Étude de la guérison des plaies cornéennes grâce à la cornée reconstruite par génie tissulaire

Mémoire

Camille Couture

Maitrise en biologie cellulaire et moléculaire Maître ès sciences (M. Sc.)

Québec, Canada

© Camille Couture, 2016

II

Étude de la guérison des plaies cornéennes grâce à la cornée reconstruite par génie tissulaire

Mémoire

Camille Couture

Sous la direction de :

Lucie Germain, directrice de recherche Sylvain Guérin, codirecteur de recherche

III

Résumé

La cornée est la couche la plus antérieure de l'oeil et sa transparence permet de laisser passer les ondes lumineuses vers la rétine. Cependant, la localisation de la cornée la prédispose à des blessures chimiques et mécaniques. La guérison des blessures cornéennes est un mécanisme complexe faisant intervenir la mort cellulaire, la migration, la prolifération, la différenciation et le remodelage de la matrice extracellulaire (MEC). Dans cette étude, nous avons utilisé la cornée humaine reconstruite par génie tissulaire composée d’un épithélium et d’un stroma afin d’étudier les mécanismes cellulaires et moléculaires de la guérison des plaies, en particulier le remodelage de la MEC exercé par les métalloprotéinases matricielles (MMPs). Les analyses en profilage génique sur biopuces à ADN nous ont permis de démontrer que l’expression de plusieurs gènes était dérégulée lors de la guérison des plaies dans notre modèle. L’expression des gènes codant pour les MMPs, tel que confirmée en qPCR, est augmentée dans l’épithélium migrant afin de recouvrir la plaie. Les analyses en zymographie sur gel ont démontré que les MMPs étaient converties en leur forme enzymatiquement active au fur et à mesure que la lésion se referme. Par ailleurs, nous avons démontré que l’expression des MMPs par les cellules épithéliales est influencée par la présence des fibroblastes dans le stroma ainsi que par leur sécrétion d’une MEC enrichie en collagènes. De plus, les analyses en spectrométrie de masse ont confirmé que la présence d’un épithélium stratifié est requise pour la synthèse et l’organisation adéquate de la MEC. Enfin, les résultats de ces travaux améliorent nos connaissances des mécanismes cellulaires et moléculaires qui modulent la guérison des plaies cornéennes et pourront certainement mener à des progrès en clinique, notamment au niveau du développement de thérapies visant à traiter les troubles de la cornée.

IV

Abstract The cornea is located at the outer surface of the eye and its transparency is required to allow light transmission to the retina. However, because of its location, the cornea is subjected to chemical and mechanical injuries. Corneal wound healing is a complex mechanism involving many processes such as cell death, migration, proliferation, differentiation and extracellular matrix (ECM) remodeling. In the present study, we used a tissue-engineered, two-layers (epithelium and stroma) human cornea as a biomaterial to study both the cellular and molecular mechanisms of wound healing, more specifically the ECM remodeling exerted by matrix metalloproteinases (MMPs). Gene profiling on microarrays revealed important alterations in the pattern of genes expressed by tissue-engineered corneas in response to wound healing. Expression of many MMPs-encoding genes was shown by microarray and qPCR analyses to increase in the migrating epithelium of wounded corneas. Many of these enzymes were converted into their enzymatically active form as wound closure proceeded. In addition, expression of MMPs by human corneal epithelial cells was affected both by the stromal fibroblasts and the collagen-enriched ECM they produce. Most of all, results from mass spectrometry analyses provided evidence that a fully stratified epithelium is required for proper synthesis and organization of the ECM on which the epithelial cells adhere. This study will improve our understanding of the cellular and molecular mechanisms that modulate human corneal wound healing by exploiting a new, innovative 3D reconstructed tissue much closer to the native cornea. It is likely that our study will lead to the development of novel therapies for the treatment of many corneal disorders.

V

Table des matières Résumé ......................................................................................................................................................... III  Abstract ......................................................................................................................................................... IV  Table des matières ......................................................................................................................................... V  Liste des tableaux ......................................................................................................................................... VII  Liste des figures .......................................................................................................................................... VIII  Liste des abréviations et des sigles ............................................................................................................... IX  Remerciements ........................................................................................................................................... XIII  Avant-propos .............................................................................................................................................. XIV   Chapitre I : Revue de la littérature .................................................................................................................. 1  1. Introduction ................................................................................................................................................. 1  

1.1. Le globe oculaire humain .................................................................................................................... 2  1.2. La cornée ............................................................................................................................................ 4  

1.2.1. L’épithélium cornéen .................................................................................................................... 5  1.2.2. La membrane de Bowman et le stroma cornéen ......................................................................... 8  1.2.3. La membrane de Descemet et l’endothélium cornéen .............................................................. 10  

1.3. La cornée reconstruite par génie tissulaire ....................................................................................... 10  1.3.1. Le génie tissulaire ...................................................................................................................... 11  1.3.2. La cornée reconstruite par auto-assemblage ............................................................................ 13  

1.4. Les troubles visuels liés à la cornée et les traitements ..................................................................... 17  1.4.1. Les types de blessures à la cornée ........................................................................................... 17  1.4.2. Les conséquences des blessures cornéennes .......................................................................... 19  1.4.3. Les traitements des troubles de la cornée ................................................................................. 22  

1.5. La guérison des plaies cornéennes .................................................................................................. 26  1.5.1. Le processus de cicatrisation de la cornée ................................................................................ 26  1.5.2. Le remodelage de la matrice extracellulaire lors de la guérison des plaies cornéennes ........... 34  

1.6. Problématique, hypothèse et objectifs de recherche ........................................................................ 46  1.6.1. Problématique et hypothèse ...................................................................................................... 46  1.6.2. Objectifs de recherche ............................................................................................................... 46  

Chapitre II : ................................................................................................................................................... 48  La cornée humaine reconstruite par génie tissulaire comme modèle d’étude pour l’analyse de l’expression des métalloprotéinases matricielles lors de la guérison des plaies cornéennes .......................................... 48  

2.1. Résumé ............................................................................................................................................. 48  2.2. Title Page .......................................................................................................................................... 50  The tissue-engineered human cornea as a model to study expression of matrix metalloproteinases during corneal wound healing .................................................................................................................. 50  

VI

2.3. Abstract ............................................................................................................................................. 51  2.4. Introduction ....................................................................................................................................... 52  2.5. Materials and Methods ...................................................................................................................... 55  

2.5.1. Cell culture and production of the tissue-engineered human corneas ....................................... 55  2.5.2. Mass spectrometry .................................................................................................................... 56  2.5.3. Western Blots ............................................................................................................................ 57  2.5.4. Gene expression profiling .......................................................................................................... 58  2.5.5. Gelatin zymography ................................................................................................................... 59  2.5.6. Quantitative PCR (qPCR) .......................................................................................................... 59  2.5.7. Statistical analyses .................................................................................................................... 60  

2.6. Results .............................................................................................................................................. 60  2.6.1. Analysis of corneal wound healing in tissue-engineered human corneas ................................. 60  2.6.2.The gene expression pattern is altered by wound healing in the tissue-engineered human cornea .................................................................................................................................................. 61  2.6.3. Epithelial cells respond to corneal damage by altering the expression of MMPs ...................... 62  2.6.4. Deregulated expression of MMPs by HCECs depends on the presence of stromal fibroblasts 64  2.6.5. The composition of the stromal ECM is under the influence of HCECs .................................... 65  

2.7. Discussion ......................................................................................................................................... 66  2.8. Conclusion ........................................................................................................................................ 72  2.9. Acknowledgments ............................................................................................................................. 72  2.10. References ...................................................................................................................................... 74  2.11. Tables ............................................................................................................................................. 83  2.12. Figures Legends ............................................................................................................................. 84  2.13. Supplementary Data ....................................................................................................................... 95  

Chapitre III : Discussion et conclusion ........................................................................................................ 104  

3.1. Discussion ....................................................................................................................................... 104  3.1.1. Les forces de l’étude ................................................................................................................ 105  3.1.2. Les limites de l’étude ............................................................................................................... 108  3.1.3. L’effet de vague signalétique ................................................................................................... 109  

3.2. Perspective de recherche ............................................................................................................... 111  3.3. Conclusion générale ....................................................................................................................... 114  

Bibliographie ............................................................................................................................................... 115  

VII

Liste des tableaux

Table 2.1. Average ECM peptide counts. ………………………………………………………………………... 83

Supplementary Table 2.1. DNA sequence of the primers for qPCR analyses. ……………………………… 95

Supplementary Table 2.2. Biological functions of the proteins encoded by the differentially expressed genes ………………………………………………………………………………………………………………………… 96

VIII

Liste des figures

Figure 1.1. Représentation schématique des différentes parties du globe oculaire humain. ……………….. 4

Figure 1.2. Histologie d’une cornée humaine colorée au trichrome de Masson. ……………………………... 5

Figure 1.3. Localisation du limbe et différenciation des cellules souches cornéennes. ……………………… 8

Figure 1.4. Reconstruction d’une cornée humaine selon la méthode d’auto-assemblage. ………………… 14

Figure 1.5. Vue macroscopique de la cornée reconstruite produite par auto-assemblage. ………………... 16

Figure 1.6. La conjonctivalisation de la cornée. ……………………………………………………………….... 21

Figure 1.7. Les quatre étapes de la cicatrisation de l’épithélium cornéen. …………………………………... 27

Figure 1.8. La migration des cellules épithéliales cornéennes pendant la guérison d’une lésion. ………… 30

Figure 1.9. Les métalloprotéinases matricielles : les différentes familles, leurs structures et leurs substrats spécifique. …………………………………………………………………………………………………………… 38

Figure 1.10. La structure de la pro-MMP-2 et ses domaines. ………………………………………….……… 44

Figure 2.1. Production of wounds on tissue-engineered human corneas. …………………………………… 88

Figure 2.2. Microarray analysis of gene expression patterns in response to corneal damage. ……………. 89

Figure 2.3. Analysis of MMPs gene expression in response to corneal damage. …………………………... 90

Figure 2.4. Expression and enzymatic activity of MMPs during wounds closure. …………………………… 91

Figure 2.5. Expression of MMPs in HCECs grown on a complex stroma. …………………………………… 92

Figure 2.6. Influence of individual ECM components on the expression of MMP genes. ………………….. 93

Figure 2.7. Contribution of HCECs to the composition of the reconstructed corneal stroma. ……………... 94

Supplementary Figure 2.1. Graphical techniques. …………………………………………………………….. 103

IX

Liste des abréviations et des sigles

α Alpha

β Beta

DNA / ADN Deoxyribonucleic acid / Acide désoxyribonucléique

cDNA / ADNc complementary DNA / ADN complémentaire

ALS Average linear signal

AP-1 Activator Protein 1

AP-2 Activating enhancer binding protein 2

RNA / ARN Ribonucleic acid / Acide ribonucléique

mRNA / ARNm messenger RNA / ARN messager

B2M β2-microglobulin

BM Basement Membrane ; Membrane basilaire

BSA Bovine Serum Albumin ; Albumine de sérum bovin

C Cystéine

CAC2 Adenoid cystic carcinoma

CD44 CD44 Molecule (Indian Blood Group)

CDH2 Cadherin-2

HCECs / CECHs Human corneal epithelial cells / Cellules épithéliales de cornée humaine

CI Collagen type I

CIV Collagen type IV

CVII Collagen type VII

X

CRTAC1 Cartilage Acidic Protein 1

Da Dalton

DTT Dithiothreitol ; Dithiothréitol

EGF Epidermal growth factor

ES MS/MS Electrospray mass spectrometry

Ets Transcription factor E26 transformation-specific

FGF Fibroblast growth factor

FN Fibronectin ; Fibronectine

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

H Histidine

HGF Hepatocyte growth factor

IGF-1 Insulin-like growth factor-1

IgG Immunoglobuline G

IL Interleukin ; Interleukine

JNK c-Jun N-terminal Kinase

K Keratin ; Kératine

kDa Kilodalton

KGF Keratinocyte growth factor

Kiss-1 Kisspeptin

LAMA3 Laminin α3

LAMA5 Laminin α5

LAMC2 Laminin γ2

LASIK Laser-assisted in situ keratomileusis

XI

LCE3D Late Cornified Envelope 3D

LM Laminin ; Laminine

LOEX Laboratoire d’Organogenèse EXpérimental

M1 Myoepithelioma

MEC / ECM Matrice extracellulaire / Extracellular matrix

mmHg Millimètre de mercure

MMPs Matrix metalloproteinases ; Métalloprotéinases matricielles

MT-MMPs Membrane-type MMPs

MTA-1 Metastasis Associated 1

Na+ Ion sodium

Na+/K+ ATPase Pompe sodium-potassium adénosine triphosphatase

NF-κB Nuclear Factor kappa B

OMS Organisation Mondial de la Santé

PAMR1 Peptidase domain containing associated with muscle regeneration 1

Pax-6 Paired box protein 6

PBS Phosphate buffer saline ; Tampon phosphate salin

PDGF Platelet-derived growth factor

PRK / PKR Photorefractive keratectomy / Photokératectomie réfractive

qPCR Quantitative PCR (Real-time PCR) ; PCR quantitative (PCR en temps réel)

RECK Reversion-inducing-cysteine-rich protein with kazal motifs

RP Reversed-phase

SD Standard Deviation ; Écart-type

Sp1 Specific Protein 1

XII

Sp3 Specific Protein 3

SPRR2B Small Proline-Rich Protein 2B

SPRR2D Small Proline-Rich Protein 2D

stroma/HCEC- Stromal matrix without epithelial cells

stroma/HCEC+ Complete tissue-engineered corneas

TGF-β Transforming growth factor beta

TIMPs Tissue inhibitors of metalloproteinases ; Inhibiteurs tissulaires des métalloprotéinases

TN Tenascin ; Ténascine

TNF-α Tumour necrosis factor alpha

UV Ultraviolet

VCAM1 Vascular cell adhesion protein 1

Zn2+ Ion zinc

XIII

Remerciements

Je tiens avant tout à remercier mes directeurs de recherche pour la supervision des travaux de recherche présentés dans ce mémoire. D’abord, un merci tout spécial à Dre Lucie Germain pour la confiance qu’elle m’a accordée en m’offrant de débuter un stage dans son laboratoire en 2012, alors que je n’avais qu’une année de baccalauréat en poche. C’est sans aucun doute cette première opportunité en recherche qui m’a donné le goût de poursuivre à la maitrise. Je l’a remercie pour son dévouement, son soutien, ses encouragements et sa grande générosité. Également, je tiens à remercier de tout cœur le Dr Sylvain Guérin pour son support constant et sa présence tout au long de ma maitrise. Ses encouragements, ses explications et ses bonnes idées ont certainement contribué au succès de mon projet de recherche. Je suis très reconnaissante de l’encadrement de qualité qui m’a été offert lors de ma maitrise.

Ensuite, j’aimerais remercier les professionnels de recherche Patrick Carrier et Karine Zaniolo, qui m’ont enseigné les techniques de culture cellulaire et de biologie moléculaire. C’est grâce à eux si je suis parvenue à réaliser mon projet de recherche de manière autonome. Un merci particulier à Karine pour la réalisation des analyses sur biopuces à ADN et en qPCR qui sont présentées dans ce mémoire, son aide est très appréciée. Des remerciements sincères également à tous les étudiants du laboratoire, en particulier ceux qui ont participé à la réalisation des travaux présentés dans l’article. Votre collaboration à mon projet de recherche m’est très chère.

Je tiens aussi à remercier les Fonds de Recherche du Québec-Santé (FRQS), le Réseau en recherche en santé de la vision du FRQS, le Conseil de recherches en sciences naturelles et en génie (CRSNG) ainsi que mes directeurs de recherche pour le soutien financier, qui a été essentiel pour la réalisation de ma maitrise et qui m’a permis de participer à des congrès d’envergure internationale et ce, à plusieurs reprises.

Enfin, je remercie, du fond du cœur, ma famille et mes amis qui m’ont encouragée tout au long de mes études universitaires. Merci à mes parents et à mes grands-parents, qui démontrent toujours de l’intérêt pour mon projet de recherche et qui croient en mes capacités. Merci également à mon amoureux Pierre-Jean et mes amis, plus particulièrement Véronique et Ariane, qui ont vécu de près mes hauts et mes bas et qui ont su me garder motivée. Vos encouragements et votre présence me sont précieux !

XIV

Avant-propos

Les travaux de recherche réalisés dans le cadre de ma maitrise sont présentés dans ce mémoire et font l’objet d’un article scientifique (chapitre II), qui constitue mon premier article en temps que première auteure. Cet article, qui a pour titre ‘The tissue-engineered human cornea as a model to study expression of matrix metalloproteinases during corneal wound healing’, a été publié en février 2016 dans le journal ‘Biomaterials’ (Biomaterials, 2016; 78 :86-101) par Camille Couture, Karine Zaniolo, Patrick Carrier, Jennifer Lake, Julien Patenaude, Lucie Germain et Sylvain L. Guérin. Ma contribution à cet article est majeure puisque j’ai effectué la plupart des manipulations ayant mené aux résultats qui y sont présentés. J’ai réalisé, plus précisément, toutes les étapes de la culture cellulaire menant à la reconstruction des cornées humaines par auto-assemblage. J’ai également réalisé les immunobuvardages de type Western et j’ai mis au point la technique de zymographie sur gel, ce qui m’a permis d’établir un protocole amélioré en vue d’analyser l’activité enzymatique des métalloprotéinases matricielles. Ainsi, j’ai produit la majorité des échantillons qui ont été utilisés pour effectuer les techniques de profilage génique, de qPCR et de spectrométrie de masse. Ces techniques ont été réalisées par Karine Zaniolo et par la plateforme de protéomique du CHU de Québec dans le cas de la spectrométrie de masse. Karine a également effectué le montage des figures présentées dans l’article. Certains échantillons provenant d’expériences d’anciens étudiants ont été utilisés pour réaliser les travaux présentés dans l’article. Des échantillons provenant de la culture de cellules en monocouche sur matrice simple effectuée par Jennifer Lake ont été utilisés pour une partie des analyses en profilage génique et en qPCR. De plus, des échantillons provenant de la guérison des plaies de la cornée reconstruite produits par Julien Patenaude ont permis d’obtenir des résultats préliminaires qui ont été utiles pour la réalisation de ce projet. Ce projet de recherche est une idée que Lucie Germain, Sylvain Guérin, Patrick Carrier et moi-même avons obtenue lors de mes stages au baccalauréat en sciences biomédicales. Il s’agit de la poursuite des travaux de doctorat de Patrick Carrier, qui concernent l’étude de la guérison des plaies cornéennes grâce au modèle de la cornée reconstruite par génie tissulaire.

1

Chapitre I : Revue de la littérature

1. Introduction La cornée, de par sa localisation à la surface antérieure du globe oculaire, est en contact direct avec l’environnement extérieur. Par conséquence, cette localisation la prédispose à plusieurs blessures, traumatismes et stress pouvant affecter la vision. Selon l’Organisation Mondial de la Santé (OMS), les cécités cornéennes sont la quatrième cause de perte de la vision après la cataracte, le glaucome et la dégénérescence maculaire liée à l’âge (OMS, 2012). En plus des traumatismes physiques, plusieurs maladies inflammatoires et infectieuses affectant la cornée sont à l’origine de cicatrices, notamment via l’établissement d’une néovascularisation cornéenne et le développement d’ulcères. Les plus récentes données de l’OMS indiquent que 45 millions d’individus souffrent de perte de la vision touchant la cornée. Sur la totalité des cas, environ 20 millions sont dus à la cataracte, tandis que le trachome vient en deuxième place, avec 4,9 millions de cas (OMS, 2012). Le trachome est provoqué par Chlamydia trachomatis, un agent infectieux qui entraine la vascularisation cornéenne et mène ultimement à l’opacification de la cornée (John P. Whitcher, M. Srinivasan, & Madan P. Upadhyay, 2001). Malheureusement, le trachome est beaucoup plus répandu dans les pays à faible revenu, puisque l’accès aux soins est restreint. Par le fait même, les données statistiques de l’OMS indiquent que 90% des personnes atteintes de déficiences visuelles vivent dans les pays à faible revenu (OMS, 2012). Ensuite, les traumatismes oculaires et les ulcérations cornéennes sont estimées à 1,5 à 2 millions de nouveaux cas de cécité unilatérale chaque année, mais seraient potentiellement sous-évalués (John P. Whitcher et al., 2001). Les types de traumatismes à la cornée sont variés : coup, éraflure, brûlure chimique, sécheresse oculaire, port de lentilles cornéennes prolongé et présence d’un corps étranger irritant peuvent engendrer des ulcères et des cicatrices persistantes. Concernant l’incidence des troubles de la cornée, l’Amérique du Nord n’est pas épargné. Il est connu que 37% des troubles de la vision impliquent la cornée, et que ces troubles sont responsables de 23% des consultations en ophtalmologie (Lucie Germain, Carrier, Auger, Salesse, & Guérin, 2000). Malgré une bonne accessibilité aux soins, il reste que la cécité cornéenne est difficilement guérissable. En effet, il n’existe que très peu d’options de traitements (c’est le cas davantage pour les pays à faible revenu) et aucun traitement ne garantie un retour à la normal. La greffe de cornée est le traitement le plus utilisé pour traiter les cécités cornéennes sévères.

2

Cependant, cette pratique comprend des risques et n’est disponible que pour les pays plus fortunés. Par ailleurs, la popularité croissante des chirurgies telles que la photokératectomie réfractive (PKR) et le laser in situ keratomileusis (LASIK) pour corriger certaines dioptries rendent les cornées des donneurs inutilisables, ce qui augmente la rareté des cornées disponibles pour la greffe (Garg, Krishna, Stratis, & Gopinathan, 2005). Malgré tous les efforts et les progrès de la médecine en vue de guérir les troubles de la vision touchant la cornée, il reste néanmoins le besoin d’ordre mondial d’augmenter l’efficacité et la disponibilité des traitements. Une meilleure compréhension des mécanismes cellulaires et moléculaires impliqués dans les troubles de la cornée, notamment aux niveaux des processus de cicatrisation, permettrait éventuellement de développer des traitements plus efficaces qui répondent aux besoins d’un plus grand nombre d’individus.

1.1. Le globe oculaire humain L’œil est l’organe sensoriel responsable de la vision. Le globe oculaire adulte possède un diamètre antéropostérieur situé entre 22 et 27 mm et une circonférence de 69 à 85 mm (Grant-Kels & Kels, 1992). L’œil est composé de trois couches principales, soit la tunique fibreuse (externe), la tunique vasculaire (moyenne) et la tunique nerveuse (interne), chaque tunique étant composée de sous structures (Figure 1.1) (Martins et al., 2011). La tunique fibreuse comprend la cornée et la sclère, incluant leur zone de connexion, le limbe. La cornée est le tissu transparent le plus superficiel de l’œil et recouvre l’iris. À elle seule, la cornée procure 75% de la réfraction de la lumière à la rétine (Beems & Van Best, 1990). Elle est elle-même composée de trois types tissulaires, soit un épithélium, un stroma et un endothélium (Figure 1.2; la cornée est décrite davantage dans la section 1.2. de l’introduction). La sclère est la couche de tissu conjonctif dense entourant tout le globe (sauf la cornée). La rigidité de la sclère provient de sa composition élevée en différents types de collagènes, ce qui amène le globe oculaire à maintenir une forme sphérique. La tunique vasculaire, ou uvée, est constituée de l’iris, du corps ciliaire et de la choroïde. La choroïde, tissu fortement vascularisé, tapisse la face interne de la sclère au niveau postérieur du globe oculaire. Sa fonction principale est de fournir un apport sanguin à la rétine. Par ailleurs, la présence élevée de mélanocytes dans la choroïde permet d’absorber les rayons lumineux diffus, ce qui assure une bonne définition de l’image projetée sur la rétine. Au niveau antérieur de la tunique vasculaire, la choroïde forme le corps ciliaire.

3

Le corps ciliaire comprend le muscle ciliaire, capable d’induire la contraction ou le relâchement du cristallin et le procès ciliaire, responsable de la sécrétion de l’humeur aqueuse. Quant à l’iris, celui-ci est situé sous la cornée et confère à l’œil sa couleur. C’est en fait la quantité de mélanine présente dans l’iris qui détermine la couleur de l’œil. Outre cet aspect, l’iris a comme principale fonction de moduler la quantité de lumière qui pénètre dans l’œil via la pupille. Le diamètre de la pupille est sous le contrôle précis des muscles sphincter et dilatateur de la pupille, qui s’activent selon des réflexes autonomes en fonction de l’intensité lumineuse. Enfin, la tunique nerveuse comprend essentiellement la rétine et ses 10 couches cellulaires. La rétine tapisse les trois quarts du globe oculaire au niveau postérieur et est responsable de transformer la lumière en signaux nerveux. Elle est composée d’une partie pigmentaire, soit l’épithélium pigmentaire rétinien, et d’une partie nerveuse, soit les neurones de la rétine. Ces neurones sont les photorécepteurs, les neurones bipolaires et les cellules ganglionnaires. À partir des photorécepteurs, l’information nerveuse traverse la couche plexiforme externe, la couche de neurones bipolaires et la couche plexiforme interne, puis atteint les cellules ganglionnaires. Les axones de ces neurones se rejoignent à l’arrière du globe oculaire pour former le nerf optique, qui achemine alors l’information nerveuse au cerveau.

Outre les trois principales tuniques, le globe oculaire est formé de trois cavités, soit la chambre antérieure, la chambre postérieure et la chambre vitrée (Figure 1.1). La chambre antérieure est entourée par la partie postérieure de la cornée et la partie antérieure de l’iris. La chambre postérieure, quant à elle, est située à l’arrière de l’iris et à l’avant du cristallin. Ces deux chambres sont remplies d’humeur aqueuse, liquide qui nourrit à la fois le cristallin et la cornée. La pression intraoculaire est principalement due à l’humeur aqueuse et se tient à environ 16 mmHg (Borrone, 2012; Tortora & Derrickson, 2007). Une pression intraoculaire stable est essentielle pour maintenir la forme du globe oculaire. La troisième cavité, soit la chambre vitrée, compose la majeure partie du globe oculaire au niveau postérieur. Elle est remplie de corps vitré, un liquide gélatineux qui retient la rétine contre la choroïde. Enfin, le cristallin est une structure faisant partie intégrante de la cavité oculaire. Avasculaire et parfaitement transparent de par l’arrangement des fibres zonulaires qui le composent, le cristallin contribue à la focalisation des images sur la rétine (Tortora & Derrickson, 2007). Le cristallin assure ainsi 30% de la transmission lumineuse à la rétine, ce qui complète la transmission assurée par la cornée (C. Gupta, 2014). Dans ce mémoire, une attention particulière sera accordée à l’anatomie et la physiologie de la cornée.

4

Figure 1.1. Représentation schématique des différentes parties du globe oculaire humain. (Adaptée de Martins et al., 2011)

1.2. La cornée La cornée humaine est un tissu transparent situé sur la partie antérieure de l’œil. De par sa localisation, la cornée agit à titre de barrière physique contre l’environnement externe et, avec le film lacrymal, aide à prévenir les infections. La cornée est avasculaire et très fortement innervée. Elle reçoit son apport nutritif en glucose et oxygène principalement du film lacrymal, de l’humeur aqueuse et du limbe en sa périphérie (Koh et al., 2012). La cornée est également un des tissus les plus sensibles du corps humain, puisqu’elle possède de 300 à 600 fois plus de terminaisons nerveuses

Paupière

Sclère

Caroncule lacrymale

Canal lacrymale

IrisPupille

Cornée

Chambre antérieure

Chambre postérieureLigaments suspenseurs

Corps ciliaire

Muscle droit latéral

Sclère

ChoroïdeRétine

MaculaFovéa

Nerf optique

Muscle droit médial

Chambre vitrée(contenant le

corps vitré)

Tache aveugle

Cristallin

Limbe

5

que la peau (Muller, Marfurt, Kruse, & Tervo, 2003). Chez l’adulte, la cornée mesure environ 12 mm de diamètre et possède une épaisseur de 0,5 mm au centre, qui augmente graduellement vers la périphérie pour atteindre 0,7 mm. Cette morphologie caractéristique à la cornée, en plus de sa transparence, est optimale afin de favoriser la pénétrance de la lumière dans l’œil (DelMonte & Kim, 2011). La cornée est composée de trois couches cellulaires distinctes, soit un épithélium, un stroma et un endothélium, séparées les unes des autres par des membranes spécialisées, soit la membrane de Bowman et la membrane de Descemet (Figure 1.2). En somme, la clarté de la cornée relève de plusieurs arrangements aux niveaux tissulaire, cellulaire et moléculaire, qui seront discutés dans les prochaines sections.

Figure 1.2. Histologie d’une cornée humaine colorée au trichrome de Masson. A) La cornée se compose de 3 couches tissulaires distinctes et de deux membranes spécialisées, soit : 1) l’épithélium, 2) la membrane de Bowman, 3) le stroma, 4) la membrane de Descemet et 5) l’endothélium. B) Agrandissement de l’épithélium cornéen, où l’on peut distinguer les trois principaux types cellulaires qui le compose, soit les 6) cellules superficielles, 7) les cellules ailées et 8) les cellules basales. (© Couture, 2016)

1.2.1. L’épithélium cornéen

L’épithélium cornéen est la couche tissulaire la plus superficielle de la cornée et repose sur la membrane de Bowman. Il est doté de 5 à 7 couches de cellules pavimenteuses stratifiées non-

A B12

54

3

876

2

6

kératinisées. En tout, il représente 10% de l’épaisseur cornéenne avec une épaisseur allant de 40 µm à 50 µm (Farjo, McDermott, & Soong, 2008).

L’épithélium cornéen est constitué de trois principales couches cellulaires : superficielle, intermédiaire et basale (Figure 1.2 B). Les cellules superficielles de l’épithélium cornéen sont de forme polygonale pavimenteuse et forment de 2 à 3 couches de l’épithélium. Sur leur surface apicale, ces cellules sont dotées de microvillosités, qui sont de fins prolongements cellulaires permettant d’établir des contacts avec le film lacrymal (Nichols, Dawson, & Togni, 1983). Le film lacrymal peut être divisé en deux couches, soit la couche lipidique, en contact avec l’air, et la couche mucinique, en contact avec l’épithélium. Cette dernière, sécrétée par les cellules à gobelet situées dans la conjonctive, est intimement associée au glycocalyx des cellules superficielles de l’épithélium cornéen (Davidson & Kuonen, 2004). Cette fine membrane filamenteuse facilite le rapprochement entre le film lacrymal et les cellules épithéliales, car elle s’insère entre les microvillosités des cellules superficielles. Le contact entre les cellules superficielles et le film lacrymal via le glycocalyx établit une certaine régularité à travers l’épithélium, ce qui est critique afin d’obtenir un système optique clair et optimal (Gipson, Yankauckas, Spurr-Michaud, Tisdale, & Rinehart, 1992). De plus, les cellules superficielles de l’épithélium cornéen sont liées les unes aux autres via des jonctions serrées afin d’empêcher le liquide du film lacrymal et différents micro-organismes de pénétrer à travers l’épithélium (DelMonte & Kim, 2011). Sous les cellules superficielles se retrouve la couche intermédiaire composée des cellules ailées. Celle-ci représente de 2 à 3 couches de l’épithélium cornéen. Les cellules ailées sont moins différenciées que les cellules superficielles, mais possèdent des jonctions intercellulaires similaires à ces dernières. Elles assurent ainsi la transition entre la couche superficielle et la couche basale de l’épithélium cornéen (Beuerman & Pedroza, 1996). Enfin, la couche de cellules la plus profonde est composée d’une monocouche de cellules cuboïdales haute de 20 µm (Wiley, Sundarraj, & Thofr, 2016). Ces cellules basales sont la source des cellules subjacentes de l’épithélium. Fortement polarisées, elles possèdent à leurs surfaces latérales des jonctions d’ancrage zonulaires et de type ‘gap’, tandis qu’à leur base, elles forment des contacts avec la membrane basilaire via des hémidesmosomes (Chi & Trinkaus-Randall, 2013). La membrane basilaire constitue l’assise des cellules basales de l’épithélium cornéen. Sécrétée à la fois par ces dernières et par les kératocytes du stroma, elle consiste en un feuillet enrichi de collagènes de type IV (CIV), VII (CVII), XII (CXII), XVII (CXVII), XVIII (CXVIII), de laminines (LM) de type-1 (LM-111), -5 (LM-332), -6 (LM-311), -8 (LM-411), -10 (LM-511), d’entactine (nidogène), d’héparane sulfate

7

protéoglycane (le perlécane) et d’une petite quantité de fibronectine (FN) et de fibrine (Filenius et al., 2001; Kabosova et al., 2007). Son principal rôle est d’être un support pour l’adhésion des cellules épithéliales, mais elle favorise également la survie, la prolifération et la différenciation cellulaire (Gaudreault, Vigneault, Leclerc, & Guerin, 2007; Suzuki et al., 2003).

Afin d’assurer une entrée optimale de la lumière dans la cornée, l’intégrité de l’épithélium doit être maintenu au fil du temps. C’est pourquoi les cellules épithéliales se renouvèlent en totalité à tous les 7 à 10 jours. En effet, les cellules superficielles entrent en processus de desquamation lorsqu’elles atteignent la surface de l’épithélium. Elles se détachent alors de l’épithélium et sont rapidement remplacées par des cellules ailées de la couche intermédiaire (Yoon, Ismail, & Sherwin, 2014). Ainsi, l’épaisseur du centre de l’épithélium cornéen demeure constante puisque chaque perte cellulaire est compensée par l’addition de nouvelles cellules. Cette homéostasie de l’épithélium cornéen a conduit à l’élaboration de l’hypothèse XYZ proposée en 1983 par Thoft et collègues (Thoft et al., 1983), laquelle constitue maintenant une théorie. Selon celle-ci, le limbe, région épithéliale située entre la cornée transparente et la conjonctive opaque, est le réservoir de cellules souches épithéliales. Plus précisément, ces dernières se retrouvent dans les palissades de Vogt, au niveau de la couche basale (Figure 1.3 A). Cet endroit constitue un environnement protecteur en raison de l’épaisseur de l’épithélium au niveau du limbe, qui est plus élevée que le reste de l’épithélium cornéen, et de la présence de cellules Langerhans et de mélanocytes (Dziasko, Tuft, & Daniels, 2015; Yoon et al., 2014). Par ailleurs, le stroma sous-jacent au limbe renferme une importante quantité de vaisseaux sanguins et de nerfs, ce qui aide à maintenir l’homéostasie de la population de cellules souches dans le limbe (Castro-Muñozledo, 2013). Lors de leur division cellulaire, les cellules souches limbiques le font de manière asymétrique : elles donnent naissance à la fois à une cellule souche indifférenciée qui restera dans la niche afin de maintenir la population de cellules souches, ainsi qu’à une cellule qui se différenciera en cellule amplificatrice transitoire. Les cellules amplificatrices transitoires migrent le long de la membrane basilaire, de la périphérie de la cornée vers le centre de la cornée, et ce dans un mouvement centripète (Yoon et al., 2014). À leur arrivée au sein de l’épithélium cornéen, elles constituent alors les cellules basales de l’épithélium cornéen. C’est à ce moment qu’elles entreprennent une division asymétrique verticale afin de renouveler l’épithélium cornéen. Également, certaines d’entre elles se divisent de manière symétrique horizontale afin de proliférer le long de la membrane basilaire (Figure 1.3. B).

8

Figure 1.3. Localisation du limbe et différenciation des cellules souches cornéennes. A) Histologie du limbe colorée au trichrome de Masson. Le limbe est situé entre la cornée et la conjonctive. Les palissades de Vogt, pointées par les flèches, renferment les cellules souches limbiques qui donneront naissance à toutes les cellules de la cornée. (© Couture, 2016) B) Les cellules souches cornéennes localisées au limbe migrent dans un mouvement centripète vers le centre de la cornée en se divisant de manière symétrique horizontale. Également, les cellules souches cornéennes se divisent de manière asymétrique verticale afin de renouveler l’épithélium cornéen. (Adaptée de Castro-Muñozledo et al., 2013).

1.2.2. La membrane de Bowman et le stroma cornéen

La membrane de Bowman est une fine couche de composantes acellulaires située à l’extrémité la plus antérieure du stroma. Son épaisseur, allant de 8 à 19 µm, lui confère une certaine rigidité, ce qui aide au maintien de la structure de la cornée et à la prévention des infections (Schmoll et al., 2012). Cependant, l’épaisseur de la membrane de Bowman tend à diminuer avec l’âge, ce qui représente

ConjonctiveLimbeCornée

Division symétrique horizontale

Cornée Limbe Conjonctive

A

B

Division asymétrique verticale

9

un risque potentiel d’infections plus élevé chez les personnes âgées (Germundsson, Karanis, Fagerholm, & Lagali, 2013). Contrairement au stroma cornéen, la membrane de Bowman est peu structurée : elle est composée de fines couches de fibrilles de collagènes de petits diamètres (20 à 25 nm) allant dans toutes les directions (Komai & Ushiki, 1991). Les principaux types de collagènes lui conférant sa structure sont les types I (en majorité), III, V, VI et XII (George E. Marshall, Anastasios G. Konstas, & William R. Lee, 1991).

Le stroma cornéen constitue la majeure partie de la cornée, soit environ 80% de l’épaisseur cornéenne totale. L’une de ses caractéristiques principales qui le distingue des autres tissus conjonctifs du corps humains est sa transparence, qui est due à l’arrangement précis des fibres de collagènes et des protéines de la matrice extracellulaire (MEC) qui la composent (DelMonte & Kim, 2011). Bien que le stroma soit constitué principalement de composantes acellulaires, il y réside également des kératocytes, cellules quiescentes peu nombreuses (47100 cellules / mm3) possédant un cycle cellulaire très lent (Karimi, Wong, & Bizheva, 2011). Toutefois, à la suite d’une lésion, ces dernières se métamorphosent en fibroblastes actifs impliqués dans l’homéostasie de la MEC. Ces derniers synthétisent les molécules de collagènes, de glycosaminoglycanes et également de certaines protéases, dont les métalloprotéinases matricielles (MMPs). Ces enzymes exercent un rôle crucial dans le remodelage de la MEC afin de veiller au maintien de la structure du stroma et à sa transparence (Tallant, Marrero, & Gomis-Ruth, 2010). Lors d’une lésion, les fibroblastes du stroma peuvent se différencier en myofibroblastes et vont alors favoriser la guérison en sécrétant différents facteurs de croissance (Dwivedi et al., 2006). Les principaux types de collagènes du stroma cornéen sont les types I et V, formant des complexes hétérodimériques appelés fibrilles. La régulation de la structure et de l’hydratation des fibrilles est assurée par des protéoglycanes (décorine, lumican) associés à des glycosaminoglycanes (chondroïtine sulfate et héparane sulfate) (M. Elizabeth Fini & Stramer, 2005). Les fibrilles de collagènes, parallèles et équidistantes les unes par rapport aux autres, sont organisées en lamelles superposées et parallèles à la cornée. Le stroma de l’œil humain est composé de 200 à 250 lamelles, chacune formant un angle variable avec la lamelle adjacente (Maurice, 1970). Cependant, 58% des lamelles du stroma cornéen sont orientées avec un angle situé entre 31° et 60° par rapport à la suivante. Au niveau de la cornée centrale, le stroma est moins dense afin de permettre à la lumière de mieux pénétrer à l’intérieur de celle-ci et de se rendre à la rétine (Meek & Fullwood, 2001b).

10

1.2.3. La membrane de Descemet et l’endothélium cornéen

La membrane de Descemet constitue l’assise basale des cellules de l’endothélium cornéen. Chez l’enfant, la membrane de Descemet possède une épaisseur approximative de 3 µm et augmente jusqu’à 10 µm chez l’adulte. Elle est composée de deux couches : une première formée de lamelles de collagènes de type IV et VIII et de protéoglycanes et une deuxième, d’apparence fibreuse et sécrétée par les cellules endothéliales. La présence de collagène de type VIII est caractéristique de la membrane de Descemet et son assemblage ressemble à une échelle lorsqu’observée en microscopie électronique (Eghrari, Riazuddin, & Gottsch, 2015).

L’endothélium cornéen est composé d’une monocouche de cellules aplaties de forme hexagonale, recouvrant l’entièreté de la surface postérieure de la cornée et en contact directe avec l’humeur aqueuse. Contrairement à la plupart des cellules du corps humain, les cellules endothéliales ne prolifèrent pas ou que très peu (Joyce, 2003). Ainsi, la densité cellulaire de l’endothélium, soit de 5000 cellules/mm2 à la naissance, diminue de moitié pour atteindre 2500 cellules/mm2 à l’âge adulte (Abib & Barreto, 2001). Cependant, elles demeurent capables d’exercer leur rôle de déturgescence du stroma même à cette densité. En effet, la principale fonction des cellules endothéliales est de contrôler l’hydratation du stroma, notamment via des pompe Na+/K+ ATPase qui expulsent les ions Na+ et bicarbonates dans l’humeur aqueuse. Cette sortie d’ions établit alors un gradient osmotique qui assure la sortie de l’eau et des déchets métaboliques du stroma, processus essentiel au maintien de la transparence cornéenne (Bonanno, 2012; Eghrari et al., 2015). L’entrée d’eau dans le stroma cornéen s’effectue plus facilement, car les cellules endothéliales possèdent des jonctions communicantes de type ‘gap’ latérales et des jonctions serrées discontinues au niveau apical, qui laissent entrer l’eau dans le stroma (Fischbarg & Diecke, 2005).

1.3. La cornée reconstruite par génie tissulaire Cette section vise à décrire les principaux aspects liés à la cornée humaine reconstruite par génie tissulaire, qui constitue le modèle utilisé afin de mener à terme l’étude présentée dans ce mémoire.

11

1.3.1. Le génie tissulaire

1.3.1.1. Définition et intérêts du génie tissulaire Le génie tissulaire est un domaine relevant de la recherche biomédicale visant à reconstruire des organes in vitro. L’approche du génie tissulaire consiste à appliquer les principes de la biologie cellulaire et du génie biologique dans le but de reconstruire des structures semblables aux tissus natifs à partir de cellules vivantes. Comme les applications du génie tissulaire sont à la fois cliniques et fondamentales, ce domaine suscite beaucoup d’intérêt. En effet, le but ultime du génie tissulaire est la reconstruction de tissus ou d’organes qui permettent de pallier au déficit d’organes à transplanter. De même, les tissus reconstruits font d’excellents modèles d’études en recherche fondamentale puisqu’ils possèdent les caractéristiques des tissus humains natifs, notamment au niveau de leur morphologie et de leur aspect histologique.

L’épiderme humain a été le premier tissu reconstruit en laboratoire pour fins de greffes (Gallico, 1984). Cette première reconstruction a été développée afin d’améliorer le traitement des patients gravement brulés, notamment par la greffe de larges feuillets d’épiderme autologue minimisant le rejet et accélérant la guérison (Goulet et al., 1996). Malgré le fait qu’il était déjà possible à l’époque de conserver en culture des cellules épidermiques, c’est l’amélioration des conditions de culture qui a permis l’obtention de feuillets manipulables. Par exemple, le raffinement des techniques telles que l’isolation des cellules chez le patient, l’optimisation des conditions de culture et le contrôle de la croissance des fibroblastes ont menés à l’élaboration de protocoles détaillés décrivant les principes fondateurs du génie tissulaire (Lucie Germain et al., 2000). Aujourd’hui, de tels progrès rendent possible la reconstruction de tissus plus complexes comme la peau (épiderme et derme) (Auger, Berthod, Moulin, Pouliot, & Germain, 2004), les vaisseaux sanguins (Laflamme et al., 2005), les valves cardiaques (Dubé et al., 2014), le tissu adipeux (Vermette et al., 2007) et la cornée (L. Germain et al., 1999b).

