YAP1-Mediated CDK6 Activation Confers Radiation …Research, Daping Hospital, Third Military Medical University, Chongqing, China. ... The normal human esophageal epithelial cell line

Translational Cancer Mechanisms and Therapy

YAP1-Mediated CDK6 Activation ConfersRadiation Resistance in Esophageal Cancer –Rationale for the Combination of YAP1 andCDK4/6 Inhibitors in Esophageal CancerFan Li1,2, Yan Xu1, Bovey Liu1, Pankaj Kumar Singh3, Wei Zhao1, Jiankang Jin1,Guangchun Han4, Ailing W. Scott1, Xiaochuan Dong1, Longfei Huo1, Lang Ma1,Melissa Pool Pizzi1, Ying Wang1, Yuan Li1, Kazuto Harada1, Min Xie5, Heath D. Skinner3,Sheng Ding5, Linghua Wang4, Sunil Krishnan3, Randy L. Johnson6, Shumei Song1, andJaffer A. Ajani1

Abstract

Purpose: Esophageal cancer is a lethal disease that is oftenresistant to therapy. Alterations of YAP1 and CDK6 are fre-quent in esophageal cancer. Deregulation of both moleculesmay be responsible for therapy resistance.

Experimental Design: Expressions of YAP1 andCDK6wereexamined in esophageal cancer cells and tissues using immu-noblotting and immunohistochemistry. YAP1 expression wasinduced in esophageal cancer cells to examine YAP1-mediatedCDK6 activation and its association with radiation resistance.Pharmacologic and genetic inhibitions of YAP1 and CDK6were performed to dissect the mechanisms and assess theantitumor effects in vitro and in vivo.

Results: YAP1 expression was positively associated withCDK6 expression in resistant esophageal cancer tissues andcell lines. YAP1 overexpression upregulated CDK6 expres-sion and transcription, and promoted radiation resistance,whereas treatment with the YAP1 inhibitor, CA3, stronglysuppressed YAP1 and CDK6 overexpression, reduced Rb

phosphorylation, as well as sensitized radiation-resistant/YAP1high esophageal cancer cells to irradiation. CDK4/6inhibitor, LEE011, and knock down of CDK6 dramaticallyinhibited expression of YAP1 and sensitized resistant eso-phageal cancer cells to irradiation indicating a positivefeed-forward regulation of YAP1 by CDK6. In addition,suppression of both the YAP1 and CDK6 pathways by thecombination of CA3 and LEE011 significantly reducedesophageal cancer cell growth and cancer stem cell popu-lation (ALDH1þ and CD133þ), sensitized cells to irradia-tion, and showed a strong antitumor effect in vivo againstradiation-resistant esophageal cancer cells.

Conclusions:Our results document that a positive crosstalkbetween the YAP1 and CDK6 pathways plays an importantrole in conferring radiation resistance to esophageal cancercells. Targeting both YAP1 and CDK6 pathways could be anovel therapeutic strategy to overcome resistance in esoph-ageal cancer.

IntroductionEsophageal cancer ranks eighth in incidence and sixth in

mortality among all types of cancers worldwide (1, 2). A total

of 17,290 new cases and 15,850 deaths were likely to occur in2018 in the United States (3, 4). Preoperative chemoradiotherapyis an accepted standard approach for some localized esophagealcancer patients (5, 6). However, most patients do not benefit, andtheir 5-year survival rate is �40% (7). Thus, resistance to therapyand metastatic potential are common in the clinic (8). Therefore,defining key mediators of resistance to therapy is critical toimprove the outcome of patients.

Molecular mechanisms that mediate resistance to chemoradia-tion therapy in esophageal cancer remain unclear, and multiplepathways appear to be engaged by cancer cells. One widelyaccepted notion is the role of cancer stem cells (CSCs). CSCs aredefined as a small subpopulation of undifferentiated cells thathave the self-renewal capacity, and they produce progenies tomaintain tumor progression. We previously reported on the roleof the Hippo pathway transcriptional coactivator Yes-associatedprotein (YAP1) onCSCphenotype that can endowCSCpropertiesto cells including high capacity to form tumor spheres, increasedproliferation, and progression by regulating its target SOX9 (9).We reported that YAP1's upregulation of the EGFR pathway playsan important role in conferring chemotherapy resistance toesophageal cancer cells. (10) Taken together, these results suggest

1Department of Gastrointestinal Medical Oncology, U.T.MD. Anderson CancerCenter, Houston, Texas. 2Department of General Surgery, Institute of SurgeryResearch, Daping Hospital, Third Military Medical University, Chongqing, China.3Department of RadiationOncology, U.T.MD. Anderson Cancer Center, Houston,Texas. 4Department of Genomic Medicine, U.T.MD. Anderson Cancer Center,Houston, Texas. 5Department of Pharmaceutical Chemistry, University of Cali-fornia, San Francisco, San Francisco, California. 6Department of Cancer Biology,U.T.MD. Anderson Cancer Center, Houston, Texas.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

F. Li and Y. Xu are co-first authors of this article.

CorrespondingAuthors:Shumei Song, University of TexasMDAndersonCancerCenter, 1515 Holcombe Blvd Unit 426Houston, TX 77030-4009. Phone: 713-834-6144; Fax: 713-745-1163; E-mail: [email protected]; and Jaffer A. Ajani,Phone: 713-792-3685; Fax: 713-792-8864; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-18-1029

�2018 American Association for Cancer Research.

ClinicalCancerResearch

Clin Cancer Res; 25(7) April 1, 20192264

on June 7, 2021. © 2019 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst December 18, 2018; DOI: 10.1158/1078-0432.CCR-18-1029

http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-18-1029&domain=pdf&date_stamp=2019-3-7http://clincancerres.aacrjournals.org/

that YAP1 may be a key player in chemoradiation resistance inesophageal cancer.

Amplification of cyclin-dependent kinases (CDK6) has beenreported in esophageal cancer (11). CDK6 is a key regulator of thecell cycle andplays a pivotal role in the transition fromG1 toSphasein cancer cells (12) through phosphorylation of retinoblastoma-associated protein 1 (Rb1). Overexpression and amplification ofCDK6 together with its homologue CDK4 were associated withpoor survival in esophageal adenocarcinoma (11). A previousreport suggested that YAP1/Tead-mediated transcription controlscellular senescence by CDK6, implying a crosstalk between theHippo/YAP1 and CDK6 pathways (13). Both YAP1 and CDK6 arehighly relevant toesophageal cancerprogression;however, their roleand mechanisms involved in radiation resistance remain unclear.We hypothesized that YAP1 regulates the sustained CDK6 over-expression and its activation,which confers resistance in esophagealcancer. Therefore, targeting both YAP1 and CDK6 might be moreadvantageous in overcoming resistance in esophageal cancer.

In this study, we demonstrated that overexpression of YAP1 waspositively associatedwith CDK6 expression in posttreatment (radi-ation-resistant) esophageal cancer tissues. Induced YAP1 in esoph-ageal cancer cells upregulated CDK6 expression, increased tran-scription, and induced radiation resistance, but blocking YAP1 andCDK6 by the YAP1 inhibitor, CA3, and the CDK6 inhibitor,LEE001, significantly suppressed esophageal cancer cell growthand CSC properties particularly in radiation-resistant cells. Thecombination of LEE001 and CA3 had the highest antitumor effectsin radiation-resistant cells with high YAP1 and CDK6 in vitro andin vivo. Furthermore, the combined inhibition of YAP1 and CDK6sensitized resistant tumors to irradiation in vivo.Ourdata imply thata crosstalk between YAP1 and CDK6 seems to play a pivotal role inconferring radiation resistance, and targeting both YAP1 andCDK6could be a useful therapeutic strategy to treat esophageal cancer.

