. Yu, B. F. Cao, and Y. Q. Ji, “Sclerostin as a new key factor in vascular calcification in chronic kidney disease stages 3 and 4,” International Urology and Nephrology, vol. 48, no. 12, pp. 2043–2050, 2016.
[131] X. R. Wang, L. A. Yuan, J. J. Zhang, L. Hao, and D. G. Wang, “Serum sclerostin values are associated with abdominal aortic calcification and predict cardiovascular events in patients with chronic kidney disease stages 3-5D,” Nephrology, vol. 22, no. 4, pp. 286–292, 2017.
[132] V. M. Brandenburg, R. Kramann, R. Koos et al., “Relationship between sclerostin and cardiovascular calcification in hemodialysis patients: a cross-sectional study,” BMC Nephrology, vol. 14, no. 1, 2013.
[133] A. R. Qureshi, H. Olauson, A. Witasp et al., “Increased circulating sclerostin levels in end-stage renal disease predict biopsy-verified vascular medial calcification and coronary artery calcification,” Kidney International, vol. 88, no. 6, pp. 1356–1364, 2015.
[134] M. Morena, I. Jaussent, A. M. Dupuy et al., “Osteoprotegerin and sclerostin in chronic kidney disease prior to dialysis: potential partners in vascular calcifications,” Nephrology Dialysis Transplantation, vol. 30, no. 8, pp. 1345–1356, 2015.
115
[135] D. Zhu, N. C. W. Mackenzie, J. L. Millán, C. Farquharson, and V. E. MacRae, “The appearance and modulation of osteocyte marker expression during calcification of vascular smooth muscle cells,” PLoS One, vol. 6, no. 5, p. e19595, 2011.
[136] L. Viaene, G. J. Behets, K. Claes et al., “Sclerostin: another bone-related protein related to all-cause mortality in haemodialysis?,” Nephrology Dialysis Transplantation, vol. 28, no. 12, pp. 3024–3030, 2013.
[137] C. Drechsler, P. Evenepoel, M. G. Vervloet et al., “High levels of circulating sclerostin are associated with better cardiovascular survival in incident dialysis patients: results from the NECOSAD study,” Nephrology Dialysis Transplantation, vol. 30, no. 2, pp. 288–293, 2015.
[138] F. L. C. Gonçalves, R. M. Elias, L. M. dos Reis et al., “Serum sclerostin is an independent predictor of mortality in hemodialysis patients,” BMC Nephrology, vol. 15, no. 1, 2014.
[139] M. Kanbay, Y. Solak, D. Siriopol et al., “Sclerostin, cardiovascular disease and mortality: a systematic review and metaanalysis,” International Urology and Nephrology, vol. 48, no. 12, pp. 2029–2042, 2016.
[140] M. S. Ominsky, R. W. Boyce, X. D. Li, and H. Z. Ke, “Effects of sclerostin antibodies in animal models of osteoporosis,” Bone, vol. 96, pp. 63–75, 2017.
[141] Y. S. Ren, X. L. Han, Y. Jing et al., “Sclerostin antibody (Scl-Ab) improves osteomalacia phenotype in dentin matrix protein 1(Dmp1) knockout mice with little impact on serum levels of phosphorus and FGF23,” Matrix Biology, vol. 52-54, pp. 151–161, 2016.
[142] S. M. Moe, N. X. Chen, C. L. Newman et al., “Anti-sclerostin antibody treatment in a rat model of progressive renal osteodystrophy,” Journal of Bone and Mineral Research, vol. 30, no. 3, pp. 499–509, 2015.