1.3.1.2. Les différentes approches pour la reconstruction de la cornée in vitro L’élaboration de protocoles permettant la culture de cellules à long terme lors de la mise au point de la reconstruction de l’épiderme humain a permis le développement de plusieurs approches afin de reconstruire d’autres tissus, comme la cornée. Au fil du temps, certaines améliorations ont été

12

apportées afin d’optimiser les propriétés de la cornée reconstruite. L’ajout de différentes matrices ou de cellules provenant d’origines diverses ont, dans un premier temps, été testées. Les premières cornées reconstruites étaient constituées de gels de collagènes et de cellules d’origine animale. Dans les années 1990, plusieurs équipes ont développé des équivalents cornéens avec des cellules de porc (A. I. Schneider, K. Maier-Reif, & T. Graeve, 1999), de lapin (Zieske et al., 1994a) et de bœuf (Parnigotto, Bassani, Montesi, & Conconi, 1998). Par exemple, l’équipe de Minami a combiné l’utilisation du gel de collagène avec des cellules porcines afin de reconstruire une cornée complète comprenant un épithélium, un stroma et un endothélium (Sugihara, Toda, Miyabara, Kusaba, & Minami, 1991). En plus d’aider au maintien de la structure du tissu reconstruit, le gel de collagène permet l’établissement d’une membrane basilaire semblable à celle de la cornée native et facilite également la prolifération et la différenciation des cellules épithéliales. Les modèles de cornées reconstruites avec matériaux et cellules d’origines diverses ont été utiles pour l’optimisation des conditions de culture du tissu et également à l’étude des interactions cellules-matrice (a I. Schneider, K. Maier-Reif, & T. Graeve, 1999). Cependant, malgré le fait que les cellules animales soient plus accessibles pour la recherche que les cellules humaines, il reste que les cornées reconstruites avec des cellules animales ne peuvent être greffées chez l’être humain en raison du rejet inévitable. C’est pourquoi la recherche s’est orientée vers la reconstruction d’équivalents cornéens dont les cellules proviennent de la cornée humaine. Néanmoins, les cellules humaines utilisées pour la reconstruction devaient être, à l’époque, transformées (immortalisées) afin d’augmenter leur potentiel en culture (Griffith, 1999). Encore une fois, ces cornées ne pouvaient être greffées en raison de la présence du virus nécessaire à l’immortalisation (Griffith, 2002). En 1999, l’équipe du Dre Germain a élaboré un protocole permettant pour la première fois de reconstruire des cornées avec des cellules humaines non-immortalisées (L. Germain et al., 1999b). Dans ce modèle, les fibroblastes sont inclus dans un gel de collagène, mimant ainsi l’aspect du stroma cornéen natif. En effet, des analyses histologiques ont démontré que l’expression des intégrines et des composantes de la membrane de Bowman est similaire à celles de la cornée native. Cependant, la présence du matériel exogène qu’est le gel de collagène, en plus de sa nature bovine, est un frein à la greffe en raison de son potentiel infectieux. Le défi de développer une cornée reconstruite pouvant être greffée chez le patient a été relevé par la même équipe lors de la publication du modèle d’auto-assemblage en 1999 (Michel et al., 1999a).

13

1.3.2. La cornée reconstruite par auto-assemblage

1.3.2.1. La méthode d’auto-assemblage La méthode d’auto-assemblage a été élaborée comme alternative à l’utilisation de matériaux exogènes et de cellules animales ou immortalisées, afin de reconstruire des tissus humains compatibles avec la greffe. Cette approche, développée au Laboratoire d’Organogénèse Expérimentale (LOEX) (Michel et al., 1999a), mise sur la propriété qu’ont les cellules humaines de reconstruire leur tissu d’origine lorsqu’elles sont soumises à des conditions de culture adéquates. Le principe clef de la méthode d’auto-assemblage est que les fibroblastes, lorsque cultivés en présence d’acide ascorbique, sécrètent alors leur propre MEC menant à l’élaboration d’un tissu organisé et cohérant, comme le stroma cornéen. En effet, il a été démontré que l’acide ascorbique, ou vitamine C, augmente la synthèse de l’ARNm du procollagène chez les fibroblastes humains et murins (Geesin, Darr, Kaufman, Murad, & Pinnell, 1988). L’acide ascorbique induit également des modifications post-traductionnelles sur le collagène, telles que l’hydroxylation des résidus proline et lysine, ce qui augmente la stabilité des hélices de collagène et ainsi la sécrétion du collagène par les cellules en culture (Chan, Lamande, Cole, & Bateman, 1990; Geesin et al., 1988; Hata & Senoo, 1989; Michel et al., 1999a). D’abord utilisée pour la reconstruction d’équivalent de peau (Michel et al., 1999a), la méthode d’auto-assemblage a ensuite été utilisée pour la reconstruction d’autres tissus, comme la cornée. En raison de la similarité structurale entre la peau et la cornée, ces tissus sont reconstruits par auto-assemblage selon un protocole similaire (D. Larouche et al., 2009) (Figure 1.4). Après 35 jours de culture pour les fibroblastes cornéens (ou 28 jours de culture pour les fibroblastes dermique),, les feuillets reconstruits sont méticuleusement décollés du flacon et superposés deux par deux pour reconstruire un stroma cornéen mixte, formé d’un feuillet cornéen et d’un feuillet dermique. Le stroma cornéen reconstruit est ensuite immergé une semaine dans le milieu de culture afin de faciliter l’adhésion des deux feuillets l’un à l’autre. Par la suite, des cellules épithéliales de cornée sont ensemencées sur le dessus du stroma cornéen reconstruit et l’équivalent cornéen demeure immergé dans le milieu de culture une semaine pour permettre aux cellules épithéliales de proliférer et de coloniser toute la surface du stroma. Ensuite, la cornée reconstruite est incubée une semaine à l’interface air-liquide, un environnement mimant celui de la cornée native, où l’épiderme est alors en contact avec l’air tandis que le stroma est en contact uniquement avec le milieu de culture.

14

L’interface air-liquide stimule alors la différenciation verticale des cellules épithéliales (Pruniéras, 1983), ce qui mène à la formation d’un épithélium formé de 5 à 7 couches de cellules. On obtient alors, après 8 semaines de culture, un équivalent cornéen composé uniquement de cellules humaines et de MEC sécrétées par celles-ci, histologiquement similaire à la cornée native.

1.4. Reconstruction d’une cornée humaine selon la méthode d’auto-assemblage. Schéma représentant les étapes requises afin de reconstruire une cornée humaine selon la méthode d’auto-assemblage mise au point au LOEX. (Adaptée de Couture et al., 2016)

Fibroblastes cultivés avec acide ascorbique pendant 35 jours

Superposition de 2 feuillets reconstruits

7 jours de maturationEnsemencement de cellules épithéliales

cornéennes

Stroma reconstruitStroma épithélialisé

Maturation de la cornée à l’interface air-liquide

7 Jours de maturation

Cornée humaine reconstruite par auto-assemblage

15

1.3.2.2. Les caractéristiques structurales de la cornée reconstruite par auto-assemblage

1.3.2.2.1.  L’épithélium  cornéen  reconstruit  et  la  membrane  de  Bowman   L’épithélium de la cornée reconstruite par auto-assemblage partage plusieurs caractéristiques histologiques avec celui de la cornée native. En effet, celui-ci est constitué de 5 à 7 couches de cellules épithéliales uniformément réparties sur le stroma. La couche superficielle de l’épithélium reconstruit est constituée de cellules aplaties non kératinisées, phénotype similaire à celui de la cornée native. Le phénotype des cellules basales est également typique, car celles-ci sont de forme cuboïdale avec un noyau arrondi (Patrick Carrier et al., 2008). Cette différenciation normale lors de la reconstruction de la cornée apparait au moment de sa maturation à l’interface air-liquide. Cette technique, d’abord élaborée avec des kératinocytes, démontre que le contact avec l’air induit la morphogénèse de l’épiderme et la formation de granules épidermiques superficiels (Antipolis, 1985). Cette différenciation est renforcée grâce à l’omission de l’EGF dans le milieu de culture lors de la culture en interface air-liquide, ce qui pousse les cellules à se différencier au lieu de proliférer (Tran, Kennedy, & Carrion, 2012). En plus d’être histologiquement semblables, des analyses en immunofluorescence ont démontré que la cornée reconstruite possède aussi des similarités avec la cornée native quant à l’expression et la localisation de certaines protéines. En ce qui a trait à la membrane de Bowman reconstruite, il a été démontré que le CVII et la LM-V sont exprimés tout le long de la membrane basilaire (Stéphanie Proulx et al., 2010). Par ailleurs, les sous-unités β4 et α6 des intégrines ont été retrouvées au niveau des hémidesmosomes formant des contacts entre les cellules basales et la membrane de Bowman. Quant aux sous-unités α2, α3 et β1, celles-ci ont été localisées en périphérie des cellules basales de l’épithélium reconstruit, et même parfois dans les couches plus superficielles (Patrick Carrier et al., 2008). Ainsi, on retrouve les sous-unités des intégrines aux mêmes endroits dans la cornée reconstruite et dans la cornée native. En ce qui a trait aux K3 et K12, marqueurs des cellules épithéliales cornéennes, celles-ci ont été détectées dans toutes les couches de l’épithélium reconstruit et de l’épithélium natif. Ainsi, ces évidences démontrent que l’épithélium cornéen reconstruit est histologiquement semblable à l’épithélium natif (Stéphanie Proulx et al., 2010).

16

1.3.2.2.2.  Le  stroma  cornéen  reconstruit   Le stroma cornéen reconstruit par auto-assemblage est formé par la superposition de deux feuillets, le premier composé de fibroblastes dermiques et le second de fibroblastes cornéens. Ce stroma mixte, en plus d’augmenter la résistance mécanique de la cornée reconstruite, permet la formation d’un épithélium différencié d’avantage similaire à la cornée native comparativement à un stroma formé uniquement par les fibroblastes cornéens (Patrick Carrier et al., 2008). Malgré la présence du feuillet dermique, le stroma cornéen est tout à fait transparent et laisse donc passer la lumière, caractéristique essentielle à la vision. La transparence de la cornée reconstruite est aussi conservée après l’ajout de cellules épithéliales (Figure 1.5). En effet, il a été démontré que la cornée reconstruite possède un maximum d’absorption des rayons UV à 265 nm (Patrick Carrier et al., 2009), ce qui est comparable au maximum d’absorption des rayons UV de la cornée native, situé à 275 nm (Kolozsva, No, & Bor, 2002). La transparence de la cornée reconstruite démontre également que le stroma reconstruit est capable d’organiser ses fibrilles de collagènes en lamelles parallèles, telles que retrouvées dans le stroma cornéen natif. Par ailleurs, des analyses menées en immunofluorescence ont démontré que les stromas cornéens reconstruits et natifs sont tous les deux composés majoritairement de collagène de type I (Stéphanie Proulx et al., 2010). Ainsi, le stroma reconstruit par auto-assemblage, en plus d’être exempt de matériel exogène, reproduit les caractéristiques histologiques de la cornée native, de même que sa transparence.

Figure 1.5. Vue macroscopique de la cornée reconstruite produite par auto-assemblage. La cornée reconstruite par auto-assemblage est constituée à la fois d’un épithélium et d’un stroma. La cornée reconstruite est le tissu transparent au centre de l’anneau de papier filtre (en rose). (© Couture, 2016)

17

1.4. Les troubles visuels liés à la cornée et les traitements

De par sa localisation antérieure à l’œil, la cornée est en contact avec l’environnement externe, ce qui la rend plus à risque de subir des blessures. Tout comme la peau, la cornée est susceptible aux blessures mécaniques, telles que les abrasions, ainsi qu’aux blessures chimiques, comme la brûlure alcaline. Cependant, la capacité de régénérescence de la cornée est d’autant plus importante que celle de la peau, car elle est essentielle au maintient de sa transparence. Ainsi, une blessure à la cornée affectant la capacité des cellules souches à maintenir la transparence de la cornée peut mener à des troubles visuels importants, voir même la cécité. De plus, différentes complications peuvent survenir lors d’une lésion cornéenne, comme l’érosion persistante, l’ulcération et les infections. Dépendamment de la gravité de la blessure, différents traitements doivent être appliqués rapidement afin d’optimiser la cicatrisation de la cornée. Pour les blessures moins sévères, l’application de médicaments sur la lésion est généralement efficace, tandis que pour les troubles plus graves, comme le syndrome de déficience en cellules souches limbiques, la greffe de cornée s’impose. Cependant, ces traitements ne sont pas sans risques. Ainsi, le traitement sera choisi selon la cause de la blessure et selon son impact sur la cornée afin d’augmenter la qualité de la guérison.

1.4.1. Les types de blessures à la cornée

1.4.1.1. Les blessures de type mécanique Les blessures cornéennes engendrées par les coups, le frottement, la présence de corps étranger et le port prolongé de lentilles cornéennes sont fréquentes. Aux États-Unis, il est estimé que 8% des consultations à l’urgence médicale sont reliées à des troubles oculaires (McGwin, Xie, & Owsley, 2005). De ces consultations, 45% sont en lien avec l’abrasion cornéenne et 31% avec la présence de corps étrangers dans l’œil (McGwin & Owsley, 2005). Les causes les plus fréquentes de l’abrasion cornéenne sont le frottement de la cornée avec les ongles (Harris, 2011) ainsi que l’irritation due au port de lentilles cornéennes la nuit (S. Y. Lee, Kim, Johnson, Mondino, & Weissman, 2012). Certaines abrasions peuvent affecter l’intégrité de l’épithélium cornéen et dans certains cas, la présence d’un corps étranger peut même affecter le stroma, notamment par perforation (Casswell,

18

Anikina, & Mearza, 2014). Bien que la majorité des abrasions cornéennes guérissent en 2 à 3 jours, il n’en demeure pas moins que certaines abrasions peuvent mener à des problèmes de vision à long terme si elles ne sont pas traitées de manière appropriée. En effet, si le corps étranger n’est pas retiré rapidement par un ophtalmologiste, il peut causer des dommages répétés à la cornée et mener à des problèmes chroniques de cicatrisation. Par exemple, des débris métalliques peuvent laisser des dépôts de rouille, ce qui ralentit la guérison de la blessure (Ramakrishnan, Constantinou, Jhanji, & Vajpayee, 2012). De surcroit, si la blessure n’est pas traitée rapidement et efficacement, elle peut engendrer d’autres complications à long terme telles que des ulcères, des infections bactériennes et des irritations récurrentes. La meilleure manière de prévenir les blessures de type mécanique demeure le port de lunettes protectrices lors d’activités à risque, notamment chez les travailleurs de la construction et également lors de la pratique de certains sports (Ahmed, House, & Feldman, 2015).

1.4.1.2. Les blessures de type chimique Tout comme les abrasions cornéennes, les blessures chimiques à l’œil sont des causes communes de troubles oculaires. Lors d’une brûlure au visage, l’œil n’est généralement pas épargné; il est également touché dans 7,5% à 36% des cas (Bouchard, Morno, Perkins, McDonnell, & Dicken, 2001). Généralement, les brûlures chimiques entrainent des conséquences affectant sévèrement la vision. Selon la classification des blessures chimiques oculaires Roper-Hall, le pronostique de guérison est mauvais si plus de la moitié du limbe est affecté. À l’inverse, si le limbe n’est pas touché, le pronostique de guérison est meilleur (Gupta, Kalaivani, & Tandon, 2011). Cette classification se base sur le principe que la perte des cellules souches assurant le renouvèlement de la cornée entraine généralement l’opacification cornéenne et mène à la perte de la vision (Logothetis, Leikin, & Patrianakos, 2014). La sévérité des blessures chimiques varie également en fonction de la nature du composé chimique ayant causé la brûlure. Les blessures alcalines entrainent normalement davantage de dommages que les blessures acides en raison de leur capacité plus élevée à pénétrer dans la cornée. La nature lipophile des composés alcalins fait en sorte que ces derniers peuvent pénétrer au travers de l’épithélium, de la membrane basilaire, du stroma et de l’endothélium cornéen (Bunker, George, Kleinschmidt, Kumar, & Maitz, 2014). Parfois, ces composés peuvent même affecter des structures internes de l’œil, comme l’iris, le cristallin et le corps ciliaire. Si tel est le cas,

19

des maladies comme le glaucome et la cataracte peuvent se développer (Reim, 1989). Lors de leur contact avec l’épithélium cornéen, les cations des composés alcalins se dissocient et interagissent avec les groupements carboxyles des glycosaminoglycanes à la surface des cellules épithéliales, ce qui cause l’opacification cornéenne (Bunker, George, Kleinschmidt, Kumar, & Maitz, 2014). Ainsi, les brûlures chimiques peuvent avoir des conséquences désastreuses et mener à une perte de vision permanente. Comme la plupart des blessures chimiques surviennent à la maison ou au travail par l’utilisation de produits ménagers corrosifs, la meilleure manière de prévenir les accidents est le port de protection adéquate lors de l’utilisation de ces produits (Bunker et al., 2014).

1.4.2. Les conséquences des blessures cornéennes

1.4.2.1. Les ulcères et les infections de la cornée Le développement d’ulcères à la cornée est une complication commune d’une lésion cornéenne. Dans le monde, il est estimé que chaque année, 1,5 millions d’individus développent des ulcères cornéens (Basak, Basak, Mohanta, & Bhowmick, 2005). Aux États-Unis, environ 3 patients sur 1000 consultent un ophtalmologiste pour des ulcères à la cornée (Wilhelmus, 2002). Les ulcères cornéens sont généralement causés par des bactéries ou virus, mais peuvent être également causés par des parasites ou moisissures (Geeta K. Vemuganti & Das, 2011). Ces infections à l’œil, que l’on nomme kératites, proviennent à la base de blessures infligées à la cornée par un traumatisme, le port de lentilles cornéennes prolongées ou par une chirurgie cornéenne récente. Par ailleurs, l’usage chronique de médication ophtalmique topique ou l’immunosuppression systémique sont des facteurs de risque du développement des kératites (Cheng et al., 1999). À propos de la chirurgie, il a été récemment rapporté que des chirurgies telles que le PKR et le LASIK entraînent des complications chez 5% à 22.6% des patients, dont la kératite (Azar, Chang, & Han, 2012). En plus d’entrainer des effets secondaires tels que la rougeur, la sécrétion excessive de larme et la photophobie, les infections cornéennes diminuent l’acuité visuelle. Dans 50% des cas, le développement de kératite mène à une dégradation de la vision du patient, pouvant aller jusqu’à 20/200 (Wilhelmus, 2002).

Au niveau histologique, l’infection dégrade le tissu cornéen, résultant en un ulcère. Tout d’abord, l’infection pénètre dans l’épithélium cornéen déjà amincit et entraine sa perforation. L’infiltration du

20

stroma par les bactéries active le système immunitaire, dont les granulocytes. La sécrétion d’enzymes dégradant le collagène par les granulocytes et le relâchement de toxines par les bactéries mènent alors à la destruction de la membrane de Bowman et à la nécrose du stroma. Certains cas d’ulcères plus sévères peuvent aller jusqu’à la perforation de la membrane de Descemet. Dans les cas plus précis de kératite bactérienne, l’infection peut se rendre jusqu’au 2/3 du stroma, ce qui entraine la formation d’abcès cornéens (Wilson et al., 2001). Lorsque l’infection est chronique, le tissu cornéen développe des caractéristiques cicatricielles, comme la transformation des fibroblastes en myofibroblastes et l’accentuation du remodelage de la MEC (Geeta K. Vemuganti & Das, 2011). Ainsi, à cause de la gravité des conséquences engendrées par le développement d’ulcères sur la vision, il est nécessaire de trouver des traitements réduisant l’impact de l’infection. Heureusement, le trachome, une infection oculaire bactérienne, fait l’objet d’un programme érigé par l’OMS visant l’éradication de la maladie d’ici 2020 (OMS, 2012).

1.4.2.2. Le syndrome de déficience en cellules souches limbiques En temps normal, l’épithélium cornéen est capable de s’auto-renouveler afin de maintenir la transparence et l’intégrité fonctionnelle de la cornée. Ce processus d’auto-renouvèlement est directement associée à la fonction des cellules souches résidentes du limbe, qui, constamment, se divisent de façon asymétrique afin de remplacer les cellules épithéliales qui desquament (Yoon et al., 2014). Ainsi, lors d’une blessure, l’épithélium est en mesure de cicatriser rapidement en accélérant le processus de régénération. Cependant, lorsque le limbe est affecté par une blessure ou par une cicatrisation persistante, l’intégrité des cellules souches peut être altérée, ce qui diminue leur capacité à régénérer l’épithélium cornéen (Daniels, Dart, Tuft, & Khaw, 2001). Dans ce cas, on parle alors de syndrome de déficience en cellules souches limbiques.

En clinique, le syndrome de déficience en cellules souches limbiques se caractérise par un envahissement de la cornée par un épithélium de type conjonctival, processus appelé conjonctivalisation (Figure 1.6). La conjonctivalisation entraine plusieurs changements au niveau de l’aspect de la cornée, dont une néovascularisation aberrante, une inflammation chronique et la présence d’irrégularités et de cicatrices. Par ailleurs, la présence de cellules à gobelet dans le tissu cornéen est un bon marqueur de la conjonctivalisation (Daniels et al., 2001). Tous ces éléments

21

entrainent inévitablement la perte de la transparence de la cornée, processus appelé opacification cornéenne. Il va sans dire que l’opacification cornéenne diminue énormément l’acuité visuelle, et peut même mener à la perte totale de la vision (Dua & Azuara-Blanco, 2000). Les syndromes de déficit en cellules souches sont classés en deux catégories, selon la cause du déficit. La première catégorie comprend les brûlures oculaires chimiques, les chirurgies (cryothérapie et radiothérapie) effectuées près du limbe, le port inadéquat de lentille cornéenne, les kératites sévères ainsi que les maladies inflammatoires auto-immunes (syndrome de Stevens-Johnson et la pemphigoïde). La deuxième catégorie est plutôt associée aux maladies rares congénitales, comme l’aniridie et la kératodermie congénitale (Graziella Pellegrini, Rama, Di Rocco, Panaras, & De Luca, 2014). Dépendamment du type de blessure infligée, le déficit peut être unilatéral, bilatéral, partiel ou total. Le traitement sera choisi en conséquence du niveau d’atteinte du limbe.

Figure 1.6. La conjonctivalisation de la cornée. A) Une des caractéristiques cliniques de la conjonctivalisation est la présence de cellules de type conjonctival dans l’épithélium cornéen, telles que les cellules à gobelet (flèche). B) L’opacification cornéenne (flèche pointillée) et la néovascularisation (flèches pleines) sont également observées lors d’une conjonctivalisation cornéenne. (Tirée de Daniels et al., 2001).

22

1.4.3. Les traitements des troubles de la cornée

1.4.3.1. Les médicaments Les érosions cornéennes, les kératites et les ulcères peu sévères sont la plupart du temps traités par médication. Le choix du médicament dépend de plusieurs facteurs, comme la cause de la blessure, l’ampleur de l’atteinte du tissu cornéen, les symptômes découlant de la blessure et le degré de douleur ressentie par le patient. Des études ont démontrées l’effet bénéfique de couvrir l’œil avec un ‘patch’. En effet, garder l’œil fermé est proposé afin de réduire la douleur causée par la blessure. Cependant, cette méthode augmente le potentiel de développer une infection, ce qui présente un risque important pour le développement de kératites (Moller, 2007; Turner & Rabiu, 2006). Une alternative au ‘patch’ est le port de lentilles cornéennes thérapeutiques combiné à l’application d’antibiotiques (Weaver & Terrell, 2003). Ces lentilles, composées de collagènes d’origine porcine, sont conçues pour se dissoudre en quelques jours, permettant à la lésion de guérir. Cependant, l’inconfort occasionné par le port de ces lentilles et leur remplacement fréquent font en sorte que ce traitement est couteux et peu toléré (Groden & White, 1990). En raison de l’insuccès des lentilles thérapeutiques, ce sont les gouttes oculaires qui sont davantage prescrites en clinique. Des anti-inflammatoires non-stéroïdiens, des antibiotiques (quinolones) et parfois des analgésiques (s’il y a présence de douleur) sont administrés sous forme de goutes oculaires lors d’une blessure mineure à la cornée (Nabili et al., 2013). Ce traitement routinier, bien qu’efficace dans la majorité des cas, ne contient pas d’agent actif accélérant la guérison de la blessure. Ainsi, comme il est connu que le risque d’infections augmente lorsque la guérison est lente, il serait avantageux de combiner l’usage d’antibiotiques à un médicament accélérant la guérison des plaies cornéennes.

1.4.3.2. Les greffes

Lorsque la blessure infligée à la cornée est sévère à un point tel qu’elle entraine le développement du syndrome de déficience en cellules souches limbiques, le recours à la chirurgie est inévitable. En effet, le déficit en cellules souches limbiques ne peut être traité que par greffe, que ce soit la greffe de cornée cadavérique, l’autogreffe ou l’allogreffe de limbe, la greffe d’épithélium cornéen cultivé in

vitro ou la greffe de cellules souches limbiques sur membrane amniotique.

23

1.4.3.2.1.  La  greffe  de  cornée  cadavérique   Les premiers articles relatant des greffes de cornées provenant de donneurs ont été publiés dans les années 40 (Messier & Hoffman, 1949; Moldovan, Borderie, Baudrimont, & Laroche, 1999; Smelser & Ozanics, 1946). Bien que la technique ait évoluée depuis ce temps, le concept est demeuré le même, soit le prélèvement de la cornée pleine épaisseur (greffe transfixiante) d’un donneur décédé afin de la greffer à la surface oculaire du patient. Cependant, la greffe de cornée cadavérique présente des risques de rejet considérables étant donné l’inflammation élevée déjà présente dans l’œil malade du patient. Par ailleurs, la déficience en cellules souches limbiques ne peut être totalement guérie par la greffe de cornée puisque celle-ci restaure uniquement la cornée centrale et non le limbe (Puangsricharern & Tseng, 1995). Ainsi, la greffe de cornée cadavérique ne permet pas de retrouver la vision à long terme pour les patients atteint du syndrome de déficience en cellules souches limbiques. Aujourd’hui, la greffe de cornée cadavérique est prescrite en dernier recours lorsque le limbe est détruit de façon bilatérale. Dans le cas d’échecs multiples de greffes, une cornée artificielle ou kératoprothèse peut être greffée (Martinez et al., 2013). Néanmoins, d’autres méthodes plus raffinées ont dues être mise en œuvre afin d’arriver à augmenter l’efficacité de la greffe et à diminuer le risque de rejet.

1.4.3.2.2.  L’autogreffe  et  l’allogreffe  limbo-­‐conjonctivale   Lorsque le déficit en cellules souches limbiques est total, irréversible et n’atteint qu’un œil, il est alors possible de procéder à une autogreffe limbo-conjonctivale. Cette méthode a pour but de fournir des cellules souches épithéliales provenant de l’œil sain à l’œil malade afin que celui-ci soit en mesure de former à nouveau un limbe fonctionnel. Ne comportant aucun risque de rejet, cette méthode est devenue une procédure standard en clinique pour traiter les déficits en cellules souches limbiques unilatérales (Moldovan et al., 1999). Néanmoins, le prélèvement du greffon dans l’œil sain génère également un certain risque de provoquer un déficit dans cet œil. C’est pourquoi le chirurgien doit minimiser la surface prélevée sur le limbe sain (J. J. Chen & Tseng, 1991). En 1989, Kenyon et Tseng ont été les premiers à proposer la méthode d’autogreffe limbo-conjonctivale pour traiter les patients souffrant d’un déficit en cellules souches limbiques unilatéral. Ces derniers ont réalisé la greffe de deux biopsies provenant du limbe de l’œil sain sur les 2/3 de la circonférence de l’œil

24

malade. Après quelques temps, les cellules souches greffées ont efficacement rétabli le phénotype normal de l’épithélium cornéen et la greffe fut un véritable succès (Kenyon & Tseng, 1989). Lors d’une blessure bilatérale où le déficit est total et irréversible, seule l’allogreffe limbo-conjonctivale est réalisable. Cette procédure implique que le greffon provienne d’un donneur vivant apparenté génétiquement au patient ou d’une banque de donneurs décédés compatibles. Néanmoins, l’allogreffe implique la prise d’immunosuppresseurs afin de limiter le risque de rejet du greffon, sans compter le risque de développer une maladie infectieuse suivant la greffe (Solomon et al., 2002).

1.4.3.2.3.  La  greffe  d’épithélium  cornéen  cultivé  in  vitro   Malgré le succès relatif des techniques de greffe présentées ci-dessus, le risque de développer un déficit en cellules souches dans l’œil sain, un rejet et une maladie infectieuse demeurent malgré tout. Il est alors primordial de trouver une méthode alternative qui permet de réduire considérablement ces risques. C’est en 1993, lors des premiers succès du génie tissulaire, que l’équipe de Lindberg a mis au point une méthode de culture des cellules souches limbiques humaines permettant leur expansion in vitro (Lindberg, Brown, Chaves, Kenyon, & Rheinwald, 1993). Selon leur protocole, ces cellules sont d’abord isolées à partir d’une biopsie limbique de 1 mm2 et sont cultivées en présence de fibroblastes murins irradiés (cellules 3T3). Ces fibroblastes irradiés ne sont plus en mesure de se diviser mais forment néanmoins une couche nourricière permettant la prolifération des cellules souches limbiques. Après plusieurs passages, il en résulte un épithélium composé de 2 à 3 couches de cellules, lequel a été greffé sur le dos de souris athymiques afin de confirmer la capacité de ces cellules en culture à régénérer un épithélium cornéen pluristratifié et différencié. Cette réussite prometteuse a suscité l’intérêt de plusieurs équipes, dont celle de Pellegrini, qui a réalisé la première greffe autologue d’épithélium cornéen sur deux patients atteints du syndrome de déficit en cellules souches limbiques causé par une brûlure chimique (G. Pellegrini et al., 1997). Cette technique ne comporte pas de risque d’engendrer un déficit dans l’œil sain à cause de la taille du greffon (1 mm2) qui est minime. L’épithélium reconstruit est maintenu sur l’œil malade par une lentille thérapeutique, laquelle est retirée 2 semaines suivant la greffe. Cette étude a démontré que les cellules greffées ont pu régénérer le phénotype épithélial, notamment via la présence de K3 et d’une membrane basilaire typique. Depuis la première greffe de cellules souches limbiques cultivées ex vivo, plus de 1000

25

patients souffrant du syndrome de déficit en cellule souches limbiques ont été traités selon cette méthode initialement élaborée par Pellegrini (Utheim, 2015).

En parallèle, diverses équipes se sont penchées sur la possibilité de greffer un épithélium cornéen autologue en utilisant des cellules provenant d’une source externe au limbe cornéen. Depuis 2003, 9 cultures provenant de cellules d’origines différentes au limbe ont été utilisées afin de reconstruire un épithélium cornéen (Sehic, Utheim, Ommundsen, & Utheim, 2015). Parmi ces sources font parties les cellules épithéliales de la muqueuse orale (Utheim, 2015), les cellules souches embryonnaires (Homma et al., 2004), les cellules conjonctivales (Tanioka et al., 2006), les cellules souches épidermiques (Yang et al., 2007) et les cellules souches de la pulpe dentaire (Monteiro et al., 2009). Ces cellules constituent une alternative à l’utilisation des cellules souches limbiques lors du traitement de déficit bilatéral où le limbe du patient est sévèrement atteint et qu’il ne peut être mis en culture. Plusieurs études se penchent présentement sur le potentiel clinique de ces sources cellulaires (Utheim, Utheim, Khan, & Sehic, 2016).

1.4.3.2.4.  La  greffe  de  cellules  souches  limbiques  sur  membrane  amniotique     À partir du moment où il a été démontré qu’il était possible de greffer un épithélium fonctionnel à partir des cellules souches limbiques du patient, plusieurs améliorations ont été apportées, notamment au niveau du type de support utilisé pour la greffe. Ainsi, l’utilisation de supports biologiques est devenue préférable aux armatures synthétiques afin d’optimiser la prise du greffon sur le support ainsi que sa capacité à régénérer un épithélium fonctionnel une fois greffé. Les supports biocompatibles les plus utilisés en clinique sont les gels de fibrine (Han, Schwab, Madsen, & Isseroff, 2002; Rama et al., 2001), les lentilles cornéennes souples (Deshpande et al., 2009) et les membranes amniotiques humaines (Schwab, 1999; Tsai, Li, & Chen, 2000). La membrane amniotique tapisse la surface interne du placenta et est prélevée après l’accouchement. Celle-ci possède des propriétés anti-inflammatoires intéressantes, notamment via la sécrétion de différents facteurs de croissance tels que le FGF, le HGF et le TGF-β (Shimazaki, Shinozaki, & Tsubota, 1998). Il a aussi été rapporté que la membrane amniotique comprenant les cellules épithéliales sécrète davantage de facteurs de croissance que la membrane amniotique déépithélialisée (Koizumi et al., 2000). La membrane amniotique améliorerait également la capacité des cellules souches limbiques à

26

former un néoépithélium, notamment par la prolongation de leur survie et le maintien de leur caractère souche. En clinique, il a été démontré qu’en plus de réduire l’inflammation, l’usage de la membrane amniotique réduit la cicatrisation persistante ainsi que la vascularisation, facilite la réépithélialisation et aide au rétablissement d’un phénotype épithélial normal (Malhotra & Jain, 2014; S. C. Tseng, 2001). Un des principaux avantages au choix de la membrane amniotique comme support lors d’une greffe est l’absence de couche nourricière lors de la culture, ce qui permet d’éviter le rejet ou la transmission d’infection par les fibroblastes murins (Tsai et al., 2000). La greffe de cellules souches limbiques autologues sur membrane amniotique est indiquée pour traiter plusieurs troubles de la cornées tels que l’ulcération, les déficits en cellules souches partiels ou totaux, les brûlures chimiques et les érosions douloureuses persistantes (S. C. Tseng, 2001). Enfin, l'emploi d’une membrane amniotique à des fins de greffe peut comporter certains risques de transmission d’infections bactériennes ou virales si elle n’est pas utilisée ou entreposée dans des conditions stériles (Malhotra & Jain, 2014). En raison de tous les avantages qu’elle apporte, l’usage de la membrane amniotique comme support est privilégiée en clinique.

1.5. La guérison des plaies cornéennes

1.5.1. Le processus de cicatrisation de la cornée

1.5.1.1. Les étapes de la cicatrisation de l’épithélium cornéen Lors d’une blessure à la cornée, plusieurs processus cellulaires et moléculaires s’enclenchent au niveau de l’épithélium cornéen afin de reconstituer rapidement l’intégrité de la surface de la cornée. Plus la guérison est rapide et efficace, plus faible est le risque de développer une infection ou une cicatrice permanente pouvant affecter l’acuité visuelle. La cicatrisation de l’épithélium cornéen est un processus complexe impliquant divers mécanismes cellulaires et moléculaires, qui peut être divisé en quatre grandes étapes séquentielles, soit 1) la phase latente, 2) la phase migratoire, 3) la prolifération et différenciation cellulaire et 4) l’adhésion cellulaire (Figure 1.7.).

27

Figure 1.7. Les quatre étapes de la cicatrisation de l’épithélium cornéen. Représentation schématique de la cicatrisation de l’épithélium cornéen, laquelle s’effectue en 4 étapes : 1) la phase latente, 2) la phase migratoire, 3) la phase de prolifération et de différenciation cellulaire et 4) l’adhésion cellulaire. (Figure fournie par J. Lake).

1. Phase latente

2. Phase migratoire

3. Phases de prolifération etde di�érenciation

4. Phase d’adhésion cellulaire

28

1.5.1.1.1.  La  phase  latente   Cette première étape de la cicatrisation de l’épithélium cornéen caractérise la période qui a lieu entre la formation de la blessure et le début de la migration cellulaire afin de recouvrir la lésion. Cette période quiescente, variant entre 4 à 6 heures, a pour but de mettre en branle les mécanismes nécessaires à la guérison de la plaie. Immédiatement après la formation de la lésion, les cellules épithéliales en bordure de la lésion entreprennent la réorganisation de leur cytosquelette et augmentent leur métabolisme général afin de se préparer à migrer vers le centre de la lésion (Agrawal & Tsai, 2003). Plusieurs protéines du cytosquelette essentielles à la migration cellulaire sont alors synthétisées, telles que la vinculine, l’actine, la taline et certaines intégrines (Zieske & Gipson, 1986). Également, les intégrines α6 et β4 composant les hémidesmosomes situés à l’extrémité basale de ces cellules épithéliales sont redistribuées à la surface cellulaire (Liu & Kao, 2015). Ainsi, ces jonctions cellulaires sont remplacées par des complexes d’adhésion focale temporaires pour permettre la migration des cellules épithéliales (Suzuki et al., 2003). Ces changements cellulaires caractérisés à la fois par la perte de la morphologie cuboïdale des cellules basales et par la desquamation des cellules superficielles engendrée par la lésion causent l’amincissement de l’épithélium en bordure de la plaie. À la fin de la période latente, les cellules situées directement en marge de la lésion forment une monocouche de cellules amincies possédant des lamellipodes et des filopodes prêts pour la migration.

Des modifications se produisent également au niveau de la MEC afin de préparer un environnement favorable à la guérison. La FN, le fibrinogène et la fibrine apparaissent sur la région lésée dans les premières heures suivant la lésion (Zieske, 2001). Il a également été démontré que la ténascine (TN), le lumican et la LM participent à la formation d’une matrice provisoire facilitant la migration des cellules épithéliales. Cependant, la FN est la glycoprotéine ayant le plus grand rôle à jouer dans la cicatrisation cornéenne, car, normalement absente, elle est sécrétée en très grande quantité par les fibroblastes du stroma cornéen en réponse à une blessure (Suzuki et al., 2003). En plus de son rôle structural, la FN participe à la signalisation de processus cellulaires importants lors de la guérison des plaies, telles que la migration et la prolifération. Cette signalisation s’effectue via l’activation du récepteur de la FN, l’intégrine α5β1, qui mène entre autres à la réorganisation des filaments d’actine afin de favoriser la migration cellulaire (Kimura et al., 2010).

29

1.5.1.1.2.  La  phase  migratoire   La seconde phase de la cicatrisation cornéenne est la phase migratoire, correspondant au mouvement linéaire horizontal des cellules épithéliales afin de recouvrir la surface de la lésion (Crosson, Klyce, & Beuerman, 1986). Celles-ci migrent sur la matrice temporaire constituée majoritairement de FN nouvellement synthétisée (Agrawal & Tsai, 2003). Au début de la phase migratoire, les cellules aplaties situées directement en marge de la lésion forment des fronts de migration de façon aléatoire, qui deviennent des langues de migration au fur et à mesure que les cellules progressent vers le centre de la lésion (Figure 1.8). Ainsi, la migration des cellules épithéliales n’est pas uniforme puisqu’elle s’effectue en fonction du mouvement convexe des langues de migration qui tendent à se rejoindre au centre de la lésion (Zagon, Sassani, & McLaughlin, 2000). En temps normal, la migration des cellules épithéliales se fait assez rapidement, soit à une vitesse constante allant de 60 à 80 µm/heure (Matsuda, Ubels, & Edelhauser, 1985). C’est donc un processus cellulaire qui demande énormément d’énergie provenant entre autres du glucose présent dans l’humeur aqueuse et des réserves de glycogène intracellulaires (Carrier, 2006). La migration cellulaire est un processus pouvant se diviser en quatre étapes distinctes. D’abord, les cellules s’étalent en formant des protrusions en direction du mouvement, tels que des filopodes et lamellipodes. Ensuite, elles établissent des points d’attachement avec la MEC via les complexes focaux d’adhésion situés à l’extrémité des protrusions cellulaires. Ainsi, elles sont en mesure d’avancer en contractant les filaments d’actine et de myosine intracellulaires des protrusions comme point de traction. Enfin, les points d’adhésion de l’arrière de la cellule sont relâchés, ce qui provoque le mouvement (Devreotes & Horwitz, 2015). À la fin de la phase migratoire, on obtient une lésion dont la surface est recouverte d’une monocouche homogène de cellules épithéliales formant des contacts provisoires avec la matrice temporaire qui leur est sous-jacente.

 

30

Figure 1.8. La migration des cellules épithéliales cornéennes pendant la guérison d’une lésion. A) Coupe histologique colorée au trichrome de Masson d’une cornée reconstruite 5 jours suivant la lésion. Les cellules épithéliales ont migré de la marge de la plaie pour former un néoépithélium, lequel s’amincit à son extrémité pour former une langue de migration. (Adaptée de Couture, 2016) B) Aspect macroscopique d’une lésion de 6 mm de diamètre 2 jours suivant la lésion d’une cornée reconstruite. Les flèches pointent les fronts de migration épithéliaux convexes progressant vers le centre de la plaie. (Adaptée de Carrier et al., 2008).

 

1.5.1.1.3.  La  prolifération  et  la  différenciation  cellulaire     Bien souvent, la prolifération cellulaire vient de paire avec la migration cellulaire. En effet, dans le contexte de la cicatrisation cornéenne, ces deux processus se chevauchent afin de restaurer l’intégrité de l’épithélium. Pendant que les cellules épithéliales en marge de la lésion migrent afin de recouvrir la surface lésée, ces dernières ne prolifèrent que très peu ou pas du tout. Ce sont plutôt les cellules éloignées de la lésion qui augmentent significativement leur activité mitotique afin de

Cornée reconstruite Néoépithélium

Marge de la plaieLangue de migration

A

B

31

proliférer vers la plaie. Ce processus mitotique accru en périphérie a pour effet d’amener des cellules souches épithéliales de la région limbique vers la lésion via la membrane basilaire (Chung, Hutcheon, Joyce, & Zieske, 1999; Hanna, 1966; Samy et al., 1999). Par conséquent, l’arrivée de nouvelles cellules au sein de la lésion contribue à restaurer le nombre initial de cellules épithéliales afin de régénérer l’épithélium cornéen. De même, les cellules épithéliales accrochées à la membrane basilaire au niveau de la plaie vont être amenées à se diviser verticalement afin de rétablir la stratification de l’épithélium (voir section 1.2.1). Ainsi, la prolifération des cellules en périphérie et la différenciation verticale des cellules basales recouvrant la lésion contribuent à générer un néoépithélium stratifié.

1.5.1.1.4.  L’adhésion  cellulaire   L’adhésion de l’épithélium cornéen nouvellement régénéré à la membrane basilaire et au stroma est la dernière étape du processus de cicatrisation de l’épithélium cornéen. Cette étape est cruciale afin d’assurer que le tissu régénéré soit bien attaché au stroma, assurant du même coup la qualité de la guérison. L’adhésion du néoépithélium cornéen commence d’abord par le rétablissement des contacts cellules-cellules et cellules-matrice qui avaient été perdus lors de la phase migratoire. Parmi les différentes jonctions rétablies, les premières à l’être sont les jonctions intercellulaires afin de mettre en place une barrière protectrice le plus rapidement possible (Suzuki et al., 2003). Les hémidesmosomes sont redistribués au pôle basal des cellules épithéliales pour que celles-ci puissent établir des liens solides avec la membrane basilaire (Payne, Gong, & Trinkaus-Randall, 2000). Cette dernière, qui avait été désassemblées lors de la formation de la plaie, est également reconstruite à l’aide de la LM-1 sécrétée par les cellules épithéliales migratoires. Le rétablissement de la membrane basilaire concorde également avec le réassemblage des desmosomes, des jonctions de type ‘gap’ et des jonctions adhérentes formant l’intégrité structurale de l’épithélium cornéen normal (Suzuki et al., 2003).

32

1.5.1.2. La cicatrisation du stroma et de l’endothélium cornéen

1.5.1.2.1.  La  cicatrisation  de  la  membrane  de  Bowman  et  du  stroma   Certaines blessures de l’œil peuvent également affecter d’autres structures plus profondes que l’épithélium, soit le stroma et l’endothélium cornéen. Lorsque l’intégrité de la membrane de Bowman est affectée, cela peut engendrer des conséquences au niveau de la guérison de l’épithélium, mais aussi au niveau du stroma cornéen (Ljubimov & Saghizadeh, 2015). Par exemple, il a été démontré que plus la lésion est large, plus elle prend de temps à guérir et plus la membrane de Bowman risque d’être affectée (Sta Iglesia & Stepp, 2000). Dans un contexte sain, l’une des fonctions de la membrane de Bowman est d’empêcher la libre diffusion des facteurs produits dans l’épithélium vers le stroma et vice-versa. Ainsi, lorsqu’il se produit un bris dans l’intégrité de la membrane de Bowman, il y a alors libre diffusion de cytokines telles que le TGF-β1 et le PDGF produits par les cellules épithéliales vers les fibroblastes du stroma, ce qui cause leur transformation en myofibroblastes (Wilson, Liu, & Mohan, 1999). De même, la diffusion de l’IL-1 en provenance de l’épithélium cause l’apoptose des kératocytes du stroma (V. Singh et al., 2011). Ces changements cellulaires engendrés par la rupture de la membrane de Bowman ont pour but d’activer les mécanismes nécessaires à la guérison de la plaie. Dans un premier temps, l’apoptose des kératocytes en marge de la région endommagée crée une zone acellulaire requise afin d’initier le processus de cicatrisation (Wilson, 2000). Ensuite, les kératocytes situés en bordure de la zone d’apoptose vont être amenés à proliférer pour remplacer les cellules mortes. Ces kératocytes ont acquis des caractéristiques fibroblastiques qui leur permet de migrer vers la région endommagée. À cet endroit, ces fibroblastes sécrètent des composantes de la MEC telles que la FN, la TN, les collagènes, les protéoglycanes, les MMPs et certaines intégrines afin de générer une matrice provisoire stimulant la guérison (Dwivedi et al., 2006; Liu & Kao, 2015). Par ailleurs, une sous-population de ces fibroblastes est amenée à se différencier en myofibroblastes, lesquels sécrètent des facteurs de croissance tels que le HGF et le KGF qui vont contribuer à favoriser la prolifération des cellules épithéliales (Wilson et al., 2001). Enfin, la résolution de la cicatrisation du stroma cornéen nécessite le rétablissement de la MEC riche en collagènes et protéoglycanes, processus qui peut prendre plusieurs mois ou années selon la sévérité de la blessure (Cintron, Covington, & Kublin, 1990).