Materials and MethodsCells and reagents

The normal human esophageal epithelial cell line HET-1A;esophageal adenocarcinoma cell (EAC) lines Flo-1, SKGT-4, BE3,OE33, JHESO, and OACP; plus esophageal squamous carcinoma(ESCC) cells Yes-6, KATO-TN (TN), TE-2, TE3, TE-7, TE-8, and TE-12 were used in this study (14–16). All human cell lines weretested and authenticated in the Characterized Cell Line Corefacility at The U.T.M D Anderson Cancer Center (Houston, TX).

LEE001 was purchased from the United States Pharmacopeia.Doxycycline hyclate (DOX) was purchased from Sigma-Aldrich.The antibodies against YAP1, CDK4, CDK6, and phosphorylatedRb were purchased from Cell Signaling Technology. CD133-APCand CD44-PE were purchased from Miltenyi Biotec Inc. ALDH1labeling and sorting were performed using an ALDEFLUOR kitfrom STEMCELL Technologies Canada Inc. DNA plasmids thatencoded wild-type human YAP1 (hYAP1, CMV-YAP1) or amutant protein that can no longer be phosphorylated at Ser127(hYAP1 S127A, CMV-S127A-YAP1) were purchased fromAddgene (9). We have previously reported on the doxycycline-inducible YAP1 lentivirus expression plasmid (PIN20YAP1) andlentiCRISPR to knock down YAP1 (17).

Protein isolation and immunoblot analysesThe protein extraction and Western blot analyses were per-

formed as previously described, and immunoreactive bands werevisualized by chemiluminescence detection (18).

Generation of knockout YAP1 or CDK6 in esophageal cancercell lines using LentiCrispr/Cas9

The LentiCrispr/Cas9 system was used to knock out YAP1 orCDK6 in JHESO, Flo-1 XTR cells using the GeCKO LentiCrisprresource tool (MIT, http://genome-engineering.org/gecko/). gRNAswere designed using the MIT's online webpage (http://crispr.mit.edu/). pLentiCrispr v1 was used for cloning gRNAs. Briefly, thevector included Cas9 gene and was cut with BsmB1, the longerfragmentwas ligatedwith the gRNApairing duplexes, and resultingclones were verified by sequencing. Lentiviruses were made usingpLentiCripr-gRNA, packaging plasmids pCMV.Dr8.2, and pCMV.VSV.G in 10:10:1 ratio in the 6-well plate of HEK293T. Lentiviralsupernatantwasused to transduce cell lines in the6-wellplate in thepresence of 8 mg/mL polybrene. Cells were then selected in puro-mycin at proper concentrations for 1 to 2 weeks. Cells were thenpropagated and verified for knockout efficiency by Western blots.

Cell growth inhibition assaySKGT-4 (pIN20YAP1) with (DOXþ) or without (DOX-) or

radiation-resistant Flo-1 XTR and its parental cells were treatedwith 0.1% dimethyl sulfoxide (control), CA3, LEE001, or thecombination (CA3 plus LEE001) for 3 and 6 days. Cell viabilitywas then assessed by using the CellTiter 96 aqueous nonradio-active cell proliferation assay (MTS) according to the instructionsof the manufacturer (Promega). The results have been presentedas the percentage of control and repeated at least 3 times.

Establishment of chemoradiation-resistant cell linesTo establish 5-FU–resistant subclones, SKGT-4 parental cells

were cultured with various concentrations of 5-FU for 3 to 5weeks, and surviving cells were collected. This procedure wasrepeated 4 times. The establishment of these 5-FU–resistantsubclones took 3 to 6 months, and newly derived 5-FU–resistantcloneswere designated SKGT4-RF. To establish radiation-resistantsubclones, Flo-1 and SKGT-4 esophageal adenocarcinoma paren-tal cells were irradiated with 2 GY, 4 times, once every week for 8weeks. Flo-1 and SKGT-4 cells were made resistant to radiationand designated Flo-1 XTR or SKGT-4 XTR.

Real-time PCRTo quantify changes in the YAP1 and CDK6mRNA levels, real-

time RT-PCR was performed using the ABI 7500 fast system

Translational Relevance

Esophageal cancer is lethal and often resistant to therapy.Elucidating the resistance mechanisms and key mediators ofresistance is critical to improve the outcome of patients withesophageal cancer. Here, we demonstrated that feed-forwardcrosstalk between the YAP1 and CDK6 pathways mediatedradiation resistance. Combined targeting of both YAP1 andCDK6 provided the best antitumor effects in vitro and in vivoand highest suppression of cancer stemness in radiation-resistant cells. Thus, our study provides a strong rationale fora clinical trial in patients with esophageal cancer with theupregulated YAP1–CDK6 axis, thus an opportunity to enrichpatients based on these biomarkers.

YAP Activation of CDK6 Mediates Radiation Resistance in Esophageal Cancer

www.aacrjournals.org Clin Cancer Res; 25(7) April 1, 2019 2265



http://genome-engineering.org/gecko/http://crispr.mit.edu/http://crispr.mit.edu/http://clincancerres.aacrjournals.org/

(AppliedBiosystems). TotalRNA fromcell cultureswas extractedbyusing Trizol (Ambion), and concentrations ofRNAsweremeasuredby Nanodrop 1000 (Nanodrop). The first strand of cDNA wassynthesized by reverse transcription PCR using the Invitrogen'sSuperscript III kit (Invitrogen).Quantitative PCRmeasuringmRNAexpression levels was performed by the ABI 7500 Sequence Detec-tion System 2.2 software that automatically determined the foldchange for YAP1 and/or CDK6 in each sample by using the ddCtmethod with 95% confidence using primers listed below. Relativequantitation was calculated by using RE ¼ 2(�DDCt). Primers forreference gene GAPDH were hGAPDH-5 50 ACCCAGAAGAC-TGTGGATGG 30; hGAPDH-3 50 TCTAGACGGCAGGTCAGGTC-30. Primers forYAP1werehYAP1.E3.F 50 CTGTCCCAGATGAACGT-CAC-30 and hYAP1. R 50-TTCTCTGGTTCATGGCAAAA-30. Primersfor CDK6 were hCDK6. F 50 GGAGACCTTCGAGCACC 30 andhCDK6.mRNA.R 50 CACTCCAGGCTCTGGAACTT 30.

Flow cytometry and cell-cycle analysisAnalysis of the cell cycle in esophageal adenocarcinoma cells

using flow cytometrywas performed as described previously (19).In brief, SKGT-4 and JHESO cells were seeded onto the 6-wellplates (1� 105 cells/well) in theDMEMand cultured for 24 hoursto allow for cell attachment. Cells were then treated with 0.1%dimethyl sulfoxide (control) or LEE001 at different concentra-tions as indicated for 48 hours. Next, cells were harvested, fixedwith methanol, washed, treated with RNase A, stained for DNAwith propidium iodide (Sigma), and their DNA histograms andthe cell-cycle phase distributions were analyzed using flow cyto-metry with the FACS Calibur instrument (Becton Dickinson).

Transient transfection and luciferase reporter assaysWe have previously described the 5 � -UAS-luciferase reporter

and Gal4-TEAD4 constructs (20). Transient cotransfection 293Tand SKGT4 doxþ esophageal adenocarcinoma cells with 5 �-UAS-luciferase reporter and Gal4-TEAD4 with a CMV-b-gal con-struct were performed as described previously (21).