116
Figure Legends Figure 1: Mineral and bone disorders in chronic kidney disease (CKD). Elevated phosphorus (P), low calcium (Ca), and 1,25 (OH)2D (vitD) stimulate parathyroid hormone (PTH) production by the parathyroid glands, which leads to increased bone turnover and P excretion by the kidneys. High PTH and P also seem to either directly or indirectly stimulate fibroblast growth factor 23 (FGF23) production by osteoblasts and osteocytes, though this seems at least partly mediated by an upregulation of vitD by high PTH, which in turn activates FGF23 production. While FGF23 stimulates P excretion, it further suppresses vitD production. Suppression of PTH levels may arise from Ca and vitD supplements or treatment with calcimimetics in CKD. Suppressed PTH levels will lead to decreased bone turnover. Figure 2: Wnt/β-catenin pathway and bone formation. On the left, no Wnt ligand is present and the phosphorylation complex, which consists of GSK3β, APC, CK1, and Axin, can freely phosphorylate β-catenin. This phosphorylation signals to an ubiquitin ligase that β-catenin has to be marked by degradation by the proteasome. On the right, a Wnt ligand binds to Frizzled (Fz) receptor and Lrp5/6 coreceptor. This causes Dvl to phosphorylate Lrp5/6, leading to the recruitment and subsequent inactivation of the phosphorylation complex. β-Catenin is free to translocate to the nucleus and act as a transcription factor for osteoblastic genes. Figure 3: Proposed mechanisms by which PTH activates Wnt/β-catenin pathway in osteoblasts and osteocytes to modulate bone turnover. In the osteoblast (left), PTH binding to Lrp6 and PTH1R activates PKA, which activates the Wnt/β-catenin pathway by phosphorylating Lrp6. The levels of β-catenin rise, which leads to modulation of RANKL and OPG expression resulting in a decreased RANKL/OPG ratio. PKA itself can also directly stabilize β-catenin through phosphorylation and also directly stimulates RANKL production. The increased production of RANKL when PTH is administered continuously might be mediated by this action of PKA. A similar mechanism occurs in the osteocyte (right), presumably also through Lrp6 signaling. While it is unconfirmed whether PKA can also directly stimulate RANKL transcription in osteocytes, continuous PTH in osteocytes activates RANKL production while only activating the Wnt/β-catenin instead increases OPG production. A notable difference between how both cell types respond to PTH is that PKA activation inhibits sclerostin production in osteocytes. The decrease in sclerostin could partly explain the resulting increase in bone formation when PTH is given intermittently. Moreover, expression of sclerostin in osteocytes seems to further upregulate RANKL in those same cells. Figure 4: Mechanisms of action of common Wnt inhibitors. Sclerostin (light green) and Dkk1 (light pink) both prevent Wnt/β-catenin pathway activation by binding to Lrp5/6, which prevents its interaction with Frizzled (Fz). The primary mechanism of action of SFRPs (blue) is to bind to Wnt molecules thus preventing its interaction with its receptor and further activate the Wnt/β-catenin pathway.
117
Figures Figure 1: Mineral and bone disorders in chronic kidney disease (CKD).
118
Figure 2: Wnt/β-catenin pathway and bone formation.
119
Figure 3: Proposed mechanisms by which PTH activates Wnt/β-catenin pathway in osteoblasts and
osteocytes to modulate bone turnover.
120
Figure 4: Mechanisms of action of common Wnt inhibitors.
121
Tables
Table 1: Effects of targeted treatments using antibodies on bone anomalies and vascular calcification in animal models of CKD.
Treatment
Model
Effect on bone∗
Effect on vascular
calcification∗
Other effects∗
Anti-sclerostin
Cy/+ rats with low
PTH
↑ bone volume/total volume
(trabecular bone) ↑ trabecular
mineralization surface
↓ % of animals with
signification arterial
calcification
↑ bone SOST transcripts
Anti-sclerostin
Cy/+ rats with high PTH
—
—
—
Anti-Dkk1
CKD stage 2 (partial
nephrectomy) diabetic mice
↑ bone formation rate
↑ bone volume ↑ trabecular number
and volume ↑ osteoblast and
osteoclast number
↓
↓ RunX2 in aorta ↓ circulating
sclerostin ↑ sm22α in aorta ↑ Klotho in aorta
Anti-Dkk1 + phosphate binders
CKD stage 2
(partial nephrectomy) diabetic mice
↑ bone formation rate
↑ bone volume ↑ trabecular number
and volume ↑ osteoblast and
osteoclast number
↓
↓ RunX2 in aorta ↓ circulating
sclerostin ↑ sm22α in aorta ↑ Klotho in aorta
↓ circulating FGF23
Cy/+: genetic model of polycystic kidney disease.
∗ Effects as compared to Cy/+ with high/low PTH or CKD stage 2 diabetes without treatment.
![· Web viewThe relaxation and contraction experiments of ascending thoracic aorta were conducted in accordance with literature’s method [26]. D etection of biochemical indexes](https://img.pdfslide.fr/doc/110x75/5ed575a977a7be1f0d40fa48/web-view-the-relaxation-and-contraction-experiments-of-ascending-thoracic-aorta.jpg)
![BCL9PromotesTumorProgressionbyConferringEnhanced ...Res2009;69(19):7577–86] Introduction The Wnt pathway consists of a highly conserved and tightly regulated receptor-mediated signal](https://img.pdfslide.fr/doc/110x75/612571378eb4a3086b4f647d/bcl9promotestumorprogressionbyconferringenhanced-res200969197577a86-introduction.jpg)
![dheg / Condensersst-agro.com/wp-content/uploads/2014/05/condenser_photo... · 2017-02-26 · Кed[\dheg_ / Condensers @QHIN\ / Version Reij]dthip: 14,5 aВi fg_ fe[Wnt feYtigr >5m/s](https://img.pdfslide.fr/doc/110x75/5f23ad760f7e3f1741232522/dheg-condensersst-agrocomwp-contentuploads201405condenserphoto-2017-02-26.jpg)