33

1.5.1.2.1.  La  cicatrisation  de  la  membrane  de  Descemet  et  de  l’endothélium  cornéen   L’endothélium cornéen possède une capacité très limitée à se régénérer in vivo, ce qui explique d’ailleurs la nécessité de procéder à la transplantation d’endothélium cornéen lorsque ce dernier est trop abimé par une blessure ou une pathologie (Maycock & Marshall, 2014). Lors d’une lésion à l’endothélium, les cellules endothéliales affectées ne peuvent être remplacées puisqu’elles sont incapables de progresser en mitose (Abib & Barreto, 2001). Ainsi, le seul moyen de combler le vide laissé par la lésion demeure l’expansion et l’amincissement des cellules voisines (Bonanno, 2012). Au fil du temps, une diminution de la densité cellulaire peut conduire à la perte de la fonctionnalité endothéliale. Par exemple, lorsque la densité diminue sous les 2000 cellules/mm2, certaines jonctions discontinues incomplètes peuvent se former entre les cellules endothéliales, ce qui, progressivement, mène à la fuite d’eau en provenance de l’humeur aqueuse vers le stroma. À une densité cellulaire très faible, soit 500 cellules/mm2, l’activité de déturgescence du stroma effectuée par les pompes Na+/K+ ATPase n’est plus en mesure de maintenir l’hydratation du stroma, ce qui a comme conséquence d’entrainer la formation d’œdème (Dawson, 2011). Ainsi, à cause de la capacité limitée de l’endothélium cornéen à se renouveler après une blessure, une lésion à ce tissu est à risque de causer des troubles de la vision. Néanmoins, lorsque la membrane de Descemet est endommagée par une blessure, certains processus de cicatrisation sont activés afin de limiter les dommages liés à la cicatrisation. Par exemple, certaines cellules endothéliales acquièrent la capacité de migrer vers le site lésé afin de créer une barrière temporaire incomplète réduite en site de pompage. Elles sont alors en mesure de synthétiser une nouvelle membrane de Descemet sous le site lésé. Au cours des semaines et des mois suivant la lésion, le nombre et la qualité des pompes retournent à la normale et l’épaisseur de l’endothélium est rétablit (Mimura, Yamagami, & Amano, 2013). Enfin, la dernière étape est le remodelage des cellules endothéliales afin qu’elles retrouvent leur forme hexagonale, ce qui peut requérir plusieurs mois (DelMonte & Kim, 2011; Watsky, McDermott, & Edelhauser, 1989).

34

1.5.2. Le remodelage de la matrice extracellulaire lors de la guérison des plaies cornéennes

Pendant le processus de la cicatrisation de la cornée, la composition de la MEC est constamment modifiée afin d’optimiser la guérison. Ce changement progressif de la MEC s’effectue sous l’action concertée de plusieurs protéines signalétiques, telles que les intégrines et les MMPs, et de protéines structurales, comme les collagènes, les LMs et la FN. Dès les premières heures suivant la lésion, la membrane basilaire de l’épithélium cornéen est désassemblée par des protéases, dont les MMPs (Zieske, 2001). Cette disparition de la membrane basilaire est caractérisée par la perte des protéines structurales composant cette dernière, soit les LMs et le CIV (Torricelli, Singh, Santhiago, & Wilson, 2013). Dès lors, une matrice provisoire est rapidement sécrétée et déposée sous la région lésée. Cette matrice, composée majoritairement de FN, est sécrétée par les cellules épithéliales et les kératocytes du stroma en bordure de la plaie (Sta Iglesia, Gala, Qiu, & Stepp, 2000). La FN est une glycoprotéine composée, entre autres, de plusieurs domaines représentant des sites de liaison pour les intégrines. Ainsi, l’augmentation de sa sécrétion a pour effet d’induire l’expression du gène codant pour la sous-unité d’intégrine α5 à la surface des cellules épithéliales (K. Larouche, Leclerc, Salesse, & Guerin, 2000). L’association de la sous-unité α5 avec la sous-unité β1 aura pour effet de créer la formation de complexes focaux d’adhésion impliquant l’intégrine α5β1, qui vont contribuer à stimuler la migration des cellules épithéliales sur la matrice provisoire de FN (Kiwanuka et al., 2013; J. Lake et al., 2013). Les intégrines sont des glycoprotéines hétérodimériques transmembranaires faisant le pont entre l’environnement extracellulaire et la signalisation intracellulaire. Elles sont capables de lier plusieurs protéines de la MEC, ce qui leur permet d’influencer le comportement cellulaire en fonction des changements dans la composition de la MEC entourant la cellule (Barczyk, Carracedo, & Gullberg, 2010). En plus de la FN, d’autres constituants de la MEC sont déposés au site endommagé à la suite d’une blessure, comme la LM-5, le lumican et la TN-C. Tout comme la FN, ces protéines favorisent la migration et la prolifération cellulaire (Saika, Ohnishi, Ooshima, Liu, & Kao, 2002; Stepp & Zhu, 1997). Lorsque toute la surface de la lésion est recouverte par les cellules épithéliales cornéennes, la sécrétion de FN diminue progressivement afin de permettre la régénération de la membrane basilaire. Ainsi, au même moment, la LM-1, LM-5 et le CIV sont sécrétés abondamment afin de reconstituer les hémidesmosomes nécessaires à l’ancrage des cellules épithéliales à la membrane basilaire (Tanaka, Furutani, Nakamura, & Nishida, 1999). Ces protéines sont également connues pour stimuler la différenciation verticale des cellules basales de l’épithélium cornéen afin de

35

reconstituer sa stratification lors des dernières étapes du processus de cicatrisation (Gaudreault et al., 2007; Jennifer Lake, 2015). En somme, la cicatrisation de la cornée fait intervenir une variété de facteurs cellulaires et de protéines afin d’optimiser la guérison de la plaie. Parmi celles-ci, les MMPs sont particulièrement importantes du au fait qu’elles participent au remodelage de la MEC tout au long du processus de cicatrisation. Les prochaines sections portent sur ces enzymes, en accordant une attention particulière aux gélatinases, soit la MMP-2 et la MMP-9.

1.5.2.1. Les métalloprotéinases matricielles (MMPs) L’existence des MMPs a pour la première fois été démontrée lors d’une étude portant sur le remodelage du collagène durant la formation de la queue du têtard de grenouille (Gross & Lapiere, 1962). Depuis cette découverte, 23 MMPs ont été identifiées chez l’être humain, chacune d’entres elles étant codée par des gènes différents. Les MMPs sont des enzymes qui contribuent à une diversité de processus physiologiques normaux tels que l’embryogénèse, le remodelage tissulaire, l’angiogenèse, la guérison des plaies, le remodelage du tissu osseux, la croissance neuronale, l’immunité adaptive et l’inflammation (Loffek, Schilling, & Franzke, 2011). Plus récemment, des évidences ont démontrés que ces enzymes avaient également un rôle à jouer dans des processus pathologiques comme le cancer et les maladies inflammatoires chroniques (Lopez-Otin & Matrisian, 2007). Les MMPs sont en mesure de remplir ces fonctions grâce à leur capacité de dégrader de façon spécifique toutes les composantes de la MEC et à sécréter différents facteurs dans l’environnement péricellulaire. Le clivage des composantes de la MEC est le principal processus qui caractérise le remodelage tissulaire et ce processus est primordial afin de réguler l’abondance, la composition et la structure de la MEC, de même que le relâchement de molécule biologiquement actives (Bonnans, Chou, & Werb, 2014). Dans les prochaines sections, les familles des différentes MMPs, leurs structures ainsi que leur régulation seront présentés dans un contexte de remodelage tissulaire.

36

1.5.2.1.1.  Les  différentes  familles  des  métalloprotéinases  matricielles,  leurs  structures  et  leur  substrats     Les MMPs sont des enzymes appartenant à la superfamille des Metzincines, qui regroupe toutes les protéases partageant le motif de liaison du Zn2+ HEXXHXXGXXH, soit les adamalysines, les astacines, les serralysines, les pappalysines et les MMPs (Vandenbroucke & Libert, 2014). Après leur synthèse, les MMPs sont sécrétées à l’extérieur de la cellule et se retrouvent alors sous deux formes possibles : solubles ou ancrées à la membrane plasmique. Les 23 MMPs sont classées en plusieurs sous-familles en fonction de leurs substrats et des domaines formant leur structure (Figure 1.9). En effet, les MMPs partagent plusieurs domaines fonctionnels, soit le peptide signal, le propeptide, le domaine catalytique et le domaine hémopexine (sauf pour la MMP7, MMP23 et MMP26). Chaque domaine composant la structure de la MMP est nécessaire pour l’ensemble de ses fonctions. D’abord, le peptide signal, situé à l’extrémité N-terminal de l’enzyme, est requis pour sa sécrétion à l’extérieur de la cellule après sa synthèse dans le réticulum endoplasmique. Adjacent au peptide signal, le domaine propeptide, formé d’environ 80 résidus d’acides aminés, confère à la MMP sa forme latente inactive, appelée alors zymogène (sauf pour la MMP-23). Cet état inactif provient de la présence du résidu C dans le motif ‘cystein switch’ PRCGxPD hautement conservé. Le domaine catalytique de l’enzyme, formé d’environ 165 résidus, est responsable de l’activité enzymatique de la MMP grâce à son activité protéolytique intrinsèque. Le domaine catalytique contient le motif de liaison du Zn2+, lequel s’y lie via les trois résidus H qu’il porte. Lorsque le Zn2+ est lié à son motif, cet ion divalent est en mesure d’interagir avec le résidu cystéine de la ‘cystein switch’ du prodomaine, maintenant ainsi l’état inactif de la pro-MMP. Enfin, le domaine hémopexine, séparé du domaine catalytique de quelques acides aminés, compose le reste de la structure peptidique jusqu’à l’extrémité C-terminale. Le domaine hémopexine confère à l’enzyme plusieurs de ses fonctions, dont sa liaison à son substrat et l’activation d’autres pro-MMPs (Bonnans et al., 2014; Gomis-Ruth et al., 1996; Nagase & Woessner, 1999). Par ailleurs, d’autres sous-domaines des MMPs sont dans certains cas insérés dans le domaine hémopexine afin d’augmenter la spécificité de ces enzymes envers leurs substrats. Par exemple, les gélatinases MMP-2 et MMP-9 possèdent trois domaines répétés de type II de la FN en C-terminal, ce qui leur permet de dégrader spécifiquement la gélatine, qui consiste en du collagène dénaturé (Nagase & Fushimi, 2008).

37

Les substrats biologiques susceptibles d’être clivés par les MMPs sont très nombreux et comprennent plusieurs protéines de la MEC (collagènes, LM, FN, TN, élastine et protéoglycanes) ainsi que des substrats non-matriciels (cytokines, récepteurs, facteurs de croissance, sérine-protéases, MMPs, inhibiteurs de protéases, etc.) (Folgueras, Pendas, Sanchez, & Lopez-Otin, 2004; McCawley & Matrisian, 2001). Ainsi, toutes les MMPs sont en mesure de dégrader la majorité des composantes d’un tissu. Comme plusieurs MMPs partagent les mêmes substrats, il existe une certaine redondance fonctionnelle entre les MMPs (Greenlee, Werb, & Kheradmand, 2007). En effet, des expériences de knock-out effectuées chez la souris ont démontré que l’abolition de l’expression d’une seule MMP n’affectait pas la survie de l’animal en raison d’un effet compensatoire établi par les autres MMPs (Paiva & Granjeiro, 2014). Seule l’inhibition de la MT1-MMP entraine des changements phénotypiques drastiques tels que du dimorphisme squelettique, de l’arthrite et de la fibrose (Loffek et al., 2011).

38

Figure 1.9. Les métalloprotéinases matricielles : les différentes familles, leurs structures et leurs substrats spécifique. Les MMPs sont des enzymes appartenant à la superfamille des Metzincines. Les 23 MMPs sont classées en plusieurs sous-familles en fonction de leurs substrats et des domaines formant leur structure. Ces enzymes partagent plusieurs domaines fonctionnels communs, soit le peptide signal, le propeptide, le domaine catalytique et le domaine hémopexine. Également, d’autres sous-domaines sont dans certains cas insérés dans le domaine hémopexine afin d’augmenter la spécificité des MMPs envers leurs substrats. (Tirée de (Bonnans et al., 2014).

39

1.5.2.1.2.  La  régulation  des  métalloprotéinases  matricielles   La régulation des MMPs est un processus qui a pour but de moduler finement l’action de ces enzymes au sein d’un tissu. En effet, une dérégulation du niveau de l’activité des MMPs pourrait mener au développement de plusieurs pathologies. Par exemple, un niveau d’activation trop élevée de ces enzymes aurait pour conséquence la formation d’ulcères récurrents, tandis qu’un niveau d’activation trop faible entrainerait de la fibrose (Brew & Nagase, 2010; Paiva & Granjeiro, 2014). Afin d’éviter ces complications, les MMPs sont soumises à quatre niveaux de régulation, soit au niveau de l’activation protéolytique du zymogène, de leur transcription, de l’inhibition de l’enzyme active par des inhibiteurs de protéases et de leur compartimentalisation cellulaire (Loffek et al., 2011). Ainsi, les cellules sont en mesure de réguler l’activité des MMPs à la hausse ou à la baisse selon les besoins, le moment et l’endroit précis.

1.5.2.1.2.1.  La  régulation  positive  des  métalloprotéinases  matricielles   Les MMPs sont d’abord synthétisées sous forme de zymogènes inactifs que l’on nomme pro-MMPs. Cet état de latence est maintenu grâce à la présence du propeptide à leur extrémité N-terminal, qui, en interagissant avec l’ion Zn2+ du domaine catalytique, interdit l’accès du substrat au site actif de l’enzyme. Ainsi, l’activation des pro-MMPs requiert obligatoirement le retrait de leur prodomaine. Ce processus est généralement enclenché par des agents chaotropiques, des oxydants, des composés organosulfurés, des agents alkylants ainsi que par des protéases telles que la trypsine, la plasmine et les autres MMPs (Cha, Pedersen, & Auld, 1996). Tous ces facteurs engendrent un changement de la conformation de la pro-MMP, menant au retrait du résidu C de la ‘cystein switch’ du prodomaine. Cet événement entraine l’ouverture du site catalytique de l’enzyme et permet l’entrée de molécules solubles capables d’interagir avec l’ion Zn2+ du domaine catalytique, ce qui mène à la formation d’un site catalytique fonctionnel. Enfin, ces diverses modifications dans la structure de la pro-MMP l’amène à cliver son propre prodomaine afin d’acquérir sa forme active capable de lier ses substrats (Tallant et al., 2010).

La régulation des MMPs peut même avoir lieu bien avant leur traduction en protéines, c’est-à-dire au niveau de leur transcription génique. Cette forme de régulation permet de contrôler finement les besoins en MMPs dans un tissu donné selon le contexte cellulaire. Par exemple, lors d’une lésion,

40

des signaux dérivés des intégrines, des protéines de la MEC, des cytokines et des facteurs de croissance, vont activer les voies signalétiques menant à la transcription des gènes codant pour les MMPs (Gordon, Ledee, Feuer, & Fini, 2009; Sternlicht & Werb, 2001). Cette activation s’effectue via les facteurs de transcription régulateurs de la transcription des MMPs, dont AP-1, Pax-6 et les membres de la famille Ets, qui vont être en mesure de lier leurs éléments de réponse sur les promoteurs des gènes des MMPs, permettant ainsi la transcription de ces enzymes (Benbow & Brinckerhoff, 1997; Puzovic, Brcic, Ranogajec, & Jakic-Razumovic, 2014; Sivak et al., 2000). Au final, cette régulation positive va mener à l’augmentation de la quantité de MMPs dans le tissu ciblé afin de rétablir l’homéostasie tissulaire. À l’inverse, la transcription des MMPs peut également subir une régulation négative afin de diminuer leur expression lorsqu’elles ne sont pas requises (Piperi & Papavassiliou, 2012).

Un troisième niveau de régulation des MMPs a lieu selon leur compartimentalisation cellulaire ou péricellulaire, c’est-à-dire selon leur confinement dans un lieu précis de la cellule ou dans l’environnement extracellulaire. Cette régulation est mise en branle dès la sécrétion des pro-MMPs dans le cytoplasme afin de contrôler leur disponibilité pour leur activation protéolytique. D’abord, le processus de relocalisation des MMPs est initié par les récepteurs membranaires liant les protéines de la MEC, qui envoient des signaux à l’intérieur de la cellule afin d’amener certaines MMPs vers la membrane plasmique (Ra & Parks, 2007). Ainsi, ces dernières sont en mesure de cliver leurs substrats spécifiques de la MEC. Les MMPs sont recrutées à la membrane via leur domaine hémopexine, qui est en mesure de lier plusieurs protéines et lipides membranaires comme l’intégrine α2β1, le CD44 et le sulfate de cholestérol (Stricker et al., 2001; Q. Yu & Stamenkovic, 2000). Par exemple, la MMP-7 lie le sulfate de cholestérol à la surface membranaire, ce qui promeut la dégradation péricellulaire de la LM et de la FN (Yamamoto, Miyazaki, & Higashi, 2010). Par ailleurs, certaines MMPs sont exclusivement retrouvées à la membrane plasmique. Ce sont les MT-MMPs, qui, en plus d’exercer leur rôle normal d’enzymes dégradant la MEC, participent à l’activation des pro-MMPs. Par exemple, la MT1-MMP, en combinaison avec la TIMP-2, forme un récepteur membranaire de la pro-MMP-2 qui vient s’y fixer via son domaine hémopexine. Cette surface de recrutement permet alors le clivage du propeptide de la pro-MMP-2 par une seconde MT1-MMP a proximité, ce qui permet l’activation de l’enzyme (Visse & Nagase, 2003).

41

1.5.2.1.2.2.  La  régulation  négative  des  métalloprotéinases  matricielles   Une forme majeure de régulation négative des MMPs est orchestrée par les inhibiteurs tissulaires des métalloprotéinases (TIMPs). Les TIMPs forme une famille d’enzymes composée de quatre homologues, soit les TIMPs 1 à 4, chacun étant spécifique à un tissu particulier. Ces enzymes sont connues pour inhiber de manière réversible toutes les MMPs (Murphy, 2011). Néanmoins, l’efficacité d’inhibition des MMPs varie pour chaque TIMP. Par exemple, la TIMP1 inhibe fortement toutes les MMPs à l’exception des MT-MMPs. TIMP2 et TIMP3 inhibent davantage la pro-MMP-9 tandis que TIMP-3 et TIMP-4 inhibent plutôt la pro-MMP-2 (Brew, Dinakarpandian, & Nagase, 2000). Les TIMPs sont constitués de deux domaines, soit un domaine N-terminal et un domaine C-terminal, tous les deux stabilisés par deux ponts disulfure (Williamson et al., 1990). La capacité inhibitrice des TIMPs provient de leur extrémité N-terminal, qui est en mesure de former des liens non covalents avec le domaine catalytique des MMPs. Cette interaction implique les 5 premiers résidus N-terminaux de la TIMP, qui se positionnent dans le site catalytique de la MMP de la même manière qu’un substrat, ce qui bloque l’accès d’autres molécules au site catalytique, entrainant par le fait même l’inhibition de la MMP (Brew & Nagase, 2010). Bien que les TIMPs sont principalement connues pour leur effet inhibiteur, ces enzymes peuvent dans certains cas agir en tant qu’activateurs des MMPs. Cette régulation positive s’effectue de concert avec les MT-MMPs, tel que discuté dans le paragraphe précédant. De plus, les fonctions des TIMPs ne se limitent pas à la régulation de l’expression des MMPs. Ces derniers contrôlent également une variété de processus cellulaires, comme la prolifération, l’apoptose, la différenciation et la survie (Melendez-Zajgla, Del Pozo, Ceballos, & Maldonado, 2008).

1.5.2.1.3.  Les  métalloprotéinases  et  la  guérison  des  plaies  cornéennes     La guérison des lésions cornéennes est un processus qui fait intervenir les MMPs en raison de leur capacité à dégrader les composantes la MEC. En effet, la migration des cellules épithéliales vers le centre de la lésion nécessite le désassemblage de la membrane basilaire, l’arrangement d’une matrice provisoire composée majoritairement de FN et le réassemblage de la membrane basilaire, qui sont des étapes nécessitant toutes l’action des MMPs (Agrawal & Tsai, 2003). Plusieurs études ont démontré l’importante contribution des MMPs dans la guérison des plaies cornéennes grâce à

42

des expériences menées in vivo chez le modèle animal et in vitro sur des cellules humaines en culture. Une étude menée chez le modèle félin a démontré que la sécrétion de MMPs dans le film lacrymal, plus particulièrement la MMP-9, augmente à la suite d’une blessure (Petznick et al., 2011). De même, une étude portant sur la production des MMPs après une brûlure alcaline chez la souris a montré une élévation du taux d’activité des MMP-1, -3, -9, and -13 suivant la brûlure (Bian et al., 2015). Par ailleurs, des expériences menées chez le rat ont démontré que la MMP-12 régule la prolifération des cellules épithéliales cornéennes et que la transcription de cette MMP est sous le contrôle de la voie Wnt/ β-caténine (Lyu & Joo, 2005a, 2006). Un modèle de débridement de l’épithélium de cornées humaines ex vivo a permis de démontrer que la réépithélialisation engendre des niveaux accrus de MMP-1, MMP-3, MMP-9, MMP-10 et TIMP-1, lesquels sont sécrétés par les cellules épithéliales et les fibroblastes cornéens (Daniels et al., 2003). Plusieurs études ont également voulu vérifier le rôle des MMPs dans la cicatrisation à la suite des chirurgies LASIK et PKR (Gonzalez-Perez, Villa-Collar, Gonzalez-Meijome, Porta, & Parafita, 2012; Holopainen et al., 2003; Ji et al., 2014; Malecaze et al., 1997). D’ailleurs, l’expression persistante de la MMP-9 plusieurs mois après une chirurgie LASIK est perçue en clinique comme étant défavorable à la guérison, car elle a pour conséquence d’engendrer des complications comme la desquamation et des irrégularités épithéliales (Sambursky & O'Brien, 2011). Grâce à ces évidences, on peut donc affirmer que les MMPs exercent des fonctions essentielles dans la régénération d’un épithélium cornéen fonctionnel à la suite d’une blessure à l’œil. Les prochaines sections décrivent les deux principales MMPs impliquées dans la guérison des plaies cornéennes in vivo et qui, par le fait même, participent également à la guérison des plaies dans notre modèle de cornée humaine reconstruite par génie tissulaire.

1.5.2.1.3.1.  La  métalloprotéinase  matricielle  2  (MMP-­‐2)   La MMP-2, ou gélatinase A, est une protéine de 62 kDa (comparativement à 72 kDa pour la pro-MMP-2) dont le principal substrat est la gélatine (Jacob-Ferreira et al., 2013) (Figure 1.10). Cette spécificité envers la gélatine est due à la présence de trois domaines répétés de type II de la FN insérés dans la structure de la protéine en C-terminal. En plus de la gélatine, la MMP-2 peut cliver une variété de facteurs et de protéines de la MEC, dont des facteurs de croissance, des cytokines et des inhibiteurs de protéases. Également, la MMP-2 est en mesure de convertir la pro-MMP-1 et la

43

pro-MMP-13 en enzymes actives. L’activation de la pro-MMP-2, quant à elle, est un mécanisme unique qui diffère de l’activation des autres MMPs, car elle requiert la participation de la MT-MMP-1 et d’une TIMP, soit la TIMP1 ou la TIMP2 (Corcoran, Hewitt, Kleiner, & Stetler-Stevenson, 1996). Tout comme les autres MMPs, la synthèse et la fonction de la MMP-2 sont régulées à différents niveaux et s’effectuent via la présence de nombreux facteurs. Par exemple, le TGF-β, l’IL-8 et l’IGF-1 influencent positivement l’expression de la MMP-2. Cependant, le mécanisme de régulation de cette enzyme reste partiellement incompris puisqu’on ne connait pas tous les éléments régulateurs de son promoteur (Zhang, Bar-Eli, Meloche, & Brodt, 2004). Néanmoins, il a été démontré que les facteurs de transcription Sp1, Sp3 et AP-2 sont requis pour l’expression constitutive de la MMP-2 (Y. Chen et al., 2014; Ma et al., 2004; Qin, Sun, & Benveniste, 1999).

Pendant la guérison des plaies cornéennes, la MMP-2 est exprimée de façon constitutive. Cependant, son activation est exacerbée lors des phases plus tardives de la cicatrisation. En effet, une étude menée chez le rat a démontré que l’ARNm de la MMP-2 était détecté seulement 3 jours après une chirurgie PKR (Hongqing Q. Ye & Azar, 1998). Cette expression tardive de MMP-2 peut être expliquée par le fait que ce sont les myofibroblastes ayant remplacés les kératocytes qui la sécrètent en majeure partie. Par ailleurs, cette étude a aussi démontré que la MMP-2 était sécrétée par les cellules épithéliales du néoépithélium en fin de cicatrisation, ce qui témoigne de son rôle dans la régénération final de l’épithélium cornéen. Cette expression tardive a également été observée précédemment chez le lapin (Matsubara, Girard, Kublin, Cintron, & Fini, 1991). Des études réalisées in vitro avec des cellules humaines en culture ont validé l’importance de la MMP-2 lors de la guérison de plaies cornéennes. D’abord, une expérience réalisée sur des cellules épithéliales de cornées humaines a permis de préciser le rôle de la MMP-2 lors de la réépithélialisation. En effet, lorsque cette MMP est sous l’influence du HGF, elle promeut alors la migration des cellules épithéliales afin de favoriser la guérison. Par ailleurs, cette étude a aussi démontré que la sécrétion de MMP-2 augmente au fur et à mesure que des cellules épithéliales migrent. Enfin, peu d’études ont pu vérifier l’expression de la MMP-2 (et des autres MMPs) in vivo lors d’une blessure de la cornée humaine principalement en raison des problèmes éthiques que soulève le prélèvement de tissu et des faibles concentrations recueillies dans le film lacrymal. Néanmoins, des biopsies provenant d’yeux de patients ayant développé des complications après une chirurgie LASIK ont démontré que la cicatrisation post-chirurgicale induisait des taux plus élevés de MMP-2 par rapport aux yeux contrôles

44

(Maguen et al., 2002), ce qui démontre encore une fois l’importance de la MMP-2 dans la guérison des plaies cornéennes.

Figure 1.10. La structure de la pro-MMP-2 et ses domaines. Représentation schématique de la structure cristallographique de la pro-MMP-2. Chacun de ses domaines est représenté par une couleur : le propeptide en rose, le domaine catalytique en vert et le domaine hémopexine en jaune. Les ions Zn2+ sont représentés par les sphères mauves. (Tirée de Jacob-Ferreira et al., 2013).

1.5.2.1.3.2.  La  métalloprotéinase  matricielle  9  (MMP-­‐9)   La MMP-9, ou gélatinase B, est une protéine de 82 kDa (comparativement à 92 kDa pour la pro-MMP-2) qui, tout comme la MMP-2, dégrade la gélatine. En plus du collagène dénaturé, la MMP-9 est en mesure de cliver plusieurs composantes de la membrane basilaire telles que les CIV, CV, CVII, FN, LM, fibrine et le nidogène, et également des cytokines et facteurs de croissance, comme l’IL-1β et le TGF-β (McCawley & Matrisian, 2001). En plus de ses trois domaines répétés de type II de la FN, la MMP-9 possède un domaine de liaison au CV unique inséré dans son domaine catalytique, qui d’ailleurs, constitue le collagène le plus abondant dans le stroma cornéen avec le CI (George E. Marshall et al., 1991). Contrairement à la MMP-2 qui est exprimée de façon constitutive, l’expression basale de la MMP-9 est faible, mais augmente en réponse à la sécrétion locale de

45

cytokines et de facteurs de croissance, comme l’IL-1 et le TNF-α (C. Yan & Boyd, 2007). Plusieurs études se sont intéressées à la régulation du gène de la MMP-9 au niveau de son promoteur. Ainsi, il est maintenant connu que de nombreux facteurs sont capables d’activer ou d’inhiber la transcription de la MMP-9, c’est-à-dire bien avant sa sécrétion en tant qu’enzyme (Labrie & St-Pierre, 2013). Concernant la régulation positive de la MMP-9, il est admis que le facteur AP-1 est un activateur de la transcription de cette MMP, et que lorsque cette activation est réalisée en collaboration avec les facteurs de transcriptions NF-κB et Sp1, elle devient maximale (Eberhardt, Huwiler, Beck, Walpen, & Pfeilschifter, 2000; R. Mohan, Rinehart, Bargagna-Mohan, & Fini, 1998). À l’inverse, la protéine Kiss-1 est connue pour supprimer l’expression de la MMP-9 en interférant avec la liaison du facteur de transcription NF-κB à ses éléments de liaison sur le promoteur de la MMP-9 (J. H. Lee & Welch, 1997). Par ailleurs, d’autres protéines comme MTA-1 et RECK ont démontré leur capacité à inhiber la transcription de la MMP-9 (Noda, Takahashi, Matsuzaki, & Kitayama, 2010; Takagi, Simizu, & Osada, 2009; L. Yan, Borregaard, Kjeldsen, & Moses, 2001).

Le rôle de la MMP-9 lors de la guérison des plaies cornéennes n’est plus matière à débat, car plusieurs études s’entendent pour affirmer que la MMP-9 est l’une, sinon la MMP la plus impliquée dans les processus de cicatrisation de la cornée. Sa capacité à dégrader une variété de substrats de la MEC lui permet de contrôler plusieurs processus de la régénération épithéliale, comme le remodelage et le réassemblage de la membrane basilaire et l’élimination de la matrice temporaire de FN nécessaire à la migration cellulaire (Gordon et al., 2011). Des études d’immunolocalisation menées chez plusieurs espèces animales (rats, souris, lapins) et chez l’être humain ont démontré que la MMP-9 est exprimée au front des langues de migration lors de la cicatrisation de l’épithélium cornéen (M. E. Fini et al., 1996; Matsubara, Girard, et al., 1991; Matsubara, Zieske, & Fini, 1991; R. Mohan et al., 1998). Par ailleurs, une étude menée in vivo sur des souris chez lesquelles on a supprimé l’expression de la MMP-9 (souris ‘knockout’) a démontré que la guérison de la lésion cornéenne s’effectue plus rapidement chez celles-ci, ce qui suggère que la MMP-9 altère la prolifération des cellules épithéliales (R. Mohan et al., 2002). De surcroit, l’absence de MMP-9 dans ce modèle de souris limite le remodelage de la MEC après la fermeture de la plaie, ce qui se traduit par la persistance aberrante de la matrice provisoire de FN une fois la réépithélialisation terminée. Malheureusement, peu d’études ont pu être réalisé in vivo chez des patients ayant subi une blessure à la cornée. Une étude réalisée in vivo chez des patients soufrant de désordres épithéliaux et d’ulcères récurrents a tout de même démontré un accroissement de la sécrétion de MMP-9 active

46

dans les larmes de ces patients en comparaison au groupe contrôle sain (A. Singh, Maurya, Jagannadhan, & Patel, 2012).

1.6. Problématique, hypothèse et objectifs de recherche

1.6.1. Problématique et hypothèse

La cornée est la couche la plus superficielle de l’œil et sa transparence permet de laisser passer les ondes lumineuses afin d’assurer une transmission efficace de la lumière à la rétine. Cependant, la localisation de la cornée la prédispose à plusieurs types de blessures, chimiques et mécaniques. En effet, un traumatisme de la cornée peut avoir d’importantes répercussions aux niveaux cellulaire et physiologique. Par exemple, une opacification cornéenne, ou conjonctivalisation, est souvent le résultat d’une blessure physique à l’œil. Malheureusement, la guérison de la surface oculaire est souvent lente et accompagnée de plusieurs complications. Il est donc crucial de mieux comprendre les mécanismes impliqués dans les processus de guérison, dont la réépithélialisation. L’hypothèse de ce projet est que la fermeture de la plaie, lors d’une lésion à la cornée, requiert des changements considérables dans l’expression de plusieurs gènes dont les produits permettent d’assurer une réépithélialisation adéquate de ce tissu.

1.6.2. Objectifs de recherche

L’objectif général de mon projet de maîtrise consistait à analyser les changements transcriptionnels et protéiques qui se produisent lors de la guérison d’une lésion de l’épithélium cornéen en accordant une attention particulière aux MMPs. Pour cette étude, la cornée reconstruite par génie tissulaire a été utilisée en guise de modèle expérimental. Afin de répondre à l’objectif général, nous nous sommes fixé les sous-objectifs suivants :

1) Identifier les gènes dont l’expression est dérégulée lors de la cicatrisation cornéenne.

47

2) Analyser l’expression génique et l’expression protéique des MMPs lors de la cicatrisation cornéenne.

3) Déterminer l’activité enzymatique de la MMP-9, de la MMP-2 et de leurs zymogènes durant la fermeture des plaies cornéenne.

4) Déterminer l’influence des fibroblastes et des différentes composantes de la MEC sur l’expression génique et protéique des MMPs.

5) Vérifier comment l’absence ou la présence de cellules épithéliales modifie l’expression des MMPs.

6) Analyser les modifications qu’apportent les cellules épithéliales cornéennes quant à la composition des stromas reconstruits.

48

Chapitre II :

La cornée humaine reconstruite par génie tissulaire comme modèle d’étude pour l’analyse de l’expression des métalloprotéinases matricielles lors de la guérison des plaies cornéennes

Camille Couture, Karine Zaniolo, Patrick Carrier, Jennifer Lake, Julien Patenaude, Lucie Germain et Sylvain L. Guérin.

Article publié dans Biomaterials, 2016; 78 :86-101.

Facteur d’impact : 8.557

2.1. Résumé

Les blessures à la cornée demeurent une cause majeure de consultations en ophtalmologie dans le monde entier. La guérison des blessures cornéennes est un mécanisme complexe faisant intervenir plusieurs processus tels que la mort cellulaire, la migration, la prolifération, la différenciation et le remodelage de la matrice extracellulaire (MEC). Dans cette étude, nous avons utilisé la cornée humaine reconstruite par génie tissulaire composée d’un épithélium et d’un stroma afin d’étudier les mécanismes cellulaires et moléculaires de la guérison des plaies. Le profilage génique sur biopuces à ADN a relevé que d’importantes altérations se produisent dans le patron d’expression des gènes exprimés par la cornée reconstruite en réponse à la lésion. L’expression de plusieurs gènes codant pour les MMPs, telle que démontrée par les analyses en profilage génique et en qPCR, est augmentée dans l’épithélium migrant afin de recouvrir la plaie occasionnée à la cornée reconstruite.

49

Nous avons montré que la plupart de ces enzymes sont converties en leur forme active au fur et à mesure que la lésion se referme. De plus, l’expression des MMPs par les cellules épithéliales de cornée humaine est modifiée à la fois par la présence des fibroblastes dans le stroma et par leur sécrétion d’une MEC enrichie en collagènes. Par ailleurs, les résultats obtenus des analyses en spectrométrie de masse ont démontré que la présence d’un épithélium différencié est requise pour la synthèse et l’organisation adéquates de la MEC sur laquelle les cellules épithéliales adhèrent. En conclusion, de par les caractéristiques qu’elle partage avec la cornée native, la cornée reconstruite humain composée de deux couches est particulièrement appropriée pour l’étude détaillée des mécanismes de la guérison des plaies cornéennes.

50

2.2. Title Page

The tissue-engineered human cornea as a model to study expression of matrix metalloproteinases during corneal wound healing

Camille Couturea,b,c, Karine Zanioloa,b, Patrick Carriera,b,c, Jennifer Lakea,b, Julien Patenaudea,b,c, Lucie Germaina,b,c and *Sylvain L. Guérina,b

aCUO-Recherche, Médecine Régénératrice - Centre de recherche FRQS du CHU de Québec-Université Laval, Québec, Canada; and Centre de Recherche en Organogénèse expérimentale de l'Université Laval/LOEX, bDépartement d’Ophtalmologie and cDépartement de Chirurgie, Faculté de médecine, Université Laval, Québec, QC, Canada.

* Corresponding author:

Dr. Sylvain L. Guérin, CUO-Recherche/LOEX

Hôpital du Saint-Sacrement, Centre de recherche du CHU de Québec

Québec, QC, Canada

Phone: (418) 682-7565; Fax: (418) 682-8000

E-mail: Sylvain.Guerin@fmed.ulaval.ca

51

2.3. Abstract Corneal injuries remain a major cause of consultation in the ophthalmology clinics worldwide. Repair of corneal wounds is a complex mechanism that involves cell death, migration, proliferation, differentiation, and extracellular matrix (ECM) remodeling. In the present study, we used a tissue-engineered, two-layers (epithelium and stroma) human cornea as a biomaterial to study both the cellular and molecular mechanisms of wound healing. Gene profiling on microarrays revealed important alterations in the pattern of genes expressed by tissue-engineered corneas in response to wound healing. Expression of many MMPs-encoding genes was shown by microarray and qPCR analyses to increase in the migrating epithelium of wounded corneas. Many of these enzymes were converted into their enzymatically active form as wound closure proceeded. In addition, expression of MMPs by human corneal epithelial cells (HCECs) was affected both by the stromal fibroblasts and the collagen-enriched ECM they produce. Most of all, results from mass spectrometry analyses provided evidence that a fully stratified epithelium is required for proper synthesis and organization of the ECM on which the epithelial cells adhere. In conclusion, and because of the many characteristics it shares with the native cornea, this human two layers corneal substitute may prove particularly useful to decipher the mechanistic details of corneal wound healing.

KEYWORDS

Tissue-engineering, biomaterial, cornea, wound healing, matrix metalloproteinase, extracellular matrix, gene expression

ABBREVIATED TITLE

Expression of MMPs during wound healing of reconstructed human corneas

52

2.4. Introduction

The cornea is localized at the outer surface of the eye. It is a transparent organ, highly specialized and unique that is continually subjected to abrasive forces and occasional mechanical or chemical trauma because of its anatomical localization. Upon injury, a complete reepithelialization and the reorganization of a mature smooth stratified epithelium, as well as a structured stroma, are essential in restoring the adequate function of the cornea (Agrawal & Tsai, 2003; Taliana, Evans, Dimitrijevich, & Steele, 2000). Damages to the cornea can result in scarring or opacification that may lead to visual defects and even complete loss of vision in which case corneal transplant is required. More than 10 million patients worldwide are in need of such corneal transplants. Of these, 1.5–2.0 million patients annually have untreated corneal blindness primarily because of the shortage of corneal donors (J. P. Whitcher, M. Srinivasan, & M. P. Upadhyay, 2001). The need for alternative options to cadaveric corneas is expected to keep growing very rapidly as a result of increasing incidence of transmissible diseases (e.g., human immunodeficiency virus), aging of the population, and the popularity of refractive surgery (primarily photorefractive keratectomy (PRK) and laser in situ keratomileusis (LASIK) (Woreta, Davis, & Bower, 2015)), which renders corneas unusable for later transplantation. Tissue engineering can remedy this problem by reconstructing a functional human corneal substitute in vitro that can be used as a replacement tissue for grafting. Alternatively, the reconstructed cornea is also an outstanding biomaterial to study the cellular and molecular mechanisms of corneal wound healing.

Several models of wound healing have been developed in order to investigate the corneal mechanisms of reepithelialization and to screen for growth factors susceptible to stimulate an adequate healing response (Brazzell, Stern, Aquavella, Beuerman, & Baird, 1991; Burling et al., 2000; Grant, Khaw, Schultz, Adams, & Shimizu, 1992; M. J. Kim et al., 2001; Maldonado & Furcht, 1995; Nelson, Silverman, Lima, & Beckman, 1990; Simmons, Jumblatt, & Neufeld, 1987; Taliana et al., 2000; Zieske, Hutcheon, Guo, Chung, & Joyce, 2001). Although very useful because of their ease of use, cell monolayer in vitro models however suffer from the lack of epithelial-mesenchymal interactions and the limited epithelium thickness. In addition, studies of corneal wound healing in animal models are very expensive and inter-individual variability among animals is inherent to in vivo experiments. Progress in tissue engineering resulted in the development of human tissue-engineered

53

corneas that were designed to mimic their in vivo counterpart in terms of cell phenotype and tissue architecture (see (Ghezzi, Rnjak-Kovacina, & Kaplan, 2015) for an extensive review). The three-dimensional tissue-engineered corneas were intended for basic research or clinical purposes. However, most of them use synthetic biomaterials combined with the use of immortalized human cells, which makes them dissimilar from the native cornea. We recently succeeded in tissue-engineering human corneal substitutes that show appropriate histology, expression of basal membrane (BM) components and integrins (P. Carrier et al., 2009; P. Carrier et al., 2008; L. Germain et al., 1999a, 1999b; L. Germain, Carrier, Auger, Salesse, & Guerin, 2000; Germain L, 2004; Holopainen et al., 2003; Paquet et al., 2010; S. Proulx et al., 2010b). Besides being devoided of any synthetic materials, corneas tissue-engineered by our self-assembly approach exhibit a well-developed stratified epithelium, a stroma and a well organized BM (Michel et al., 1999b; Pouliot et al., 2002). When mechanically damaged (using a biopsy punch), this fully human, tissue-engineered cornea, produced from living fibroblasts and untransformed human corneal epithelial cells (HCECs), mimics many aspects of the reepithelialization process including cell migration, proliferation and the restoration of a stratified epithelium (P. Carrier et al., 2009; P. Carrier et al., 2008).

Repair of corneal wounds requires proper adhesion as well as migration of HCECs to the BM in order to cover the wound (Gaal, 2002) which, in turn, also requires ECM synthesis and assembly. The ECM is a complex, cross-linked structure of proteins and polysaccharides that organizes the geometry of normal tissues. It undergoes complex and dynamic changes in its organization and composition as part of normal homeostasis and tissue repair (Liotta & Kohn, 2001; Streuli, 1999). This process is in great part ensured by the enzymatic actions of metalloproteinases (MMPs), which comprises 23 zinc and calcium ion–dependent proteolytic enzymes that are key regulators of ECM remodeling (Filippov et al., 2005; Holmbeck et al., 1999; Shapiro, 1998). MMPs are involved in normal and pathologic tissue repair, including epithelial regeneration, fibrotic repair and scar remodeling (Sivak & Fini, 2002). MMPs expression is profoundly altered during wound healing in response to the alterations occurring in the secretion of the ECM components such as fibronectin (FN). This is particularly noticeable for MMP9, whose expression increases in corneal epithelial cells during wound healing (Chakraborti, Mandal, Das, Mandal, & Chakraborti, 2003; Lyu & Joo, 2005b; Mulholland, Tuft, & Khaw, 2005) through a process that is likely regulated by cytokines such as IL-1,

IL-8 and TGF-β.

54

In the present study, we used the two-layers tissue-engineered human cornea as a substitute to investigate the changes that occur in the pattern of genes expressed by corneal cells during wound closure of damaged corneas with a particular attention given to MMPs as they are well known to function as key regulators of ECM remodeling (Filippov et al., 2005; Holmbeck et al., 1999; Shapiro, 1998).

55

2.5. Materials and Methods

This study was conducted in accordance with our institution’s guidelines and the Declaration of Helsinki. The protocols were approved by the hospital and Laval University Committees for the Protection of Human Subjects.

2.5.1. Cell culture and production of the tissue-engineered human corneas

Human corneal epithelial cells (HCECs) were isolated from the limbal area of normal eyes of 44-, 52- and 71 year-old donors following a procedure previously described (Gaudreault et al., 2003; L. Germain et al., 1999a); the eyes were obtained from the Banque d’Yeux Nationale of the Centre Universitaire d’Ophtalmologie (CHU de Québec, Hôpital du Saint-Sacrement, Québec, QC, Canada). HCECs were primary cultured with a feeder layer of irradiated murine Swiss-3T3 fibroblasts (ATCC, Rockville, MD) as previously reported (L. Germain et al., 1999a). Human corneal fibroblasts were isolated from the stromal portion of a cornea (from a 26 days-old donor) left after dispase digestion and removal of both the endothelium and epithelium, and primary cultured and subcultured as previously reported (L. Germain et al., 1999a; Germain L, 2004). All cells were grown under 8% CO2

at 37°C and culture medium was changed after 2-3 days (P. Carrier et al., 2008).