Indirect immunofluorescenceEsophageal cancer cells and esophageal cancer tissues were

subjected to indirect immunofluorescence staining with YAP1(1:100) and CDK6 (1:100) primary antibodies and then labelingwith Alex-488 (for CDK6) and Alex-555 (for YAP1) as describedelsewhere (18). Fluorescence was assayed by the confocal micro-scope (FluoView FV500; Olympus) and analyzed by the Cell-Quest PRO software (BD Biosciences).

Tumor sphere formationSphere cultures were performed as described previously (21).

Briefly, parental Flo-1 and Flo-1 XTR cells were seeded in triplicateonto the 6-well ultra-low attachment plates (800 cells/well; Corn-ing Life Sciences) in the serum-free combinedDulbecco's modifiedessential and F-12 media supplemented with 20 ng/mL epidermalgrowth factor, 5 mg/mL insulin, 0.5 mg/mL hydrocortisone, and 2%B27 supplement without vitamin A and 1% N2 Supplement(Invitrogen, Life Technologies). CA3, LEE001, or their combinationwas added at the time the cells were seeded. After 10 to 20 days inculture, the tumor spheres (diameter >100 mm) were counted.

ImmunohistochemistryIHC staining for YAP1 and CDK6 was performed on human

esophageal cancer tissues and mouse xenografts using the anti-

bodies against CDK6 (1:100), YAP1 (1:100), and KI67 (1:100) asdescribed previously (21).

Colony formation and radiosensitivity assayEsophageal adenocarcinoma cells were seeded in the 6-well

plates for different radiation doses to allow for an approximatelyequal number of resultant colonies, and the optimal number ofcells was determined to be 800 per well. The following day, cellswere irradiated using a high-dose-rate 137Cs irradiator (4 Gy or5 Gy/min) and cultured for 10 to 14 days to allow for colonyformation. Cells were then fixed in a 3% crystal violet/10%formalin solution. Colonies of more than 50 cells were thencounted, and survival fractionwas determined. Thequantificationof colony was also assessed by using the fluostar omega micro-plate reader (BMG LABTECH Inc.) at wavelength of 590 nm afterdissolving colonies using 10% acetate acid. All treatments wereperformed in triplicate or higher.

In vivo xenograft mouse modelIn vivo experiments were conducted in accordance with the

guidelines of theMDAnderson Institutional AnimalCare andUseCommittee. Nude mice were inoculated subcutaneously withFlo-1 cells and Flo-1 XTR–resistant cells (5 � 106 cells and n ¼5/group). After 15 days, the mice bearing Flo-1 XTR xenograftsunderwent intraperitoneal injection of CA3 at 1 mg/kg/mouse,LEE001 at 30 mg/kg/mouse, or a combination of them, 3 timesa week for total 3 weeks. The control group was given PBS at 100mL/mouse. The mice tumor volumes, tumor weights, and bodyweights weremeasured as described previously (22). All measure-ments were compared using the unpaired Student t test.

Statistical analysisDifferences between the groupswere assessed using the Student

t test or the Fisher exact test. The IHC expression analyses wereperformed using the appropriate nonparametric test (x2 test andSpearman correlation test). Univariate survival analysis was per-formed using the Kaplan–Meier method. A multivariate Coxregression model with the backward stepwise method was usedto detect the independent prognosticators of survival. Two-tailedP values of less than0.05were considered significant. All statisticalanalyses were performed using the SPSS_20.0 software program(IBM Corporation).

ResultsCDK6 expression was correlated with YAP1 expression inresistant esophageal cancer tissues and esophageal cancer celllines

Wehave previously reported that the overexpression of YAP1 inesophageal cancer plays an important role in cell proliferation andacquisition of the CSC properties (refs. 9 and 22). In The CancerGenome Atlas (TCGA) genomic sequence data, we found thatCDK6 is frequently amplified in esophageal cancers, actually thesecond highest rate of amplification across all tumor types indi-cating its importance in esophageal cancer (cbioportal.com; Fig. 1A). To determine whether both YAP1 and CDK6expressions were associated with esophageal cancer, immuno-blotting was performed on HET1A cells, 6 esophageal adenocar-cinoma cell lines, and 7 ESCC cell lines. The results in Fig. 1B showthat the expression of both YAP1 and CDK6 increased in most ofesophageal adenocarcinoma and ESCC cell lines compared with

Li et al.

Clin Cancer Res; 25(7) April 1, 2019 Clinical Cancer Research2266



http://clincancerres.aacrjournals.org/

HET1A cells, and there was a correlation between overexpressionof YAP1 and CDK6. The positive association of YAP1 and CDK6was further validated in 151 esophageal cancer samples including71 esophageal adenocarcinoma and 77 ESCC as shown in Fig. 1C.When we analyzed ESCC and esophageal adenocarcinoma sep-arately, we found ahigher correlation between YAP1 andCDK6 inESCC than in esophageal adenocarcinoma (Supplementary Fig.S1). We have previously reported that YAP1 mediates chemore-sistance (10). To further explore if both YAP1 and CDK6 wereassociated with therapy resistance, wemeasured the expression ofYAP1 and CDK6 by IHC in 25 treated residual resistant esoph-ageal cancer tissues (P2, posttreated esophageal cancer tissue with�50% residual tumor cells) comparedwith the relatively sensitivetumors (P0/P1, esophageal cancer tissue with 0% or

YAP1 induced CDK6 expression and transcription inesophageal cancer cells

To determine whether CDK6 expressionwas regulated by YAP1in esophageal cancer and other cell types, transfection of humanembryonic kidney (HEK293T) cells with constitutively activemutant YAP1S127A cDNAorwithwild type YAP1was performed.As shown in Fig. 2A, the protein expression of CDK6 dramaticallyincreasedwith the transfection ofwild-type YAP1cDNAormutantYAP1S127A cDNA (an activating mutation that keeps YAP1active) which was concomitant with an increase in Rb phosphor-ylation. Correspondingly, the CDK6 mRNA levels increased sig-nificantly in HEK293T cells stably transfected with YAP1 by real-timeQ-PCR as shown in Fig. 2B, right, which is in concert with theincreased YAP1 mRNA levels (Fig. 2B, left). Next, we transducedesophageal cancer cell lines SKGT-4, KATO-TN, and YES-6 withthe doxycycline-inducible human flag-tagged YAP1S127A cDNA(PIN20 YAP1S127A). A successful YAP1 induction in SKGT-4,YES-6, and KATO-TN cells by doxycycline at 1 mg/mL increasedexpression of CDK6 that correlated with increased YAP1 expres-sion (Fig. 2C, left). In contrast, the LentiCRISPR/Cas9-mediatedknock down of YAP1 in JHESO cells with constitutively highYAP1 greatly reduced CDK6 expression (Fig. 2C, right). Immu-nofluorescence analyses further showed that the induction ofYAP1 by doxycycline at 1 mg/mL increased nuclear expression ofCDK6 that correlated with YAP1 expression in SKGT-4 cells,whereas the knock down of YAP1 in JHESO cells decreasednuclear expression of both YAP1 and CDK6 (Fig. 2D, bottom).To further determine if YAP1 regulated CDK6 at the level oftranscription, quantitative real-time RT-PCR was performed inesophageal cancer cells with genetically altered YAP1 levels. Asshown in Fig. 2E, the CDK6 mRNA levels were significantlyincreased by stably YAP1-induced SKGT-4, Yes-6, and KATO-TN cells by doxycycline (DOXþ), which were consistent withthe YAP1 mRNA levels. In contrast, the knock down of YAP1 inJHESO cells significantly decreased the CDK6 mRNA levels in2 different clones (Fig. 2F). These data confirmed that YAP1upregulated CDK6 overexpression and transcription in esoph-ageal cancer cells.

