37
Applications of CRISPR- Cas9 for disease research Randall J. Platt, Ph.D. Feng Zhang Lab, Broad Institute of MIT and Harvard

Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

  • Upload
    others

  • View
    8

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Applications of CRISPR-

Cas9 for disease research

Randall J. Platt, Ph.D.

Feng Zhang Lab,

Broad Institute of MIT and Harvard

Page 2: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Engineering the genome to

investigate disease mechanisms

Randall J Platt, PhD Broad | MIT | McGovern

Page 3: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

gacaagaagtacagcatcggcctggacatcggcaccaact

ctgtgggctgggccgtgatcaccgacgagtacaaggtgccc

agcaagaaattcaaggtgctgggcaacaccgaccggcac

agcatcaagaagaacctgatcggagccctgctgttcgaca

gcggcgaaacagccgaggccacccggctgaagagaacc

gccagaagaagatacaccagacggaagaaccggatctg

ctatctgcaagagatcttcagcaacgagatggccaaggtgg

acgacagcttcttccacagactggaagagtccttcctggtgg

aagaggataagaagcacgagcggcaccccatcttcggca

acatcgtggacgaggtggcctaccacgagaagtaccccac

catctaccacctgagaaagaaactggtggacagcaccgac

aaggccgacctgcggctgatctatctggccctggcccacat

gatcaagttccggggccacttcctgatcgagggcgacctga

Page 4: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Patients

Disease

Genotype Phenotype

Therapy

Model systems

Page 5: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Targeted DNA breaks facilitate genome editing

Knock-out Knock-in

Page 6: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Targeted genome editing toolbox

• ZF

• TALE

• ZFN/TALEN

• CRISPR-Cas9

Page 7: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,
Page 8: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

CRISPR: a microbial adaptive immune system

Page 9: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

CRISPR-Cas9

• Guide RNA + Cas9

• 20 nucleotide target

• DNA double strand break

• Multiplexable

Jinek et al. Science 2012, Gausianas et al. PNAS 2012, Cong et al. Science 2013, Mali et al Science 2013.

Page 10: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Gene editing with Cas9

in vitro in cell lines Cong et al. Science 2013

Mali et al. Science 2013

Jinek et al. eLife 2013

Cho et al. Nat Biotechnol 2013

and others

single cell zygotes Hwang et al. Nat Biotechnol 2013

Wang et al. Cell 2013

Niu et al. Cell 2014

and others

Page 11: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Edit genes directly in vivo in adult mice

Cas9 sgRNA sgRNA

Cas9 mouse

Page 12: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Controlled Cas9 expression by Cre crosses

Neuronal subtype

specific expression

Ubiquitous expression

TH Cas9 TH/Cas9

PV Cas9 PV/Cas9

Zoom

Zoom

Platt et al. Cell 2014

Page 13: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Is Cas9 toxic in vivo?

LSL-Cas9 WT Cas9

Platt et al. Cell 2014

LSL-Cas9 WT

Cas9

Page 14: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Cas9-mediates efficient gene KO

Platt et al. Cell 2014

Page 15: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Cas9-mediates efficient gene KO

Platt et al. Cell 2014

Page 16: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Cas9-mediates efficient gene KO

Western blot

Western blot quant Indel analysis by NGS

NeuN

Platt et al. Cell 2014

Page 17: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

NeuN Platt et al. Cell 2014

Page 18: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

From monogenic to polygenic

Page 19: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Polygenic disease modeling

• Simultaneously model top three lung cancer alleles • P53, LKB1, KRAS

Platt et al. Cell 2014

Page 20: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Polygenic disease modeling

• Simultaneously model top three lung cancer alleles • P53, LKB1, KRAS

Saline AAV9-luciferase

Platt et al. Cell 2014

Page 21: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Polygenic disease modeling

• Simultaneously model top three lung cancer alleles • P53, LKB1, KRAS

sgLacZ Kras, p53, and Lkb1

(KPL)-targeted

Platt et al. Cell 2014

Page 22: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Polygenic disease modeling

• Simultaneously model top three lung cancer alleles • P53, LKB1, KRAS

sgLacZ Kras, p53, and Lkb1 (KPL)-targeted

Platt et al. Cell 2014

Page 23: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Genome engineering with CRISPR-Cas9 mice

Page 24: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Acknowledgements Feng Zhang

Ian Slaymaker

Naomi Habib

Lukasz Sweich

Hannah Kempton

Matthias Heidenreich

Michael Yim

Zhang lab

Phil Sharp

Sidi Chen

Guoping Feng

Yang Zhou

Robert Langer

Daniel Anderson

James Dahlman

Siddharth Jhunjhunwala

Aviv Regev

Oren Parnas

Marko Jovanovic

Nir Hacohen

Thomas Eisenhaure

Ramnik Xavier

Daniel Graham

Personal support: NSF GRFP, Afeyan, and Friends of McGovern Fellowships

Research support: NIH Pioneer and TR01 awards, NSF Waterman; the Keck, Damon Runyon,

Searle Scholars, Klingenstein, Vallee, Merkin, and Simons Foundations, and Bob Metcalfe

Resources:

Cas9 mice available through

The Jackson Laboratory

Cre-dependent - 024857

Constitutive - 024858

DNA plasmids available through Addgene

Page 25: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Questions?

[email protected]

Page 26: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Learn More

www.genscript.com/CRISPR.html

Page 27: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Learn more

27

Page 28: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

CRISPR Services & Reagents

28

Page 29: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Please complete the survey

Webinar Archives:

www.genscript.com/webinars.html

CRISPR Resource Center:

www.genscript.com/CRISPR.html

Thank you!

29

Page 30: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,
Page 31: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Applications of CRISPR-Cas9 mice

Page 32: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Immune cell editing ex vivo

Page 33: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,
Page 34: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,
Page 35: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,

Vasculature genome editing by

nanoparticle-mediated delivery of sgRNA

Page 36: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,
Page 37: Applications of CRISPR- Cas9 for disease research · CRISPR-Cas9 •Guide RNA + Cas9 •20 nucleotide target •DNA double strand break •Multiplexable Jinek et al. Science 2012,