The tissue-engineered, two-layers 3D human corneas that have been used as a biomaterial were produced following the self-assembly approach (P. Carrier et al., 2008; S. Proulx et al., 2010b). Briefly, corneal fibroblasts were seeded and cultured in fibroblast growth medium supplemented with

50 μg/ml ascorbic acid (Sigma, Oakville, Ont., Canada) for 35 days. Ascorbic acid allows fibroblasts to secrete and lay down their own ECM (P. Carrier et al., 2008). After peeling from the flasks, two tissue sheets were superimposed to form a reconstructed stroma and were cultured for another week so that they could adhere to each other. Then, human corneal epithelial cells (HCECs) isolated from donors of different ages (44-, 52- and 71-years old) were seeded on the surface of the reconstructed stroma and cultured in submerged conditions in complete epithelial cell medium supplemented with ascorbate, as previously described (P. Carrier et al., 2009; P. Carrier et al., 2008; Germain L, 2004). After 7 days, reconstructed tissues were fed an EGF-free epithelial cell medium and were raised at the air-liquid interface for 10 days to induce epithelial differentiation. Reconstructed partial thickness

56

corneas produced by the self-assembly approach were then wounded using 8-mm biopsy punch (Figure 1A and 1B). After wounding, the tissue-engineered corneas were placed over two supplementary fibroblast sheets (F3 and F4 on Figure 1C) to allow reepithelialization over a natural matrix. Wound closure was then examined macroscopically every 24 hours for 4 days following the initial damage by observing the ring of reepithelialization that progressed toward the wound center. Biopsy samples were photographed at regular intervals (24 hours) using a Zeiss Imager.Z2 microscope (Zeiss Canada Ltd, North York, ON, Canada) equipped with a numeric CCD camera (AxioCam MRm; Zeiss). All experiments were repeated four times. When indicated, corneal stromas were depleted of their corneal fibroblasts by a 3 min treatment with 0.5% sodium deoxycholate followed by five washes with 1x PBS.

When indicated, HCECs were also cultured as a monolayer on tissue culture plates coated with collagen type I (CI; 5 µg/cm2) and type IV (CIV; 50 µg/cm2), fibronectin (FN; 5 µg/cm2), laminin (LM; 2 µg/cm2), tenascin C (TN; 2 µg/cm2) or BSA (2%) as previously described (Duval, Zaniolo, Leclerc, Salesse, & Guerin, 2015; Gaudreault et al., 2007; K. Larouche et al., 2000).

2.5.2. Mass spectrometry

The digest and mass spectrometry experiments were performed by the Proteomics platform of the Eastern Quebec Genomics Center, CHU de Quebec, Canada. Punch biopsies (8 mm diameter) taken either from complete tissue-engineered corneas (stroma/HCEC+) or just the stromal matrix without epithelial cells (stroma/HCEC-) were first dissolved in ammonium bicarbonate 50 mM (10 µl), reduced and alkylated with DTT 45 mM and Iodoacetamide 100 mM, then digested with 126nM of modified porcine trypsin (Sequencing grade, Promega, Madison, WI) at 58°C for 1h. Digestion products were extracted using 1% formic acid, 2% acetonitrile followed by 1% formic acid, 50% acetonitrile. The recovered extracts were pooled, vacuum centrifuge dried, desalted and then resuspended into 10 µl of 0.1% formic acid and 2 µl were analyzed by mass spectrometry. Peptide samples were separated by online reversed-phase (RP) nanoscale capillary liquid chromatography and analyzed by electrospray mass spectrometry (ES MS/MS). The experiments were performed with a Thermo Surveyor MS pump connected to a LTQ linear ion trap mass spectrometer equipped with a nanoelectrospray ion source (Thermo Fisher Scoentific Inc., San Jose, Ca USA). Peptide separation took place on a self-packed PicoFrit column (New Objective, Woburn, MA) packed with

57

Jupiter (Phenomenex) 5µ, 300A C18, 10 cm x 0.075 mm internal diameter. Peptides were eluted with a linear gradient from 2-50% solvent B (acetonitrile, 0.1% formic acid) in 30 minutes, at 200 nL/min (obtained by flow-splitting). Mass spectra were acquired using a data dependent acquisition mode with Xcalibur software version 2.0. Each full scan mass spectrum (400 to 2000 m/z) was followed by collision-induced dissociation of the seven most intense ions. The dynamic exclusion (30 sec exclusion duration) function was enabled, and the relative collisional fragmentation energy was set to 35%. All MS/MS samples were analyzed using Mascot (Matrix Science, London, UK; version 2.3.0)). Mascot was searched with a fragment ion mass tolerance of 0.50 Da and a parent ion tolerance of 2.0 Da. Iodoacetamide derivative of cysteine was specified as a fixed modification and oxidation of methionine was specified as a variable modification. Two missed cleavages were allowed. Scaffold (version 4) (Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95 % probability as specified by the Peptide Prophet algorithm (Keller, Nesvizhskii, Kolker, & Aebersold, 2002). Protein probabilities were assigned by the Protein Prophet algorithm (Nesvizhskii, Keller, Kolker, & Aebersold, 2003).

2.5.3. Western Blots

Protein extracts for Western blot analyses were concentrated from culture media using a Centricon Ultracel YM-10 column (EMD Millipore, Darmstadt, Germany). Western blots were conducted as described (K. Larouche et al., 2000) using the following primary antibodies: a mouse polyclonal antibody against MMP1 (1:5000; Thermo Fisher Scientific Inc., Rockford, IL, USA) or rabbit polyclonal antibodies against MMP2 (1:10000; Thermo Fisher Scientific Inc.), MMP3 (1:3000; Thermo Fisher Scientific Inc.), MMP9 (1:1000; Abcam, Toronto, ON, Canada), MMP10 (1:3000; Thermo Fisher Scientific Inc.), MMP11 (1:5000; Thermo Fisher Scientific Inc.), MMP13 (1:5000; Thermo Fisher Scientific Inc.), Sp1 (1:2000; Santa Cruz Biotechnology, Dallas, Texas, USA), c-Fos (1:2000; Santa Cruz), c-Jun (1:2000; Santa Cruz), JunB (1:2000; Santa Cruz) and actin (1:40000; Santa Cruz) as well as a peroxidase-conjugated AffiniPure Goat secondary antibody against either mouse or rabbit IgG (1:1000 dilution; Jackson ImmunoResearch Laboratories, Baltimore, PA, USA). The labeling was revealed using a Detection Kit (Amersham, Baie d’Urfé, Canada) as described (Gaudreault et al., 2007; Gingras et al., 2003). Whenever possible, expression of both the inactive

58

(pro-enzyme) and active MMPs was examined throughout wound closure (which depended on whether antibodies could detect both the active and inactive MMPs or just the inactive one).

2.5.4. Gene expression profiling

The epithelial cells from biopsy punch-wounded tissue-engineered corneas were isolated from three different areas after 4-days of culture at the air-liquid interface: i) a central area of 8 mm in diameter (wounded) that contains the neoepithelium, ii) the internal (unwounded) ring, that includes tissue surrounding the wounded central area and contained between diameter 8 to 14 mm of the tissue-engineered cornea, and iii) the external ring, an area that surrounds the unwounded internal ring from diameter 14 to 19 mm (Figure 2A). As negative controls, cells were also isolated from the same three areas of unwounded tissue-engineered corneas. Total RNA was then prepared from the material isolated from the central, internal or external rings using the RNeasy Mini Kit (QIAGEN, Toronto, ON, CA). It is important to point out that because corneal fibroblasts are less abundant (36,2 +/- 1,0%) than epithelial cells (63,9 +/- 0,9%) are in the reconstructed tissue, and that they are trapped in the stromal collagen matrix and not mitotically active, they will not significantly contribute to the total RNAs isolated as nearly all of it will originate from the epithelial cells. RNAs were also isolated from HCECs grown to 100% confluence on 2% BSA, on individual ECM components (collagens type I (CI) and IV (CIV), FN, tenascin (TN) and laminin (LM)) or on tissue-reconstructed stromas depleted (by treating them with 0.5 % deoxycholate; stroma-) or not (stroma+) of their corneal fibroblasts. Quantity and quality of all preparation of total RNA was assessed using an Agilent Technologies 2100 bioanalyzer and RNA 6000 Nano LabChip kit (Agilent Technologies, Mississauga, ON, Canada). Biological replicates were as follow: for the wound healing experiment conducted on the tissue-engineered corneas made-up of a stroma with a complete, stratified epithelium, total RNA was obtained from 3 different reconstructed corneas produced using HCECs cultured from 3 different donors (44-, 52- and 71-year old); for the monolayer experiment on BSA, total RNA was obtained from 5 different preparations of HCECs cultured from 3 different donors (44-, 52- and 71-year old); for the stroma- condition, total RNA was isolated from 3 preparations of HCECs cultured from 3 different donors (44-, 52- and 71-year old); for the stroma+ condition, total RNA was isolated from 2 preparations of HCECs cultured from 2 different donors (44- and 52-year old). For the monolayer experiments on CI, CIV, LM, FN and TN, total RNA was obtained from 5 different preparations of HCECs cultured from 3 different donors (44-, 52- and 71-year old). Cyanine 3-CTP labeled cRNA

59

targets were prepared from 50 ng of total RNA, using the Agilent One-Color Microarray-Based Gene Expression Analysis kit (Agilent Technologies). Then, 600 ng cRNA was incubated on a G4851A SurePrint G3 Human GE 8x60K array slide (60 000 probes, Agilent Technologies). Slides were then hybridized (Agilent protocol), washed and scanned on an Agilent SureScan Scanner according to the manufacturer’s instructions. Data were finally analyzed using the ArrayStar V12 (DNASTAR, Madison, WI, USA) software for scatter plots and generation of the heat maps of selected genes of interest. All data generated from the arrays were also analyzed by RMA (‘Robust Multiarray Analysis’) for background correction of the raw values. They were then transformed in Log2 base and quantile normalized before a linear model was fitted to the normalized data to obtain an expression measure for each probe set on each array. All microarray data presented in this study comply with the Minimum Information About a Microarray Experiment (MIAME) requirements. The gene expression data have been deposited in NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number (GSE #75336).

2.5.5. Gelatin zymography

The zymographic analyses were conducted as previously described (Beliveau, Berube, Rousseau, Pelletier, & Guerin, 2000) using samples from the culture media of confluent HCECs that have been grown either on BSA or on various individual ECM components (CI and CIV, FN, TN and LM). MMP2 and MMP9 activity was also monitored in the culture medium of wounded tissue engineered human corneas. Medium samples were harvested at the moment the two-layers corneas were wounded (day 0) and then sequentially at every 24 hours until 4 days of wound closure (days 1 to 4). Reconstructed corneas were changed cultured medium every 24 hours (and also 24 h prior to wounding) to prevent enzyme accumulation.

2.5.6. Quantitative PCR (qPCR)

Some of the total RNAs prepared for microarray analyses were also used for qPCR analyses. Reverse transcription was performed using random hexamer primers following the manufacturer’s protocol for synthesis of the first strand cDNA (High Capacity cDNA Reverse Transcription Kit; Applied Biosystem, Foster City, CA, USA). Equal amounts of cDNA were run in quadruplicate and

60

amplified in a 20 μl reaction containing 10 μl of 2X Brillant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies), 250 nM of upstream and downstream primers, and 10 ng of cDNA target. No-template controls were also used as recommended. The mixture was incubated at 95°C for 3 min, and then cycled at 95°C for 10 sec and at 60°C for 20 sec 35 times using the QIAGEN Rotor-Gene Q real-time cycler. Amplification efficiencies were validated and normalized either to the actin or GAPDH mRNA transcript (as specified in the figure’s legends) and quantity of target genes were calculated according to a standard curve. Primers were designed using Primer3 (v.0.4.0) and are listed in Supplementary Table 1.

2.5.7. Statistical analyses

One-way ANOVA (figures 3 and 6) or Student’s t-test (figure 5) was performed for comparison of the groups in qPCR analyses (Prism 6.0; GraphPad Software, La Jolla, CA). Differences were considered to be statistically significant at P < 0.05. All data are also expressed as mean ± SD.

2.6. Results

2.6.1. Analysis of corneal wound healing in tissue-engineered human corneas

We first evaluated the feasibility of using tissue-engineered human corneas as a model for studying the molecular mechanisms of partial thickness wound healing of the anterior cornea in an environment close to the in vivo condition. As shown on Figure 1B, macroscopic observation of wound closure in tissue-engineered, two-layers human corneas wounded using a punch biopsy revealed that migration of the corneal epithelium was unequal in each of the three independent wounded corneas. Indeed, multiple convex leading fronts from different regions of the surrounding intact epithelium advanced toward the center (Figure 1B). These migrating fronts developed within 12 to 24 hours after wounding and continued to advance for the period studied (96 hours). Only between 6 to 10% of the wounded areas was remaining at 4 days (Figure 1B, subpanels D, H and L) and all wounds were completely closed at 5 days (results not presented). The neoepithelium was clearly

61

visible 3 days after wounding (Figure 1C). Furthermore, the epithelium was stratified and similar to the normal corneal structure near the wound margin and in the middle of the neoepithelium. Therefore, the well-differentiated epithelium from the tissue-engineered corneas produced using the self-assembly approach appropriately responded to injury and demonstrated the validity of using this substitute as a model to study further the mechanisms of wound healing.

2.6.2.The gene expression pattern is altered by wound healing in the tissue-engineered human cornea

We next wounded tissue-engineered corneas and conducted gene profiling analysis on microarrays using total RNAs isolated from the epithelial cells of three different areas (central, internal and external areas) from our reconstructed tissues after 4-days of culture under air-liquid condition. A scatter plot analysis of the 60 000 different transcripts contained on the arrays indicated clearly that HCECs from the central area of wounded corneas have patterns of expressed genes distinctive from those yielded by HCECs from unwounded corneas as revealed by the dispersion of the normalized signals that appear as a cloud of dots on Figure 2B (left panel) and the slope of the regression curve (R2 = 0,9316). However, as we move away from the wounded central area toward both the internal and external rings, the number of deregulated genes progressively decreases, as is also revealed by the change in the slope of the regression curve (R2 = 0.9362 and 0.9417, respectively). Comparison of internal and external transcriptional profiles revealed a more modest global change in the patterns of genes expressed by these cells (R2=0.9726; Figure 2B, right panel).

A heatmap for all the genes showing a 2-fold or more expression variation unique to HCECs from the central, internal and external areas of wounded corneas paired with their corresponding regions in the unwounded cornea was then generated (Figure 2C). A total of 2754 genes fitted into that category of differentially regulated genes when HCECs from the central area are compared between wounded and unwounded corneas (condition A in Figure 2C and 2D). The number of total genes deregulated by more than 2-fold decreased to 2626 and 2283 when the microarray data from the internal and external areas, respectively, are compared between the wounded and unwounded tissue-engineered corneas (conditions B and C, respectively, in Figure 2C and 2D).

We next examined the data files from the microarrays to sort out genes whose expression is the most deregulated in HCECs from the central, internal and external areas of the wounded corneas relative

62

to their unwounded substitutes. The 55 most deregulated genes were ordered according to their variation during wound healing and arbitrarily named class I, II and III. As shown on Figure 2E, expression of the genes identified as class I was dramatically reduced in the central wound and remained low as we move away from the wounded area in both the internal and external rings. On the other hand, genes from class II seek their expression strongly increased in the central wound but tend to return to the level of the unwounded control as we move away from the central area. Genes from class III are heavily down-regulated in the central wound and also tend to return to their normal level in the unwounded control as we move away from the central area.

2.6.3. Epithelial cells respond to corneal damage by altering the expression of MMPs

As both metalloproteinases MMP9 and MMP10 were among the 55 genes identified as the most deregulated in the central area of wounded, tissue-engineered corneas (Figure 2E) we examined whether other MMP genes had their expression altered during wound healing by searching into the microarray data files. As shown on Figure 3A, five additional MMPs (MMP1, MMP2, MMP3, MMP11 and MMP13), besides MMP9 and MMP10, also had their expression considerably increased in the central area of wounded, reconstructed corneas. Remarkably, expression of all of them rapidly decreases as we move away from the central wound (in both the internal and external rings). As the activity of MMPs is dependent on the TIMPs, we also monitored their expression during wound healing of the tissue-engineered corneas. Of the four TIMPs, only TIMP3 had its expression considerably increased in the central wound (Figure 3A). With the only exception of MMP11, the increased MMPs expression observed in microarray were also validated by qPCR (Figure 3B). Detection of MMP11 in our microarray data files is, however, consistent with previous analysis that observed expression of that gene in corneal epithelial cells (Li et al., 2003).

We then examined whether the alterations observed in microarray for the expression of MMPs may

have resulted from corresponding changes in the expression of interleukins and TGF-β in the central

area of wounded corneas as these diffusible compounds are well documented to influence on MMPs expression through alterations in the expression and/or activity of the transcription factors Sp1 and AP-1. Indeed, dramatic increases in the central area that progressively decrease as we move away

from the wounded area could be observed by microarrays for IL-1α, IL-1β, IL-6, IL-11 and both TGF-

63

β1 and TGF-β3 expression (Figure 3C). Interestingly, expression of the gene encoding Sp1 was

lower in the central area than in the periphery of the wounds whereas that of the AP-1 constituting subunit c-Jun was considerably higher in the central wounded area (Figure 3D). Both these results (decreased Sp1 and increased AP-1 expression) were further confirmed by qPCR (Figure 3E). The reduced expression of the Sp1 transcript in the central wound also translated into a corresponding reduction of the Sp1 protein relative to the level observed into both the internal and external rings (Figure 3F). Meanwhile, Western blot analyses revealed that expression of the AP-1 subunits c-Fos, c-Jun and JunB was higher in both the central and internal areas than in the external ring of wounded corneas (Figure 3F), a result somehow consistent with both the microarray and qPCR data.

As we identified many MMPs whose expression is deregulated during wound healing of two-layers tissue-engineered corneas, we next monitored their secretion into the culture medium by Western blot during wound closure over a four-day period. All of the MMPs whose transcription was demonstrated to be deregulated in the central area of wounded corneas by microarray (MMP1, MMP2, MMP3, MMP9, MMP10, MMP11 and MMP13; Figure 3) were also expressed at the protein level prior to wounding although both MMP3 and MMP11 were very low (day 0; Figure 4A). Interestingly, the amount of inactive pro-MMP1 progressively diminished with increasing wound closure time whereas that of active MMP1 increased, as is revealed by the decrease in the pro-/active MMP ratio. Similar results were also observed with MMP11. No significant change was observed in the pro-/active MMP2 ratio, which is consistent with the modest 2-fold increase observed in the MMP2 enzymatic activity (Figure 4B). Interestingly, the amount of secreted pro-MMP9 progressively diminished as wound closure was progressing suggesting that pro-MMP9 was converted into the active form of the enzyme as wound closure proceeds. This is indeed consistent with the increased enzymatic activity observed in gel zymography for MMP9 in the culture medium of wounded reconstructed cornea (9-fold increase in gelatinolytic activity at day-4 relative to day-0; Figure 4B). As for MMP9, our antibodies against MMP3 and MMP13 could only recognize the inactive pro-enzyme. Expression of pro-MMP3 increased at 1-day post-wounding but remained constant until 4-day wound closure. Interestingly, basal expression of the MMP1, MMP3, MMP10, MMP11 and MMP13 pro-enzymes increased within 24 h and then progressively decreased (for MMP1, MMP10 and MMP11) as wounds were closing.

64

2.6.4. Deregulated expression of MMPs by HCECs depends on the presence of stromal fibroblasts

We next wished to determine which of the fibroblasts or the ECM they secrete contributes the most to the change in the expression of MMPs secreted by HCECs during wound healing. As shown on Figure 5A, culturing HCECs on the stromal matrix depleted of its fibroblasts (ECM influence alone) resulted in a significant increase in the expression of many MMPs (MMP1, MMP7, MMP9, MMP10, MMP14, MMP15, MMP17 and MMP23B) relative to the pattern seen when HCECs are grown solely on BSA. These results were validated further for both MMP9 and MMP10 (which are also the most deregulated) by qPCR (Figure 5B) and gel zymography (for both MMP2 and MMP9 Figure 5C). In addition, TIMP3 gene expression was also substantially increased in HCECs by the devitalized stroma. Remarkably, preserving the stromal fibroblasts within the tissue-engineered stroma (stroma+) dramatically increased expression of MMPs (MMP2, MMP3, MMP12, MMP13 and MMP24) that otherwise did not responded to the tissue-engineered ECM alone (stroma-). On the other hand, expression of MMP1, MMP10 and MMP14 (and also that of TIMP2) was primarily dictated by the interaction of HCECs with the secreted ECM as no further increase was observed when living fibroblasts were maintained in the stroma. Interestingly, expression of the MMP7 gene (as well as that of TIMP3), which was considerably stimulated by the ECM alone, increased further when living fibroblasts were present in the stroma suggesting that its transcription responds to both the ECM and the diffusible factors secreted by fibroblasts.

As the ECM is a complex structure made up of different cell-adhesion components, we next evaluated whether individual ECM components might have accounted for the increased expression of the MMPs (for instance MMP1, MMP7, MMP9, MMP10, MMP14, MMP15, MMP17 and MMP23B) in response to the devitalized ECM. As illustrated on Figure 6A, MMP1 expression was considerably increased by CI but was strongly repressed by FN and TN. No increased expression was observed for MMP7 whose transcription was, however, repressed by both CIV and FN. Expression of MMP10 was also increased by CI but dramatically repressed by TN. No significant variation in the expression MMP14, MMP15, MMP17 and MMP23B was observed besides a weak decrease on LM for both MMP15 and MMP17. Interestingly, MMP9 expression was substantially increased by both CI and LM but repressed by TN, a result that was also confirmed by qPCR (Figure 6B). However, these ECM component-dependent influences on the transcriptional activity of the MMP9 gene (activation by CI

65

and LM and repression by TN) did not translate into corresponding alterations in the MMP9 enzymatic activity (Figure 6C) or in the amount of MMP9 protein (Figure 6D) despite an increase in the proMMP9/active MMP9 ratio when HCECs are grown on FN and TN (0.80 and 1.06 for FN and TN, respectively, compared to 0.20 on BSA). A substantial increase in the proMMP2/active MMP2 ratio was observed when HCECs are grown on TN (3.68 on TN compared to 1.81 on BSA; Figure 6D) that also translated into a near 2-fold reduction in the MMP2 enzymatic activity on TN (Figure 6C). As with TN, LM also increased the proMMP2/active MMP2 ratio (3.58 on TN compared to 1.81 on BSA). In agreement with the results presented on Figure 5A, MMPs whose expression responded only to the presence of living stromal fibroblasts (MMP2, MMP3, MMP12, MMP13 and MMP24) were also unaffected by any of the individual ECM components on which HCECs were grown.

2.6.5. The composition of the stromal ECM is under the influence of HCECs

We next exploited mass spectrometry to determine the precise protein composition of the ECM produced by stromal fibroblasts and determined whether the presence of HCECs contributes to the final organization of this matrix. Examination of the tissue-engineered stroma that has not been added HCECs (stroma/HCEC-) revealed that it is rich in collagen types VI and XII with moderate levels of collagen types I and XIV (Figure 7A). All together, collagens corresponded to 56% of all ECM peptides detected in the tissue-engineered stromas (average collagen peptides counts: 361; average total ECM peptides: 641; Figure 7A and Table 1). Furthermore, FN, TN (that totalize 16% of the ECM components), periostin, fibulins and fibrillins are the predominant glycoproteins present in the stroma/HCEC- (Figure 7B and Table 1) whereas low levels of the proteoglycans biglycan, lumican, versican, mimecan, fibromodulin and decorin (that altogether totalized 9% of the average total ECM peptides) could also be detected (Figure 7C and Table 1). Addition of HCECs had little impact on the stromal accumulation of proteoglycans (11% with stroma/HCEC+ compared to 9% with stroma/HCEC- of the average total ECM peptides), besides the detection of low levels of both perlecan and glypican in the stroma/HCEC+ condition that otherwise were totally absent from the stroma/HCEC- condition (Figure 7C). However, the presence of HCECs caused significant changes in the combination of collagens that were secreted into the stromal ECM. Indeed, the amount of collagen types -VI, -XII and XIV was considerably decreased in the stroma/HCEC+ condition whereas that of types II, III, IV, V, VII, XVII and XVIII, most of which could not be detected in stroma/HCEC-, can now be detected at low levels in stroma/HCEC+ (Figure 7A). However, the overall proportion of

66

collagens remained the same whether or not HCECs are present in the tissue-engineered substitutes (55% with stroma/HCEC+ compared to 56% with stroma/HCEC- of the average total ECM peptides; Table 1). Appearance of laminins, increased levels of TN and the complete disappearance of fibrillin, along with a substantial reduction in FN, periostin and fibulins are the most noticeable features occurring in the glycoproteins composition of the stroma/HCEC+. Again, despite the change in the composition of the glycoproteins when HCECs are present, their overall proportion remained the same between both conditions (34% of the average total ECM peptides for both the stroma/HCEC+

and stroma/HCEC- conditions; Table 1).

2.7. Discussion Wound healing is a well-ordered but complex process involving activities such as cell migration and proliferation. Migration of corneal epithelial cells requires the coordinated expression of growth factors and cytokines (Imanishi et al., 2000a; O'Kane & Ferguson, 1997; Philipp, Riedel, Sauerbier, Hormann, & Germann, 2004; Saika, 2004; Santoro & Gaudino, 2005). During cell migration, the epithelial cells (and to some extent, the stromal fibroblasts as well) in turn regulate the expression of both extracellular matrix (ECM) proteins and matrix metalloproteinases (MMPs) that are required to ensure appropriate remodeling of the ECM during the wound healing process (Lu, Reinach, & Kao, 2001; Philipp et al., 2004; Santoro & Gaudino, 2005). The very fast but transitory changes occurring in the composition of the ECM on which corneal epithelial cells migrate in order to cover the damaged corneal area are probably the most important characteristic of corneal wound healing. These rapid modifications in the ECM composition are in part ensured by the enzymatic activities of MMPs whose expression and activity change as wound healing is progressing. We previously demonstrated that tissue-engineered, complex ECMs could be used as biomaterials in order to study the expression of integrin genes as well as other genes that might play a pivotal function during the corneal repair process (J. Lake et al., 2013). In the present study, we used the two layer tissue-engineered human cornea, a substitute that is much closer to the native cornea as it is constituted of a stroma and a stratified epithelium made up of 5 to 7 layers of epithelial cells, as a model system to study the contribution of MMPs to the healing of partial thickness wounds of the anterior cornea. We did not include an endothelial layer in our reconstructed cornea since the endothelium is part of the posterior cornea. It could be interesting in the future to evaluate the effect of the endothelium on wound healing since dramatic changes in the organization and quality of the corneal BM have been reported when

67

immortalized mouse corneal endothelial cells are present in the three-dimensional corneal tissue (Zieske et al., 1994b). However, we have shown a few years ago, that endothelial cells had no influence on the composition and organization of the BM in our model (S. Proulx et al., 2010b). This apparent discrepancy can be explained, at least in part, by the differences between the 2 models: i) a combination of rabbit and mouse rather than human corneal cells were used and ii) rabbit corneal epithelial and stromal fibroblast cells were embedded into a collagen matrix rather than exploiting the matrix naturally secreted by the human stromal fibroblasts, as is the case in our reconstructed corneal tissues. Corneal models have also been produced with other cell types such as umbilical stem cells (Garzon et al., 2014). It would prove interesting to use these models to evaluate the impact of a different stroma on corneal healing.

Wound healing of the injured cornea would not be possible without significant alterations in the pattern of genes expressed by the epithelial cells bordering the damaged area. Although the most dramatic change in the transcriptional pattern of deregulated genes occurs in the central wounded area (a total of 2754 genes), yet more than 2200 genes expressed by HCECs from the external ring have become deregulated by at least a 2-fold factor (1256 are commonly deregulated in both the central and external rings) despite that these cells were located far from the wounded area. Interestingly, of all these genes, 1098 were found to be deregulated in all three areas from the wounded corneas relative to their counterpart in the unwounded corneas (Figure 2D), a clear indication that wound healing is still going on four days after wounding. These particularly interesting results suggest that the intact cells bordering the damaged area somehow transmit signals (diffusible or through cell-cell contacts) that move from cell to cell, like a wave effect, all over the intact section of the tissue-engineered cornea. In a recent study by Gao et al. (Gao et al., 2013), a similar signal wave was reported to occur upon scratch injury of primary cultured cerebral cortical astrocytes. This remarkable process was demonstrated to be caused by a calcium influx from the extracellular compartment, initially triggered by the scratch wound, that is then transmitted through gap junctions to the surrounding intact cells. One of the consequences of the sudden calcium influx is the activation of the JNK/c-Jun/AP-1 pathway. Interestingly, in the present study, transcription of the c-Jun subunit encoding gene was shown to be significantly increased in the central wound (average linear signal (ALS): 548.7) and returned to the control level in the external ring (ALS: 208.9; Figure 3 and Supplementary Table 2). Although scratch injury is well recognized as a model to study corneal wound healing, yet our study is the first to report the existence of such a signal wave and to examine

68

its influence on global gene expression in a tissue-engineered, human corneal model. Alternatively, the differential gene regulatory effects we observed between the central and external areas of wounded corneas may also have resulted from cytokines and/or growth factors released in the culture media by the cells from the central wound. However, we believe this is highly improbable due to the fact that the reconstructed two-layers corneas were cultured at the air-liquid interface prior to wounding and that no culture medium was therefore present over the entire stratified corneal epithelium during wound closure, the reconstructed tissues being supplemented from their stromal compartment. Therefore, the ‘signal wave’ as detailed above remains a sounded possibility to explain our results.

The 55 most deregulated genes in the wounded corneas were organized into different classes (I, II and III) depending on how their expression evolves between the central, internal and external areas. Those from class I, such as VCAM1 and PAMR1, have their expression dramatically reduced in the central wound and remained low as we move away from the wounded area and never returned to their non-injured level. On the other hand, those that belong to what we defined as class II were strongly expressed in the central wound but tended to return to the level of the unwounded control as

we moved away from the central area. Both MMP9 and MMP10 as well as the laminin α3 (LAMA3)

and γ2 (LAMC2) genes belong to that category. Finally, those identified as class III genes suddenly

became repressed in the central wound but as with the class II genes, they then tended to return to their normal control, unwounded level as we move away from the central area. No particular feature emerged from the analysis of the class I gene function. On the other hand, examination of the class II genes revealed that five of them (LAMA5, LAMC2, MMP9, MMP2 and MMP10) encodes proteins that may contribute either to the composition or the remodeling of the ECM. In addition, three genes (LCE3D, SPRR2B and SPRR2D) encodes proteins that are predominantly expressed in epithelial cells. Finally, two genes from class III (CDH2 and CRTAC1) encodes proteins that participate to cell adhesion (also refer to Supplementary Table 2 for more details).

Gene profiling analysis conducted on our two-layers tissue-engineered corneas revealed often dramatic increases in the expression of the metalloproteinases-encoding genes MMP1, MMP2, MMP3, MMP9, MMP10, MMP11 and MMP13 in the central area of wounded, tissue-engineered corneal tissues, which is very similar to the pattern reported recently by Gordon et al. in a mouse corneal model of epithelial resurfacing (Gordon et al., 2011). MMP-9 is well known to be the primary

69

MMP synthesized and secreted by basal corneal epithelial cells that migrate to cover the wound (M. E. Fini, Girard, Matsubara, & Bartlett, 1995; Matsubara, Girard, et al., 1991). During rat corneal wound healing, expression of MMP1, MMP3, MMP7, MMP9 and MMP12 was also reported to increase in corneal epithelial cells (Lyu & Joo, 2005b). Meanwhile, wound repair after keratectomy is also characterized by increased expression of MMP1, MMP2, MMP3 and MMP9 in the rabbit and rat corneas (Mulholland et al., 2005). MMP13, along with MMP1 and MMP8, are collagenases capable of degrading native fibrillar collagens (type I, II, and III collagens). Lacking in normal control corneas, MMP13 mRNA has, however, been detected in the epithelial cells of wounded rat corneas (H. Q. Ye, Maeda, Yu, & Azar, 2000) whereas MMP10 was shown to be overexpressed in the diabetic corneal epithelium (Saghizadeh et al., 2001). In addition, expression of MMP3, MMP10 and MMP11, which

could be detected in normal corneal epithelial cells, increases upon exposure to IL-1β and TNF-α (Li

et al., 2003). The pattern of MMPs expressed in our healing, partial thickness tissue-engineered corneas is therefore consistent with the metalloproteinase activities observed in various corneal pathologies that require migration or replacement of the epithelial cells.

In our biomaterial model, the presence of stromal fibroblasts clearly impacted on the MMPs secreted by HCECs (in the stroma+ condition) as they often triggered dramatic increases in the expression of MMP2, MMP3, MMP12, MMP13 and MMP24 that otherwise did not respond to the tissue-engineered ECM depleted of its fibroblasts (in the stroma- condition). It is also interesting to point out that the pattern of MMPs expressed by HCECs grown on the fibroblasts-containing stroma (Stroma+; Figure 5A) is virtually identical to that seen in the central area of wounded partial thickness tissue-engineered corneas (Central; Figure 3A) thereby suggesting that both the fibroblasts and the matrix they secrete are required to allow the expression of the appropriate combination of MMPs during corneal wound healing. This result clearly suggests that stromal fibroblasts do produce diffusible factors that then trigger HCECs to increase the transcription of these MMP genes as well as that of other genes whose encoded products are required for wound healing, such as integrins and ECM component encoding genes (J. Lake et al., 2013). Indeed, MMPs expression in the cornea has been

shown to be modulated by cytokines (such as IL-1β and IL-6 (Ko, Chikama, Sonoda, & Kiuchi, 2012;

H. C. Tseng et al., 2013)) and growth factors (such as TGF-β (Girard, Matsubara, & Fini, 1991; H. S.

Kim, Shang, Chen, Pflugfelder, & Li, 2004)) through alteration in the expression and/or properties of a few transcription factors such as AP-1 (H. C. Tseng et al., 2013) and Sp1 (Reddy et al., 2010). The requirement for soluble factors secreted by living stromal fibroblasts is in agreement with our previous

70

observation that corneal fibroblasts contribute to the differentiation and stratification properties of HCECs (P. Carrier et al., 2009). Consistent with the above studies, we also identified IL-6 as one such soluble factor (P. Carrier et al., 2009). Transcription of the IL-6 encoding gene was also found to increase considerably in the central wound of our partial thickness tissue-engineered corneas relative to both the internal and external rings (ALS: 576.8, 165.0 and 184.0 for central, internal and external areas, respectively). Interestingly, expression of MMP1, MMP3, MMP10, MMP11 and MMP13 has

been reported to be dose dependently upregulated by IL-1β and TNF-α in corneal epithelial cells

(Li et al., 2003), which is also consistent with the dramatic increase in the expression of IL-1β (ALS:

316.2, 50.8 and 10.7 for central, internal and external areas, respectively) and TNF-α (ALS: 69.3,

13.9 and 16.4 for central, internal and external areas, respectively) we observed in the central area of wounded tissue-engineered corneas (Figure 3 and Supplementary Table 2). Meanwhile, Kim et al.

demonstrated clearly that TGF-β1 exerts a positive regulatory influence on the expression and

production of gelatinase (MMP9), collagenases (MMP1, MMP13) and stromelysins (MMP3, MMP10,

MMP11) in HCECs cultured in monolayers and suggested that TGF-β1 may play a role in the

pathogenesis of MMP mediated ocular surface diseases, such as sterile corneal ulceration (H. S. Kim et al., 2004). This may explain at least in part the dramatic increase in the expression of MMP1, MMP2, MMP3, MMP9, MMP10, MMP11 and MMP13 that we observed in the wounded tissues of our

two-layers tissue-engineered corneas as increases in the expression of both TGF-β1 (ALS: 312.6,

212.1 and 171.8 for central, internal and external areas, respectively) and TGF-β3 (ALS: 537.6, 90.3

and 68.2 for central, internal and external areas, respectively) were also observed in the central wounds relative to the controls (Figure 3C and Supplementary Table 2).

One particularly unique aspect of our study is the demonstration that HCECs are required, together with stromal fibroblasts, to secrete and organize an ECM that is very close to that seen in the native cornea. This may depend in part from the inability of stromal fibroblasts to organize a typical BM without interactions with epithelial cells. The epithelial cells from the two-layers tissue-engineered human cornea were demonstrated to secrete and organize such a typical BM (P. Carrier et al., 2008; L. Germain et al., 1999a; L. Germain et al., 2000) although its precise composition had never been precisely determined before. In the native cornea, the BM on which epithelial cells attach is enriched in various types of collagens (IV, VII, XII, XVII, XVIII), laminins (LM-111, LM-332, LM-311, LM-411, LM-511), nidogen, perlecan and small amounts of FN (Kabosova et al., 2007; Ljubimov et al., 1995;

71

Martin & Timpl, 1987; Michelacci, 2003; Nakayasu, Tanaka, Konomi, & Hayashi, 1986; Torricelli et al., 2015; Torricelli et al., 2013; Tuori, Uusitalo, Burgeson, Terttunen, & Virtanen, 1996). With the exception of CXII and FN, none of these BM components could be detected in the tissue-engineered

stroma that has not been added HCECs (stroma/HCEC-). On the other hand, they all could be

detected, although at low levels, when a corneal epithelial layer was present (stroma/HCEC+), a clear

indication that organization of the corneal BM do require the presence of a corneal epithelial layer.

The very low level of CIV in the stroma/HCEC+ tissue-engineered corneas, which is normally present

in the corneal BM and the Descemet’s membrane but absent from the corneal stroma (Schlotzer-Schrehardt et al., 2015), may be accounted for by the lack of maturity of the BM beneath the stratified epithelium as a result of a rather short culture period (7 days) at the air-liquid interface. Reduced levels of CIV (as well as that of other collagen types) may also have resulted from the fact that it is a substrate of many MMPs, including MMP9 and MMP10, whose expression is dramatically increased during wound healing. Unlike for the BM components, all those from the corneal stroma, which comprise collagen types I, III, V, VI, XII, XIV, and various proteoglycans (decorin, lumican and mimecan) can be observed in the stroma of our tissue-engineered corneas in the absence of an

epithelial layer (stroma/HCEC-) (Meek & Fullwood, 2001a; Michelacci, 2003; Newsome, Gross, &

Hassell, 1982; Robert, Legeais, Robert, & Renard, 2001). These results are also consistent with those reported in a recent study by Gendron and Rochette (Gendron & Rochette, 2015) who used tissue-engineered human corneal stromas in order to examine the change in the ECM composition upon exposure of the tissue-engineered stromas to UV light. Finally, the Bowman’s membrane has been shown to contain collagen types I, III, IV, V, VI, VII and XII (of which both CIV and CVII were thought to come from the corneal BM) (Jacobsen, Jensen, & Prause, 1984; G. E. Marshall, A. G. Konstas, & W. R. Lee, 1991a, 1991b; Nakayasu et al., 1986), all of which could be detected in the

matrix from the tissue-engineered corneas grown with an epithelial layer (stroma/HCEC+).

Our results suggest that expression of LM, glypican and perlecan in the stromal and basal ECM matrix is dependent on the presence of HCECs. Laminins are normal constituents of the corneal BM and have been shown to be secreted by the basal cells (primarily LM-5) from the corneal epithelium and also suggested to be produced (for LM-10) by stromal fibroblasts (Filenius et al., 2001). Deregulated expression of glypican has been shown to be associated with wound healing of the

72

mouse cornea (Saravanan, Cao, Head, & Panjwani, 2010). Interestingly, perlecan, an heparin sulfate proteoglycan that cross-links many components from the ECM and cell surface molecules, is a constituent of the normal, unwounded corneal BM (Torricelli et al., 2015).

When tested individually, some of the ECM components clearly altered the pattern of MMP genes expressed by HCECs when grown as a monolayer. This was particularly noticeable for both MMP1 and MMP9. Indeed, whereas CI influenced positively the expression of both MMP1 and MMP9, TN, on the other hand, severely repressed their transcription (as well as that of MMP10). In addition, LM also increased expression of MMP9, which is consistent with the observation that silencing expression of LM alpha-4 chain also decreased MMP9 expression in extravillous explants and HTR8/SVneo cells (Shan et al., 2015). Furthermore, cells from human oral squamous cell carcinoma (OSCC), adenoid cystic carcinoma (CAC2) and myoepithelioma (M1) exposed to the LM alpha1 chain peptide AG73 also had increased MMP9 activity (Gama-de-Souza et al., 2008; Siqueira, Gama-de-Souza, Arnaud, Pinheiro, & Jaeger, 2010). Therefore, LM has obviously a positive influence on the expression of the MMP9 gene. However, the true significance of these alterations in the expression of MMPs by individual ECM components at the transcriptional level remains elusive as no corresponding changes were observed in the expression and enzymatic activity of these enzymes at the protein level.

2.8. Conclusion In this study, we demonstrated that the two-layers tissue-engineered human cornea used as a biomaterial substitute is an outstanding model to study the expression of MMP genes, as well as that of other genes, that play pivotal functions in the remodeling of the ECM during corneal wound healing. Altering expression of these ECM remodeling enzymes in the tissue-engineered cornea with the aim of improving the dynamic of wound closure should prove a safe and practical procedure and a prerequisite to the use of animal models.

2.9. Acknowledgments This study was supported by a grant from the ‘Canadian Institutes of Health Research’ (CIHR) to L.G., S.L.G and François A. Auger. The Banque d’yeux Nationale is partly supported by the Réseau de Recherche en Santé de la Vision from the ‘Fonds de Recherche du Québec-Santé’ (FRQS). C.C.

73

was supported by a studentship from the FRQS. L.G. is the recipient of a Tier 1 Canadian Research Chair on Stem Cell and Tissue Engineering.

74

2.10. References [1] Agrawal VB, Tsai RJ. Corneal epithelial wound healing. Indian journal of ophthalmology. 2003;51:5-15.

[2] Taliana L, Evans MD, Dimitrijevich SD, Steele JG. Vitronectin or fibronectin is required for corneal fibroblast-seeded collagen gel contraction. Invest Ophthalmol Vis Sci. 2000;41:103-9.

[3] Whitcher JP, Srinivasan M, Upadhyay MP. Corneal blindness: a global perspective. Bulletin of the World Health Organization. 2001;79:214-21.

[4] Woreta FA, Davis GW, Bower KS. LASIK and surface ablation in corneal dystrophies. Survey of ophthalmology. 2015;60:115-22.

[5] Brazzell RK, Stern ME, Aquavella JV, Beuerman RW, Baird L. Human recombinant epidermal growth factor in experimental corneal wound healing. Invest Ophthalmol Vis Sci. 1991;32:336-40.

[6] Burling K, Seguin MA, Marsh P, Brinkman K, Madigan J, Thurmond M, et al. Effect of topical administration of epidermal growth factor on healing of corneal epithelial defects in horses. American journal of veterinary research. 2000;61:1150-5.

[7] Grant MB, Khaw PT, Schultz GS, Adams JL, Shimizu RW. Effects of epidermal growth factor, fibroblast growth factor, and transforming growth factor-beta on corneal cell chemotaxis. Invest Ophthalmol Vis Sci. 1992;33:3292-301.

[8] Kim MJ, Jun RM, Kim WK, Hann HJ, Chong YH, Park HY, et al. Optimal concentration of human epidermal growth factor (hEGF) for epithelial healing in experimental corneal alkali wounds. Current eye research. 2001;22:272-9.

[9] Maldonado BA, Furcht LT. Epidermal growth factor stimulates integrin-mediated cell migration of cultured human corneal epithelial cells on fibronectin and arginine-glycine-aspartic acid peptide. Invest Ophthalmol Vis Sci. 1995;36:2120-6.

[10] Nelson JD, Silverman V, Lima PH, Beckman G. Corneal epithelial wound healing: a tissue culture assay on the effect of antibiotics. Current eye research. 1990;9:277-85.

75

[11] Simmons SJ, Jumblatt MM, Neufeld AH. Corneal epithelial wound closure in tissue culture: an in vitro model of ocular irritancy. Toxicology and applied pharmacology. 1987;88:13-23.

[12] Zieske JD, Hutcheon AE, Guo X, Chung EH, Joyce NC. TGF-beta receptor types I and II are differentially expressed during corneal epithelial wound repair. Invest Ophthalmol Vis Sci. 2001;42:1465-71.

[13] Ghezzi CE, Rnjak-Kovacina J, Kaplan DL. Corneal Tissue Engineering: Recent Advances and Future Perspectives. Tissue engineering Part B, Reviews. 2015.

[14] Carrier P, Deschambeault A, Audet C, Talbot M, Gauvin R, Giasson CJ, et al. Impact of cell source on human cornea reconstructed by tissue engineering. Invest Ophthalmol Vis Sci. 2009;50:2645-52.

[15] Carrier P, Deschambeault A, Talbot M, Giasson CJ, Auger FA, Guerin SL, et al. Characterization of wound reepithelialization using a new human tissue-engineered corneal wound healing model. Invest Ophthalmol Vis Sci. 2008;49:1376-85.