YAP1-mediated radiation resistance but YAP1 inhibitionreduced YAP1, CDK6, and Rb phosphorylation and sensitizedesophageal cancer cells to irradiation

Having established that YAP1 induction increased CDK6expression in esophageal cancer cells, we questioned whetherincreased YAP1 and CDK6 in esophageal cancer cells mediatedradiation resistance. As shown in Fig. 3A, we exposed SKGT4

DOXþ and Yes6 DOXþ (with YAP1 induction) and DOX� (with-out YAP1 induction) cells to different dosages of irradiation (2, 4,and 6Gy). Both SKGT4 (SK4) and Yes6 YAP1high cells with DOXþ

were significantly resistant to radiation compared with DOX�

cells and in a dose-dependent manner (Fig. 3A, left and middleplots). In contrast, the knock down of YAP1 in JHESO cellssignificantly sensitized cells to irradiation (Fig. 3A, right plot)indicating increased YAP1- and CDK6-mediated radiation resis-tance. Further, we used our established radiation-resistant esoph-ageal cancer cell lines (Flo-1 XTR and SKGT-4 XTR; ref. 23) andfound that bothYAP1andCDK6arehighly upregulated inbothofthese resistant cells compared with their parental counterparts(Fig. 3B, left). The immunofluorescent staining (Fig. 3B, right)further confirmed an increase in the nuclear expression of bothCDK6 and YAP1 in radiation-resistant XTR cells. To develop aneffective way to overcome radiation resistance, we developed anovel YAP1 inhibitor, CA3, basedon the inhibition onYAP1/Teadtranscriptional activity (24). We found that CA3 significantlyinhibited YAP1 expression in both SKGT-4 and JHESO cells.Interestingly, CA3 dramatically suppressed CDK6 expression andRb phosphorylation, which represents the downstream CDK6activity (Fig. 3D). CA3 significantly sensitized radiation-resistantFlo-1 XTR cells to irradiation (Fig. 3E). Most importantly, CA3preferentially sensitized induced YAP1high SKGT-4 (DOXþ) cellsto irradiation, whereas there was onlyminimum effect on SKGT-4(DOX�) induction (Fig. 3F and G).

The CDK4/6 inhibitor, LEE001, inhibited Rb phosphorylationand YAP1 expression in esophageal cancer cells, decreasedS phase cells, and increased G1 phase cells

LEE001 is a small-molecule inhibitor of CDK4/6 that is knownto have clinical activity in several tumor types. As demonstratedin Fig. 4A, LEE001 dramatically reduced expression of YAP1 andRb phosphorylation in SKGT-4, JHESO, and Flo-1cells, whereasLEE001 did not affect the protein level of CDK6 (only exerted itsactivity by reduced Rbphosphorylation).Moreover, the reductionof YAP1 and Rb phosphorylation was in a dose-dependentmanner (Fig. 4B). To determine whether the growth inhibitionobserved in esophageal cancer cells was associated with specificchanges in the cell-cycle distributions, we analyzed the cell-cyclestages using flow cytometry. The cell-cycle phase distributionswere analyzed upon treatment of SKGT-4 and JHESO cells withLEE001 at 1 and 5 mmol/L for 48 hours. The results in Fig. 4C andD show that LEE001 increased the G0–G1 phase cells but dra-matically decreased the S-phase cells in both SKGT-4 and JHESO.

To further confirm that YAP1's upregulation of CDK6mediatesradiation resistance, we knocked down CDK6 in radiation-resistant Flo-1 XTR cells using the LentiCRISPR/Cas9 system(Fig. 4E, insert). We found that the knock down of CDK6 inradiation-resistant XTR cells also suppressed YAP1 expression(Fig. 4E, insert) but also dramatically decreased colony formationand sensitized tumor cells to irradiation implying that CDK6 canpositively crosstalk to YAP1 to play a critical role in YAP1-medi-ated radiation resistance (Fig. 4E). In addition, as indicated in

Table 1. Correlation between expression of YAP1 and CDK6 and esophageal adenocarcinoma–resistant tissues

Resistant tumors (n ¼ 15) Sensitive tumors (n ¼ 10)Protein expression þ (%) – (%) þ (%) – (%) PYAP1 9/15 (60) 6/15 (40) 2/10 (20) 8/10 (80) 0.0221CDK6 13/15 (86.7) 2/15 (13.3) 3/10 (30) 7/10 (70) 0.0038

Table 2. Association of YAP1 and CDK6 in esophageal adenocarcinoma–resistant tumors

CDK6YAP1 þ – r Pþ 10 1 0.6906 0.0001– 6 8

Li et al.





Figure 2.

YAP1 induces CDK6 expression and transcription in esophageal cancer cells. A, 293T cells transfected with either mutant YAP1S127A or wt YAP1 expressionvectors, and expressions of YAP1 and CDK6 were detected by immunoblotting. B,mRNA level of YAP1 or CDK6 was performed in these 293T cells transfectedwith either mutant YAP1S127A or wt YAP1 expression vectors. C, SKGT-4, YES-6, and KATO-TN cells were transduced with lentiviral plasmid containing inducibleYAP1 cDNA (PIN20YAP1). YAP1 and CDK6 expression was determined using immunoblotting using antibodies against YAP1 or CDK6 (left). Immunoblotting ofYAP1 or CDK6 was performed in JHESO cells with 2 independent YAP1 knockdown clones (YAP1 lcy1 and YAP1 lcy3), right).D, Immunofluorescent staining ofYAP1 and CDK6 in SKGT-4 cells that were transduced with inducible YAP1 (PIN20YAP1) with or without doxycycline induction at 1 mg/mL (top), andimmunofluorescent staining of YAP1 and CDK6 in JHESO cells with YAP1 knockdown (YAP lyc1). E and F,mRNA levels of YAP1 and CDK6 were determined byqPCR in SKGT-4 YES-6 and KATO-TN cells transduced with lentiviral plasmid containing inducible YAP1 cDNA (PIN20YAP1) and induced YAP1 with or withoutdoxycycline at 1 mg/mL or knockdown in JHESO cells (F). The experiments were performed in triplicate and repeated at least 2 times. The Student t test was usedfor statistical analysis. � , P < 0.01 and �� , P < 0.001.






Figure 3.

YAP1 mediates radiation resistance, and YAP1 inhibitor suppresses YAP1, CDK6, and Rb phosphorylation and sensitizes esophageal cancer cells to radiationtreatment.A, SKGT-4 (PIN20YAP1) and YES6 (PIN20YAP1) with (DOXþ) or without (DOX�) YAP1 induction or JHESO and its YAP1 KO clones were treated atdifferent dosage of radiation (2, 4, or 6 Gy) and determined cell radiation sensitivity using clonogenic assay as described in Materials and Methods. B and C,Expressions of YAP1 and CDK6 were detected by immunoblotting in Flo-1or SKGT-4 parental cells and their radiation-resistant Flo-1 XTR or SKGT-4 XTR cells.C, Expression of YAP1 and CDK6 was detected by immunofluorescent staining of YAP1 and CDK6 in Flo-1 parental and Flo-1 XTR cells. D, Protein levels of YAP1and CDK6 and phosphor-RBwere determined by immunoblotting in SKGT-4 and JHESO esophageal cancer cells treated with CA3 for 48 hours at dosageindicated. E, YAP1 inhibitor CA3 sensitized Flo-1 XTR–resistant cells to radiation treatment at 4 Gy using clonogenic assay as described in Materials and Methods.F and G, YAP1 inhibitor CA3 at 0.5 mmol/L preferentially sensitized YAP1-high SKGT-4 DOXþ cells to radiation treatment at 4 and 6 Gy. The experiments wereperformed in triplicate and repeated at least 2 times. The Student t test was used for statistical analysis. �, P < 0.01 and �� , P < 0.001.