[16] Germain L, Auger FA, Grandbois E, Guignard R, Giasson M, Boisjoly H, et al. Reconstructed human cornea produced in vitro by tissue engineering. Pathobiology. 1999;67:140-7.

[17] Germain L, Carrier P, Auger FA, Salesse C, Guerin SL. Can we produce a human corneal equivalent by tissue engineering? Prog Retin Eye Res. 2000;19:497-527.

[18] Germain L GC, Carrier P, Guérin SL, Salesse C, Auger Tissue Engineering of Cornea. In: Wnek GE BG, editor. Encyclopedia of Biomaterials and Biomedical Engineering. New York: Marcel Dekker; 2004. p. p. 1534-44.

[19] Paquet C, Larouche D, Bisson F, Proulx S, Simard-Bisson C, Gaudreault M, et al. Tissue engineering of skin and cornea: Development of new models for in vitro studies. Ann N Y Acad Sci. 2010;1197:166-77.

[20] Proulx S, d'Arc Uwamaliya J, Carrier P, Deschambeault A, Audet C, Giasson CJ, et al. Reconstruction of a human cornea by the self-assembly approach of tissue engineering using the three native cell types. Mol Vis. 2010;16:2192-201.

76

[21] Michel M, L'Heureux N, Pouliot R, Xu W, Auger FA, Germain L. Characterization of a new tissue-engineered human skin equivalent with hair. In Vitro Cell Dev Biol Anim. 1999;35:318-26.

[22] Pouliot R, Larouche D, Auger FA, Juhasz J, Xu W, Li H, et al. Reconstructed human skin produced in vitro and grafted on athymic mice. Transplantation. 2002;73:1751-7.

[23] Gaal C. [German physicians--decimated by ageing, low spirit, and changing attitude to life]. Orv Hetil. 2002;143:2449-51.

[24] Liotta LA, Kohn EC. The microenvironment of the tumour-host interface. Nature. 2001;411:375-9.

[25] Streuli C. Extracellular matrix remodelling and cellular differentiation. Current opinion in cell biology. 1999;11:634-40.

[26] Filippov S, Koenig GC, Chun TH, Hotary KB, Ota I, Bugge TH, et al. MT1-matrix metalloproteinase directs arterial wall invasion and neointima formation by vascular smooth muscle cells. The Journal of experimental medicine. 2005;202:663-71.

[27] Holmbeck K, Bianco P, Caterina J, Yamada S, Kromer M, Kuznetsov SA, et al. MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell. 1999;99:81-92.

[28] Shapiro SD. Matrix metalloproteinase degradation of extracellular matrix: biological consequences. Current opinion in cell biology. 1998;10:602-8.

[29] Sivak JM, Fini ME. MMPs in the eye: emerging roles for matrix metalloproteinases in ocular physiology. Progress in retinal and eye research. 2002;21:1-14.

[30] Lyu J, Joo CK. Wnt-7a up-regulates matrix metalloproteinase-12 expression and promotes cell proliferation in corneal epithelial cells during wound healing. The Journal of biological chemistry. 2005;280:21653-60.

[31] Mulholland B, Tuft SJ, Khaw PT. Matrix metalloproteinase distribution during early corneal wound healing. Eye (Lond). 2005;19:584-8.

77

[32] Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T. Regulation of matrix metalloproteinases: an overview. Mol Cell Biochem. 2003;253:269-85.

[33] Gordon GM, Ledee DR, Feuer WJ, Fini ME. Cytokines and signaling pathways regulating matrix metalloproteinase-9 (MMP-9) expression in corneal epithelial cells. J Cell Physiol. 2009;221:402-11.

[34] Joo CK, Seomun Y. Matrix metalloproteinase (MMP) and TGF beta 1-stimulated cell migration in skin and cornea wound healing. Cell Adh Migr. 2008;2:252-3.

[35] Jovanovic M, Stefanoska I, Radojcic L, Vicovac L. Interleukin-8 (CXCL8) stimulates trophoblast cell migration and invasion by increasing levels of matrix metalloproteinase (MMP)2 and MMP9 and integrins alpha5 and beta1. Reproduction. 2010;139:789-98.

[36] Gaudreault M, Carrier P, Larouche K, Leclerc S, Giasson M, Germain L, et al. Influence of sp1/sp3 expression on corneal epithelial cells proliferation and differentiation properties in reconstructed tissues. Invest Ophthalmol Vis Sci. 2003;44:1447-57.

[37] Gaudreault M, Vigneault F, Leclerc S, Guerin SL. Laminin reduces expression of the human alpha6 integrin subunit gene by altering the level of the transcription factors Sp1 and Sp3. Invest Ophthalmol Vis Sci. 2007;48:3490-505.

[38] Larouche K, Leclerc S, Salesse C, Guerin SL. Expression of the alpha 5 integrin subunit gene promoter is positively regulated by the extracellular matrix component fibronectin through the transcription factor Sp1 in corneal epithelial cells in vitro. The Journal of biological chemistry. 2000;275:39182-92.

[39] Duval C, Zaniolo K, Leclerc S, Salesse C, Guerin SL. Characterization of the human alpha9 integrin subunit gene: Promoter analysis and transcriptional regulation in ocular cells. Experimental eye research. 2015;135:146-63.

[40] Keller A, Nesvizhskii AI, Kolker E, Aebersold R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal Chem. 2002;74:5383-92.

78

[41] Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem. 2003;75:4646-58.

[42] Gingras ME, Larouche K, Larouche N, Leclerc S, Salesse C, Guerin SL. Regulation of the integrin subunit alpha5 gene promoter by the transcription factors Sp1/Sp3 is influenced by the cell density in rabbit corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:3742-55.

[43] Beliveau A, Berube M, Rousseau A, Pelletier G, Guerin SL. Expression of integrin alpha5beta1 and MMPs associated with epithelioid morphology and malignancy of uveal melanoma. Invest Ophthalmol Vis Sci. 2000;41:2363-72.

[44] Li DQ, Shang TY, Kim HS, Solomon A, Lokeshwar BL, Pflugfelder SC. Regulated expression of collagenases MMP-1, -8, and -13 and stromelysins MMP-3, -10, and -11 by human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2003;44:2928-36.

[45] Imanishi J, Kamiyama K, Iguchi I, Kita M, Sotozono C, Kinoshita S. Growth factors: importance in wound healing and maintenance of transparency of the cornea. Progress in retinal and eye research. 2000;19:113-29.

[46] O'Kane S, Ferguson MW. Transforming growth factor beta s and wound healing. The international journal of biochemistry & cell biology. 1997;29:63-78.

[47] Philipp K, Riedel F, Sauerbier M, Hormann K, Germann G. Targeting TGF-beta in human keratinocytes and its potential role in wound healing. Int J Mol Med. 2004;14:589-93.

[48] Saika S. TGF-beta signal transduction in corneal wound healing as a therapeutic target. Cornea. 2004;23:S25-30.

[49] Santoro MM, Gaudino G. Cellular and molecular facets of keratinocyte reepithelization during wound healing. Exp Cell Res. 2005;304:274-86.

[50] Lu L, Reinach PS, Kao WW. Corneal epithelial wound healing. Exp Biol Med (Maywood). 2001;226:653-64.

79

[51] Lake J, Zaniolo K, Gaudreault M, Carrier P, Deschambault A, Bazin R, et al. Expression of the alpha5 integrin gene in corneal epithelial cells cultured on tissue-engineered human extracellular matrices. Biomaterials. 2013;34:6367-76.

[52] Zieske JD, Mason VS, Wasson ME, Meunier SF, Nolte CJ, Fukai N, et al. Basement membrane assembly and differentiation of cultured corneal cells: importance of culture environment and endothelial cell interaction. Exp Cell Res. 1994;214:621-33.

[53] Garzon I, Martin-Piedra MA, Alfonso-Rodriguez C, Gonzalez-Andrades M, Carriel V, Martinez-Gomez C, et al. Generation of a biomimetic human artificial cornea model using Wharton's jelly mesenchymal stem cells. Invest Ophthalmol Vis Sci. 2014;55:4073-83.

[54] Gao K, Wang CR, Jiang F, Wong AY, Su N, Jiang JH, et al. Traumatic scratch injury in astrocytes triggers calcium influx to activate the JNK/c-Jun/AP-1 pathway and switch on GFAP expression. Glia. 2013;61:2063-77.

[55] Gordon GM, Austin JS, Sklar AL, Feuer WJ, LaGier AJ, Fini ME. Comprehensive gene expression profiling and functional analysis of matrix metalloproteinases and TIMPs, and identification of ADAM-10 gene expression, in a corneal model of epithelial resurfacing. J Cell Physiol. 2011;226:1461-70.

[56] Fini ME, Girard MT, Matsubara M, Bartlett JD. Unique regulation of the matrix metalloproteinase, gelatinase B. Invest Ophthalmol Vis Sci. 1995;36:622-33.

[57] Matsubara M, Girard MT, Kublin CL, Cintron C, Fini ME. Differential roles for two gelatinolytic enzymes of the matrix metalloproteinase family in the remodelling cornea. Developmental biology. 1991;147:425-39.

[58] Ye HQ, Maeda M, Yu FS, Azar DT. Differential expression of MT1-MMP (MMP-14) and collagenase III (MMP-13) genes in normal and wounded rat corneas. Invest Ophthalmol Vis Sci. 2000;41:2894-9.

[59] Saghizadeh M, Brown DJ, Castellon R, Chwa M, Huang GH, Ljubimova JY, et al. Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic

80

corneas: a possible mechanism of basement membrane and integrin alterations. The American journal of pathology. 2001;158:723-34.

[60] Ko JA, Chikama T, Sonoda KH, Kiuchi Y. Up-regulation of matrix metalloproteinase-1 and interleukin-6 expression in cocultures of corneal fibroblasts and neural cells. Biochemical and biophysical research communications. 2012;419:537-42.

[61] Tseng HC, Lee IT, Lin CC, Chi PL, Cheng SE, Shih RH, et al. IL-1beta promotes corneal epithelial cell migration by increasing MMP-9 expression through NF-kappaB- and AP-1-dependent pathways. PloS one. 2013;8:e57955.

[62] Girard MT, Matsubara M, Fini ME. Transforming growth factor-beta and interleukin-1 modulate metalloproteinase expression by corneal stromal cells. Invest Ophthalmol Vis Sci. 1991;32:2441-54.

[63] Kim HS, Shang T, Chen Z, Pflugfelder SC, Li DQ. TGF-beta1 stimulates production of gelatinase (MMP-9), collagenases (MMP-1, -13) and stromelysins (MMP-3, -10, -11) by human corneal epithelial cells. Experimental eye research. 2004;79:263-74.

[64] Reddy VS, Prabhu SD, Mummidi S, Valente AJ, Venkatesan B, Shanmugam P, et al. Interleukin-18 induces EMMPRIN expression in primary cardiomyocytes via JNK/Sp1 signaling and MMP-9 in part via EMMPRIN and through AP-1 and NF-kappaB activation. American journal of physiology Heart and circulatory physiology. 2010;299:H1242-54.

[65] Kabosova A, Azar DT, Bannikov GA, Campbell KP, Durbeej M, Ghohestani RF, et al. Compositional differences between infant and adult human corneal basement membranes. Invest Ophthalmol Vis Sci. 2007;48:4989-99.

[66] Ljubimov AV, Burgeson RE, Butkowski RJ, Michael AF, Sun TT, Kenney MC. Human corneal basement membrane heterogeneity: topographical differences in the expression of type IV collagen and laminin isoforms. Laboratory investigation; a journal of technical methods and pathology. 1995;72:461-73.

[67] Martin GR, Timpl R. Laminin and other basement membrane components. Annual review of cell biology. 1987;3:57-85.

81

[68] Michelacci YM. Collagens and proteoglycans of the corneal extracellular matrix. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica [et al]. 2003;36:1037-46.

[69] Nakayasu K, Tanaka M, Konomi H, Hayashi T. Distribution of types I, II, III, IV and V collagen in normal and keratoconus corneas. Ophthalmic research. 1986;18:1-10.

[70] Torricelli AA, Marino GK, Santhanam A, Wu J, Singh A, Wilson SE. Epithelial basement membrane proteins perlecan and nidogen-2 are up-regulated in stromal cells after epithelial injury in human corneas. Experimental eye research. 2015;134:33-8.

[71] Torricelli AA, Singh V, Santhiago MR, Wilson SE. The corneal epithelial basement membrane: structure, function, and disease. Invest Ophthalmol Vis Sci. 2013;54:6390-400.

[72] Tuori A, Uusitalo H, Burgeson RE, Terttunen J, Virtanen I. The immunohistochemical composition of the human corneal basement membrane. Cornea. 1996;15:286-94.

[73] Schlotzer-Schrehardt U, Bachmann BO, Tourtas T, Torricelli AA, Singh A, Gonzalez S, et al. Ultrastructure of the posterior corneal stroma. Ophthalmology. 2015;122:693-9.

[74] Meek KM, Fullwood NJ. Corneal and scleral collagens--a microscopist's perspective. Micron. 2001;32:261-72.

[75] Newsome DA, Gross J, Hassell JR. Human corneal stroma contains three distinct collagens. Invest Ophthalmol Vis Sci. 1982;22:376-81.

[76] Robert L, Legeais JM, Robert AM, Renard G. Corneal collagens. Pathologie-biologie. 2001;49:353-63.

[77] Gendron SP, Rochette PJ. Modifications in stromal extracellular matrix of aged corneas can be induced by ultraviolet A irradiation. Aging cell. 2015;14:433-42.

[78] Jacobsen IE, Jensen OA, Prause JU. Structure and composition of Bowman's membrane. Study by frozen resin cracking. Acta ophthalmologica. 1984;62:39-53.

82

[79] Marshall GE, Konstas AG, Lee WR. Immunogold fine structural localization of extracellular matrix components in aged human cornea. II. Collagen types V and VI. Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie. 1991;229:164-71.

[80] Marshall GE, Konstas AG, Lee WR. Immunogold fine structural localization of extracellular matrix components in aged human cornea. I. Types I-IV collagen and laminin. Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie. 1991;229:157-63.

[81] Filenius S, Hormia M, Rissanen J, Burgeson RE, Yamada Y, Araki-Sasaki K, et al. Laminin synthesis and the adhesion characteristics of immortalized human corneal epithelial cells to laminin isoforms. Experimental eye research. 2001;72:93-103.

[82] Saravanan C, Cao Z, Head SR, Panjwani N. Analysis of differential expression of glycosyltransferases in healing corneas by glycogene microarrays. Glycobiology. 2010;20:13-23.

[83] Shan N, Zhang X, Xiao X, Zhang H, Tong C, Luo X, et al. Laminin alpha4 (LAMA4) expression promotes trophoblast cell invasion, migration, and angiogenesis, and is lowered in preeclamptic placentas. Placenta. 2015;36:809-20.

[84] Siqueira AS, Gama-de-Souza LN, Arnaud MV, Pinheiro JJ, Jaeger RG. Laminin-derived peptide AG73 regulates migration, invasion, and protease activity of human oral squamous cell carcinoma cells through syndecan-1 and beta1 integrin. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2010;31:46-58.

[85] Gama-de-Souza LN, Cyreno-Oliveira E, Freitas VM, Melo ES, Vilas-Boas VF, Moriscot AS, et al. Adhesion and protease activity in cell lines from human salivary gland tumors are regulated by the laminin-derived peptide AG73, syndecan-1 and beta1 integrin. Matrix biology : journal of the International Society for Matrix Biology. 2008;27:402-19.

83

2.11. Tables Table 2.1. Average ECM peptide counts. COLLAGENS Average ECM HCEC- Average ECM HCEC+ Collagen TYPE I 21,0 +/- 15,1 28,0 +/- 6,6 Collagen TYPE II N.D. 3,0 +/- 1,0 Collagen TYPE III 2,0 +/-2,6 6,7 +/- 2,9 Collagen TYPE IV N.D. 1,0 +/- 1,7 Collagen TYPE V 1,7 +/- 0,6 9,0 +/- 3,0 Collagen TYPE VI 148,3 +/- 18,8 59,0 +/- 1,7 Collagen TYPE VII N.D. 3,3 +/- 3,1 Collagen TYPE XII 151,7 +/- 32,3 108,3 +/- 16,0 Collagen TYPE XIV 35,3 +/- 7,5 15,7 +/- 3,5 Collagen TYPE XV N.D. 0,7 +/- 1,2 Collagen TYPE XVI 1,3 +/- 1,2 N.D. Collagen TYPE XVII N.D. 2,7 +/- 0,6 Collagen TYPE XVIII N.D. 1,0 +/- 1,0 Collagen TYPE XXVII N.D. 0,7 +/- 1,2 Total Collagens 361,3 239,3 GLYCOPROTEINS

Fibronectin 59,0 +/- 9,6 23,3 +/- 6,7 Tenascin 45,7 +/- 10,3 85,7 +/- 3,1 Laminin N.D. 13,7 +/- 9,9 Periostin 40,7 +/- 9,5 13,7 +/- 9,3 Fibulin 25,3 +/- 11,1 6,7 +/- 1,5 Prolargin 2,3 +/- 2,1 4,0 +/- 2,6 Podocan 1,0 +/- 1,7 0,7 +/- 1,2 Peroxidasin 1,3 +/- 0,6 0,7 +/- 1,2 Fibrillin 45,3 +/- 16,4 N.D. Total Glycoproteins 220,6 148,5 PROTEOGLYCANS

Biglycan 13,7 +/- 3,2 6,3 +/- 3,1 Lumican 9,3 +/- 5,0 13,7 +/- 0,6 Versican 6,0 +/- 4,3 4,3 +/- 3,8 Perlecan N.D. 3,3 +/- 4,2 Glypican N.D. 1,7 +/- 1,5 Mimecan 2,7 +/- 3,1 N.D. Fibromodulin 9,3 +/- 2,9 5,0 +/- 2,9 Decorin 17,7 +/- 5,9 14,7 +/- 1,5 Total Proteoglycans 58,7 49,0 Total ECM peptides 640,6 436,6

84

2.12. Figures Legends

Figure 2.1. Production of wounds on tissue-engineered human corneas

A: The reconstructed cornea is wounded using a 8mm biopsy punch. B: Closure of wounds on tissue-engineered corneas produced using HCECs isolated from the eyes of three different donors (of 44-, 52- and 71 years old). Closure of the wounded epithelia has been followed from 1 to 4 days after corneal injury. C: Composite image showing a complete view of the wounded, tissue engineered human cornea 3 days following corneal damage (sections were stained with Masson trichrome; cells are pink and collagen is bluish). The wound margin created by the biopsy punch is indicated. F1+F2: initial fibroblast sheets present in the reconstructed cornea prior to wounding; F3+F4: supplementary fibroblast sheets added following wounding of the tissue-engineered corneas.

Figure 2.2. Microarray analysis of gene expression patterns in response to corneal damage

A: Schematic representation of the areas, from the wounded reconstructed corneas, that were recovered five days following wounding in order to prepare total RNA in view of microarray analyses. B: Scatter plots of log2 of signal intensity from 60 000 different targets covering the entire human transcriptome of cells isolated from the central, internal or external area of wounded tissue-engineered human corneas (in the y-axis) plotted against: cells from unwounded reconstructed corneas (first three graph), or against cells from the internal or external areas (last three graphs) (in the x-axis). C: Heatmap representation of genes whose expression is differentially regulated by at least 2-fold in corneal epithelial cells isolated from wounded (central, internal and external) or unwounded (control) tissue-engineered human corneas. The color scale used to display the log2 expression level values is determined by the Hierarchical clustering algorithm of the Euclidian metric distance between genes. Genes indicated in dark blue correspond to those whose expression is very low whereas highly expressed genes are shown in orange/red. Microarray data for the housekeeping genes β2-microglobulin (B2M) and golgin subfamily A member 1 (GOLGA1) that are expressed respectively to very high and low levels in all types of cells are also shown. D: Vein diagram that depicts the number of deregulated genes in wounded (central: red circle; internal: green circle; external: dark blue circle) relative to unwounded reconstructed corneas. Genes that are deregulated between two different areas are also indicated (in yellow, purple and light blue) as well as those

85

commonly deregulated in all three areas (in white). E: Heatmap representation of the 55 most deregulated genes expressed by wounded (central, internal, external) relative to their levels in unwounded tissue-engineered corneas (control).

Figure 2.3. Analysis of MMPs gene expression in response to corneal damage

A: Heatmap representation of the expression profiles of both MMP and TIMP genes between central (wounded), internal and external (unwounded) areas of tissue-engineered human corneas. B: qPCR analysis conducted for the MMPs (MMP-1, MMP-2, MMP-3, MMP-9, MMP-10, MMP-11 and MMP-13) that have been identified as the most deregulated between the central and external areas of wounded reconstructed corneas. Data were normalized to GAPDH and their statistical relevance analyzed by one-way ANOVA (Dunnett’s post-test; P < 0.05). C: Same as in panel A but for the genes encoding both interleukins and TGF-β. D. Same as in panel A but for genes encoding the transcription factors Sp1, Sp3 and AP1. E: qPCR analysis of Sp1 and the AP1 subunits c-Fos and c-Jun. Data were normalized to GAPDH and their statistical relevance analyzed by one-way ANOVA (Dunnett’s post-test; P < 0.05). F: Western blot analysis of Sp1 and the AP1 subunits c-Fos, c-Jun and JunB. Actin is also shown as an internal control.

Figure 2.4. Expression and enzymatic activity of MMPs during wounds closure

A: Samples of culture media from unwounded (day 0) and wounded (day 1 to 4 of wound closure) tissue-engineered human corneas were analyzed by Western blot to reveal the relative amount of pro- and active MMPs. Data are expressed as the ratio of pro-MMP/active-MMP, with the exception of MMP3, MMP10 and MMP13 that were compared to their level prior to corneal wounding at day 0 (as their respective antibodies only recognized the inactive pro-enzyme). Coomassie blue staining of proteins from each sample is also presented as a normalization control (bottom lane). The most relevant molecular mass markers (kDa) are also indicated on the left of each blot. B: The media samples used in panel A were examined by gel zymography to reveal the gelatinolytic activity of both MMP-2 and MMP-9.

Figure 2.5. Expression of MMPs in HCECs grown on a complex stroma

A: Heatmap representation of the expression profiles for all MMP and TIMP genes in HCECs grown on BSA (used as a negative control) or on a tissue-engineered stromas that have been depleted

86

(stroma-) or not (stroma+) of their fibroblasts. B: qPCR analysis of MMP9 and MMP10 expression in HCECs grown on BSA or on a fibroblast-depleted stroma (stroma-). C: Samples of culture media from HCECs grown on BSA or on a fibroblast-depleted stroma (stroma-) were examined by gel zymography to reveal the gelatinolytic activity of both MMP-2 and MMP-9. The position of the most relevant molecular mass markers (kDa) is indicated.

Figure 2.6. Influence of individual ECM components on the expression of MMP genes

A: Heatmap representation of the expression profiles for all MMP and TIMP genes in HCECs grown on BSA or on individual ECM components (CI, CIV, FN, TN and LM). B: Comparison of MMP9 expression as measured by qPCR (black columns) and microarray (red columns). For qPCR analyses, data were expressed as the ratio of the MMP9 copy number (normalized to that of GAPDH) measured on the individual ECM components over that obtained on BSA. For microarray analyses, data were expressed as the ratio of the MMP9 linear signal (normalized to that of B2M) measured on the individual ECM components over that obtained on BSA. The statistical relevance of the data was analyzed by one-way ANOVA (Dunnett’s post-test; P < 0.05). C: The enzymatic activity of both MMP2 and MMP9 was evaluated in the culture media of HCECs grown on BSA or on each of the individual ECM component by zymographic analyses. Both the MMP2 and MMP9 activity was quantified and expressed as the ratio of each MMP measured on each individual ECM component over that measured on BSA. The most relevant molecular mass markers (kDa) are also indicated on the left of each gel. D: Expression of both MMP2 and MMP9 was monitored by Western blot in total protein extracts prepared from HCECs grown on BSA and individual ECM components. Both the inactive (pro-) and active forms of the enzymes are indicated. The amount of MMP2 and MMP9 protein was quantified by densitometric analysis and expressed as the ratio of pro-MMP/active-MMP measured on each individual ECM component over that measured on BSA. Coomassie blue staining of proteins from each sample is also presented as a normalization control (bottom lane).

Figure 2.7. Contribution of HCECs to the composition of the reconstructed corneal stroma

A-C: Mass spectrometry analysis of the ECM components from the reconstructed stromas alone (stroma/HCECs-) or seeded with HCECs and then raised to the air-liquid condition in order to produce a stratified corneal epithelium (stroma/HCECs+). Data are provided for the various types of

87

collagens (panel A), glycoproteins (panel B) and proteoglycans (panel C) (n=4). The value for each individual ECM component is expressed as the ratio of its normalized spectrum count.

88

Figure 2.1. Production of wounds on tissue-engineered human corneas.

A.

B.

C.

Day 1 Day 2 Day 3 Day 4

44

52

71

Dono

r’s ag

e

Reconstructed cornea Wound

F1+F2F3+F4 F3+F4

Near the wound margin

Wound margin

Neoepithelium

Migrating epithelial tongue

89

Figure 2.2. Microarray analysis of gene expression patterns in response to corneal damage.

B.

+1,0 +16,6

RGS5RGS4KCNE3RASSF2GNAZVCAM1CACNA1ANPAS4BMP3MYH4ZNF853SOX11SCRG1RGSL1KIF5CPAMR1CA9CCL5SLC13A5C20orf103MMP10PTHLHHEYLZFP42CLEC3A

KITRERGCRTAC1CDH2GRPACTG2PLA2G16C8orf84MGPSULF1C4orf49

SPRR2GSPRR2BDEFB103BCDAWFDC5IL36RNWFDC12GPX3KLK6MMP9DEFB4ALAMC2LAMA3LCE3DCLUKRT12PI3SPRR2D

C. E.

+5,4 +14,0

GOLGA1B2M

ControlCentral Internal External

Control

Inte

rnal

ControlEx

tern

al

Cent

ral

Control

Fi 2

D.

A1043 genes

B500 genes

C454genes

A/B455 genes

A/C158 genes

B/C573 genes

A/B/C1098 genes

Control

+0,8 +16,6

Central Internal External

AB

C

A. Central ring 8 mm

Internal ring 14 mm

External ring 19 mm

Internal

Cent

ral

External

Cent

ral

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2

External

Inte

rnal

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2

2 4 6 8 10 12 14 16

16

14

12

10

8

6

4

2 R2=0,9316 R2=0,9362 R2=0,9417 R2=0,9629 R2=0,9529 R2=0,9726

I

II

III

90

Figure 2.3. Analysis of MMPs gene expression in response to corneal damage.

*

A. B.

Fi 3

MMP7

MMP1

MMP9

MMP3

MMP28

MMP14

MMP2

MMP17

MMP24

MMP21

MMP16

MMP20

MMP26

MMP8

MMP12MMP13

MMP11

MMP23B

MMP25

MMP27

MMP15

MMP19

MMP10

+1,0 +12,8

Central Internal External

+4,8 +12,8

TIMP3TIMP4

TIMP2TIMP1

+5,5 +13,9GOLGA1B2M

CentralInternal

External

MMP1 *

0,002 0,006 0,010 0,014

**

MMP2

0,10 0,20 0,30 0,500,40

**

MMP3 *

0,005 0,010 0,015 0,0250,020

**

MMP9 *

0,02 0,04 0,06 0,100,08

**

MMP10

0,005 0,015 0,025

**

MMP11

0,01 0,02 0,040,03

**

MMP13 * **

0,0005 0,0015 0,00350,0025copy number of MMP/copy number of GAPDH

E. CentralInternal

External

0,008 0,012 0,016*

Sp1 *

0,004copy number of Sp1/copy number of GAPDH

c-Fos *

0,002 0,006 0,0140,010

**

copy number of c-Fos/copy number of GAPDH

c-Jun

0,01 0,02 0,03

**

copy number of c-Jun/copy number of GAPDH

D. +5,1 +10,9

Central Internal External

JunB

Sp3Sp1

Fra-1JunDFra-2

c-Junc-FosFosB

+5,5 +13,9GOLGA1B2M

C.IL1A

+1,7 +9,1

Central Internal External

IL24

IL1B

IL11

IL37

IL17DIL20

IL8IL6

+1,5 +9,2TGFB1TGFB3MEGF10

+5,5 +13,9GOLGA1B2M

F.85

Central Internal External

50

50

50

50

MW (kDa)

Sp1

c-Fos

c-Jun

JunB

Actin

91

Figure 2.4. Expression and enzymatic activity of MMPs during wounds closure.

B.

50

85

MMP9

day 0

MMP2/day 0MMP9/day 0

1,533,02

day 1

1,135,33

day 2 day 3

1,796,43

day 4

2,029,99

MMP2

120

A.MMP1

day 0 day 1 day 2 day 3 day 4

pro-MMP2

MMP3

MMP9

MMP10

MMP11

MMP13

85

50

85

50

50

50

50

5085

120

372520

ControlProteins

Pro-MMP2/Active MMP2

Total MMP3/day 0

Total MMP9/day 0

Total MMP10/day 0

Pro-MMP11/Active MMP11

Total MMP13/day 0

0,27 0,23 0,17 0,22

1,28 1,32 1,38 2,00

2,49 2,15 1,42 1,11

0,79 0,53 0,44 0,48

3,12 0,64 0,45 0,44

1,98 2,36 2,70 2,18

pro-MMP1

pro-MMP11

Pro-MMP1/Active MMP1 3,72 0,85 0,62 0,96

MMP2

2,07

0,18

2,43

92

Figure 2.5. Expression of MMPs in HCECs grown on a complex stroma.

MMP7

MMP1

MMP9

MMP3

MMP28

MMP14

MMP2

MMP17

MMP24

MMP21

MMP16

MMP20

MMP26

MMP8

MMP12

MMP13

MMP11

MMP23B

MMP25

MMP27

MMP15

MMP19

MMP10

A. B.BSA Stroma -

TIMP3

TIMP4

TIMP2

TIMP1

GOLGA1

B2M

MMP10

MMP9

BSA

Stroma -

0,2 0,4 0,6 1,00,8

*

0,01 0,02 0,03

*

C.

+1,4 +15,6

+2,8 +13,6

+5,1 +15,5

Stroma +

0,04 0,05

606060 MMP9

MMP2

MW (kDa)

60

85

BS

A

Str

om

a -

copy number of MMP9/copy number of ACTB

copy number of MMP10/copy number of ACTB

93

Figure 2.6. Influence of individual ECM components on the expression of MMP genes.

MMP7

MMP1

MMP9

MMP3

MMP28

MMP14

MMP2

MMP17

MMP24

MMP21

MMP16

MMP20

MMP26

MMP8

MMP12MMP13

MMP11

MMP23B

MMP25

MMP27

MMP15

MMP19

MMP10

A.BSA CI

TIMP3TIMP4

TIMP2TIMP1

GOLGA1B2M

+1,3 +14,3

+3,3 +13,1

+5,0 +14,7

CIV FN TN LM

C.MMP9MMP2

50

85

MMP9MMP2

50

85

BSA CI CIV FN TN LM

MMP2/BSA 0,73 1,16 1,80 0,55 1,20

0,57 0,54 0,46 0,70 0,77

D.BSA CI CIV FN TN LM

B.

MMP9 qPCR mRNA expression/GAPDH (copy number) (ratio Matrix/BSA)MMP9 gene profiling linear signal/B2M (ratio Matrix/BSA)

LM

CI

FN

BSA

CIV

TN

4,0 6,02,0 8,03,0 5,01,0 7,0

*

*

**

MMP9/BSA

pro-MMP2MMP2

5085

120

3725

ControlProteins

MW (kDa) MW (kDa)85

85

Pro-MMP2/Active MMP2 1,98 1,75 3,68 3,581,951,81

0,60 0,80 1,06 0,480,57

*

*

pro-MMP9MMP9

Pro-MMP9/Active MMP9 0,20

*

94

Figure 2.7. Contribution of HCECs to the composition of the reconstructed corneal stroma.

COL Type I

Stroma/HCEC-Stroma/HCEC+

COL Type IICOL Type IIICOL Type IVCOL Type VCOL Type VICOL Type VIICOL Type XIICOL Type XIVCOL Type XV

COL Type XXVIICOL Type XVIIICOL Type XVII

16020 60 100 120Collagens normalized spectrum counts

40 80

A.

FibronectinTenascinsLamininsPeriostinFibulinsProlarginPodocan

FibrillinPeroxidasin

Glycoproteins normalized spectrum counts 10 30 9050 70

B.

N.D.

Stroma/HCEC-Stroma/HCEC+

5 10 15 20Proteoglycans normalized spectrum counts

LumicanBiglycan

VersicanPerlecanGlypicanMimecan

DecorinFibromodulin

C.

N.D.

N.D.

N.D.

Stroma/HCEC-Stroma/HCEC+

Fi

140

N.D.

N.D.

N.D.

N.D.

N.D.

N.D.

20 8040 60

N.D.

180

N.D.COL Type XVI

N.D.

95

2.13. Supplementary Data

Supplementary Table 2.1. DNA sequence of the primers for qPCR analyses.

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’)

Genebank #

MMP1 GGGGCTTTGATGTACCCTAGC TGTCACACGCTTTTGGGGTTT NM_002421

MMP2 TAGCAGAGCCTAGACAAGGG CAGGACAGAGGGACTAGAGC NM_004530

MMP3 GTCACTTGTCTGTTGCACACG AGGGAACTTGAGCGTGAATCT NM_002422

MMP9 GACGGGTATCCCTTCGAC CCGAGTTGGAACCACGAC NM_004994

MMP10 GCTCTGCCTATCCTCTGAG CACATCCTTTTCGAGGTTG NM_002425

MMP11 CCGCAACCGACAGAAGAGG ATCGCTCCATACCCTTAGGGC NM_005940

MMP13 CCAGACTTCACGATGGCATTG CCGCAACCGACAGAAGAGG NM_002427

SP1 GTCCCTAAGTAAGTTTCTTCC GGAGGCTACAGACTAC NM_003109

FOS GCTGGTGCATTACAGAGAGG CTCCGGAAGAGGTAAGGAC NM_005252

JUN GGGCATGTGCTGTGACC CATAAGCAAAGGCCATC NM_002228

ACTB CAAGATGAGATTGGCATGG GGCCACATTGTGAACTTG NM_001101

GAPDH

AAGGTCGGAGTCAACGGAT GGAAGATGGTGATGGGATTTC NM_002046

Supplementary Table 2.2. Biological functions of the proteins encoded by the differentially expressed genes

Gene  Name   Protein  Name   Central   Internal   External   Control  

Fold  change  Central  vs  Control   Functions  

ACTG2  

Actin,  gamma-­‐enteric  smooth  muscle   36,4   40,7   44,1   1035,1   28,4  down  

Actin  is  a  component  of  the  cytoskeleton  and  links  to  alpha-­‐actinin,  E-­‐cadherin  and  beta-­‐catenin  at  adherens  junctions.  This  gives  mechanical  support  to  cells  and  attaches  them  to  each  other  and  the  extracellular  matrix.  In  muscle  cells,  actin-­‐rich  thin  filaments  associate  with  myosin-­‐rich  thick  filaments  to  form  actomyosin  myofibrils.  Using  energy  from  the  hydrolysis  of  ATP,  myofibrils   undergo   cyclic   shortening   through   actin-­‐myosin   head   interactions,   which   represents   the   mechanics   of   muscle  contraction.   Finally,   actin   has   a   role   in   cell   motility   through   polymerization   and   depolymerization   of   fibrils.   Diseases  associated  with  ACTG2  include  visceral  myopathy  and  myopathic  intestinal  pseudoobstruction.  

BMP3  Bone  morphogenetic  protein  3   3,1   3,4   5,0   43,1   14,0  down  

BMP3   belongs   to   the   transforming   growth   factor-­‐beta   (TGFB)   superfamily.   Bone   morphogenic   protein,   also   known   as  osteogenin,  induces  bone  formation.  Negatively  regulates  bone  density.  Antagonizes  the  ability  of  certain  osteogenic  BMPs  to  induce  osteoprogenitor  differentitation  and  ossification.  Diseases  associated  with  BMP3  include  refractive  error  

C20orf103  

Lysosome-­‐associated  membrane  glycoprotein  5   99,1   13,3   4,3   8,1   12,2  up   Unknown  function.  

C4orf49   Protein  MGARP   89,7   458,2   1142,0   4221,4   47,1  down  

MGARP   (Mitochondria-­‐Localized   Glutamic   Acid-­‐Rich   Protein)   is   a   Protein   Coding   gene.   lays   a   role   in   the   trafficking   of  mitochondria  along  microtubules.  Regulates  the  kinesin-­‐mediated  axonal  transport  of  mitochondria  to  nerve  terminals  along  microtubules   during   hypoxia.   Participates   in   the   translocation   of   TRAK2/GRIF1   from   the   cytoplasm   to   the  mitochondrion.  Also  plays  a  role  in  steroidogenesis  through  maintenance  of  mitochondrial  abundance  and  morphology.  Diseases  associated  with  MGARP  include  hypoxia.  

C8orf84  

Somatomedin-­‐B  and  thrombospondin  type-­‐1  domain-­‐containing  protein   9,7   49,8   55,9   170,9   17,6  down  

SBSPON  (Somatomedin  B  And  Thrombospondin,  Type  1  Domain  Containing)  is  a  Protein  Coding  gene.  GO  annotations  related  to  this  gene  include  scavenger  receptor  activity  and  polysaccharide  binding.  

CA9  Carbonic  anhydrase  9   61,7   65,5   38,3   5,4   11,3  up  

Carbonic  anhydrases  (CAs)  are  a  large  family  of  zinc  metalloenzymes  that  catalyze  the  reversible  hydration  of  carbon  dioxide.  They  participate   in  a  variety  of  biological  processes,   including  respiration,   calcification,  acid-­‐base  balance,  bone  resorption,  and   the   formation   of   aqueous   humor,   cerebrospinal   fluid,   saliva,   and   gastric   acid.   They   show   extensive   diversity   in   tissue  distribution  and  in  their  subcellular  localization.  CA  IX  is  a  transmembrane  protein  and  is  one  of  only  two  tumor-­‐associated  carbonic   anhydrase   isoenzymes   known.   It   is   expressed   in   all   clear-­‐cell   renal   cell   carcinoma,   but   is   not   detected   in   normal  kidney  or  most  other  normal  tissues.  It  may  be  involved  in  cell  proliferation  and  transformation.  Diseases  associated  with  CA9  include  renal  cell  carcinoma  and  clear  cell  renal  cell  carcinoma.  

CACNA1A  

Voltage-­‐dependent  P/Q-­‐type  calcium  channel  subunit  alpha-­‐1A   17,9   32,0   21,7   205,2   11,4  down  

Voltage-­‐sensitive   calcium  channels   (VSCC)  mediate   the   entry  of   calcium   ions   into   excitable   cells   and  are   also   involved   in   a  variety  of  calcium-­‐dependent  processes,  including  muscle  contraction,  hormone  or  neurotransmitter  release,  gene  expression,  cell   motility,   cell   division   and   cell   death.   The   isoform   alpha-­‐1A   gives   rise   to   P   and/or   Q-­‐type   calcium   currents.   P/Q-­‐type  calcium   channels   belong   to   the   high-­‐voltage   activated   (HVA)   group   and   are   blocked   by   the   funnel   toxin   (Ftx)   and   by   the  omega-­‐agatoxin-­‐IVA  (omega-­‐Aga-­‐IVA).  They  are  however  insensitive  to  dihydropyridines  (DHP),  and  omega-­‐conotoxin-­‐GVIA  (omega-­‐CTx-­‐GVIA).  Diseases  associated  with  CACNA1A  include  spinocerebellar  ataxia  6  and  migraine,  familial  hemiplegic,  1.  

 RANTES(4-­‐68),  C-­‐C  

                 

Chemoattractant  for  blood  monocytes,  memory  T-­‐helper  cells  and  eosinophils.  Causes  the  release  of  histamine  from  basophils  and  activates  eosinophils.  May  activate  several  chemokine  receptors  including  CCR1,  CCR3,  CCR4  and  CCR5.  One  of  the  major  HIV-­‐suppressive   factors   produced   by   CD8+   T-­‐cells.   Recombinant   RANTES   protein   induces   a   dose-­‐dependent   inhibition   of  

                                 

97

natural   chemotaxis   inhibitor   and   is   a  more   potent   inhibitor   of  HIV-­‐1-­‐infection.   The   second   processed   form  RANTES(4-­‐68)  exhibits   reduced   chemotactic   and   HIV-­‐suppressive   activity   compared   with   RANTES(1-­‐68)   and   RANTES(3-­‐68)   and   is  generated  by  an  unidentified  enzyme  associated  with  monocytes  and  neutrophils.  May  also  be  an  agonist  of   the  G  protein-­‐coupled   receptor   GPR75,   stimulating   inositol   trisphosphate   production   and   calcium   mobilization   through   its   activation.  Together  with  GPR75,  may  play  a  role  in  neuron  survival  through  activation  of  a  downstream  signaling  pathway  involving  the  PI3,  Akt  and  MAP  kinases.  By  activating  GPR75  may  also  play  a  role  in  insulin  secretion  by  islet  cells.  Diseases  associated  with  CCL5  include  ulcer  of  lower  limbs  and  african  tick-­‐bite  fever.  

CDA   Cytidine  deaminase   1270,9   417,5   162,3   78,5   16,2  up  

This  gene  encodes  an  enzyme  involved  in  pyrimidine  salvaging.  The  encoded  protein  forms  a  homotetramer  that  catalyzes  the  irreversible   hydrolytic   deamination   of   cytidine   and   deoxycytidine   to   uridine   and   deoxyuridine,   respectively.   It   is   one   of  several  deaminases  responsible  for  maintaining  the  cellular  pyrimidine  pool.  Diseases  associated  with  CDA  include  xeroderma  pigmentosum,  group  d.  

CDH2  

cDNA  FLJ53252,  highly  similar  to  Cadherin-­‐2   30,2   33,2   28,2   602,4   19,9  down  

Cadherins  are  calcium-­‐dependent  cell  adhesion  proteins.  They  preferentially  interact  with  themselves  in  a  homophilic  manner  in   connecting   cells;   cadherins  may   thus   contribute   to   the   sorting  of  heterogeneous   cell   types.  Acts   as   a   regulator  of  neural  stem  cells  quiescence  by  mediating  anchorage  of  neural  stem  cells  to  ependymocytes  in  the  adult  subependymal  zone:  upon  cleavage  by  MMP24,  CDH2-­‐mediated  anchorage   is   affected,   leading   to  modulate  neural   stem  cell  quiescence.  CDH2  may  be  involved   in   neuronal   recognition   mechanism.   In   hippocampal   neurons,   may   regulate   dendritic   spine   density.   Diseases  associated  with  CDH2  include  pseudomyxoma  peritonei  and  hypoplastic  left  heart  syndrome.  

CLEC3A  C-­‐type  lectin  domain  family  3  member  A   32,2   2,5   2,1   2,0   16,3  up   Promotes  cell  adhesion  to  laminin-­‐332  and  fibronectin.  .  Diseases  associated  with  CLEC3A  include  methylmalonic  acidemia.  

CLU   Clusterin  beta  chain   1031,3   5436,4   10935,5   17130,5   16,6  down  

Isoform   1   functions   as   extracellular   chaperone   that   prevents   aggregation   of   nonnative   proteins.   Prevents   stress-­‐induced  aggregation   of   blood   plasma   proteins.   Inhibits   formation   of   amyloid   fibrils   by   APP,   APOC2,   B2M,   CALCA,   CSN3,   SNCA   and  aggregation-­‐prone  LYZ  variants  (in  vitro).  Does  not  require  ATP.  Maintains  partially  unfolded  proteins  in  a  state  appropriate  for  subsequent  refolding  by  other  chaperones,  such  as  HSPA8/HSC70.  Does  not  refold  proteins  by  itself.  Binding  to  cell  surface  receptors   triggers   internalization   of   the   chaperone-­‐client   complex   and   subsequent   lysosomal   or   proteasomal   degradation.  Secreted  isoform  1  protects  cells  against  apoptosis  and  against  cytolysis  by  complement.  Intracellular  isoforms  interact  with  ubiquitin   and   SCF   (SKP1-­‐CUL1-­‐F-­‐box   protein)   E3   ubiquitin-­‐protein   ligase   complexes   and   promote   the   ubiquitination   and  subsequent   proteasomal   degradation   of   target   proteins.   Promotes   proteasomal   degradation   of   COMMD1   and   IKBKB.  Modulates  NF-­‐kappa-­‐B   transcriptional  activity.  Nuclear   isoforms  promote  apoptosis.  Mitochondrial   isoforms  suppress  BAX-­‐dependent  release  of  cytochrome  c  into  the  cytoplasm  and  inhibit  apoptosis.  Plays  a  role  in  the  regulation  of  cell  proliferation.  Diseases  associated  with  CLU  include  cystadenoma  and  ovarian  cystadenoma.  