Li et al.





Figure 4.

Pharmacologic and genetic inhibition of CDK6 suppresses YAP1 expression and sensitizes resistant esophageal cancer cells to radiation. A, Expressions of YAP1and CDK6 and phosphor-Rb were determined by immunoblotting in esophageal cancer cells treated with CDK6 inhibitor LEE001 at 5 mmol/L for 48 hours.B, Esophageal cancer cells treated with LEE001 at different dosage and expression of YAP1 and CDK6 and phosphor-RB in SKGT-4 and JHESO cells weredetermined using immunoblotting. C, The SKGT-4 and JHESO cells were seeded onto 6-well plates and treated with 0.1% DMSO (as control) or with LEE001 1 or5 mmol/L for 48 hours and then fixed and stained for DNAwith propidium iodide and then analyzed for DNA histograms and cell-cycle phase distribution by flowcytometry using a FACS Calibur instrument. D, The cell-cycle distribution of SKGT-4 and JHESO was demonstrated in bar graphs according to the proportion oftheir G0–G1 phase (left) and S phase (right) after LEE001 treatment as indicated. The experiments were performed in triplicate and repeated at least 2 times. TheStudent t test was used for statistical analysis. � , P < 0.01 and �� , P < 0.001. E, Effect of knockdown of CDK6 on sensitizing to radiation demonstrated by colonyformation assay in radiation resistant Flo-1 XTR cells as described in Materials and Methods. Demonstration of colony for each group in the left, and quantificationof colony in the right. Expressions of YAP1 and CDK6 were detected by immunoblotting in radiation-resistant Flo-1 XTR cells and CDK6 knockdown cells (insert).






Supplementary Fig. S2C, YAP1 and CDK6 expressions alsoincreased in the established 5-FU–resistant SKGT-4-RF and Flo-1-RF cells, suggesting that similar mechanisms may apply in bothradiation- and chemoresistance. Although in this study, our focusis on radiation resistance of esophageal cancer. These data sug-gested that YAP1 induction of CDK6 was associated with radia-tion resistance in esophageal cancer cells.

Combined inhibition of YAP1 and CDK6 synergisticallysuppressed the expression of both YAP1 andCDK6 to overcomeresistance in esophageal cancer

Having shown that LEE001 or CA3 can inhibit YAP1, CDK6,and Rb phosphorylation, we then aimed to explore whether these2 inhibitors can synergize. As shown in Fig. 5A, the expression ofYAP1,CDK6, andphosphorylatedRbdramatically decreasedwiththe combination at very low doses compared with treatments bysingle agent in both cell lines (Fig. 5A). Similarly, the YAP/TEADluciferase activity in both 293T and SKGT-4 DOXþ (YAP1-induced cells) was synergistically suppressed by the combinationof CA3 and LEE001 as assessed by luciferase activity in cellscotransfected with Gal4-Tead and 5XUAS-luciferase plasmidswhich represents YAP-1 transcriptional activity (ref. 20; Fig. 5B).

Having demonstrated that YAP1 regulates CDK6 to inducetherapy resistance and inhibition of both (YAP1/CDK6) resultsin the highest decrease in YAP1/CDK6 expression as well as inreduced Rb phosphorylation, next, we sought to assess if thecombined inhibitors had higher antitumor effects in vitro espe-cially in YAP1 high and radiation-resistant cells. SKGT-4(PIN20YAP) cells with YAP induction (DOXþ) or without YAPinduction (DOX�) were treated with CA3 and LEE011 eitheralone or in combination at the concentration indicated for 3 and6 days. The cell growth inhibition was measured using the MTSassay. We observed that the combination had much higherinhibitory effect in SKGT-4 cells on both day 3 (SupplementaryFig. S3A) and day 6 (Fig. 5C, left plot). Similar results wereobserved in Flo-1 parental cells and radiation-resistant Flo-1XTR cells (Supplementary Fig. S3B; Fig. 5C, right plot). Moreimportantly, we observed that the combination significantlydecreased colony formation in radiation-resistant XTR cells(Fig. 5D). These data indicated that inhibition of both YAP1and CDK6 could provide the best antitumor effects in resistantesophageal cancer cells.

Targeting both YAP1 and CDK6 reduced cancer stemness inradiation-resistant cells

We first observed that the radiation-resistant XTR cells wereenriched with the CSC properties by increased capacity to formlarger tumor spheres but also in greater numbers than did theparental counterparts (Supplementary Fig. S3C) and have higherfraction of ALDH1þ cells than the parental counterparts (23). Thecombination of CA3 and LEE001 dramatically reduced tumorsphere formation in XTR Flo-1 cells compared with either treat-ment alone, whereas parental Flo-1 cells do not form tumorspheres (Supplementary Fig. S3D). CD133, ALDH1, and CD44are established CSC markers, thus the combination of drugsmarkedly decreased CSC cells as determined by assessing thefractions of CD133þ (Fig. 5E), ALDH1þ (Fig. 5F), and CD44þ

cells (Supplementary Fig. S3E) in radiation-resistant XTR cells.This indicated that combined suppression of YAP1/CDK6 had thestrongest effect in reducing the CSC population that is especiallyenriched in radiation-resistant cells.

Strong antitumor activity with combined LEE001 and CA3treatment in resistant esophageal cancer tumor growth in vivo

Initially, we implanted both parental Flo-1 and Flo-1 XTR cellsinto nude mice, and Flo-1 XTR xenografts formed successfully,whereas the parental Flo-1 cells formed smaller and slowlygrowing xenografts (Fig. 6A) consistent with their behaviors intumor sphere formation assays (Supplementary Fig. S3C), indi-cating that Flo-1 XTR radiation-resistant cells were enriched withCSCs (tumor initiation cells). Thus, we used Flo-1 XTR cells toassess the effect of combined LEE001/CA3 treatment on tumorgrowth in vivo. Figure 6B shows the treatment schema using CA3,LEE011, and combination in the Flo-1 XTR cell-derived xerograph(CDX)model. In nudemice bearing Flo-1 XTR xenografts, tumorswere divided randomly into 4 groups and then treated withcontrol (PBS), CA3, LEE001, and combination (CA3/LEE001)for 3 weeks. At the end of the 3 weeks, xenografts weights andvolumes were measured. The mice treated with either LEE001 orCA3 had reduced tumorweights/volumes, whereas the xenograftsafter LEE001 plus CA3had the lowest weights/volumes comparedwith CA3 or LEE001 alone (Fig. 6B–D). In addition, the level ofYAP1, CDK6, and Ki67 in mice xenografts diminished dramati-cally after the combination (Fig. 6E). To determine if inhibition ofYAP1, CDK6, or both can further sensitize radiation-resistant,XTR, cells in vivo to radiation, we treated Flo-1 XTR xenografts asfollows: (1) the control (PBS) group, (2) irradiation (10 Gy, 1time) alone, (3) CA3 and irradiation, (4) LEE001 and irradiation,and (5) CA3, LEE011, and irradiation (Supplementary Fig. S4).The results showed that irradiation alone resulted in marginalinhibition of tumor growth, but the combination of irradiationand CA3 had a higher antitumor effect (P < 0.05). Significantly,the combination of irradiation, CA3, and LEE011 resulted in themaximum antitumor effect (Supplementary Fig. S4B and S4C)but without affecting the mice body weight (SupplementaryFig. S4D).

DiscussionHere, we demonstrated, for the first time, that both YAP1 and

CDK6 are overexpressed in resistant esophageal cancer tissues andare associated with therapy resistance in esophageal cancer tissuesand cell lines. YAP1 increased CDK6 expression and transcriptionin esophageal cancer cells and resulted in activation of both YAP1and CDK6 to confer radiation resistance in esophageal cancer,whereas depletion of CDK6 reversed YAP1-mediated radiationresistance. Importantly, both pathways positively regulate eachother. The combined inhibition of YAP1 and CDK6 produced thehighest level of antitumor activity in YAP1high and therapy-resis-tant esophageal cancer cells as well as sensitized resistant cells toirradiation (Fig. 6F). Our data demonstrated that CDK6-targetedtherapeutics could be a promising strategy when combined withYAP1-targeted agents to achieve maximal effect in patients withesophageal cancer. This notion is consistent with the currentapproaches in the clinic where single agent inmost circumstanceshas limited value. Cancer cells reprogram frequently, and the dualpathway inhibition may turn out to be a better strategy. Patientsafety will remain a concern with the combination approach.

We have previously reported on YAP1's role in chemotherapyresistance, and we noted that TCGA data showed frequent ampli-fication/overexpression of CDK6 that allowed us to furtherexplore these 2 distinct pathways. We have discovered the cross-talk between the 2 pathways in esophageal cancer. It was recently

Li et al.





Figure 5.

Combination inhibition of YAP1 and CDK6 synergistically suppresses expression of both YAP1 and CDK6 and utmost suppresses cancer stemness in resistantesophageal cancer cells. A, YAP1, CDK6, and phosphor-RB were detected using immunoblotting at SKGT-4 and JHESO esophageal cancer cells treated with CA3at 0.5 mmol/L and LEE001 at 5 mmol/L for 48 hours either alone or in combination. B, YAP1/Tead transcriptional activity was detected in 293T cells transienttransfected with YAP1/Tead and SKGT-4 (PIN20YAP1) cells with induced YAP1 by doxycycline at 1 mg/mL after these cells were treated with CA3 and LEE011 or intheir combination for 48 hours. C, SKGT4 (PIN20YAP) with (DOXþ) or without (DOX�) YAP1 induction with (DOXþ) or without (DOX�) YAP1 induction (left),and FLO-1 cells and its resistant cells (Flo-1 XTR; right) treated with CA3 and LEE011 or in combination for 6 days then cell growth was determined using MTS asindicated in Materials and Methods. D, The effects of combination of CA3 and LEE011 on colony formation in Flo-1 XTR–resistant cells using clonogenic assay asdescribed in Materials and Methods. The experiments were performed in triplicate and repeated at least 3 times. The Student t test was used for statisticalanalysis. �� , P < 0.01 and �� , P < 0.001. E, Flo-1 XTR cells were treated with CA3 and LEE011 either alone or in combination for 48 hours and then labeling withCD133 antibody. CD133þ cells were detected by the flow cytometry. F, Flo-1 XTR cells treated with CA3, LEE011, or in combination for 48 hours and then labelingwith ALDH1þ cell population using ALDH1 labeling kit as described in Materials and Methods. ALDH1þ population in each group was shown in the bar graph on theright. Data are represented as mean and SD from 3 experiments. �� , P < 0.01 and �� , P < 0.001.






reported that YAP1 downregulation increased senescence in ap53- and p21-dependent manner in colorectal carcinoma cellline, HCT116 (25). Xie and colleagues reported that YAP1 coop-erated with TEAD transcription factors to control CDK6 that leads

to senescence (13). Our results suggest that YAP1–CDK6 crosstalkin esophageal cancer cells might be the driver for constitutive oracquired radiation resistance. First, the esophageal cancer cellswith high YAP1 and CDK6weremore invasive andmore resistant

Figure 6.

Strong antitumor activity for the combination of LEE011 and CA3 on resistant esophageal cancer tumor growth in vivo.A, Flo-1 (right) and Flo-1 XTR cells (left;1.5� 106) were injected subcutaneously in nudemice, and each mouse has 2 sites of injections; 5 mice/group. B, Demonstration of treatment plan in Flo-1 XTRCDXmodel. Flo-1 XTR cells (left; 1.5� 106) were injected subcutaneously in nude mice, 5 mice/group, and treated with either CA3 alone, LEE011 alone, or incombination as described in Materials and Methods. Tumor volume (C) and tumor weight (D, top plot) in each group were measured and calculated as describedin Materials and Methods. Representative tumors (D, bottom) from each group after 4 weeks are shown. E, Immunohistochemistry for YAP1, CDK6, and Ki67 wasperformed in mouse tumor tissues derived from Flo-1 XTR xenograft nudemice. F,Working model of both YAP1 and CDK6 positively regulates each other, andthe combination targeting both YAP1 and CDK6may provide novel therapeutic strategies against therapy-resistant esophageal cancer.

Li et al.





to irradiation (Fig. 3A). Second, both YAP1 and CDK6 wereupregulated in posttreatment-resistant esophageal cancer tissues(P2) compared with relatively sensitive esophageal cancer tissues(P0/P1). Induced radiation-resistant Flo-1 XTR and SKGT-4 XTRcells had high YAP1 and CDK6 expression compared with theirrelatively sensitive parental counterparts. Third, we observedthat the YAP1-mediated resistance by introducing YAP1 intoesophageal cancer cells made cells more aggressive when trea-ted with the ionized radiation (Fig. 3A). In contrast, pharma-cologic and/or genetic knock down of YAP1 or CDK6 inYAP1high or XTR-resistant esophageal cancer cells significantlydecreased tumor growth and increased sensitivity to irradia-tion (10, 26). In addition, although we focused more on YAP1'supregulation of CDK6 using genetic and pharmacologic toolsin this study, we observed that the inhibition of CDK6 byLEE001 or the genetic knock down of CDK6 in esophagealcancer cells decreased YAP1 expression indicating a feed-for-ward–positive regulation of YAP1 by CDK6 that requires fur-ther investigation (Fig. 6F).

In a previous study, we have reported on another YAPinhibitor Verteporfin (VP) inhibited YAP1 protein levels, sen-sitized cells to cytotoxics, and overcame chemoresistance (10,27). In the present study, we investigated CA3 (a compoundsimilar to CIL56 according to analysis of its structure; ref. 24)strongly inhibited both YAP1 and CDK6 protein levels, CSCproperties, and tumor sphere formation in radiation-resistantesophageal cancer cells. Similar effects can also be observedwith the orally available LEE011 targeting CDK4/6 activity,thereby inhibiting Rb protein phosphorylation and inducingG1 arrest in esophageal cancer cells while not affecting expres-sion of CDK6. Interestingly, LEE001 inhibited YAP1 overex-pression, the YAP1/Tead transcriptional activity, and CA3strongly suppressed CDK6 overexpression and reduced Rbphosphorylation, further confirming the YAP1–CDK6 crosstalkin esophageal cancer cells.

The clinical use of selective CDK4/6 inhibitor combined with atargeted agent or paclitaxel has been proven to be efficacious inadvanced-stage ERþ breast cancer and other tumor types (ref. 28;refs. 12, 29). In this study, we showed that YAP1 upregulatesCDK6 and keeps CDK6 active (increased Rb phosphorylation).We propose that dual inhibition of both YAP1 and CDK6 mayimprove outcome.