CRTAC1  Cartilage  acidic  protein  1   27,6   144,7   361,7   479,5   17,4  down  

This  gene  encodes  a  glycosylated  extracellular  matrix  protein  that  is  found  in  the  interterritorial  matrix  of  articular  deep  zone  cartilage.   This   protein   is   used   as   a   marker   to   distinguish   chondrocytes   from   osteoblasts   and   mesenchymal   stem   cells   in  culture.  The  presence  of  FG-­‐GAP  motifs  and  an  RGD  integrin-­‐binding  motif  suggests  that  this  protein  may  be  involved  in  cell-­‐cell  or  cell-­‐matrix  interactions.  Diseases  associated  with  CRTAC1  include  botulism  and  neurofibromatosis.  

DEFB103B   Beta-­‐defensin  103   952,9   695,9   354,4   29,7   32,0  up  

Defensins   form  a   family  of  microbicidal  and  cytotoxic  peptides  made  by  neutrophils.  Exhibits  antimicrobial  activity  against  Gram-­‐positive  bacteria  S.aureus  and  S.pyogenes,  Gram-­‐negative  bacteria  P.aeruginosa  and  E.coli  and  the  yeast  C.albicans.  Kills  multiresistant  S.aureus  and  vancomycin-­‐resistant  E.faecium.  This  gene  encodes  defensin,  beta  103,  which  has  broad  spectrum  antimicrobial  activity  and  may  play  an  important  role  in  innate  epithelial  defense.  Diseases  associated  with  DEFB103B  include  colitis  and  cystic  fibrosis.  

DEFB4A   Beta-­‐defensin  4A   6804,0   6052,6   4173,8   543,5   12,5  up  

Defensins   form   a   family   of   microbicidal   and   cytotoxic   peptides   made   by   neutrophils.   Members   of   the   defensin   family   are  highly   similar   in   protein   sequence.   This   gene   encodes   defensin,   beta   4,   an   antibiotic   peptide  which   is   locally   regulated   by  inflammation.  Diseases  associated  with  DEFB4A  include  tinea  corporis  and  middle  ear  cholesteatoma.  

GNAZ  

Guanine  nucleotide-­‐binding  protein  G(z)  subunit  alpha   13,4   17,2   18,1   170,3   12,7  down  

The  protein  encoded  by  this  gene  is  a  member  of  a  G  protein  subfamily  that  mediates  signal  transduction  in  pertussis  toxin-­‐insensitive   systems.   This   encoded   protein   may   play   a   role   in   maintaining   the   ionic   balance   of   perilymphatic   and  endolymphatic  cochlear   fluids  and  are   involved  as  modulators  or   transducers   in  various  transmembrane  signaling  systems.  Diseases  associated  with  GNAZ  include  pertussis  and  autosomal  dominant  congenital  stationary  night  blindness.  

98

GPX3  

Glutathione  peroxidase,  Glutathione  peroxidase  3   1314,7   842,2   351,6   119,2   11,0  up  

This  gene  product  belongs  to  the  glutathione  peroxidase  family,  which  functions  in  the  detoxification  of  hydrogen  peroxide.  Protects   cells   and   enzymes   from   oxidative   damage,   by   catalyzing   the   reduction   of   hydrogen   peroxide,   lipid   peroxides   and  organic  hydroperoxide,  by  glutathione.  Diseases  associated  with  GPX3  include  keshan  disease.  

GRP  Gastrin-­‐releasing  peptide   19,2   26,6   32,1   404,0   21,0  down  

This  gene  encodes  a  member  of  the  bombesin-­‐like  family  of  gastrin-­‐releasing  peptides.  GRP  stimulates  gastrin  release  as  well  as   other   gastrointestinal   hormones.   Operates   as   a   negative   feedback   regulating   fear   and   established   a   causal   relationship  between   GRP-­‐receptor   gene   expression,   long-­‐term   potentiation,   and   amygdala-­‐dependent   memory   for   fear.   Diseases  associated  with  GRP  include  diffuse  pulmonary  fibrosis  and  prostate  cancer.  

HEYL  

Hairy/enhancer-­‐of-­‐split-­‐related  with  YRPW  motif-­‐like  protein,  Hairy/enhancer-­‐of-­‐split  related  with  YRPW  motif-­‐like  protein   287,9   27,9   16,7   23,7   12,2  up  

This  gene  encodes  a  member  of  the  hairy  and  enhancer  of  split-­‐related  (HESR)  family  of  basic  helix-­‐loop-­‐helix  (bHLH)-­‐type  transcription   factors.   Downstream   effector   of   Notch   signaling   which   may   be   required   for   cardiovascular   development.  Transcriptional  repressor  which  binds  preferentially  to  the  canonical  E  box  sequence  5-­‐CACGTG-­‐3.  Represses  transcription  by  the  cardiac  transcriptional  activators  GATA4  and  GATA6.  

IL36RN  

Interleukin-­‐36  receptor  antagonist  protein   736,3   336,2   152,1   54,5   13,5  up  

The  protein  encoded  by  this  gene  is  a  member  of  the   interleukin  1  cytokine  family.  This  cytokine  was  shown  to  specifically  inhibit  the  activation  of  NF-­‐kappaB  induced  by  interleukin  1  family,  member  6  (IL1F6).  Part  of  the  IL-­‐36  signaling  system  that  is  thought  to  be  present  in  epithelial  barriers  and  to  take  part  in  local  inflammatory  response;  similar  to  the  IL-­‐1  system  with  which   it   shares   the   coreceptor.   Proposed   to   play   a   role   in   skin   inflammation.  May   activate   an   anti-­‐inflammatory   signaling  pathway   by   recruiting   SIGIRR.   Diseases   associated   with   IL36RN   include   acute   generalized   exanthematous   pustulosis   and  ditra.  

KCNE3  

Potassium  voltage-­‐gated  channel  subfamily  E  member  3,  Cardiac  voltage-­‐gated  potassium  channel  accessory  subunit  isoform  3b   6,2   7,1   9,8   78,4   12,6  down  

Voltage-­‐gated  potassium  (Kv)  channels  represent  the  most  complex  class  of  voltage-­‐gated  ion  channels  from  both  functional  and  structural  standpoints.  Their  diverse  functions  include  regulating  neurotransmitter  release,  heart  rate,  insulin  secretion,  neuronal   excitability,   epithelial   electrolyte   transport,   smooth   muscle   contraction,   and   cell   volume.   This   gene   encodes   a  member  of  the  potassium  channel,  voltage-­‐gated,  isk-­‐related  subfamily.  This  member  is  a  type  I  membrane  protein,  and  a  beta  subunit  that  assembles  with  a  potassium  channel  alpha-­‐subunit  to  modulate  the  gating  kinetics  and  enhance  stability  of  the  multimeric  complex.  This  gene   is  prominently  expressed   in  the  kidney.  A  missense  mutation   in  this  gene   is  associated  with  hypokalemic  periodic  paralysis.  Diseases  associated  with  KCNE3  include  brugada  syndrome  6  and  periodic  paralyses.  

KIF5C  Kinesin  heavy  chain  isoform  5C   3,3   2,4   2,4   42,8   12,9  down  

Mediates  dendritic   trafficking  of  mRNAs.   inesin   is  a  microtubule-­‐associated   force-­‐producing  protein   that  may  play  a  role   in  organelle  transport.  Diseases  associated  with  KIF5C  include  cortical  dysplasia,  complex,  with  other  brain  malformations  2  and  cortical  dysplasia,  complex,  with  other  brain  malformations.  

KIT  

Mast/stem  cell  growth  factor  receptor  Kit   17,5   71,8   194,0   356,6   20,3  down  

Tyrosine-­‐protein   kinase   that   acts   as   cell-­‐surface   receptor   for   the   cytokine   KITLG/SCF   and   plays   an   essential   role   in   the  regulation   of   cell   survival   and   proliferation,   hematopoiesis,   stem   cell   maintenance,   gametogenesis,   mast   cell   development,  migration  and  function,  and  in  melanogenesis.  In  response  to  KITLG/SCF  binding,  KIT  can  activate  several  signaling  pathways.  Phosphorylates  PIK3R1,  PLCG1,  SH2B2/APS  and  CBL.  Activates  the  AKT1  signaling  pathway  by  phosphorylation  of  PIK3R1,  the  regulatory  subunit  of  phosphatidylinositol  3-­‐kinase.  Activated  KIT  also  transmits  signals  via  GRB2  and  activation  of  RAS,  RAF1  and  the  MAP  kinases  MAPK1/ERK2  and/or  MAPK3/ERK1.  Promotes  activation  of  STAT  family  members  STAT1,  STAT3,  STAT5A   and   STAT5B.   Activation   of   PLCG1   leads   to   the   production   of   the   cellular   signaling   molecules   diacylglycerol   and  inositol   1,4,5-­‐trisphosphate.   KIT   signaling   is   modulated   by   protein   phosphatases,   and   by   rapid   internalization   and  degradation  of  the  receptor.  Activated  KIT  promotes  phosphorylation  of  the  protein  phosphatases  PTPN6/SHP-­‐1  and  PTPRU,  and  of  the  transcription  factors  STAT1,  STAT3,  STAT5A  and  STAT5B.  Promotes  phosphorylation  of  PIK3R1,  CBL,  CRK  (isoform  Crk-­‐II),  LYN,  MAPK1/ERK2  and/or  MAPK3/ERK1,  PLCG1,  SRC  and  SHC1.  Diseases  associated  with  KIT  include  sm-­‐ahnmd  and  extragonadal  seminoma.  

KLK6   Kallikrein-­‐6   1043,4   782,2   542,2   89,9   11,6  up   Kallikreins  are  a  subgroup  of  serine  proteases  having  diverse  physiological  functions.  Growing  evidence  suggests  that  many  

99

kallikreins  are   implicated   in   carcinogenesis  and  some  have  potential   as  novel   cancer  and  other  disease  biomarkers.   Shows  activity   against   amyloid   precursor   protein,   myelin   basic   protein,   gelatin,   casein   and   extracellular   matrix   proteins   such   as  fibronectin,   laminin,   vitronectin   and   collagen.   Degrades   alpha-­‐synuclein   and   prevents   its   polymerization,   indicating   that   it  may  be  involved  in  the  pathogenesis  of  Parkinson  disease  and  other  synucleinopathies.  May  be  involved  in  regulation  of  axon  outgrowth  following  spinal  cord  injury.  Tumor  cells  treated  with  a  neutralizing  KLK6  antibody  migrate  less  than  control  cells,  suggesting  a  role  in  invasion  and  metastasis.  Diseases  associated  with  KLK6  include  synucleinopathy  and  prostate  cancer.  

KRT12  Keratin,  type  I  cytoskeletal  12   1289,0   5987,3   10404,3   14419,6   11,2  down  

KRT12  encodes  the  type  I  intermediate  filament  chain  keratin  12,  expressed  in  corneal  epithelia.  Mutations  in  this  gene  lead  to  Meesmann  corneal  dystrophy.  May  play  a  unique   role   in  maintaining   the  normal   corneal  epithelial   function.  Together  with  KRT3,   essential   for   the   maintenance   of   corneal   epithelium   integrity.   Diseases   associated   with   KRT12   include   meesmann  corneal  dystrophy  and  recurrent  corneal  erosion.  

LAMA3  

Laminin  alpha-­‐3  chain  variant  2,  Laminin  subunit  alpha-­‐3,  Laminin  alpha  3  splice  variant  a   7729,6   1093,7   919,3   595,9   13,0  up  

Binding  to  cells  via  a  high  affinity  receptor,  laminin  is  thought  to  mediate  the  attachment,  migration  and  organization  of  cells  into  tissues  during  embryonic  development  by  interacting  with  other  extracellular  matrix  components.  aminin-­‐5  is  thought  to  be   involved   in   (1)   cell   adhesion   via   integrin   alpha-­‐3/beta-­‐1   in   focal   adhesion   and   integrin   alpha-­‐6/beta-­‐4   in  hemidesmosomes,   (2)   signal   transduction   via   tyrosine   phosphorylation   of   pp125-­‐FAK   and   p80,   (3)   differentiation   of  keratinocytes.   Diseases   associated   with   LAMA3   include   laryngoonychocutaneous   syndrome   and   lama3-­‐related   junctional  epidermolysis  bullosa.  

LAMC2  Laminin  subunit  gamma-­‐2   4798,9   504,0   377,3   429,7   11,2  up  

Binding  to  cells  via  a  high  affinity  receptor,  laminin  is  thought  to  mediate  the  attachment,  migration  and  organization  of  cells  into   tissues   during   embryonic   development   by   interacting  with   other   extracellular  matrix   components.   Ladsin   exerts   cell-­‐scattering  activity   toward  a  wide  variety  of  cells,   including  epithelial,  endothelial,  and   fibroblastic  cells.  Diseases  associated  with  LAMC2  include  cryptogenic  organizing  pneumonia  and  junctional  epidermolysis  bullosa  inversa.  

LCE3D  Late  cornified  envelope  protein  3D   1871,9   1995,6   1305,5   151,2   12,2  up   Precursors  of  the  cornified  envelope  of  the  stratum  corneum.  

MGP   Matrix  Gla  protein   90,9   119,2   144,3   3350,7   36,8  down  

The  protein  encoded  by  this  gene  is  secreted  and  likely  acts  as  an  inhibitor  of  bone  formation.  The  encoded  protein  is  found  in  the   organic   matrix   of   bone   and   cartilage.   Diseases   associated   with   MGP   include   acute   apical   periodontitis   and   keutel  syndrome.  

MMP10   Stromelysin-­‐2   402,9   17,8   3,4   3,2   126,9  up  

 Proteins   of   the   matrix   metalloproteinase   (MMP)   family   are   involved   in   the   breakdown   of   extracellular   matrix   in   normal  physiological  processes,  such  as  embryonic  development,  reproduction,  and  tissue  remodeling,  as  well  as  in  disease  processes,  such   as   arthritis   and   metastasis.   The   enzyme   encoded   by   this   gene   degrades   fibronectin,   gelatins   of   type   I,   III,   IV,   and   V;  weakly   collagens   III,   IV,   and  V.   Activates   procollagenase.  Diseases   associated  with  MMP10   include  mast   cell   neoplasm  and  epidermolysis  bullosa  dystrophica.  

MMP9  Matrix  metalloproteinase-­‐9   4538,2   241,1   74,0   49,1   92,4  up  

Proteins   of   the   matrix   metalloproteinase   (MMP)   family   are   involved   in   the   breakdown   of   extracellular   matrix   in   normal  physiological  processes,  such  as  embryonic  development,  reproduction,  and  tissue  remodeling,  as  well  as  in  disease  processes,  such   as   arthritis   and   metastasis.   Most   MMP's   are   secreted   as   inactive   proproteins   which   are   activated   when   cleaved   by  extracellular   proteinases.   The   enzyme   encoded   by   this   gene   degrades   type   IV   and  V   collagens.   Studies   in   rhesus  monkeys  suggest   that   the  enzyme   is   involved   in   IL-­‐8-­‐induced  mobilization  of  hematopoietic  progenitor  cells   from  bone  marrow,  and  murine   studies   suggest   a   role   in   tumor-­‐associated   tissue   remodeling.  May  play   an   essential   role   in   local   proteolysis   of   the  extracellular  matrix  and  in  leukocyte  migration.  Could  play  a  role  in  bone  osteoclastic  resorption.  Cleaves  KiSS1  at  a  Gly-­‐  -­‐Leu  bond.  Cleaves  type  IV  and  type  V  collagen  into  large  C-­‐terminal  three  quarter  fragments  and  shorter  N-­‐terminal  one  quarter  fragments.   Degrades   fibronectin   but   not   laminin   or   Pz-­‐peptide.   Diseases   associated   with   MMP9   include   metaphyseal  anadysplasia  2  and  central  nervous  system  tuberculosis.  

MYH4   Myosin-­‐4   3,1   3,6   4,5   92,4   29,6  down  

 Myosins  are  a  large  family  of  motor  proteins  that  share  the  common  features  of  ATP  hydrolysis,  actin  binding  and  potential  for  kinetic  energy   transduction.  Originally   isolated   from  muscle  cells   (hence   the  name),  almost  all  eukaryotic  cells  are  now  known  to  contain  myosins.  Structurally,  mysoins  contain  a  head  domain  that  binds  to  actin  filaments  (microfilaments)  and  is  the  site  of  ATP  hydrolysis.  The  tail  domain  interacts  with  cargo  molecules,  and  the  neck  acts  as  a  linker  between  the  head  and  tail  and  is  the  site  of  regulatory  myosin  light  chain  binding.  There  are  17  myosin  families  and  the  most  well  characterized  is  

100

myosin   II.   Myosin   II   is   found   predominantly   in   myocytes   and   mediates   plus-­‐ended   movement   along   microfilaments.   It   is  involved   in   muscle   contraction   through   cyclic   interactions   with   actin-­‐rich   thin   filaments,   creating   a   contractile   force.   It   is  regulated  by  phosphorylation  via  myosin  light  chain  kinase  (MLCK)  and  by  intracellular  Ca2+  concentrations.    

NPAS4  

Neuronal  PAS  domain-­‐containing  protein  4   2,8   5,6   3,5   49,1   17,3  down  

NXF  is  a  member  of  the  basic  helix-­‐loop-­‐helix-­‐PER  (MIM  602260)-­‐ARNT  (MIM  126110)-­‐SIM  (see  SIM2;  MIM  600892)  (bHLH-­‐PAS)  class  of  transcriptional  regulators,  which  are  involved  in  a  wide  range  of  physiologic  and  developmental  events.  Acts  as  a  transcriptional  activator  in  the  presence  of  ARNT.  Can  activate  the  CME  (CNS  midline  enhancer)  element  and  the  expression  of  the  drebrin  gene.  

PAMR1  Inactive  serine  protease  PAMR1   15,2   5,5   3,1   993,0   65,2  down    May  play  a  role  in  regeneration  of  skeletal  muscle.  

PI3   Elafin   98688,4   39556,7   15079,6   5935,0   16,6  up  

 This  gene  encodes  an  elastase-­‐specific  inhibitor  that  functions  as  an  antimicrobial  peptide  against  Gram-­‐positive  and  Gram-­‐negative  bacteria,  and  fungal  pathogens.  The  protein  contains  a  WAP-­‐type  four-­‐disulfide  core  (WFDC)  domain,  and  is  thus  a  member   of   the   WFDC   domain   family.   It   may   prevent   elastase-­‐mediated   tissue   proteolysis.   Diseases   associated   with   PI3  include  impetigo  herpetiformis  and  erysipelas.  

PLA2G16  HRAS-­‐like  suppressor  3   76,3   59,7   100,1   924,0   12,1  down  

Exhibits  PLA1/2  activity,  catalyzing  the  calcium-­‐independent  hydrolysis  of  acyl  groups  in  various  phosphatidylcholines  (PC)  and   phosphatidylethanolamine   (PE).   For   most   substrates,   PLA1   activity   is   much   higher   than   PLA2   activity.   Specifically  catalyzes  the  release  of  fatty  acids  from  phospholipids  in  adipose  tissue  (By  similarity).  N-­‐  and  O-­‐acylation  activity  is  hardly  detectable.  Might  decrease  protein  phosphatase  2A  (PP2A)  activity.  Diseases  associated  with  PLA2G16  include  neutral   lipid  storage  disease  and  lipid  storage  disease.  

PTHLH  

Parathyroid  hormone-­‐related  protein   737,2   71,0   36,9   47,2   15,6  up  

Neuroendocrine  peptide  which  is  a  critical  regulator  of  cellular  and  organ  growth,  development,  migration,  differentiation  and  survival   and   of   epithelial   calcium   ion   transport.   Regulates   endochondral   bone   development   and   epithelial-­‐mesenchymal  interactions  during  the  formation  of  the  mammary  glands  and  teeth.  Required  for  skeletal  homeostasis.  Promotes  mammary  mesenchyme   differentiation   and   bud   outgrowth   by   modulating   mesenchymal   cell   responsiveness   to   BMPs.   Upregulates  BMPR1A  expression  in  the  mammary  mesenchyme  and  this  increases  the  sensitivity  of  these  cells  to  BMPs  and  allows  them  to  respond   to   BMP4   in   a   paracrine   and/or   autocrine   fashion.   BMP4   signaling   in   the   mesenchyme,   in   turn,   triggers   epithelial  outgrowth  and  augments  MSX2  expression,  which  causes  the  mammary  mesenchyme  to  inhibit  hair  follicle  formation  within  the  nipple  sheath  (By  similarity).  Promotes  colon  cancer  cell  migration  and  invasion  in  an  integrin  alpha-­‐6/beta-­‐1-­‐dependent  manner  through  activation  of  Rac1.  Osteostatin  is  a  potent  inhibitor  of  osteoclastic  bone  resorption.  Diseases  associated  with  PTHLH  include  brachydactyly,  type  e2  and  invasive  malignant  thymoma.  

RASSF2  

Ras  association  domain-­‐containing  protein  2   10,3   10,6   20,4   224,1   21,7  down  

 This  gene  encodes  a  protein  that  contains  a  Ras  association  domain.  Similar  to  its  cattle  and  sheep  counterparts,  this  gene  is  located  near  the  prion  gene.  Potential  tumor  suppressor.  Acts  as  a  KRAS-­‐specific  effector  protein.  May  promote  apoptosis  and  cell  cycle  arrest.  Stabilizes  STK3/MST2  by  protecting  it  from  proteasomal  degradation.  

RERG  

Ras-­‐related  and  estrogen-­‐regulated  growth  inhibitor   33,8   155,7   294,3   479,2   14,2  down  

RERG,   a   member   of   the   RAS   superfamily   of   GTPases,   inhibits   cell   proliferation   and   tumor   formation.   Binds   GDP/GTP   and  possesses  intrinsic  GTPase  activity.  Has  higher  affinity  for  GDP  than  for  GTP.  In  cell  lines  overexpression  leads  to  a  reduction  in   the  rate  of  proliferation,  colony   formation  and   in   tumorigenic  potential.  Diseases  associated  with  RERG   include  pituitary  carcinoma.  

RGS4  

Regulator  of  G-­‐protein-­‐signaling  4,  Regulator  of  G-­‐protein  signaling  4   7,5   5,5   7,9   103,4   13,9  down  

 Regulator   of   G   protein   signaling   (RGS)   family   members   are   regulatory   molecules   that   act   as   GTPase   activating   proteins  (GAPs)  for  G  alpha  subunits  of  heterotrimeric  G  proteins.  Inhibits  signal  transduction  by  increasing  the  GTPase  activity  of  G  protein   alpha   subunits   thereby   driving   them   into   their   inactive   GDP-­‐bound   form.   Activity   on   G(z)-­‐alpha   is   inhibited   by  phosphorylation   of   the   G-­‐protein.   Activity   on   G(z)-­‐alpha   and   G(i)-­‐alpha-­‐1   is   inhibited   by   palmitoylation   of   the   G-­‐protein.  Diseases  associated  with  RGS4  include  schizophrenia.  

101

RGS5  

Regulator  of  G-­‐protein  signalling  5,  isoform  CRA_a;  Regulator  of  G-­‐protein-­‐signaling  5;  Regulator  of  G-­‐protein  signaling  5   11,2   7,5   9,5   124,5   11,1  down  

This  gene  encodes  a  member  of  the  regulators  of  G  protein  signaling  (RGS)  family.  The  RGS  proteins  are  signal  transduction  molecules  which   are   involved   in   the   regulation  of   heterotrimeric  G  proteins   by   acting   as  GTPase   activators.   This   gene   is   a  hypoxia-­‐inducible   factor-­‐1   dependent,   hypoxia-­‐induced   gene   which   is   involved   in   the   induction   of   endothelial   apoptosis.  Inhibits   signal   transduction   by   increasing   the   GTPase   activity   of   G   protein   alpha   subunits   thereby   driving   them   into   their  inactive  GDP-­‐bound   form.  Binds   to  G(i)-­‐alpha  and  G(o)-­‐alpha,  but  not   to  G(s)-­‐alpha.  Diseases  associated  with  RGS5   include  hypoxia  and  benign  paroxysmal  positional  nystagmus.  

RGSL1  

Regulator  of  G-­‐protein  signaling  protein-­‐like,  Regulator  of  G-­‐protein-­‐signaling  protein-­‐like   3,9   2,0   2,7   49,6   12,6    down    Unknown  function.  

SCRG1  Scrapie-­‐responsive  protein  1   2,6   2,9   3,0   46,2   18,0  down  

Scrapie-­‐responsive   gene   1   is   associated   with   neurodegenerative   changes   observed   in   transmissible   spongiform  encephalopathies.  It  may  play  a  role  in  host  response  to  prion-­‐associated  infections.  The  scrapie  responsive  protein  1  may  be  partly  included  in  the  membrane  or  secreted  by  the  cells  due  to  its  hydrophobic  N-­‐terminus.  

SLC13A5  Solute  carrier  family  13  member  5   79,4   23,2   12,7   6,2   12,9  up  

 This   gene  encodes  a  protein  belonging   to   the   solute   carrier   family  13  group  of  proteins.  This   family  member   is   a   sodium-­‐dependent   citrate   cotransporter   that   may   regulate   metabolic   processes.   High-­‐affinity   sodium/citrate   cotransporter   that  mediates   citrate   entry   into   cells.   The   transport   process   is   electrogenic;   it   is   the   trivalent   form   of   citrate   rather   than   the  divalent   form   that   is   recognized   as   a   substrate.   May   facilitate   the   utilization   of   circulating   citrate   for   the   generation   of  metabolic   energy   and   for   the   synthesis   of   fatty   acids   and   cholesterol.   iseases   associated   with   SLC13A5   include   epileptic  encephalopathy,  early  infantile,  25  and  ohtahara  syndrome.  

SOX11  Transcription  factor  SOX-­‐11   2,3   3,2   2,4   39,2   17,0  down  

This   intronless   gene   encodes   a   member   of   the   SOX   (SRY-­‐related   HMG-­‐box)   family   of   transcription   factors   involved   in   the  regulation   of   embryonic   development   and   in   the   determination   of   the   cell   fate.   The   encoded   protein   may   act   as   a  transcriptional   regulator   after   forming   a   protein   complex  with   other  proteins.   The  protein  may   function   in   the  developing  nervous   system   and   play   a   role   in   tumorigenesis.   May   also   have   a   role   in   tissue   modeling   during   development.   Diseases  associated  with  SOX11  include  mental  retardation,  autosomal  dominant,  27  and  mantle  cell  lymphoma.  

SPRR2B  Small  proline-­‐rich  protein  2B   497,4   531,9   285,5   15,1   33,0  up  

 Cross-­‐linked  envelope  protein  of  keratinocytes.  It  is  a  keratinocyte  protein  that  first  appears  in  the  cell  cytosol,  but  ultimately  becomes  cross-­‐linked  to  membrane  proteins  by  transglutaminase.  All   that  results   in  the   formation  of  an   insoluble  envelope  beneath  the  plasma  membrane.  Diseases  associated  with  SPRR2B  include  oral  squamous  cell  carcinoma.  

SPRR2D  Small  proline-­‐rich  protein  2D   33102,4   21851,4   12773,0   2130,5   15,5  up  

Cross-­‐linked  envelope  protein  of  keratinocytes.  It  is  a  keratinocyte  protein  that  first  appears  in  the  cell  cytosol,  but  ultimately  becomes  cross-­‐linked  to  membrane  proteins  by  transglutaminase.  All   that  results   in  the   formation  of  an   insoluble  envelope  beneath  the  plasma  membrane.  

SPRR2G  Small  proline-­‐rich  protein  2G   606,3   589,6   290,2   20,7   29,3  up  

 Cross-­‐linked  envelope  protein  of  keratinocytes.  It  is  a  keratinocyte  protein  that  first  appears  in  the  cell  cytosol,  but  ultimately  becomes  cross-­‐linked  to  membrane  proteins  by  transglutaminase.  All   that  results   in  the   formation  of  an   insoluble  envelope  beneath  the  plasma  membrane.  

SULF1  Extracellular  sulfatase  Sulf-­‐1   284,5   210,0   298,2   4237,4   14,9  down  

This   gene   encodes   an   extracellular   heparan   sulfate   endosulfatase.   xhibits   arylsulfatase   activity   and   highly   specific  endoglucosamine-­‐6-­‐sulfatase  activity.  It  can  remove  sulfate  from  the  C-­‐6  position  of  glucosamine  within  specific  subregions  of  intact  heparin.  Diminishes  HSPG   (heparan  sulfate  proteoglycans)   sulfation,   inhibits   signaling  by  heparin-­‐dependent  growth  factors,   diminishes   proliferation,   and   facilitates   apoptosis   in   response   to   exogenous   stimulation.   Diseases   associated   with  SULF1  include  mesomelia  and  mesomelia-­‐synostoses  syndrome.  

102

VCAM1  Vascular  cell  adhesion  protein  1   10,5   9,6   10,6   231,1   21,9  down  

 This   gene   is   a  member  of   the   Ig   superfamily   and   encodes   a   cell   surface   sialoglycoprotein   expressed  by   cytokine-­‐activated  endothelium.  This   type   I  membrane  protein  mediates   leukocyte-­‐endothelial   cell  adhesion  and  signal   transduction,  and  may  play   a   role   in   the   development   of   artherosclerosis   and   rheumatoid   arthritis.   Important   in   cell-­‐cell   recognition.   Appears   to  function   in   leukocyte-­‐endothelial   cell   adhesion.   Interacts   with   integrin   alpha-­‐4/beta-­‐1   (ITGA4/ITGB1)   on   leukocytes,   and  mediates  both  adhesion  and  signal  transduction.  The  VCAM1/ITGA4/ITGB1  interaction  may  play  a  pathophysiologic  role  both  in  immune  responses  and  in  leukocyte  emigration  to  sites  of  inflammation.  Diseases  associated  with  VCAM1  include  moorens  ulcer  and  vasculitis.  

WFDC12  

WAP  four-­‐disulfide  core  domain  protein  12   657,2   473,1   208,8   34,5   19,0  up  

 This   gene   encodes   a   member   of   the   WAP-­‐type   four-­‐disulfide   core   (WFDC)   domain   family.   The   WFDC   domain,   or   WAP  signature  motif,  contains  eight  cysteines  forming  four  disulfide  bonds  at  the  core  of  the  protein,  and  functions  as  a  protease  inhibitor.  Antibacterial  protein.    

WFDC5  

WAP  four-­‐disulfide  core  domain  protein  5   928,1   545,2   276,7   82,8   11,2  up  

 This  gene  encodes  a  member  of  the  WAP-­‐type  four-­‐disulfide  core  (WFDC)  domain  family.  Most  WFDC  proteins  contain  only  one   WFDC   domain,   and   this   encoded   protein   contains   two   WFDC   domains.   The   WFDC   domain,   or   WAP   signature   motif,  contains  eight  cysteines  forming  four  disulfide  bonds  at  the  core  of  the  protein,  and  functions  as  a  protease  inhibitor.  

ZFP42  Zinc  finger  protein  42  homolog   242,5   56,1   20,5   16,1   15,1  up  

 Involved  in  the  reprogramming  of  X-­‐chromosome  inactivation  during  the  acquisition  of  pluripotency.  Required  for  efficient  elongation  of  TSIX,  a  non-­‐coding  RNA  antisense  to  XIST.  Binds  DXPas34  enhancer  within  the  TSIX  promoter.   Involved  in  ES  cell  self-­‐renewal.  Diseases  associated  with  ZFP42  include  chromophobe  adenocarcinoma.  

ZNF853  Zinc  finger  protein  853   4,0   3,7   3,0   80,9   20,4  down    An  important  paralog  of  this  gene  is  ZFP42.    

             

103

Supplementary Figure 2.1. Graphical techniques

Stromal fibroblasts

cultured in the presence

of ascorbic acid during

40 days

Superposition of

2 sheets

After 7 days

Adding corneal

epithelial cells

Self-assembled stromal matrixEpithelialized stromal matrix

Maturation at the air-liquid

interface

After 7 days

Wounding using using a

8 mm diameter punch

Addition of two shets of

stromal matrix under

wounded tissue-engineered

cornea

Tissue-engineered

corneal wound healing

model

Wound

closure

(5 to 6 days)

Self-assembled stromal matrixEpithelialized stromal matrix

Tissue-engineered

biopsies

ECM +/- HCECs

Mass spectography

analyses

ECM expression

HCEC

Stroma -

HCEC

Stroma +

Microarray analyses

qPCR analyses

Zymographic analyses

MMPs mRNA expression

MMP-9 MMP-10 activity

HCECs cultivated on

BSA, CI, CIV, FN, TN, LM

matrix

Culture media

Western blot analyses

Zymographic analyses

MMPs expression

MMPs activity

Microarray analyses

qPCR analyses

RNA extraction

mRNA expression

MMPs

TIMPs

Interleukines

Growth factors

Transcription factors

Culture media

Western blot analyses

Zymographic analyses

MMPs expression

MMPs activity

Microarray analyses

qPCR analyses

RNA extraction

mRNA expression

MMPs

TIMPs

104

Chapitre III : Discussion et conclusion

3.1. Discussion Mes travaux de maitrise consistaient à vérifier l’hypothèse que la guérison des plaies cornéennes est un processus qui requiert des changements considérables dans l’expression de plusieurs gènes dont les produits permettent d’assurer une réépithélialisation adéquate de ce tissu. Pour se faire, l’analyse des changements transcriptionnels et protéiques occasionnés lors de la guérison d’une lésion de l’épithélium cornéen a été effectuée grâce à la cornée humaine reconstruite par génie tissulaire. Ce modèle in vitro de cornée lésée a permis de démontrer que plusieurs gènes sont dérégulés lors de la guérison des plaies dans ce modèle, dont plusieurs MMPs. En effet, l’analyse des données de la transcription génique, de l’expression protéique et de l’activité enzymatique a démontré que les MMPs sont indispensables aux processus de la cicatrisation de la cornée reconstruite, comme elles le sont pour la guérison des plaies cornéennes in vivo. Par exemple, les analyses en zymographie sur gel ont entre autres montré que la MMP-9 est active lors de la guérison de la lésion dans notre modèle, ce qui est conforme avec sa participation au remodelage de la MEC lors d’une blessure à la cornée in vivo. De même, cette présente étude a démontré que l’expression de MMPs variait en fonction de la composition de la MEC et de la présence ou non de cellules épithéliales. Cela suggère que les fibroblastes du stroma cornéen sécrètent des facteurs qui viennent moduler la transcription des gènes codants pour des protéines importantes pour la guérison des plaies, dont les MMPs, au niveau des cellules épithéliales cornéennes. L’interaction entre les cellules épithéliales et les fibroblastes via des facteurs diffusibles est donc essentielle pour que la guérison de la plaie s’effectue de manière adéquate. De plus, l’utilisation du modèle la de cornée reconstruite tridimensionnel a permis de valider que la présence des cellules épithéliales est requise pour l’élaboration d’une membrane basilaire fonctionnelle constituée des collagènes, des laminines et d’autres protéines de la MEC typiques de la membrane basilaire native. Ainsi, grâce au modèle de cornée reconstruite composée à la fois d’un épithélium et d’un stroma, il a été possible d’étudier l’expression des gènes et des protéines qui jouent un rôle clé lors de la cicatrisation de la cornée in

vitro.

105

3.1.1. Les forces de l’étude

L’une des principales forces du projet de recherche consiste en l’utilisation du modèle de cornée humaine reconstruite par génie tissulaire pour étudier la guérison des plaies. En effet, l’utilisation d’un modèle de cornée tridimensionnel entièrement constitué de cellules humaines et de MEC qu’elles sécrètent amène plusieurs avantages que les autres modèles ne peuvent reproduire. Ces modèles, que l’on peut qualifier de classiques, consistent en la culture de cellules en monocouche et en l’utilisation des modèles animaux. Malgré l’énorme potentiel qu’amène le génie tissulaire à l’étude de la guérison des plaies, il reste que ces deux modèles demeurent encore les plus utilisés lors d’études de la cicatrisation cornéenne.

Le modèle de cicatrisation des cellules épithéliales cornéennes en monocouche a été développé pour étudier principalement le processus de réépithélialisation à la suite d’une lésion de type mécanique. Cette méthode trouve son origine dans les années 80 et elle continue d’être utilisée aujourd’hui, autant avec des cellules animales qu’avec des cellules humaines (Hampel et al., 2016; Kramerov, Saghizadeh, Maguen, Rabinowitz, & Ljubimov, 2015; Simmons et al., 1987). Dans ce modèle en monocouche, la lésion de type égratignure (‘scratch’) est provoquée au centre du pétri à l’aide de la pointe d’une pipette, d’un scalpel ou d’un poinçon à biopsie une fois que les cellules ont atteint la confluence (Jumblatt & Neufeld, 1986). De cette manière, le modèle de cellules en monocouche rend possible l’étude des mécanismes de prolifération et de migration des cellules épithéliales. Par ailleurs, l’ajout de différents substrats biologiques dans le fond de pétri, tels que des protéines de la MEC, permet l’étude de l’adhésion cellulaire et des interactions cellules-matrice (J. Lake et al., 2015; Yanez-Soto, Liliensiek, Gasiorowski, Murphy, & Nealey, 2013). La simplicité de cette méthode permet également le prélèvement des facteurs qui sont sécrétés par les cellules dans le milieu de culture afin de les analyser. Enfin, l’effet de certains produits comme des facteurs de croissance, des cytokines et des agents pharmacologiques, sur la fermeture de la lésion peut facilement être vérifié à l’aide de ce modèle (Imanishi et al., 2000b; Nakamura & Nishida, 1999). La culture de cellules en monocouche amène également la possibilité de cultiver à différentes densités afin de reproduire le contexte cellulaire lors de la cicatrisation. Par exemple, les cellules cultivées à faible confluence miment un épithélium en processus de cicatrisation, tandis que celles cultivées à haute densité cellulaire miment un épithélium quiescent (J. Lake et al., 2015; K. Larouche et al., 2000; Zaniolo et al., 2004). Malgré l’étendue des possibilités d’analyses que permet le modèle de

106

cicatrisation des cellules épithéliales cornéennes en monocouche, il demeure que la présence d’un épithélium seul ne permet pas d’étudier adéquatement la guérison de la cornée. En effet, cette méthode ne permet pas l’étude des interactions entre les différents types cellulaires que l’on retrouve dans la cornée native. Comme l’importance du ‘cross-talk’ entre les cellules épithéliales et les kératocytes lors de la guérison des plaies a été établie, l’absence de kératocytes dans ce modèle est une lacune majeure (F. S. Yu, Yin, Xu, & Huang, 2010)(Wilson, Liu, & Mohan, 1999). De même, l’absence de stratification dans l’épithélium en monocouche rend impossible l’étude des interactions cellules-cellules et de la différenciation cellulaire. Enfin, comme les cellules sont généralement cultivées sur un substrat de plastique, les interactions des cellules basales avec la MEC, très importantes pour la guérison, sont absentes dans ce modèle. Néanmoins, le modèle de cicatrisation des cellules épithéliales cornéennes en monocouche est peu couteux et permet d’analyser rapidement certains processus cellulaires comme la migration et la prolifération (Saika et al., 2002).

En parallèle à la technique de culture en monocouche, plusieurs équipes se sont tournées vers l’utilisation de modèles in vivo afin d’étudier la cicatrisation cornéenne. L’un des principaux avantages du modèle animal est la variété des types de plaies qui peuvent être produites. Par exemple, des brûlures chimiques ou thermiques et la kératectomie sont utilisées pour produire une lésion sur la surface cornéenne ou en profondeur (affectant la membrane de Bowman et le stroma). Parmi les modèles animaux les plus populaires pour l’étude de la guérison des plaies cornéennes figurent la souris (Yuan et al., 2013), le rat (Hutcheon et al., 2005), le chat (Buhren et al., 2009; Nagy et al., 2007) et le lapin (Tandon et al., 2013; Yamada, Yanai, Nakamura, Inui, & Nishida, 2004). Comparativement aux autres modèles, ce dernier possède certains avantages qui justifient son utilisation. D’abord, l’œil du lapin possède une taille comparable à celle de l’oeil humain, ce qui permet l’application des mêmes techniques de chirurgies effectuées chez le patient (Pallikaris, Papatzanaki, Stathi, Frenschock, & Georgiadis, 1990). Il a également été démontré que la cicatrisation cornéenne chez le lapin s’effectue de façon similaire à la cornée humaine en termes de temps de cicatrisation, de l’étendue de la cicatrisation et de la formation de myofibroblastes (Helena, Baerveldt, Kim, & Wilson, 1998; R. R. Mohan et al., 2003; Netto et al., 2006). Toutefois, l’une des principales limitations à l’utilisation de ces cornées est que les cellules endothéliales de lapin possèdent un fort potentiel prolifératif comparativement à l’absence de mitose que l’on observe chez les cellules endothéliales humaines (Abib & Barreto, 2001). Par conséquent, l’utilisation du lapin est contre-indiquée pour étudier la guérison de l’endothélium cornéen (Valdez-Garcia, Lozano-Ramirez,

107

& Zavala, 2015). Une seconde distinction avec la cornée humaine est la localisation des cellules souches, lesquelles sont situées dans la couche basale de l’épithélium central chez le lapin et non restreintes au limbe, tel que c’est le cas pour la cornée humaine (Haddad & Faria-e-Sousa, 2014). Malgré tout, les expériences de guérison des plaies menées in vivo chez l’animal permettent une représentation plus réaliste et plus complète des mécanismes cicatriciels grâce à la présence de tous les types cellulaires, des signaux provenant de l’inflammation provoquée par la lésion, des interactions cellules-cellules et cellules-matrice. D’ailleurs, l’utilisation des animaux est obligatoire afin de mener des essais précliniques préalablement aux études cliniques chez l’être humain ("ICH Guidance Document S6(R1): Preclinical Safety Evaluation of Biotechnology-Derived Pharmaceuticals ", 2016). Néanmoins, l’utilisation des modèles animaux lors de projets de recherche possède certains désavantages non-négligeables. En plus d’être dispendieuses, les études de la guérison des plaies menées chez l’animal sont souvent complexes et laborieuses en raison des problèmes éthiques que soulève la création d’une lésion chez l’animal et de la grande variabilité entre les animaux, ce qui peut générer des lacunes dans la reproductibilité de l’expérience (Bayne & Wurbel, 2014; Graham & Prescott, 2015). De même, certains animaux possèdent des cornées ou des globes oculaires ayant des caractéristiques physiologiques uniques, ce qui peut compliquer la transposition des résultats obtenus à l’être humain (Stephens, Caley, & Peake, 2013).

Dans l’optique de vouloir utiliser le meilleur modèle d’étude de la guérison des plaies cornéennes, la cornée reconstruite par auto-assemblage a été choisie pour effectuer mon projet de maitrise. Ce modèle a pour principal avantage de reproduire le phénotype humain et ce, in vitro. En effet, leur composition en cellules humaines non-transformées et l’absence de matériel exogène font en sorte que les cornées reconstruites par auto-assemblage reproduisent un phénotype cornéen similaire à la cornée native (voir section 1.3.2.2.). La présence d’un stroma et d’un endothélium apporte un aspect tridimensionnel intéressant pour l’étude des interactions entre les différents types cellulaires et cellules-matrice (Patrick Carrier et al., 2009). Par ailleurs, ce modèle a été validé pour l’étude de la guérison des plaies cornéennes puisqu’il mime plusieurs aspects de la réépithélialisation in vivo, notamment la migration convexe des cellules épithéliales, la prolifération cellulaire en périphérie et la restauration d’un épithélium pluristratifié (Patrick Carrier et al., 2008). Ce modèle, relativement peu dispendieux à produire, diminue la variabilité entre les résultats puisque les cornées reconstruites sont produites au même moment en utilisant le même protocole. Elles offrent aussi la possibilité d’étudier plusieurs conditions simultanément puisqu’il est possible d’en produire en grande quantité.

108

Ainsi, en raison de leur capacité à reproduire les processus de cicatrisation cornéenne, de leur grande disponibilité et surtout, de leur composition en cellules et MEC entièrement dérivées de l’être humain, il nous apparaît clair que le meilleur choix pour étudier la guérison des plaies cornéennes demeure la cornée humaine reconstruite par auto-assemblage.