The mounting evidence suggests that CSCs are particularlyresistant to chemo/radiation therapy and may therefore contrib-ute to treatment failure (30). In esophageal cancer, the CSCpopulation can be efficiently evaluated by stem cell markersincluding CD133 (31), CD44, and ALDH1 labeling (32, 33).Zimmerer and colleagues (34) reported that tumor formation inNOD/SCID mice only needs as few as 500 CD133þ melanomacells; in contrast, 100,000 CD133� cells failed to form tumors inthese mice. Our previous report showed that ALDH1 is a reliableCSC marker in upper gastrointestinal track tumors (32). Thissuggests that the CD133þ or ALDH1þ cells are likely to be theCSCs. Consistent with these results, we found that the radiation-resistant Flo-1 XTR cells with high CD133þ and high ALDH1þ

populations could easily form tumor sphere in vitro and easilygenerate xenografts in mice, whereas the Flo-1 parental cells withlowCD133þ and lowALDH1þ cells didnot. These data imply thatCSC properties could be the seeds for tumor growth and the keyfactors for therapy resistance. Our previous finding has indicatedthat YAP1 is the major contributor to CSCs, and targeting YAP1

could be an effective method to target CSCs (22, 24). In thepresent study, we propose that targeting the YAP1–CDK6 axiscould be of value. Inducing radiation resistance in cells enrichesthem with CSCs, whereas the combination of CA3 and LEE001reduced number of CSCs reflected by lowered tumor sphereformation and reduced fraction of cells labeling for CD133þ,CD44þ, and/or ALDH1þ.

It is well established that the sensitivity to irradiation is cell-cycle phase dependent (35–37). Radiation-induced lesionssuch as single-strand breaks and inter-strand crosslinks thatare more toxic in the S phase but relatively nontoxic in the G1phase (38). The intrinsic resistance to DNA-damaging agentsand an increased rate of DNA repair result from G1 arrest thatmay enhance radioresistance (39, 40). We showed that selectivepharmacologic inhibition of CDK6 induced by LE001 in esoph-ageal cancer leads to G1 arrest, which is consistent with theprior reports (41). Further, downregulation of CDK6 by lenti-Crispr/Cas9 sensitized the YAP1-induced radiation-resistantesophageal cancer cells.

Whether the YAP1/CDK6 axis is operative in both majorhistologic phenotypes of esophageal cancer remains unclear.ESCCand esophageal adenocarcinomaphenotypes of esophagealcancer are genomically distinct in many aspects as noted in theTCGAanalyses (42). Clinically, ESCCappears tobemore sensitiveto chemotherapy and chemoradiation than esophageal adeno-carcinoma, but there are no distinct initial therapies available forthese 2 phenotypes; however, the modern clinical trials no longercombine these 2 histologies. Acknowledging considerable geneticdiversity in the 2 phenotypes, our results suggest that theYAP-CDK6 crosstalk may be operative in some cases of both EACand ESCC since the regulation of YAP1 on CDK6 had similar(preclinical) outcomes in both phenotypes when we geneticallyoverexpressed knockdown of YAP1 in both (EAC ¼ SKGT-4 andJHESOandESCC¼KATO-TNandYES-6).Wewould emphasize abiomarker-based rational clinical trial (using YAP1 and CDK6overexpression to enrichpatients).Wewould also like tohighlightthat the empiric therapeutic strategies that are so prevalent in theclinics could be reduced by in-depthmolecular analyses of esoph-ageal cancer.

In conclusion, our data demonstrated that both YAP1 andCDK6 are often overexpressed in resistant esophageal cancertissues (P2) compared with relatively sensitive esophageal cancertissues (P1), and YAP1 upregulated the CDK6 overexpression andtranscription in esophageal cancer cells. Positive crosstalk of theYAP1 and CDK6 pathways mediated radiation resistance, butthe combined inhibition of YAP1 and CDK6 provided bestantitumor effect in vitro and in vivo, particularly in radiation-resistant cells. Thus, our results provide a strong rationale for aclinical trial for patients with resistant esophageal cancer with anactivated YAP1–CDK6 axis while enriching the patient popula-tion based on these biomarkers.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: S. Song, J.A. AjaniDevelopment of methodology: F. Li, W. Zhao, M. Pool Pizzi, M. Xie,H.D. Skinner, S. Song, J.A. AjaniAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): F. Li, Y. Xu, B. Liu, P.K. Singh, J. Jin, A.W. Scott,X. Dong, Y. Wang, K. Harada, H.D. Skinner, S. Krishnan, R.L. Johnson, J.A. Ajani






Analysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): F. Li, G. Han, L. Huo, L. Ma, Y. Li, M. Xie, L. Wang,S. Krishnan, S. Song, J.A. AjaniWriting, review, and/or revision of the manuscript: F. Li, P.K. Singh, M. Xie,H.D. Skinner, S. Krishnan, R.L. Johnson, S. Song, J.A. AjaniAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): B. Liu, X. Dong, Y. Li, S. Ding, S. SongStudy supervision: S. Song, J.A. Ajani

AcknowledgmentsWe would like to acknowledge Donald R. Norwood, in the Department of

Scientific Publications of UT MD Anderson Cancer Center for her Englishrevision on this article. This work was supported by Public Health Service GrantDF56338 which supports the Texas Medical Center Digestive Diseases Center

(S. Song); an MD Anderson Institutional Research Grant (3-0026317, toS. Song); grants from Department of Defense (CA160433, to S. Song); andNIH (CA129906, CA138671, and CA172741, to J.A. Ajani). This work was alsosupported by NIH/NCI under award number P30CA016672 and used the FlowCytometry and Cellular Imaging Core Facility.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

ReceivedApril 2, 2018; revisedAugust 16, 2018; acceptedDecember 14, 2018;published first December 18, 2018.

References1. Wu C, Hu Z, He Z, Jia W, Wang F, Zhou Y, et al. Genome-wide association

study identifies three new susceptibility loci for esophageal squamous-cellcarcinoma in Chinese populations. Nat Genet 2011;43:679–84.

2. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2017. CA Cancer J Clin2017;67:7–30.



5. van Hagen P, Hulshof MC, van Lanschot JJ, Steyerberg EW, van BergeHenegouwen MI, Wijnhoven BP, et al. Preoperative chemoradiother-apy for esophageal or junctional cancer. N Engl J Med 2012;366:2074–84.

6. Sjoquist KM, Burmeister BH, Smithers BM, Zalcberg JR, Simes RJ, BarbourA, et al. Survival after neoadjuvant chemotherapy or chemoradiotherapyfor resectable oesophageal carcinoma: an updated meta-analysis.Lancet Oncol 2011;12:681–92.

7. Paulson TG, Reid BJ. Focus on Barrett's esophagus and esophageal ade-nocarcinoma. Cancer Cell 2004;6:11–6.

8. Kim JJ, Tannock IF. Repopulation of cancer cells during therapy: animportant cause of treatment failure. Nat Rev Cancer 2005;5:516–25.

9. Song S, Ajani JA, Honjo S, Maru DM, Chen Q, Scott AW, et al. Hippocoactivator YAP1 upregulates SOX9 and endows esophageal cancer cellswith stem-like properties. Cancer Res 2014;74:4170–82.

10. Song S, Honjo S, Jin J, Chang SS, Scott AW, Chen Q, et al. The HippoCoactivator YAP1 mediates EGFR overexpression and confers chemoresis-tance in esophageal cancer. Clin Cancer Res 2015;21:2580–90.

11. Ismail A, Bandla S, Reveiller M, Toia L, Zhou Z, Gooding WE, et al. Early G(1) cyclin-dependent kinases as prognostic markers and potential thera-peutic targets in esophageal adenocarcinoma. Clin Cancer Res 2011;17:4513–22.

12. O'Leary B, Finn RS, Turner NC. Treating cancer with selective CDK4/6inhibitors. Nat Rev Clin Oncol 2016;13:417–30

13. Xie Q, Chen J, Feng H, Peng S, Adams U, Bai Y, et al. YAP/TEAD-mediated transcription controls cellular senescence. Cancer Res 2013;73:3615–24.

14. Raju U, Ariga H, Koto M, Lu X, Pickett J, Valdecanas D, et al. Improve-ment of esophageal adenocarcinoma cell and xenograft responses toradiation by targeting cyclin-dependent kinases. Radiother Oncol 2006;80:185–91.

15. Soldes OS, Kuick RD, Thompson IA 2nd, Hughes SJ, Orringer MB, Ian-nettoni MD, et al. Differential expression of Hsp27 in normal oesophagus,Barrett's metaplasia and oesophageal adenocarcinomas. Br J Cancer 1999;79:595–603.

16. Wang Y, Ding Q, Yen CJ, Xia W, Izzo JG, Lang JY, et al. The crosstalk ofmTOR/S6K1 and Hedgehog pathways. Cancer Cell 2012;21:374–87.

17. Chen D, Sun Y,Wei Y, Zhang P, Rezaeian AH, Teruya-Feldstein J, et al. LIFRis a breast cancer metastasis suppressor upstream of the Hippo-YAPpathway and a prognostic marker. Nat Med 2012;18:1511–7.

18. Song S,MazurekN, Liu C, Sun Y, DingQQ, Liu K, et al. Galectin-3mediatesnuclear beta-catenin accumulation and Wnt signaling in human coloncancer cells by regulation of glycogen synthase kinase-3beta activity.Cancer Res 2009;69:1343–9.

19. Song S, KrishnanK, LiuK, Bresalier RS. PolyphenonE inhibits the growth ofhuman Barrett's and aerodigestive adenocarcinoma cells by suppressingcyclin D1 expression. Clin Cancer Res 2009;15:622–31.

20. Zhao B, Kim J, Ye X, Lai ZC, Guan KL. Both TEAD-binding and WWdomains are required for the growth stimulation and oncogenic transfor-mation activity of yes-associated protein. Cancer Res 2009;69:1089–98.

21. Song S, Maru DM, Ajani JA, Chan CH, Honjo S, Lin H-K, et al. Loss of TGF-beta adaptor beta2SP activates notch signaling and SOX9 expression inesophageal adenocarcinoma. Cancer Res 2013;73:2159–69.

22. Slemmons KK, Crose LES, Riedel S, Sushnitha M, Belyea B, Linardic CM. Anovel Notch-YAP circuit drives stemness and tumorigenesis in embryonalrhabdomyosarcoma. Mol Cancer Res 2017;15:1777–91.

23. WadhwaR,Wang X, Baladandayuthapani V, Liu B, ShiozakiH, ShimodairaY, et al. Nuclear expression of Gli-1 is predictive of pathologic completeresponse to chemoradiation in trimodality treated oesophageal cancerpatients. Br J Cancer 2017;117:648–55.

24. Song S, Xie M, Scott AW, Jin J, Ma L, Dong X, et al. A Novel YAP1 Inhibitortargets CSCs-enriched radiation resistant cells and exerts strong antitumoractivity in esophageal adenocarcinoma. Mol Cancer Ther 2017 2018;17:443–54.

25. Vigneron AM, Vousden KH. An indirect role for ASPP1 in limiting p53-dependent p21 expression and cellular senescence. EMBO J 2012;31:471–80.

26. Chatrchyan S, Khachatryan V, Sirunyan AM, Tumasyan A, Adam W,Bergauer T, et al. Search for top squarks in R-parity-violating supersym-metry using three or more leptons and b-tagged jets. Phys Rev Lett 2013;111:221801.

27. Sims-Mourtada J, Izzo JG, Ajani J, Chao KS. Sonic Hedgehog promotesmultiple drug resistance by regulation of drug transport. Oncogene 2007;26:5674–9.

28. Clark AS, Karasic TB, DeMichele A, Vaughn DJ, O'Hara M, Perini R, et al.Palbociclib (PD0332991)-a selective and potent cyclin-dependent kinaseinhibitor: a review of pharmacodynamics and clinical development.JAMA Oncol 2016;2:253–60.

29. O'Leary B, Finn RS, Turner NC. Treating cancer with selective CDK4/6inhibitors. Nat Rev Clin Oncol 2016;13:417–30.

30. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Gliomastem cells promote radioresistance by preferential activation of the DNAdamage response. Nature 2006;444:756–60.

31. Sui YP, Jian XP, Ma LI, Xu GZ, Liao HW, Liu YP, et al. Prognostic value ofcancer stem cell marker CD133 expression in esophageal carcinoma: ameta-analysis. Mol Clin Oncol 2016;4:77–82.

32. Ajani JA, Wang X, Song S, Suzuki A, Taketa T, Sudo K, et al. ALDH-1expression levels predict response or resistance to preoperative chemor-adiation in resectable esophageal cancer patients. Mol Oncol 2014;8:142–9.

33. Ajani JA, Song S,HochesterHS, Steinberg IB. Cancer stem cells: the promiseand the potential. Semin Oncol 2015;42:S3–17.

34. Zimmerer RM, Korn P, Demougin P, KampmannA, Kokem€uller H, EckardtAM, et al. Functional features of cancer stem cells in melanoma cell lines.Cancer Cell Int 2013;13:78.

35. Little JB. Repair of sub-lethal and potentially lethal radiation damage inplateau phase cultures of human cells. Nature 1969;224:804–6.

Li et al.





36. IliakisG,WangY,Guan J,WangH.DNAdamage checkpoint control in cellsexposed to ionizing radiation. Oncogene 2003;22:5834–47.

37. Rothe WE, Grenan MM. Radioprotection by mitotic inhibitors and mer-captoethylamine. Science 1961;133:888.

38. Caldecott KW. Single-strand break repair and genetic disease. Nat RevGenet 2008;9:619–31.

39. Mosesso P, Palitti F, Pepe G, Pi~nero J, Bellacima R, Ahnstrom G, et al.Relationship between chromatin structure, DNA damage and repair fol-lowing X-irradiation of human lymphocytes. Mutat Res 2010;701:86–91.

40. Sun Y, Jiang X, Price BD. Tip60: connecting chromatin to DNA damagesignaling. Cell Cycle 2010;9:930–6.

41. Johnson SM, Torrice CD, Bell JF, Monahan KB, Jiang Q, Wang Y, et al.Mitigation of hematologic radiation toxicity in mice through pharmaco-logical quiescence induced by CDK4/6 inhibition. J Clin Invest 2010;120:2528–36.

42. Cancer Genome Atlas Research Network; National Institutes of Health.Integrated genomic characterization of oesophageal carcinoma. Nature2017;541:169–75.






2019;25:2264-2277. Published OnlineFirst December 18, 2018.Clin Cancer Res Fan Li, Yan Xu, Bovey Liu, et al. CDK4/6 Inhibitors in Esophageal Cancer

Rationale for the Combination of YAP1 and−Esophageal Cancer YAP1-Mediated CDK6 Activation Confers Radiation Resistance in

Updated version

10.1158/1078-0432.CCR-18-1029doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2018/12/18/1078-0432.CCR-18-1029.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/25/7/2264.full#ref-list-1

This article cites 42 articles, 12 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/25/7/2264.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/25/7/2264To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-18-1029http://clincancerres.aacrjournals.org/content/suppl/2018/12/18/1078-0432.CCR-18-1029.DC1http://clincancerres.aacrjournals.org/content/25/7/2264.full#ref-list-1http://clincancerres.aacrjournals.org/content/25/7/2264.full#related-urlshttp://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/25/7/2264http://clincancerres.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

Documents

YAP1-Mediated CDK6 Activation Confers Radiation …Research, Daping Hospital, Third Military Medical University, Chongqing, China. ... The normal human esophageal epithelial cell line