3.1.2. Les limites de l’étude

Bien que la cornée humaine reconstruite par auto-assemblage constitue un modèle d’étude optimal et novateur pour l’étude de la guérison des plaies, il n’en demeure pas moins que ce modèle n’est pas parfait et comporte certaines limites. D’abord, il est important de mentionner que ce modèle n’est pas en mesure de reproduire l’ensemble des mécanismes cicatriciels qui se déroulent in vivo en raison de l’absence film lacrymal à la surface épithéliale, de nerfs et de cellules immunitaires au sein du tissu. Ainsi, la contribution des processus inflammatoires essentiels à la guérison des plaies cornéennes ne peut être étudiée. De même, certaines composantes retrouvées dans le milieu de culture, en particulier le sérum de veau fétal, modifie le phénotype des kératocytes quiescents du stroma vers un phénotype plus fibroblastique en culture (Beales, Funderburgh, Jester, & Hassell, 1999; Berryhill et al., 2002). Ainsi, les cellules du stroma reconstruit possèdent des propriétés différentes des kératocytes du stroma natif, notamment au niveau de leur capacité proliférative, migratoire et signalétique plus importante dans le stroma reconstruit (Torricelli, Santhanam, Wu, Singh, & Wilson, 2016). Toutefois, l’augmentation de ces processus cellulaires peut s’avérer être un avantage dans le contexte d’études portant sur la guérison des plaies puisqu’ils favorisent la cicatrisation. Également, certaines structures de la cornée native ne sont pas présentes dans la cornée reconstruite. D’abord, la méthode utilisée pour reconstruire la cornée ne permet pas l’élaboration d’une membrane de Bowman à la base de l’épithélium. Ensuite, l’absence d’une couche endothéliale constitue une autre limite du modèle de la cornée reconstruite. Lors de la présente étude, cette omission était volontaire afin de simplifier les étapes de la culture cellulaire. D’ailleurs, il a été démontré que les cellules endothéliales n’influencent ni la composition, ni l’organisation de la MEC dans notre modèle reconstruit (S. Proulx et al., 2010a). D’autres travaux ont néanmoins démontré que l’ajout des cellules endothéliales favoriserait une meilleure différenciation des cellules épithéliales et l’élaboration d’une membrane basilaire mieux structurée (Zieske et al., 1994a). Il serait

109

alors intéressant d’approfondir cet aspect. Comme nous possédons l’expertise au laboratoire pour la reconstruction d’une cornée formée des trois couches natives par auto-assemblage, il serait alors possible d’étudier l’impact de la couche endothéliale sur la guérison des plaies cornéennes (S. Proulx et al., 2010a). Enfin, le dernier aspect plus problématique du modèle de la cornée reconstruite par auto-assemblage concerne le choix des populations de cellules en fonction de l’âge des donneurs lors de la reconstruction de l’équivalent cornéen. En effet, il a été démontré que les cellules épithéliales provenant de prépuces de nouveau-nés ont une durée de vie plus élevée en culture comparativement aux cellules adultes puisqu’elles possèdent un nombre plus élevé de cellules souches, ce qui explique pourquoi elles conservent mieux leur phénotype au fils des passages en culture (Michel et al., 1996). Par conséquent, il a fallu porter une attention particulière au choix de la population de cellules épithéliales pour la production des cornées humaines reconstruites utilisées dans cette étude. Nous avons donc opté pour trois populations de cellules épithéliales provenant d’adultes âgés de 44, 52 et 71 ans afin de s’assurer que l’on puisse comparer notre modèle reconstruit avec la cornée native adulte. En effet, aucune différence marquante entre ces trois populations de cellules adultes n’a été relevée lors de cette étude, assurant ainsi la validité des résultats obtenus.

3.1.3. L’effet de vague signalétique

Un aspect de l’étude particulièrement surprenant et novateur concerne l’effet de vague signalétique que nous avons observé de la section lésée (centre) vers la périphérie (externe) de la cornée reconstruite lors de la guérison des plaies. En effet, les analyses sur biopuces à ADN nous ont permis de constater que 1098 gènes sont dérégulés dans les trois sections (centre, interne et externe) des cornées lésées par rapport aux contrôles non-lésés (Figure 2.2 D). De même, la dérégulation des gènes entre les sections externes des cornées lésées et les cornées contrôles démontrent que la lésion, effectuée au centre de la cornée reconstruite, influence l’expression génique des cellules distantes à la lésion. Cela suggère donc que les cellules en marge de la plaie transmettent des signaux aux cellules voisines, lesquels se propagent jusqu’aux extrémités externes de la cornée reconstruite. La transmission de ces signaux peut avoir lieu de deux manières, soit via les jonctions cellulaires ou par diffusion dans le milieu de culture. Comme les étapes de la guérison

110

de la cornée reconstruite s’effectue à l’interface air-liquide, il serait peu probable que les facteurs en provenance de l’épithélium cornéen traversent le stroma et aboutissent dans le milieu de culture. Par conséquent, l’hypothèse la plus probable qui permet d’expliquer cet effet de vague signalétique serait que les facteurs transitent via les jonctions cellulaires à travers l’épithélium. Comme cette présente étude est la première à décrire un tel effet de vague traversant l’ensemble d’un tissu reconstruit lors de la cicatrisation, peu d’éléments sont connus quant aux mécanismes moléculaires qui assurent la transmission des facteurs entre les cellules et l’identité de ces derniers. Le phénomène de vague signalétique a toutefois été observé lors d’études réalisées sur des cellules en culture monocouche. En effet, en utilisant une culture primaire d’astrocytes, l’équipe de Gordon a démontré que la lésion induit l’influx de Ca2+ vers l’intérieur de la cellule, qui se transmet ensuite via les jonctions ‘gap’ aux cellules voisines intactes. Cet influx soudain de Ca2+ cause ensuite l’activation de la voie JNK/c-Jun/AP-1, ce qui peut expliquer en partie la transmission du signal (Gordon et al., 2011). Puisque la transcription de la sous-unité de c-Jun est augmentée lors de la guérison des plaies de nos cornées reconstruites, il se pourrait que la transmission du signal s’explique par l’activation de la voie JNK/c-Jun/AP-1 dans notre modèle également. En 2006, une équipe s’est intéressée aux signaux électriques générés dans l’épithélium cornéen lors de la cicatrisation. À l’aide d’un modèle de cellules épithéliales cornéennes cultivées en monocouche, cette équipe a démontré que la lésion provoque instantanément une entrée de Ca2+ dans les cellules en marge de la lésion, qui se propage en vague pour atteindre les cellules éloignées. Par ailleurs, cette vague signalétique de Ca2+ est essentielle à la guérison, car l’inhibition du Ca2+ par le traitement à la thapsigargine ou l’incubation des cellules dans un milieu sans Ca2+ arrête complètement la guérison de la lésion (Leiper et al., 2006). Par ailleurs, il a été démontré que la propagation du signal électrique provenant de l’influx de Ca2+ dans l’épithélium cornéen provoque la redistribution des canaux chloriques vers les fronts de migration, ce qui augmente le potentiel migratoire des cellules épithéliales et favorisent la guérison de la plaie (Cao, Zhang, Liu, Chen, & Zhao, 2010). Grâce à ces évidences, il est légitime de croire que l’effet de vague signalétique obtenu dans notre modèle de cornée reconstruite lésée s’explique en partie grâce à l’influx de Ca2+ en provenance des cellules en marge de la lésion, qui se transmet par les contacts cellules-cellules jusqu’aux cellules éloignées.

En perspective, il serait intéressant d’étudier spécifiquement cet effet de vague signalétique sur différents tissus reconstruits lésés. Par exemple, il serait possible de procéder à la reconstruction d’équivalents de cornée et de peau de forme rectangulaire dont l’aire est plus grande et d’effectuer

111

une lésion à une extrémité. Par la suite, le tissu pourrait être découpé en quelques sections rectangulaires en partant de la marge de la lésion jusqu’à l’extrémité opposée et celles-ci pourraient par la suite être analysées en profilage génique pour vérifier jusqu’où l’effet de vague peut se propager dans le tissu reconstruit. Il serait aussi intéressant, en exploitant ce type de modèle, de modifier ou alors bloquer la signalisation induite par le Ca2+, ce qui permettrait de démontrer la contribution de ce mécanisme à l’effet de vague. De plus, il serait intéressant de reconstruire à nouveau des cornées lésées, mais plutôt que de prélever les biopsies centre, interne et externe au quatrième jour de fermeture des plaies, d’attendre quelques jours après que la plaie soit guérie. Cela permettrait alors de vérifier si la région externe présente un patron d’expression génique semblable à celui de la cornée non-lésée ou si elle continue d’exprimer des gènes importants pour la guérison des plaies une fois que la plaie est refermée.

3.2. Perspective de recherche Lors de ce projet de maitrise, l’analyse des changements transcriptionnels et protéiques occasionnés lors de la guérison d’une lésion de l’épithélium cornéen a été réalisée, et ce, en accordant une attention particulière aux MMPs, notamment la MMP-2 et la MMP-9. L’obtention de résultats originaux mettant en lumière les différents processus de la cicatrisation cornéenne ouvre la voie à de nouvelles perspectives ainsi qu’à de futurs projets qui seront décrits dans les prochains paragraphes.

D’abord, une perspective réalisable à court terme concerne l’étude de l’activité enzymatique des MMPs. Dans l’article constituant le chapitre 2 de ce mémoire, nous avons uniquement analysé l’activité enzymatique de la MMP-2 et de la MMP-9 par zymographie sur gel de gélatine. Ce choix a été retenu en fonction du substrat commun de ces deux MMPs : la gélatine. Comme l’activité enzymatique des autres MMPs dérégulées lors de la guérison des plaies cornéennes dans notre modèle n’a pas été vérifiée, il serait intéressant de procéder à d’autres analyses en zymographies sur gel. Par exemple, nous avons démontré, par profilage génique et qPCR, que l’expression génique des MMPs -1, -3, -10 et -11 augmente abruptement lors de la guérison des plaies dans notre modèle. Comme il est connu que l’expression génique ne corrèle pas toujours avec l’activité enzymatique, il serait important de vérifier l’activité enzymatique de ces MMPs par zymographie sur gel de collagène. Cela impliquerait la mise au point de la technique de zymographie sur gel, en

112

remplaçant la gélatine par le substrat principal de ces MMPs, qui est le collagène. De cette manière, il serait possible de démontrer de manière plus exacte et réaliste la contribution de ces enzymes à la guérison des plaies dans notre modèle de cornée reconstruite.

Par ailleurs, l’inhibition des MMPs par la technique d’interférence à l’ARN pourrait constituer une suite logique au projet. L’interférence à l’ARN mise sur le principe qu’un ARN interférant produit contre un ARNm spécifique conduit à sa dégradation et entraine ainsi la suppression de sa transcription et de sa traduction en protéine (Weinberg & Morris, 2016). D’ailleurs, cette technique est présentement utilisée lors d’études visant à vérifier l’impact de l’inhibition de la MMP-9 sur la capacité métastatiques des cellules cancéreuses (Guo, Tian, Cui, Fang, & Yang, 2015; Jia, Gao, Zhang, Yang, & Zhang, 2013). Cependant, l’inhibition des MMPs par interférence à l’ARN n’a jamais été réalisée dans un modèle tridimensionnel de cornée reconstruite. Cette approche apporterait donc de nouvelles connaissances à propos des conséquences de l’inhibition d’une seule ou de plusieurs MMPs sur la guérison des plaies cornéennes. Par exemple, on pourrait s’attendre à ce que l’inhibition de la MMP-9 entraîne des défaillances lors de la réépithélialisation, notamment au niveau du mouvement des fronts migratoires en raison d’une diminution du remodelage de la MEC pendant la migration. On pourrait également comparer l’effet de l’inhibition des différentes MMPs, ce qui permettrait de préciser pour chacune leur rôle lors de la cicatrisation cornéenne. Il est même probable que la vitesse de fermeture des plaies soit affectée par l’inhibition d’une ou de plusieurs MMPs.

Un autre aspect qu’il serait également intéressant d’étudier est la régulation génique de la MMP-9 humaine lors de la guérison des plaies de la cornée. En effet, quelques études se sont consacrées à la régulation génique de la MMP-9 au niveau de son promoteur et des facteurs de transcription qui régulent son expression lors de processus liés au cancer (Andela et al., 2003; St-Pierre, Couillard, & Van Themsche, 2004), mais très peu d’équipes se sont attardées au contexte de la cicatrisation cornéenne. Il est connu qu’une petite région du promoteur du gène MMP-9 située entre les positions -440 et -522 est requise par le TGF-β et l’IL-1 pour l’expression de la MMP-9 (Gordon et al., 2009). Cependant, l’interaction des facteurs de transcription avec cette région du promoteur demeure incomprise. Comme nous possédons l’expertise au laboratoire quant à l’étude de la régulation génique grâce aux travaux antérieurs menés par l’équipe du Dr Guérin, ce projet serait tout à fait réalisable. Il faudrait d’abord exploiter la technique de retard sur gel de polyacrylamide (‘EMSA’) afin

113

de déterminer la nature et l’identité (par analyse de super-rétention en gel EMSA à l’aide d’anticorps spécifiques) des facteurs de transcription qui lient préférentiellement la séquence -440 et -522 du promoteur MMP-9 lors de la guérison des plaies de notre modèle de cornée reconstruite. Une fois ces derniers identifiés, il serait alors possible de définir s’ils activent ou répriment la transcription dirigée par le promoteur MMP-9 en les éliminant du promoteur par mutagenèse dirigée. La suppression d’expression de ces facteurs de transcription pourrait également être réalisée de manière stable dans les cellules épithéliales de cornées humaines par RNAi ou alors en exploitant la technologie CRISPR/Cas9 avant leur utilisation dans la production de cornées humaines reconstruites. Au final, cette étude permettrait de mieux comprendre les mécanismes moléculaires qui régulent la transcription de la MMP-9 dans le contexte de la cicatrisation cornéenne.

Enfin, cette présente étude a permis de mettre en évidence d’autres gènes dont l’expression est modifiée lors de la guérison des plaies dans notre modèle de cornée reconstruite. En effet, parmi les 55 gènes les plus dérégulés dans notre modèle de cornée lésée, plusieurs codent pour des protéines importantes pour la cicatrisation et mériteraient d’être analysés de manière plus approfondie. Par exemple, nous avons démontré que l’expression des laminines LAMA3 et LAMC2 est considérablement augmentée lors de la guérison des plaies dans nos cornées reconstruites (Figure 2.2 E). Cela concorde avec le fait que l’inhibition de la queue N-terminal de la LAMA3, par interférence à l’ARN, diminue la capacité des kératinocytes de la peau à réparer une lésion de type égratignure in vitro (Hamill, Langbein, Jones, & McLean, 2009). Il a aussi été démontré que la synthèse protéique de la LAMC2 augmente dans la plaie à la suite de brûlures effectués à l’intérieur de l’oreille de la souris (Chang et al., 2009). Comme ces deux types de laminines semblent importants pour les processus de cicatrisation, et qui sont, par le fait même, régulées positivement lors de la guérison des plaies cornéennes dans notre modèle de cornée reconstruite, il serait intéressant de vérifier leurs fonctions lors de la cicatrisation cornéenne.

114

3.3. Conclusion générale

L’objectif de ce projet de maitrise consistait à analyser les changements transcriptionnels et protéiques qui se produisent lors de la guérison d’une lésion de l’épithélium cornéen en accordant une attention particulière aux MMPs. Pour y arriver, la cornée humaine reconstruite par auto-assemblage a été choisie en guise de modèle d’étude grâce à sa capacité à reproduire les processus de la cicatrisation de la cornée humaine et ce, in vitro. L’originalité de ce projet réside ainsi dans l’utilisation d’un modèle tridimensionnel de cornée humaine afin d’y mettre en évidence la participation des MMPs dans le remodelage de la MEC, qui est comparable à la cornée native. En plus des MMPs, l’utilisation de ce modèle d’étude a permis de mettre en lumière l’expression d’autres gènes essentiels aux processus de la guérison de la cornée. Ainsi, la cornée reconstruite s’avère un excellent modèle d’étude de la guérison des plaies.

Globalement, l’ensemble des résultats présentés dans ce mémoire conduit à une meilleure compréhension des processus cellulaires impliqués dans la réépithélialisation, la différenciation terminale, la migration cellulaire, la prolifération cellulaire et l’adhésion des cellules épithéliales à la membrane basilaire. De plus, les résultats apparaissant dans le chapitre 2 de ce mémoire appuient le fait que la présence à la fois d’un épithélium et d’un stroma cornéen est essentielle pour l’établissement d’une membrane basilaire fonctionnelle et pour les processus cicatriciels impliquant l’interaction entre les cellules épithéliales et les kératocytes.

Enfin, ces nouvelles informations pourront certainement mener à des progrès en clinique, notamment au niveau du développement de thérapies visant à traiter les troubles de la cornée affectant la vision. Par exemple, l’identification des facteurs contrôlant la transcription de la MMP-9 pourrait mener à l’identification de cibles thérapeutiques potentielles dont l’expression pourrait être modifiée afin d’améliorer la guérison des plaies en clinique. En effet, comme il est connu que le risque de complications augmente lorsque la guérison de la blessure cornéenne est lente, il serait avantageux de développer un médicament qui permettrait d’accélérer la guérison des plaies cornéennes.

115

Bibliographie

Abib, F. C., & Barreto, J. (2001). Behavior of corneal endothelial density over a lifetime. Journal of Cataract & Refractive Surgery, 27(10), 1574-1578.

Agrawal, V. B., & Tsai, R. J. (2003). Corneal epithelial wound healing. Indian J Ophthalmol, 51(1), 5-15.

Ahmed, F., House, R. J., & Feldman, B. H. (2015). Corneal Abrasions and Corneal Foreign Bodies. Primary care, 42(3), 363-375.

Andela, V. B., Gordon, A. H., Zotalis, G., Rosier, R. N., Goater, J. J., Lewis, G. D., . . . O'Keefe, R. J. (2003). NFkappaB: a pivotal transcription factor in prostate cancer metastasis to bone. Clin Orthop Relat Res(415 Suppl), S75-85.

Antipolis, S. (1985). Epidermal Morphogenesis and Induction of the 67 kD Keratin Polypeptide by Culture of Human Keratinocytes at the Liquid-Air Interface. Experimental Cell Research, 159, 536-539.

Auger, F. a., Berthod, F., Moulin, V., Pouliot, R., & Germain, L. (2004). Tissue-engineered skin substitutes: from in vitro constructs to in vivo applications. Biotechnology and applied biochemistry, 39(Pt 3), 263-275.

Azar, D. T., Chang, J.-H., & Han, K. Y. (2012). Wound healing after keratorefractive surgery: review of biological and optical considerations. Cornea, 31 Suppl 1(0 1), S9-19.

Barczyk, M., Carracedo, S., & Gullberg, D. (2010). Integrins. Cell Tissue Res, 339(1), 269-280.

Basak, S. K., Basak, S., Mohanta, A., & Bhowmick, A. (2005). Epidemiological and microbiological diagnosis of suppurative keratitis in Gangetic West Bengal, eastern India. Indian journal of ophthalmology, 53(March), 17-22.

Bayne, K., & Wurbel, H. (2014). The impact of environmental enrichment on the outcome variability and scientific validity of laboratory animal studies. Rev Sci Tech, 33(1), 273-280.

Beales, M. P., Funderburgh, J. L., Jester, J. V., & Hassell, J. R. (1999). Proteoglycan synthesis by bovine keratocytes and corneal fibroblasts: maintenance of the keratocyte phenotype in culture. Invest Ophthalmol Vis Sci, 40(8), 1658-1663.

Beems, E. M., & Van Best, J. A. (1990). Light transmission of the cornea in whole human eyes. Exp Eye Res, 50(4), 393-395.

116

Beliveau, A., Berube, M., Rousseau, A., Pelletier, G., & Guerin, S. L. (2000). Expression of integrin alpha5beta1 and MMPs associated with epithelioid morphology and malignancy of uveal melanoma. Investigative ophthalmology & visual science, 41(8), 2363-2372.

Benbow, U., & Brinckerhoff, C. E. (1997). The AP-1 site and MMP gene regulation: what is all the fuss about? Matrix Biol, 15(8-9), 519-526.

Berryhill, B. L., Kader, R., Kane, B., Birk, D. E., Feng, J., & Hassell, J. R. (2002). Partial restoration of the keratocyte phenotype to bovine keratocytes made fibroblastic by serum. Invest Ophthalmol Vis Sci, 43(11), 3416-3421.

Beuerman, R. W., & Pedroza, L. (1996). Ultrastructure of the human cornea. Microscopy research and technique, 33(4), 320-335.

Bian, F., Pelegrino, F. S., Pflugfelder, S. C., Volpe, E. A., Li, D. Q., & de Paiva, C. S. (2015). Desiccating Stress-Induced MMP Production and Activity Worsens Wound Healing in Alkali-Burned Corneas. Invest Ophthalmol Vis Sci, 56(8), 4908-4918.

Bonanno, J. A. (2012). Molecular mechanisms underlying the corneal endothelial pump. Exp Eye Res, 95(1), 2-7.

Bonnans, C., Chou, J., & Werb, Z. (2014). Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol, 15(12), 786-801.

Borrone, R. (2012). A new strategy for diurnal intraocular pressure curve. Eur J Ophthalmol, 22(6), 964-971.

Bouchard, C. S., Morno, K., Perkins, J., McDonnell, J. F., & Dicken, R. (2001). Ocular complications of thermal injury: a 3-year retrospective. The Journal of trauma, 50(1), 79-82.

Brazzell, R. K., Stern, M. E., Aquavella, J. V., Beuerman, R. W., & Baird, L. (1991). Human recombinant epidermal growth factor in experimental corneal wound healing. Invest Ophthalmol Vis Sci, 32(2), 336-340.

Brew, K., Dinakarpandian, D., & Nagase, H. (2000). Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Biophys Acta, 1477(1-2), 267-283.

Brew, K., & Nagase, H. (2010). The tissue inhibitors of metalloproteinases (TIMPs): an ancient family with structural and functional diversity. Biochim Biophys Acta, 1803(1), 55-71.

Buhren, J., Nagy, L., Swanton, J. N., Kenner, S., MacRae, S., Phipps, R. P., & Huxlin, K. R. (2009). Optical effects of anti-TGFbeta treatment after photorefractive keratectomy in a cat model. Invest Ophthalmol Vis Sci, 50(2), 634-643.

117

Bunker, D. J. L., George, R. J., Kleinschmidt, A., Kumar, R. J., & Maitz, P. (2014). Alkali-Related Ocular Burns. Journal of Burn Care & Research, 35(3), 261-268.

Burling, K., Seguin, M. A., Marsh, P., Brinkman, K., Madigan, J., Thurmond, M., . . . Murphy, C. J. (2000). Effect of topical administration of epidermal growth factor on healing of corneal epithelial defects in horses. Am J Vet Res, 61(9), 1150-1155.

C. Gupta, R. (2014). Biomarkers in Toxicology (1st Edition ed.): Academic Press.

Cao, L., Zhang, X. D., Liu, X., Chen, T. Y., & Zhao, M. (2010). Chloride channels and transporters in human corneal epithelium. Exp Eye Res, 90(6), 771-779.

Carrier, P. (2006). Reconstruction in vitro de cornées humaines par auto-assemblage. (Phd. ), Université Laval, Québec.

Carrier, P., Deschambeault, A., Audet, C., Talbot, M., Gauvin, R., Giasson, C. J., . . . Germain, L. (2009). Impact of cell source on human cornea reconstructed by tissue engineering. Investigative ophthalmology & visual science, 50(6), 2645-2652.

Carrier, P., Deschambeault, A., Talbot, M., Giasson, C. J., Auger, F. A., Guerin, S. L., & Germain, L. (2008). Characterization of wound reepithelialization using a new human tissue-engineered corneal wound healing model. Investigative ophthalmology & visual science, 49(4), 1376-1385.

Casswell, E. J., Anikina, E. V., & Mearza, A. A. (2014). Traumatic insertion of eyelashes into corneal stroma. Contact lens & anterior eye : the journal of the British Contact Lens Association, 37(5), 388-389.

Castro-Muñozledo, F. (2013). Review: corneal epithelial stem cells, their niche and wound healing. Molecular vision, 19(April), 1600-1613.

Cha, J., Pedersen, M. V., & Auld, D. S. (1996). Metal and pH dependence of heptapeptide catalysis by human matrilysin. Biochemistry, 35(49), 15831-15838.

Chakraborti, S., Mandal, M., Das, S., Mandal, A., & Chakraborti, T. (2003). Regulation of matrix metalloproteinases: an overview. Molecular and cellular biochemistry, 253(1-2), 269-285.

Chan, D., Lamande, S. R., Cole, W. G., & Bateman, J. F. (1990). Regulation of procollagen synthesis and processing during ascorbate-induced extracellular matrix accumulation in vitro. The Biochemical journal, 269, 175-181.

Chang, Y. C., Sabourin, C. L., Lu, S. E., Sasaki, T., Svoboda, K. K., Gordon, M. K., . . . Gerecke, D. R. (2009). Upregulation of gamma-2 laminin-332 in the mouse ear vesicant wound model. J Biochem Mol Toxicol, 23(3), 172-184.

118

Chen, J. J., & Tseng, S. C. (1991). Abnormal corneal epithelial wound healing in partial-thickness removal of limbal epithelium. Invest Ophthalmol Vis Sci, 32(8), 2219-2233.

Chen, Y., Huang, Y., Huang, Y., Xia, X., Zhang, J., Zhou, Y., . . . Zhou, J. (2014). JWA suppresses tumor angiogenesis via Sp1-activated matrix metalloproteinase-2 and its prognostic significance in human gastric cancer. Carcinogenesis, 35(2), 442-451.

Cheng, K. H., Leung, S. L., Hoekman, H. W., Beekhuis, W. H., Mulder, P. G., Geerards, A. J., & Kijlstra, A. (1999). Incidence of contact-lens-associated microbial keratitis and its related morbidity. Lancet (London, England), 354(9174), 181-185.

Chi, C., & Trinkaus-Randall, V. (2013). New insights in wound response and repair of epithelium. Journal of Cellular Physiology, 228(5), 925-929.

Chung, E. H., Hutcheon, A. E., Joyce, N. C., & Zieske, J. D. (1999). Synchronization of the G1/S transition in response to corneal debridement. Invest Ophthalmol Vis Sci, 40(9), 1952-1958.

Cintron, C., Covington, H. I., & Kublin, C. L. (1990). Morphologic analyses of proteoglycans in rabbit corneal scars. Invest Ophthalmol Vis Sci, 31(9), 1789-1798.

Corcoran, M. L., Hewitt, R. E., Kleiner, D. E., Jr., & Stetler-Stevenson, W. G. (1996). MMP-2: expression, activation and inhibition. Enzyme Protein, 49(1-3), 7-19.

Crosson, C. E., Klyce, S. D., & Beuerman, R. W. (1986). Epithelial wound closure in the rabbit cornea. A biphasic process. Invest Ophthalmol Vis Sci, 27(4), 464-473.

Daniels, J. T., Cambrey, A. D., Occleston, N. L., Garrett, Q., Tarnuzzer, R. W., Schultz, G. S., & Khaw, P. T. (2003). Matrix metalloproteinase inhibition modulates fibroblast-mediated matrix contraction and collagen production in vitro. Invest Ophthalmol Vis Sci, 44(3), 1104-1110.

Daniels, J. T., Dart, J. K., Tuft, S. J., & Khaw, P. T. (2001). Corneal stem cells in review. Wound repair and regeneration : official publication of the Wound Healing Society [and] the European Tissue Repair Society, 9(6), 483-494.

Davidson, H. J., & Kuonen, V. J. (2004). The tear film and ocular mucins. Vet Ophthalmol, 7(2), 71-77.

Dawson, D. G., J. L. Ubels, et al. (2011). Cornea and Sclera. Edinburgh: Saunders/Elsevier.

DelMonte, D. W., & Kim, T. (2011). Anatomy and physiology of the cornea. Journal of cataract and refractive surgery, 37(3), 588-598.

119

Deshpande, P., Notara, M., Bullett, N., Daniels, J. T., Haddow, D. B., & MacNeil, S. (2009). Development of a surface-modified contact lens for the transfer of cultured limbal epithelial cells to the cornea for ocular surface diseases. Tissue Eng Part A, 15(10), 2889-2902.

Devreotes, P., & Horwitz, A. R. (2015). Signaling networks that regulate cell migration. Cold Spring Harb Perspect Biol, 7(8), a005959.

Dua, H. S., & Azuara-Blanco, A. (2000). Autologous limbal transplantation in patients with unilateral corneal stem cell deficiency. The British journal of ophthalmology, 84(3), 273-278.

Dubé, J., Bourget, J.-M., Gauvin, R., Lafrance, H., Roberge, C. J., Auger, F. A., & Germain, L. (2014). Progress in developing a living human tissue-engineered tri-leaflet heart valve assembled from tissue produced by the self-assembly approach. Acta biomaterialia, 10(8), 3563-3570.

Duval, C., Zaniolo, K., Leclerc, S., Salesse, C., & Guerin, S. L. (2015). Characterization of the human alpha9 integrin subunit gene: Promoter analysis and transcriptional regulation in ocular cells. Exp Eye Res, 135, 146-163.

Dwivedi, D. J., Pino, G., Banh, A., Nathu, Z., Howchin, D., Margetts, P., . . . West-Mays, J. A. (2006). Matrix Metalloproteinase Inhibitors Suppress Transforming Growth Factor-β-Induced Subcapsular Cataract Formation. The American Journal of Pathology, 168(1), 69-79.

Dziasko, M. A., Tuft, S. J., & Daniels, J. T. (2015). Limbal melanocytes support limbal epithelial stem cells in 2D and 3D microenvironments. Exp Eye Res, 138, 70-79.

Eberhardt, W., Huwiler, A., Beck, K. F., Walpen, S., & Pfeilschifter, J. (2000). Amplification of IL-1 beta-induced matrix metalloproteinase-9 expression by superoxide in rat glomerular mesangial cells is mediated by increased activities of NF-kappa B and activating protein-1 and involves activation of the mitogen-activated protein kinase pathways. J Immunol, 165(10), 5788-5797.

Eghrari, A. O., Riazuddin, S. A., & Gottsch, J. D. (2015). Overview of the Cornea: Structure, Function, and Development. Progress in molecular biology and translational science, 134, 7-23.

Farjo, A., McDermott, M., & Soong, H. K. (2008). Corneal anatomy, physiology, and wound healing (3rd ed., pp. 203-208). St-Louis, MO, Mosby.

Filenius, S., Hormia, M., Rissanen, J., Burgeson, R. E., Yamada, Y., Araki-Sasaki, K., . . . Tervo, T. (2001). Laminin synthesis and the adhesion characteristics of immortalized human corneal epithelial cells to laminin isoforms. Exp Eye Res, 72(1), 93-103.

120

Filippov, S., Koenig, G. C., Chun, T. H., Hotary, K. B., Ota, I., Bugge, T. H., . . . Weiss, S. J. (2005). MT1-matrix metalloproteinase directs arterial wall invasion and neointima formation by vascular smooth muscle cells. J Exp Med, 202(5), 663-671.

Fini, M. E., Girard, M. T., Matsubara, M., & Bartlett, J. D. (1995). Unique regulation of the matrix metalloproteinase, gelatinase B. Invest Ophthalmol Vis Sci, 36(3), 622-633.

Fini, M. E., Parks, W. C., Rinehart, W. B., Girard, M. T., Matsubara, M., Cook, J. R., . . . Zieske, J. D. (1996). Role of matrix metalloproteinases in failure to re-epithelialize after corneal injury. Am J Pathol, 149(4), 1287-1302.

Fini, M. E., & Stramer, B. M. (2005). How the cornea heals: cornea-specific repair mechanisms affecting surgical outcomes. Cornea, 24(8 Suppl), S2-S11.

Fischbarg, J., & Diecke, F. P. J. (2005). A mathematical model of electrolyte and fluid transport across corneal endothelium. Journal of Membrane Biology, 203(1), 41-56.

Folgueras, A. R., Pendas, A. M., Sanchez, L. M., & Lopez-Otin, C. (2004). Matrix metalloproteinases in cancer: from new functions to improved inhibition strategies. Int J Dev Biol, 48(5-6), 411-424.

Gaal, C. (2002). [German physicians--decimated by ageing, low spirit, and changing attitude to life]. Orv Hetil, 143(43), 2449-2451.

Gallico, G. (1984). Permanent coverage of large burn wounds with autologous cultured human epithelium. The New England Journal of Medicine, 311(7), 448-451.

Gama-de-Souza, L. N., Cyreno-Oliveira, E., Freitas, V. M., Melo, E. S., Vilas-Boas, V. F., Moriscot, A. S., & Jaeger, R. G. (2008). Adhesion and protease activity in cell lines from human salivary gland tumors are regulated by the laminin-derived peptide AG73, syndecan-1 and beta1 integrin. Matrix Biol, 27(5), 402-419.

Gao, K., Wang, C. R., Jiang, F., Wong, A. Y., Su, N., Jiang, J. H., . . . Yu, A. C. (2013). Traumatic scratch injury in astrocytes triggers calcium influx to activate the JNK/c-Jun/AP-1 pathway and switch on GFAP expression. Glia, 61(12), 2063-2077.

Garg, P., Krishna, P. V., Stratis, a. K., & Gopinathan, U. (2005). The value of corneal transplantation in reducing blindness. Eye (London, England), 19(10), 1106-1114.

121

Garzon, I., Martin-Piedra, M. A., Alfonso-Rodriguez, C., Gonzalez-Andrades, M., Carriel, V., Martinez-Gomez, C., . . . Alaminos, M. (2014). Generation of a biomimetic human artificial cornea model using Wharton's jelly mesenchymal stem cells. Investigative ophthalmology & visual science, 55(7), 4073-4083.

Gaudreault, M., Carrier, P., Larouche, K., Leclerc, S., Giasson, M., Germain, L., & Guerin, S. L. (2003). Influence of sp1/sp3 expression on corneal epithelial cells proliferation and differentiation properties in reconstructed tissues. Investigative ophthalmology & visual science, 44(4), 1447-1457.

Gaudreault, M., Vigneault, F., Leclerc, S., & Guerin, S. L. (2007). Laminin reduces expression of the human alpha6 integrin subunit gene by altering the level of the transcription factors Sp1 and Sp3. Invest Ophthalmol Vis Sci, 48(8), 3490-3505.

Geesin, J. C., Darr, D., Kaufman, R., Murad, S., & Pinnell, S. R. (1988). Ascorbic Acid Specifically Increases Type I and Type III Procollagen Messenger RNA Levels in Human Skin Fibroblasts. Journal of Investigative Dermatology, 90(4), 420-424.

Geeta K. Vemuganti, S. M., & Das, S. (2011). Update on Pathologic Diagnosis of Corneal Infections and Inflammations. Middle East Afr J Ophthalmol, 18(4), 277-284.

Gendron, S. P., & Rochette, P. J. (2015). Modifications in stromal extracellular matrix of aged corneas can be induced by ultraviolet A irradiation. Aging Cell, 14(3), 433-442.

Germain, L., Auger, F. A., Grandbois, E., Guignard, R., Giasson, M., Boisjoly, H., & Guerin, S. L. (1999a). Reconstructed human cornea produced in vitro by tissue engineering. Pathobiology : journal of immunopathology, molecular and cellular biology, 67(3), 140-147.

Germain, L., Carrier, P., Auger, F. A., Salesse, C., & Guerin, S. L. (2000). Can we produce a human corneal equivalent by tissue engineering? Prog Retin Eye Res, 19(5), 497-527.

Germain L, G. C., Carrier P, Guérin SL, Salesse C, Auger (2004). Tissue Engineering of Cornea. In B. G. Wnek GE (Ed.), Encyclopedia of Biomaterials and Biomedical Engineering (pp. p. 1534-1544). New York: Marcel Dekker.

Germundsson, J., Karanis, G., Fagerholm, P., & Lagali, N. (2013). Age-related thinning of Bowman's layer in the human cornea in vivo. Investigative Ophthalmology and Visual Science, 54(9), 6143-6149.

122

Ghezzi, C. E., Rnjak-Kovacina, J., & Kaplan, D. L. (2015). Corneal Tissue Engineering: Recent Advances and Future Perspectives. Tissue Eng Part B Rev.

Gingras, M. E., Larouche, K., Larouche, N., Leclerc, S., Salesse, C., & Guerin, S. L. (2003). Regulation of the integrin subunit alpha5 gene promoter by the transcription factors Sp1/Sp3 is influenced by the cell density in rabbit corneal epithelial cells. Invest Ophthalmol Vis Sci, 44(9), 3742-3755.

Gipson, I. K., Yankauckas, M., Spurr-Michaud, S. J., Tisdale, A. S., & Rinehart, W. (1992). Characteristics of a glycoprotein in the ocular surface glycocalyx. Investigative Ophthalmology and Visual Science, 33(1), 218-227.

Girard, M. T., Matsubara, M., & Fini, M. E. (1991). Transforming growth factor-beta and interleukin-1 modulate metalloproteinase expression by corneal stromal cells. Invest Ophthalmol Vis Sci, 32(9), 2441-2454.

Gomis-Ruth, F. X., Gohlke, U., Betz, M., Knauper, V., Murphy, G., Lopez-Otin, C., & Bode, W. (1996). The helping hand of collagenase-3 (MMP-13): 2.7 A crystal structure of its C-terminal haemopexin-like domain. J Mol Biol, 264(3), 556-566.

Gonzalez-Perez, J., Villa-Collar, C., Gonzalez-Meijome, J. M., Porta, N. G., & Parafita, M. A. (2012). Long-term changes in corneal structure and tear inflammatory mediators after orthokeratology and LASIK. Invest Ophthalmol Vis Sci, 53(9), 5301-5311.

Gordon, G. M., Austin, J. S., Sklar, A. L., Feuer, W. J., LaGier, A. J., & Fini, M. E. (2011). Comprehensive gene expression profiling and functional analysis of matrix metalloproteinases and TIMPs, and identification of ADAM-10 gene expression, in a corneal model of epithelial resurfacing. J Cell Physiol, 226(6), 1461-1470.

Gordon, G. M., Ledee, D. R., Feuer, W. J., & Fini, M. E. (2009). Cytokines and signaling pathways regulating matrix metalloproteinase-9 (MMP-9) expression in corneal epithelial cells. J Cell Physiol, 221(2), 402-411.

Goulet, F., Poitras, A., Rouabhia, M., Cusson, D., Germain, L., & Auger, F. A. (1996). Stimulation of human keratinocyte proliferation through growth factor exchanges with dermal fibroblasts in vitro. Burns, 22(2), 107-112.

Graham, M. L., & Prescott, M. J. (2015). The multifactorial role of the 3Rs in shifting the harm-benefit analysis in animal models of disease. Eur J Pharmacol, 759, 19-29.

Grant, M. B., Khaw, P. T., Schultz, G. S., Adams, J. L., & Shimizu, R. W. (1992). Effects of epidermal growth factor, fibroblast growth factor, and transforming growth factor-beta on corneal cell chemotaxis. Invest Ophthalmol Vis Sci, 33(12), 3292-3301.

123

Grant-Kels, J. M., & Kels, B. D. (1992). Human ocular anatomy (Vol. 10, pp. 473-482).

Greenlee, K. J., Werb, Z., & Kheradmand, F. (2007). Matrix metalloproteinases in lung: multiple, multifarious, and multifaceted. Physiol Rev, 87(1), 69-98.

Griffith, M. (1999). Functional Human Corneal Equivalents Constructed from Cell Lines. Science, 286(5447), 2169-2172.

Griffith, M. (2002). Artificial Human Cornea. Cornea, 21(2), 54-61.

Groden, L. R., & White, W. (1990). Porcine collagen corneal shield treatment of persistent epithelial defects following penetrating keratoplasty. CLAO J, 16(2), 95-97.

Gross, J., & Lapiere, C. M. (1962). Collagenolytic activity in amphibian tissues: a tissue culture assay. Proc Natl Acad Sci U S A, 48, 1014-1022.

Guo, F., Tian, J., Cui, M., Fang, M., & Yang, L. (2015). Downregulation of matrix metalloproteinase 9 by small interfering RNA inhibits the tumor growth of ovarian epithelial carcinoma in vitro and in vivo. Mol Med Rep, 12(1), 753-759.

Gupta, N., Kalaivani, M., & Tandon, R. (2011). Comparison of prognostic value of Roper Hall and Dua classification systems in acute ocular burns. The British journal of ophthalmology, 95(2), 194-198.

Haddad, A., & Faria-e-Sousa, S. J. (2014). Maintenance of the corneal epithelium is carried out by germinative cells of its basal stratum and not by presumed stem cells of the limbus. Braz J Med Biol Res, 47(6), 470-477.

Hamill, K. J., Langbein, L., Jones, J. C., & McLean, W. H. (2009). Identification of a novel family of laminin N-terminal alternate splice isoforms: structural and functional characterization. J Biol Chem, 284(51), 35588-35596.

Hampel, U., Frommling, P., Brauer, L., Schaefer, I., Sel, S., Holland, D., & Paulsen, F. (2016). Somatostatin supports corneal wound healing in vivo. Ann Anat, 205, 1-8.

Han, B., Schwab, I. R., Madsen, T. K., & Isseroff, R. R. (2002). A fibrin-based bioengineered ocular surface with human corneal epithelial stem cells. Cornea, 21(5), 505-510.

Hanna, C. (1966). Proliferation and migration of epithelial cells during corneal wound repair in the rabbit and the rat. Am J Ophthalmol, 61(1), 55-63.

Harris, P. M. (2011). Workplace Injuries Involving the Eyes, 2008. 2(1), 3-9.

124

Hata, R., & Senoo, H. (1989). L-ascorbic acid 2-phosphate stimulates collagen accumulation, cell proliferation, and formation of a three-dimensional tissuelike substance by skin fibroblasts. Journal of cellular physiology, 138(1), 8-16.

Helena, M. C., Baerveldt, F., Kim, W. J., & Wilson, S. E. (1998). Keratocyte apoptosis after corneal surgery. Invest Ophthalmol Vis Sci, 39(2), 276-283.

Holmbeck, K., Bianco, P., Caterina, J., Yamada, S., Kromer, M., Kuznetsov, S. A., . . . Birkedal-Hansen, H. (1999). MT1-MMP-deficient mice develop dwarfism, osteopenia, arthritis, and connective tissue disease due to inadequate collagen turnover. Cell, 99(1), 81-92.

Holopainen, J. M., Moilanen, J. A., Sorsa, T., Kivela-Rajamaki, M., Tervahartiala, T., Vesaluoma, M. H., & Tervo, T. M. (2003). Activation of matrix metalloproteinase-8 by membrane type 1-MMP and their expression in human tears after photorefractive keratectomy. Invest Ophthalmol Vis Sci, 44(6), 2550-2556.

Homma, R., Yoshikawa, H., Takeno, M., Kurokawa, M. S., Masuda, C., Takada, E., . . . Suzuki, N. (2004). Induction of epithelial progenitors in vitro from mouse embryonic stem cells and application for reconstruction of damaged cornea in mice. Invest Ophthalmol Vis Sci, 45(12), 4320-4326.

Hutcheon, A. E., Guo, X. Q., Stepp, M. A., Simon, K. J., Weinreb, P. H., Violette, S. M., & Zieske, J. D. (2005). Effect of wound type on Smad 2 and 4 translocation. Invest Ophthalmol Vis Sci, 46(7), 2362-2368.

. ICH Guidance Document S6(R1): Preclinical Safety Evaluation of Biotechnology-Derived Pharmaceuticals (2016): Santé Canada.

Imanishi, J., Kamiyama, K., Iguchi, I., Kita, M., Sotozono, C., & Kinoshita, S. (2000a). Growth factors: importance in wound healing and maintenance of transparency of the cornea. Progress in retinal and eye research, 19(1), 113-129.

Imanishi, J., Kamiyama, K., Iguchi, I., Kita, M., Sotozono, C., & Kinoshita, S. (2000b). Growth factors: importance in wound healing and maintenance of transparency of the cornea. Prog Retin Eye Res, 19(1), 113-129.

Jacob-Ferreira, A. L., Kondo, M. Y., Baral, P. K., James, M. N., Holt, A., Fan, X., & Schulz, R. (2013). Phosphorylation status of 72 kDa MMP-2 determines its structure and activity in response to peroxynitrite. PLoS One, 8(8), e71794.

Jacobsen, I. E., Jensen, O. A., & Prause, J. U. (1984). Structure and composition of Bowman's membrane. Study by frozen resin cracking. Acta Ophthalmol (Copenh), 62(1), 39-53.

125

Ji, H., Chen, A., Zhang, W., Gu, H., Zhang, Z., & Fu, J. (2014). Dynamic changes of tear fluid matrix metralloproteinase-9 within 1 year after laser in situ keratomileusis. Nan Fang Yi Ke Da Xue Xue Bao, 34(8), 1079-1082.

Jia, W., Gao, X. J., Zhang, Z. D., Yang, Z. X., & Zhang, G. (2013). S100A4 silencing suppresses proliferation, angiogenesis and invasion of thyroid cancer cells through downregulation of MMP-9 and VEGF. Eur Rev Med Pharmacol Sci, 17(11), 1495-1508.

Joyce, N. C. (2003). Proliferative capacity of the corneal endothelium. Prog Retin Eye Res, 22(3), 359-389.

Jumblatt, M. M., & Neufeld, A. H. (1986). A tissue culture assay of corneal epithelial wound closure. Invest Ophthalmol Vis Sci, 27(1), 8-13.

Kabosova, A., Azar, D. T., Bannikov, G. A., Campbell, K. P., Durbeej, M., Ghohestani, R. F., . . . Ljubimov, A. V. (2007). Compositional differences between infant and adult human corneal basement membranes. Invest Ophthalmol Vis Sci, 48(11), 4989-4999.

Karimi, A.-H., Wong, A., & Bizheva, K. (2011). Automated detection and cell density assessment of keratocytes in the human corneal stroma from ultrahigh resolution optical coherence tomograms. Biomedical optics express, 2(10), 2905-2916.

Keller, A., Nesvizhskii, A. I., Kolker, E., & Aebersold, R. (2002). Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Analytical chemistry, 74(20), 5383-5392.

Kenyon, K. R., & Tseng, S. C. (1989). Limbal autograft transplantation for ocular surface disorders. Ophthalmology, 96(5), 709-722; discussion 722-703.

Kim, H. S., Shang, T., Chen, Z., Pflugfelder, S. C., & Li, D. Q. (2004). TGF-beta1 stimulates production of gelatinase (MMP-9), collagenases (MMP-1, -13) and stromelysins (MMP-3, -10, -11) by human corneal epithelial cells. Exp Eye Res, 79(2), 263-274.

Kim, M. J., Jun, R. M., Kim, W. K., Hann, H. J., Chong, Y. H., Park, H. Y., & Chung, J. H. (2001). Optimal concentration of human epidermal growth factor (hEGF) for epithelial healing in experimental corneal alkali wounds. Curr Eye Res, 22(4), 272-279.

Kimura, K., Kawano, S., Mori, T., Inoue, J., Hadachi, H., Saito, T., & Nishida, T. (2010). Quantitative analysis of the effects of extracellular matrix proteins on membrane dynamics associated with corneal epithelial cell motility. Invest Ophthalmol Vis Sci, 51(9), 4492-4499.

Kiwanuka, E., Andersson, L., Caterson, E. J., Junker, J. P., Gerdin, B., & Eriksson, E. (2013). CCN2 promotes keratinocyte adhesion and migration via integrin alpha5beta1. Exp Cell Res, 319(19), 2938-2946.

126

Ko, J. A., Chikama, T., Sonoda, K. H., & Kiuchi, Y. (2012). Up-regulation of matrix metalloproteinase-1 and interleukin-6 expression in cocultures of corneal fibroblasts and neural cells. Biochem Biophys Res Commun, 419(3), 537-542.

Koh, S., Maeda, N., Nakagawa, T., Higashiura, R., Saika, M., Mihashi, T., . . . Nishida, K. (2012). Characteristic higher-order aberrations of the anterior and posterior corneal surfaces in 3 corneal transplantation techniques. American journal of ophthalmology, 153(2), 284-290.e281.

Koizumi, N. J., Inatomi, T. J., Sotozono, C. J., Fullwood, N. J., Quantock, A. J., & Kinoshita, S. (2000). Growth factor mRNA and protein in preserved human amniotic membrane. Curr Eye Res, 20(3), 173-177.

Kolozsva, L., No, A., & Bor, Z. (2002). UV Absorbance of the Human Cornea in the 240- to AND. Invest Ophthalmol Vis Sci, 43(7), 2165-2168.

Komai, Y., & Ushiki, T. (1991). The three-dimensional organisation of collagen fibrils in the human cornea and sclera. Investigative Ophthalmology and Visual Science, 32(8), 2244-2258.

Kramerov, A. A., Saghizadeh, M., Maguen, E., Rabinowitz, Y. S., & Ljubimov, A. V. (2015). Persistence of reduced expression of putative stem cell markers and slow wound healing in cultured diabetic limbal epithelial cells. Mol Vis, 21, 1357-1367.

Labrie, M., & St-Pierre, Y. (2013). Epigenetic regulation of mmp-9 gene expression. Cell Mol Life Sci, 70(17), 3109-3124.

Laflamme, K., Roberge, C. J., Labont, J., Pouliot, S. p., D'Orléans-Juste, P. d., Auger, F. o. A., & Germain, L. (2005). Tissue-engineered human vascular media with a functional endothelin system. Circulation, 111(4), 459-464.

Lake, J. (2015). Modulation de l’expression du gène de la sous-unité α 5 de l’intégrine α 5 β 1 par les composantes de la matrice extracellulaire durant la cicatrisation de l’épithélium cornéen. Thèse.

Lake, J., Zaniolo, K., Gaudreault, M., Carrier, P., Deschambault, A., Bazin, R., . . . Guerin, S. L. (2013). Expression of the alpha5 integrin gene in corneal epithelial cells cultured on tissue-engineered human extracellular matrices. Biomaterials, 34(27), 6367-6376.

Lake, J., Zaniolo, K., Gingras, M. E., Couture, C., Salesse, C., & Guerin, S. L. (2015). Functional Impact of Collagens on the Activity Directed by the Promoter of the alpha5 Integrin Subunit Gene in Corneal Epithelial Cells. Invest Ophthalmol Vis Sci, 56(11), 6217-6232.

Larouche, D., Paquet, C., Fradette, J., Carrier, P., A. Auger, F., & Germain, L. (2009). Stem Cells in Regenerative Medicine. Stem Cells in Regenerative Medicine: Methods and Protocols, 482, 233-256.

127

Larouche, K., Leclerc, S., Salesse, C., & Guerin, S. L. (2000). Expression of the alpha 5 integrin subunit gene promoter is positively regulated by the extracellular matrix component fibronectin through the transcription factor Sp1 in corneal epithelial cells in vitro. J Biol Chem, 275(50), 39182-39192.

Lee, J. H., & Welch, D. R. (1997). Suppression of metastasis in human breast carcinoma MDA-MB-435 cells after transfection with the metastasis suppressor gene, KiSS-1. Cancer Res, 57(12), 2384-2387.

Lee, S. Y., Kim, Y. H., Johnson, D., Mondino, B. J., & Weissman, B. a. (2012). Contact lens complications in an urgent-care population: the University of California, Los Angeles, contact lens study. Eye & contact lens, 38(1), 49-52.

Leiper, L. J., Walczysko, P., Kucerova, R., Ou, J., Shanley, L. J., Lawson, D., . . . Collinson, J. M. (2006). The roles of calcium signaling and ERK1/2 phosphorylation in a Pax6+/- mouse model of epithelial wound-healing delay. BMC Biol, 4, 27.

Li, D. Q., Shang, T. Y., Kim, H. S., Solomon, A., Lokeshwar, B. L., & Pflugfelder, S. C. (2003). Regulated expression of collagenases MMP-1, -8, and -13 and stromelysins MMP-3, -10, and -11 by human corneal epithelial cells. Invest Ophthalmol Vis Sci, 44(7), 2928-2936.

Lindberg, K., Brown, M. E., Chaves, H. V., Kenyon, K. R., & Rheinwald, J. G. (1993). In vitro propagation of human ocular surface epithelial cells for transplantation. Invest Ophthalmol Vis Sci, 34(9), 2672-2679.

Liotta, L. A., & Kohn, E. C. (2001). The microenvironment of the tumour-host interface. Nature, 411(6835), 375-379.

Liu, C. Y., & Kao, W. W. (2015). Corneal Epithelial Wound Healing. Prog Mol Biol Transl Sci, 134, 61-71.

Ljubimov, A. V., Burgeson, R. E., Butkowski, R. J., Michael, A. F., Sun, T. T., & Kenney, M. C. (1995). Human corneal basement membrane heterogeneity: topographical differences in the expression of type IV collagen and laminin isoforms. Lab Invest, 72(4), 461-473.

Ljubimov, A. V., & Saghizadeh, M. (2015). Progress in corneal wound healing. Prog Retin Eye Res, 49, 17-45.

Loffek, S., Schilling, O., & Franzke, C. W. (2011). Series "matrix metalloproteinases in lung health and disease": Biological role of matrix metalloproteinases: a critical balance. Eur Respir J, 38(1), 191-208.

Logothetis, H. D., Leikin, S. M., & Patrianakos, T. (2014). Management of anterior segment trauma. Disease-a-month : DM, 60(6), 247-253.

128

Lopez-Otin, C., & Matrisian, L. M. (2007). Emerging roles of proteases in tumour suppression. Nat Rev Cancer, 7(10), 800-808.

Lu, L., Reinach, P. S., & Kao, W. W. (2001). Corneal epithelial wound healing. Experimental biology and medicine, 226(7), 653-664.

Lyu, J., & Joo, C. K. (2005a). Wnt-7a up-regulates matrix metalloproteinase-12 expression and promotes cell proliferation in corneal epithelial cells during wound healing. J Biol Chem, 280(22), 21653-21660.

Lyu, J., & Joo, C. K. (2005b). Wnt-7a up-regulates matrix metalloproteinase-12 expression and promotes cell proliferation in corneal epithelial cells during wound healing. The Journal of biological chemistry, 280(22), 21653-21660.

Lyu, J., & Joo, C. K. (2006). Expression of Wnt and MMP in epithelial cells during corneal wound healing. Cornea, 25(10 Suppl 1), S24-28.

Ma, Z., Chang, M. J., Shah, R., Adamski, J., Zhao, X., & Benveniste, E. N. (2004). Brg-1 is required for maximal transcription of the human matrix metalloproteinase-2 gene. J Biol Chem, 279(44), 46326-46334.

Maguen, E., Zorapapel, N. C., Zieske, J. D., Ninomiya, Y., Sado, Y., Kenney, M. C., & Ljubimov, A. V. (2002). Extracellular matrix and matrix metalloproteinase changes in human corneas after complicated laser-assisted in situ keratomileusis (LASIK). Cornea, 21(1), 95-100.

Maldonado, B. A., & Furcht, L. T. (1995). Epidermal growth factor stimulates integrin-mediated cell migration of cultured human corneal epithelial cells on fibronectin and arginine-glycine-aspartic acid peptide. Invest Ophthalmol Vis Sci, 36(10), 2120-2126.

Malecaze, F., Simorre, V., Chollet, P., Tack, J. L., Muraine, M., Le Guellec, D., . . . Darbon, J. M. (1997). Interleukin-6 in tear fluid after photorefractive keratectomy and its effects on keratocytes in culture. Cornea, 16(5), 580-587.

Malhotra, C., & Jain, A. K. (2014). Human amniotic membrane transplantation: Different modalities of its use in ophthalmology. World J Transplant, 4(2), 111-121.

Marshall, G. E., Konstas, A. G., & Lee, W. R. (1991). Immunogold fine structural localization of extracellular matrix components in aged human cornea. Graefe's Archive for Clinical and Experimental Ophthalmology, 229(2), 157-163.

Marshall, G. E., Konstas, A. G., & Lee, W. R. (1991a). Immunogold fine structural localization of extracellular matrix components in aged human cornea. I. Types I-IV collagen and laminin. Graefes Arch Clin Exp Ophthalmol, 229(2), 157-163.

129

Marshall, G. E., Konstas, A. G., & Lee, W. R. (1991b). Immunogold fine structural localization of extracellular matrix components in aged human cornea. II. Collagen types V and VI. Graefes Arch Clin Exp Ophthalmol, 229(2), 164-171.

Martin, G. R., & Timpl, R. (1987). Laminin and other basement membrane components. Annu Rev Cell Biol, 3, 57-85.

Martinez, J. D., Galor, A., Perez, V. L., Karp, C. L., Yoo, S. H., & Alfonso, E. C. (2013). Endothelial graft failure after contralateral autologous corneal transplantation. Cornea, 32(6), 745-750.

Martins, J., Leal, A., Loureno, J., Ribeiro, J., Almeida, M., Castro, M., & Paulo, J. (2011). Man Machine Interface. Ias 2011 - Instrumentation and Signal Acquisition in Bioengineering, 1-10.

Matsubara, M., Girard, M. T., Kublin, C. L., Cintron, C., & Fini, M. E. (1991). Differential roles for two gelatinolytic enzymes of the matrix metalloproteinase family in the remodelling cornea. Dev Biol, 147(2), 425-439.

Matsubara, M., Zieske, J. D., & Fini, M. E. (1991). Mechanism of basement membrane dissolution preceding corneal ulceration. Invest Ophthalmol Vis Sci, 32(13), 3221-3237.

Matsuda, M., Ubels, J. L., & Edelhauser, H. F. (1985). A larger corneal epithelial wound closes at a faster rate. Invest Ophthalmol Vis Sci, 26(6), 897-900.

Maurice, D. M. (1970). The transparency of the corneal stroma. Vision Res, 10(1), 107-108.

Maycock, N. J., & Marshall, J. (2014). Genomics of corneal wound healing: a review of the literature. Acta Ophthalmol, 92(3), e170-184.

McCawley, L. J., & Matrisian, L. M. (2001). Matrix metalloproteinases: they're not just for matrix anymore! Curr Opin Cell Biol, 13(5), 534-540.

McGwin, G., & Owsley, C. (2005). Incidence of emergency department-treated eye injury in the United States. Archives of ophthalmology, 123(5), 662-666.

McGwin, G., Xie, A., & Owsley, C. (2005). Rate of eye injury in the United States. Archives of ophthalmology, 123(7), 970-976.

Meek, K. M., & Fullwood, N. J. (2001a). Corneal and scleral collagens--a microscopist's perspective. Micron, 32(3), 261-272.

Melendez-Zajgla, J., Del Pozo, L., Ceballos, G., & Maldonado, V. (2008). Tissue inhibitor of metalloproteinases-4. The road less traveled. Mol Cancer, 7, 85.

130

Messier, P. E., & Hoffman, R. S. (1949). Mechanism of corneal graft healing; behavior of recipient and donor cells. Arch Ophthal, 42(2), 148-154.

Michel, M., L'Heureux, N., Pouliot, R., Xu, W., Auger, F. a., & Germain, L. (1999a). Characterization of a new tissue-engineered human skin equivalent with hair. In Vitro Cellular & Developmental Biology. Animal, 35(6), 318-326.

Michel, M., L'Heureux, N., Pouliot, R., Xu, W., Auger, F. A., & Germain, L. (1999b). Characterization of a new tissue-engineered human skin equivalent with hair. In Vitro Cell Dev Biol Anim, 35(6), 318-326.

Michel, M., Torok, N., Godbout, M. J., Lussier, M., Gaudreau, P., Royal, A., & Germain, L. (1996). Keratin 19 as a biochemical marker of skin stem cells in vivo and in vitro: keratin 19 expressing cells are differentially localized in function of anatomic sites, and their number varies with donor age and culture stage. J Cell Sci, 109 ( Pt 5), 1017-1028.

Michelacci, Y. M. (2003). Collagens and proteoglycans of the corneal extracellular matrix. Braz J Med Biol Res, 36(8), 1037-1046.

Mimura, T., Yamagami, S., & Amano, S. (2013). Corneal endothelial regeneration and tissue engineering. Prog Retin Eye Res, 35, 1-17.

Mohan, R., Chintala, S. K., Jung, J. C., Villar, W. V., McCabe, F., Russo, L. A., . . . Fini, M. E. (2002). Matrix metalloproteinase gelatinase B (MMP-9) coordinates and effects epithelial regeneration. J Biol Chem, 277(3), 2065-2072.

Mohan, R., Rinehart, W. B., Bargagna-Mohan, P., & Fini, M. E. (1998). Gelatinase B/lacZ transgenic mice, a model for mapping gelatinase B expression during developmental and injury-related tissue remodeling. J Biol Chem, 273(40), 25903-25914.

Mohan, R. R., Hutcheon, A. E., Choi, R., Hong, J., Lee, J., Mohan, R. R., . . . Wilson, S. E. (2003). Apoptosis, necrosis, proliferation, and myofibroblast generation in the stroma following LASIK and PRK. Exp Eye Res, 76(1), 71-87.

Moldovan, S. M., Borderie, V., Baudrimont, M., & Laroche, L. (1999). [Treatment of unilateral limbal stem cell deficiency syndrome by limbal autograft]. J Fr Ophtalmol, 22(3), 302-309.

Moller, G. (2007). [Patching for corneal abrasion. A survey of a Cochrane review]. Ugeskr Laeger, 169(39), 3276-3278.

Monteiro, B. G., Serafim, R. C., Melo, G. B., Silva, M. C., Lizier, N. F., Maranduba, C. M., . . . Kerkis, I. (2009). Human immature dental pulp stem cells share key characteristic features with limbal stem cells. Cell Prolif, 42(5), 587-594.

131

Mulholland, B., Tuft, S. J., & Khaw, P. T. (2005). Matrix metalloproteinase distribution during early corneal wound healing. Eye, 19(5), 584-588.

Muller, L. J., Marfurt, C. F., Kruse, F., & Tervo, T. M. T. (2003). Corneal nerves: structure, contents and function. Exp Eye Res, 76(5), 521-542.

Murphy, G. (2011). Tissue inhibitors of metalloproteinases. Genome Biol, 12(11), 233.

Nabili, M., Patel, H., Mahesh, S. P., Liu, J., Geist, C., & Zderic, V. (2013). Ultrasound-enhanced delivery of antibiotics and anti-inflammatory drugs into the eye. Ultrasound Med Biol, 39(4), 638-646.

Nagase, H., & Fushimi, K. (2008). Elucidating the function of non catalytic domains of collagenases and aggrecanases. Connect Tissue Res, 49(3), 169-174.

Nagase, H., & Woessner, J. F., Jr. (1999). Matrix metalloproteinases. J Biol Chem, 274(31), 21491-21494.

Nagy, L. J., MacRae, S., Yoon, G., Wyble, M., Wang, J., Cox, I., & Huxlin, K. R. (2007). Photorefractive keratectomy in the cat eye: biological and optical outcomes. J Cataract Refract Surg, 33(6), 1051-1064.

Nakamura, M., & Nishida, T. (1999). Differential effects of epidermal growth factor and interleukin 6 on corneal epithelial cells and vascular endothelial cells. Cornea, 18(4), 452-458.

Nakayasu, K., Tanaka, M., Konomi, H., & Hayashi, T. (1986). Distribution of types I, II, III, IV and V collagen in normal and keratoconus corneas. Ophthalmic Res, 18(1), 1-10.

Nelson, J. D., Silverman, V., Lima, P. H., & Beckman, G. (1990). Corneal epithelial wound healing: a tissue culture assay on the effect of antibiotics. Curr Eye Res, 9(3), 277-285.

Nesvizhskii, A. I., Keller, A., Kolker, E., & Aebersold, R. (2003). A statistical model for identifying proteins by tandem mass spectrometry. Analytical chemistry, 75(17), 4646-4658.

Netto, M. V., Mohan, R. R., Sinha, S., Sharma, A., Dupps, W., & Wilson, S. E. (2006). Stromal haze, myofibroblasts, and surface irregularity after PRK. Exp Eye Res, 82(5), 788-797.

Newsome, D. A., Gross, J., & Hassell, J. R. (1982). Human corneal stroma contains three distinct collagens. Invest Ophthalmol Vis Sci, 22(3), 376-381.

Nichols, B., Dawson, C. R., & Togni, B. (1983). Surface features of the conjunctiva and cornea. Invest Ophthalmol Vis Sci, 24(5), 570-576.

132

Noda, M., Takahashi, C., Matsuzaki, T., & Kitayama, H. (2010). What we learn from transformation suppressor genes: lessons from RECK. Future Oncol, 6(7), 1105-1116.

O'Kane, S., & Ferguson, M. W. (1997). Transforming growth factor beta s and wound healing. The international journal of biochemistry & cell biology, 29(1), 63-78.

OMS. (2012). Rapport de la seizième réunion de l'Alliance OMS pour l'élimination du trachome cécitant d'ici 2020. (pp. 14-16). Washington DC.

Paiva, K. B., & Granjeiro, J. M. (2014). Bone tissue remodeling and development: focus on matrix metalloproteinase functions. Arch Biochem Biophys, 561, 74-87.

Pallikaris, I. G., Papatzanaki, M. E., Stathi, E. Z., Frenschock, O., & Georgiadis, A. (1990). Laser in situ keratomileusis. Lasers Surg Med, 10(5), 463-468.

Paquet, C., Larouche, D., Bisson, F., Proulx, S., Simard-Bisson, C., Gaudreault, M., . . . Germain, L. (2010). Tissue engineering of skin and cornea: Development of new models for in vitro studies. Annals of the New York Academy of Sciences, 1197, 166-177.

Parnigotto, P. P., Bassani, V., Montesi, F., & Conconi, M. T. (1998). Bovine corneal stroma and epithelium reconstructed in vitro: characterisation and response to surfactants. Eye (Lond), 12 ( Pt 2), 304-310.

Payne, J., Gong, H., & Trinkaus-Randall, V. (2000). Tyrosine phosphorylation: a critical component in the formation of hemidesmosomes. Cell Tissue Res, 300(3), 401-411.

Pellegrini, G., Rama, P., Di Rocco, A., Panaras, A., & De Luca, M. (2014). Concise review: Hurdles in a successful example of limbal stem cell-based regenerative medicine. Stem Cells, 32(1), 26-34.

Pellegrini, G., Traverso, C. E., Franzi, A. T., Zingirian, M., Cancedda, R., & De Luca, M. (1997). Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium. Lancet, 349(9057), 990-993.

Petznick, A., Evans, M. D., Madigan, M. C., Markoulli, M., Garrett, Q., & Sweeney, D. F. (2011). A comparison of basal and eye-flush tears for the analysis of cat tear proteins. Acta Ophthalmol, 89(1), e75-81.

Philipp, K., Riedel, F., Sauerbier, M., Hormann, K., & Germann, G. (2004). Targeting TGF-beta in human keratinocytes and its potential role in wound healing. International journal of molecular medicine, 14(4), 589-593.

Piperi, C., & Papavassiliou, A. G. (2012). Molecular mechanisms regulating matrix metalloproteinases. Curr Top Med Chem, 12(10), 1095-1112.

133

Pouliot, R., Larouche, D., Auger, F. A., Juhasz, J., Xu, W., Li, H., & Germain, L. (2002). Reconstructed human skin produced in vitro and grafted on athymic mice. Transplantation, 73(11), 1751-1757.

Proulx, S., d'Arc Uwamaliya, J., Carrier, P., Deschambeault, A., Audet, C., Giasson, C. J., . . . Germain, L. (2010a). Reconstruction of a human cornea by the self-assembly approach of tissue engineering using the three native cell types. Mol Vis, 16, 2192-2201.

Proulx, S., d'Arc Uwamaliya, J., Carrier, P., Deschambeault, A., Audet, C., Giasson, C. J., . . . Germain, L. (2010b). Reconstruction of a human cornea by the self-assembly approach of tissue engineering using the three native cell types. Molecular vision, 16, 2192-2201.

Proulx, S., d'Arc Uwamaliya, J., Carrier, P., Deschambeault, A., Audet, C., Giasson, C. J., . . . Germain, L. (2010). Reconstruction of a human cornea by the self-assembly approach of tissue engineering using the three native cell types. Molecular vision, 16(October 2009), 2192-2201.

Pruniéras, M. (1983). Methods for cultivation of keratinocytes with an air-liquid interface. Journal of investigative dermatology, 81(1), 28-33.

Puangsricharern, V., & Tseng, S. C. (1995). Cytologic evidence of corneal diseases with limbal stem cell deficiency. Ophthalmology, 102(10), 1476-1485.

Puzovic, V., Brcic, I., Ranogajec, I., & Jakic-Razumovic, J. (2014). Prognostic values of ETS-1, MMP-2 and MMP-9 expression and co-expression in breast cancer patients. Neoplasma, 61(4), 439-446.

Qin, H., Sun, Y., & Benveniste, E. N. (1999). The transcription factors Sp1, Sp3, and AP-2 are required for constitutive matrix metalloproteinase-2 gene expression in astroglioma cells. J Biol Chem, 274(41), 29130-29137.

Ra, H. J., & Parks, W. C. (2007). Control of matrix metalloproteinase catalytic activity. Matrix Biol, 26(8), 587-596.

Rama, P., Bonini, S., Lambiase, A., Golisano, O., Paterna, P., De Luca, M., & Pellegrini, G. (2001). Autologous fibrin-cultured limbal stem cells permanently restore the corneal surface of patients with total limbal stem cell deficiency. Transplantation, 72(9), 1478-1485.

Ramakrishnan, T., Constantinou, M., Jhanji, V., & Vajpayee, R. B. (2012). Corneal metallic foreign body injuries due to suboptimal ocular protection. Archives of environmental occupational health, 67(1), 48-50.

134

Reddy, V. S., Prabhu, S. D., Mummidi, S., Valente, A. J., Venkatesan, B., Shanmugam, P., . . . Chandrasekar, B. (2010). Interleukin-18 induces EMMPRIN expression in primary cardiomyocytes via JNK/Sp1 signaling and MMP-9 in part via EMMPRIN and through AP-1 and NF-kappaB activation. Am J Physiol Heart Circ Physiol, 299(4), H1242-1254.

Reim, M. (1989). Surgical procedures in the treatment of most severe eye burns. Revival of the artificial epithelium. Acta ophthalmologica, 192, 47-54.

Robert, L., Legeais, J. M., Robert, A. M., & Renard, G. (2001). Corneal collagens. Pathol Biol (Paris), 49(4), 353-363.

Saghizadeh, M., Brown, D. J., Castellon, R., Chwa, M., Huang, G. H., Ljubimova, J. Y., . . . Ljubimov, A. V. (2001). Overexpression of matrix metalloproteinase-10 and matrix metalloproteinase-3 in human diabetic corneas: a possible mechanism of basement membrane and integrin alterations. Am J Pathol, 158(2), 723-734.

Saika, S. (2004). TGF-beta signal transduction in corneal wound healing as a therapeutic target. Cornea, 23(8 Suppl), S25-30.

Saika, S., Ohnishi, Y., Ooshima, A., Liu, C. Y., & Kao, W. W. (2002). Epithelial repair: roles of extracellular matrix. Cornea, 21(2 Suppl 1), S23-29.

Sambursky, R., & O'Brien, T. P. (2011). MMP-9 and the perioperative management of LASIK surgery. Curr Opin Ophthalmol, 22(4), 294-303.

Samy, T. S., Schwacha, M. G., Chung, C. S., Cioffi, W. G., Bland, K. I., & Chaudry, I. H. (1999). Proteasome participates in the alteration of signal transduction in T and B lymphocytes following trauma-hemorrhage. Biochim Biophys Acta, 1453(1), 92-104.

Santoro, M. M., & Gaudino, G. (2005). Cellular and molecular facets of keratinocyte reepithelization during wound healing. Experimental cell research, 304(1), 274-286.

Saravanan, C., Cao, Z., Head, S. R., & Panjwani, N. (2010). Analysis of differential expression of glycosyltransferases in healing corneas by glycogene microarrays. Glycobiology, 20(1), 13-23.

Schlotzer-Schrehardt, U., Bachmann, B. O., Tourtas, T., Torricelli, A. A., Singh, A., Gonzalez, S., . . . Kruse, F. E. (2015). Ultrastructure of the posterior corneal stroma. Ophthalmology, 122(4), 693-699.

Schmoll, T., Unterhuber, A., Kolbitsch, C., Le, T., Stingl, A., & Leitgeb, R. (2012). Precise Thickness Measurements of Bowman ’ s Layer , Epithelium , and Tear Film. 89(5), 795-802.

135

Schneider, a. I., Maier-Reif, K., & Graeve, T. (1999). Constructing an in vitro cornea from cultures of the three specific corneal cell types. In vitro cellular & developmental biology. Animal, 35(9), 515-526.

Schneider, A. I., Maier-Reif, K., & Graeve, T. (1999). Constructing an in vitro cornea from cultures of the three specific corneal cell types. In Vitro Cell Dev Biol Anim, 35(9), 515-526.

Schwab, I. R. (1999). Cultured corneal epithelia for ocular surface disease. Trans Am Ophthalmol Soc, 97, 891-986.

Sehic, A., Utheim, O. A., Ommundsen, K., & Utheim, T. P. (2015). Pre-Clinical Cell-Based Therapy for Limbal Stem Cell Deficiency. J Funct Biomater, 6(3), 863-888.

Shan, N., Zhang, X., Xiao, X., Zhang, H., Tong, C., Luo, X., . . . Qi, H. (2015). Laminin alpha4 (LAMA4) expression promotes trophoblast cell invasion, migration, and angiogenesis, and is lowered in preeclamptic placentas. Placenta, 36(8), 809-820.

Shapiro, S. D. (1998). Matrix metalloproteinase degradation of extracellular matrix: biological consequences. Curr Opin Cell Biol, 10(5), 602-608.

Shimazaki, J., Shinozaki, N., & Tsubota, K. (1998). Transplantation of amniotic membrane and limbal autograft for patients with recurrent pterygium associated with symblepharon. Br J Ophthalmol, 82(3), 235-240.

Simmons, S. J., Jumblatt, M. M., & Neufeld, A. H. (1987). Corneal epithelial wound closure in tissue culture: an in vitro model of ocular irritancy. Toxicol Appl Pharmacol, 88(1), 13-23.

Singh, A., Maurya, O. P., Jagannadhan, M. V., & Patel, A. (2012). Matrix metalloproteinases (MMP-2 and MMP-9) activity in corneal ulcer and ocular surface disorders determined by gelatin zymography. J Ocul Biol Dis Infor, 5(2), 31-35.

Singh, V., Santhiago, M. R., Barbosa, F. L., Agrawal, V., Singh, N., Ambati, B. K., & Wilson, S. E. (2011). Effect of TGFbeta and PDGF-B blockade on corneal myofibroblast development in mice. Exp Eye Res, 93(6), 810-817.

Siqueira, A. S., Gama-de-Souza, L. N., Arnaud, M. V., Pinheiro, J. J., & Jaeger, R. G. (2010). Laminin-derived peptide AG73 regulates migration, invasion, and protease activity of human oral squamous cell carcinoma cells through syndecan-1 and beta1 integrin. Tumour Biol, 31(1), 46-58.

Sivak, J. M., & Fini, M. E. (2002). MMPs in the eye: emerging roles for matrix metalloproteinases in ocular physiology. Progress in retinal and eye research, 21(1), 1-14.

136

Sivak, J. M., Mohan, R., Rinehart, W. B., Xu, P. X., Maas, R. L., & Fini, M. E. (2000). Pax-6 expression and activity are induced in the reepithelializing cornea and control activity of the transcriptional promoter for matrix metalloproteinase gelatinase B. Dev Biol, 222(1), 41-54.

Smelser, G. K., & Ozanics, V. (1946). Effect of quick freezing at very low temperatures of donor tissue in corneal transplants. Proc Soc Exp Biol Med, 62(2), 274-277.

Solomon, A., Ellies, P., Anderson, D. F., Touhami, A., Grueterich, M., Espana, E. M., . . . Tseng, S. C. (2002). Long-term outcome of keratolimbal allograft with or without penetrating keratoplasty for total limbal stem cell deficiency. Ophthalmology, 109(6), 1159-1166.

St-Pierre, Y., Couillard, J., & Van Themsche, C. (2004). Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets, 8(5), 473-489.

Sta Iglesia, D. D., Gala, P. H., Qiu, T., & Stepp, M. A. (2000). Integrin expression during epithelial migration and restratification in the tenascin-C-deficient mouse cornea. J Histochem Cytochem, 48(3), 363-376.

Sta Iglesia, D. D., & Stepp, M. A. (2000). Disruption of the basement membrane after corneal debridement. Invest Ophthalmol Vis Sci, 41(5), 1045-1053.

Stephens, P., Caley, M., & Peake, M. (2013). Alternatives for animal wound model systems. Methods Mol Biol, 1037, 177-201.

Stepp, M. A., & Zhu, L. (1997). Upregulation of alpha 9 integrin and tenascin during epithelial regeneration after debridement in the cornea. J Histochem Cytochem, 45(2), 189-201.

Sternlicht, M. D., & Werb, Z. (2001). How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol, 17, 463-516.

Streuli, C. (1999). Extracellular matrix remodelling and cellular differentiation. Curr Opin Cell Biol, 11(5), 634-640.

Stricker, T. P., Dumin, J. A., Dickeson, S. K., Chung, L., Nagase, H., Parks, W. C., & Santoro, S. A. (2001). Structural analysis of the alpha(2) integrin I domain/procollagenase-1 (matrix metalloproteinase-1) interaction. J Biol Chem, 276(31), 29375-29381.

Sugihara, H., Toda, S., Miyabara, S., Kusaba, Y., & Minami, Y. (1991). Reconstruction of the skin in three-dimensional collagen gel matrix culture. In Vitro Cell Dev.Biol, 27A(0883-8364 (Print)), 142-146.

Suzuki, K., Saito, J., Yanai, R., Yamada, N., Chikama, T., Seki, K., & Nishida, T. (2003). Cell-matrix and cell-cell interactions during corneal epithelial wound healing. Prog Retin Eye Res, 22(2), 113-133.

137

Takagi, S., Simizu, S., & Osada, H. (2009). RECK negatively regulates matrix metalloproteinase-9 transcription. Cancer Res, 69(4), 1502-1508.

Taliana, L., Evans, M. D., Dimitrijevich, S. D., & Steele, J. G. (2000). Vitronectin or fibronectin is required for corneal fibroblast-seeded collagen gel contraction. Invest Ophthalmol Vis Sci, 41(1), 103-109.

Tallant, C., Marrero, A., & Gomis-Ruth, F. X. (2010). Matrix metalloproteinases: fold and function of their catalytic domains. Biochim Biophys Acta, 1803(1), 20-28.

Tanaka, T., Furutani, S., Nakamura, M., & Nishida, T. (1999). Changes in extracellular matrix components after excimer laser photoablation in rat cornea. Jpn J Ophthalmol, 43(5), 348-354.

Tandon, A., Sharma, A., Rodier, J. T., Klibanov, A. M., Rieger, F. G., & Mohan, R. R. (2013). BMP7 gene transfer via gold nanoparticles into stroma inhibits corneal fibrosis in vivo. PLoS One, 8(6), e66434.

Tanioka, H., Kawasaki, S., Yamasaki, K., Ang, L. P., Koizumi, N., Nakamura, T., . . . Kinoshita, S. (2006). Establishment of a cultivated human conjunctival epithelium as an alternative tissue source for autologous corneal epithelial transplantation. Invest Ophthalmol Vis Sci, 47(9), 3820-3827.

Thoft, R., Friend, J., Jm, E., E, A., F, F., E, G., . . . G, V. (1983). The X , Y , Z Hypothesis of Comeol Epitheliol Mointenonce To the Editor : For the past few years , studies of corneal epithelial of corneal epithelial disease . Department of Ophthalmology. Invest Ophthalmol Vis Sci, 24(October), 1442-1443.

Torricelli, A. A., Marino, G. K., Santhanam, A., Wu, J., Singh, A., & Wilson, S. E. (2015). Epithelial basement membrane proteins perlecan and nidogen-2 are up-regulated in stromal cells after epithelial injury in human corneas. Exp Eye Res, 134, 33-38.

Torricelli, A. A., Santhanam, A., Wu, J., Singh, V., & Wilson, S. E. (2016). The corneal fibrosis response to epithelial-stromal injury. Exp Eye Res, 142, 110-118.

Torricelli, A. A., Singh, V., Santhiago, M. R., & Wilson, S. E. (2013). The corneal epithelial basement membrane: structure, function, and disease. Invest Ophthalmol Vis Sci, 54(9), 6390-6400.

Tortora, G. J., & Derrickson, B. (2007). Principes d'anatomie/physiologie 2e éd (ERPI ed.).

Tran, Q. T., Kennedy, L. H., & Carrion, S. L. (2012). EGFR regulation of epidermal barrier function. Physiological Genomics, 44(8), 455-469.

138

Tsai, R. J., Li, L. M., & Chen, J. K. (2000). Reconstruction of damaged corneas by transplantation of autologous limbal epithelial cells. N Engl J Med, 343(2), 86-93.

Tseng, H. C., Lee, I. T., Lin, C. C., Chi, P. L., Cheng, S. E., Shih, R. H., . . . Yang, C. M. (2013). IL-1beta promotes corneal epithelial cell migration by increasing MMP-9 expression through NF-kappaB- and AP-1-dependent pathways. PLoS One, 8(3), e57955.

Tseng, S. C. (2001). Amniotic membrane transplantation for ocular surface reconstruction. Biosci Rep, 21(4), 481-489.

Tuori, A., Uusitalo, H., Burgeson, R. E., Terttunen, J., & Virtanen, I. (1996). The immunohistochemical composition of the human corneal basement membrane. Cornea, 15(3), 286-294.

Turner, A., & Rabiu, M. (2006). Patching for corneal abrasion. Cochrane Database Syst Rev(2), CD004764.

Utheim, T. P. (2015). Concise review: transplantation of cultured oral mucosal epithelial cells for treating limbal stem cell deficiency-current status and future perspectives. Stem Cells, 33(6), 1685-1695.

Utheim, T. P., Utheim, O. A., Khan, Q. E., & Sehic, A. (2016). Culture of Oral Mucosal Epithelial Cells for the Purpose of Treating Limbal Stem Cell Deficiency. J Funct Biomater, 7(1).

Valdez-Garcia, J. E., Lozano-Ramirez, J. F., & Zavala, J. (2015). Adult white New Zealand rabbit as suitable model for corneal endothelial engineering. BMC Res Notes, 8, 28.

Vandenbroucke, R. E., & Libert, C. (2014). Is there new hope for therapeutic matrix metalloproteinase inhibition? Nat Rev Drug Discov, 13(12), 904-927.

Vermette, M., Trottier, V., Ménard, V., Saint-Pierre, L., Roy, A., & Fradette, J. (2007). Production of a new tissue-engineered adipose substitute from human adipose-derived stromal cells. Biomaterials, 28(18), 2850-2860.

Visse, R., & Nagase, H. (2003). Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res, 92(8), 827-839.

Watsky, M. A., McDermott, M. L., & Edelhauser, H. F. (1989). In vitro corneal endothelial permeability in rabbit and human: the effects of age, cataract surgery and diabetes. Exp Eye Res, 49(5), 751-767.

Weaver, C. S., & Terrell, K. M. (2003). Evidence-based emergency medicine. Update: do ophthalmic nonsteroidal anti-inflammatory drugs reduce the pain associated with simple corneal abrasion without delaying healing? Ann Emerg Med, 41(1), 134-140.

139

Weinberg, M. S., & Morris, K. V. (2016). Transcriptional gene silencing in humans. Nucleic Acids Res, 10, 101-113.

Whitcher, J. P., Srinivasan, M., & Upadhyay, M. P. (2001). Corneal blindness : a global perspective / John P. Whitcher, M. Srinivasan and Madan P. Upadhyay. 79(3), 214-221.

Whitcher, J. P., Srinivasan, M., & Upadhyay, M. P. (2001). Corneal blindness: a global perspective. Bull World Health Organ, 79(3), 214-221.

Wiley, L., Sundarraj, N., & Thofr, R. A. (2016). Regional Heterogeneity in Human Corneal and Limbal Epithelia: An Innmunohistochemical Evaluation. 32(3), 594-602.

Wilhelmus, K. R. (2002). Indecision about corticosteroids for bacterial keratitis. Ophthalmology, 109(5), 835-842.

Williamson, R. A., Marston, F. A., Angal, S., Koklitis, P., Panico, M., Morris, H. R., . . . Freedman, R. B. (1990). Disulphide bond assignment in human tissue inhibitor of metalloproteinases (TIMP). Biochem J, 268(2), 267-274.

Wilson, S. E. (2000). Role of apoptosis in wound healing in the cornea. Cornea, 19(3 Suppl), S7-12.

Wilson, S. E., Liu, J. J., & Mohan, R. R. (1999). Stromal-epithelial interactions in the cornea. Prog Retin Eye Res, 18(3), 293-309.

Wilson, S. E., Mohan, R. R., Mohan, R. R., Ambrosio, R., Jr., Hong, J., & Lee, J. (2001). The corneal wound healing response: cytokine-mediated interaction of the epithelium, stroma, and inflammatory cells. Prog Retin Eye Res, 20(5), 625-637.

Woreta, F. A., Davis, G. W., & Bower, K. S. (2015). LASIK and surface ablation in corneal dystrophies. Surv Ophthalmol, 60(2), 115-122.

Yamada, N., Yanai, R., Nakamura, M., Inui, M., & Nishida, T. (2004). Role of the C domain of IGFs in synergistic promotion, with a substance P-derived peptide, of rabbit corneal epithelial wound healing. Invest Ophthalmol Vis Sci, 45(4), 1125-1131.

Yamamoto, K., Miyazaki, K., & Higashi, S. (2010). Cholesterol sulfate alters substrate preference of matrix metalloproteinase-7 and promotes degradations of pericellular laminin-332 and fibronectin. J Biol Chem, 285(37), 28862-28873.

Yan, C., & Boyd, D. D. (2007). Regulation of matrix metalloproteinase gene expression. J Cell Physiol, 211(1), 19-26.

140

Yan, L., Borregaard, N., Kjeldsen, L., & Moses, M. A. (2001). The high molecular weight urinary matrix metalloproteinase (MMP) activity is a complex of gelatinase B/MMP-9 and neutrophil gelatinase-associated lipocalin (NGAL). Modulation of MMP-9 activity by NGAL. J Biol Chem, 276(40), 37258-37265.

Yanez-Soto, B., Liliensiek, S. J., Gasiorowski, J. Z., Murphy, C. J., & Nealey, P. F. (2013). The influence of substrate topography on the migration of corneal epithelial wound borders. Biomaterials, 34(37), 9244-9251.

Yang, X., Qu, L., Wang, X., Zhao, M., Li, W., Hua, J., . . . Dou, Z. (2007). Plasticity of epidermal adult stem cells derived from adult goat ear skin. Mol Reprod Dev, 74(3), 386-396.

Ye, H. Q., & Azar, D. T. (1998). Expression of gelatinases A and B, and TIMPs 1 and 2 during corneal wound healing. Investigative Ophthalmology and Visual Science, 39(6), 913-921.

Ye, H. Q., Maeda, M., Yu, F. S., & Azar, D. T. (2000). Differential expression of MT1-MMP (MMP-14) and collagenase III (MMP-13) genes in normal and wounded rat corneas. Invest Ophthalmol Vis Sci, 41(10), 2894-2899.

Yoon, J., Ismail, S., & Sherwin, T. (2014). Limbal stem cells: Central concepts of corneal epithelial homeostasis. World journal of stem cells, 6(4), 391-403.

Yu, F. S., Yin, J., Xu, K., & Huang, J. (2010). Growth factors and corneal epithelial wound healing. Brain Res Bull, 81(2-3), 229-235.

Yu, Q., & Stamenkovic, I. (2000). Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-beta and promotes tumor invasion and angiogenesis. Genes Dev, 14(2), 163-176.

Yuan, Y., Yeh, L. K., Liu, H., Yamanaka, O., Hardie, W. D., Kao, W. W., & Liu, C. Y. (2013). Targeted overexpression of TGF-alpha in the corneal epithelium of adult transgenic mice induces changes in anterior segment morphology and activates noncanonical Wnt signaling. Invest Ophthalmol Vis Sci, 54(3), 1829-1837.

Zagon, I. S., Sassani, J. W., & McLaughlin, P. J. (2000). Reepithelialization of the human cornea is regulated by endogenous opioids. Invest Ophthalmol Vis Sci, 41(1), 73-81.

Zaniolo, K., Leclerc, S., Cvekl, A., Vallieres, L., Bazin, R., Larouche, K., & Guerin, S. L. (2004). Expression of the alpha4 integrin subunit gene promoter is modulated by the transcription factor Pax-6 in corneal epithelial cells. Invest Ophthalmol Vis Sci, 45(6), 1692-1704.

141

Zhang, D., Bar-Eli, M., Meloche, S., & Brodt, P. (2004). Dual regulation of MMP-2 expression by the type 1 insulin-like growth factor receptor: the phosphatidylinositol 3-kinase/Akt and Raf/ERK pathways transmit opposing signals. J Biol Chem, 279(19), 19683-19690.

Zieske, J. D. (2001). Extracellular matrix and wound healing. Curr Opin Ophthalmol, 12(4), 237-241.

Zieske, J. D., & Gipson, I. K. (1986). Protein synthesis during corneal epithelial wound healing. Invest Ophthalmol Vis Sci, 27(1), 1-7.

Zieske, J. D., Hutcheon, A. E., Guo, X., Chung, E. H., & Joyce, N. C. (2001). TGF-beta receptor types I and II are differentially expressed during corneal epithelial wound repair. Invest Ophthalmol Vis Sci, 42(7), 1465-1471.

Zieske, J. D., Mason, V. S., Wasson, M. E., Meunier, S. F., Nolte, C. J., Fukai, N., . . . Parenteau, N. L. (1994). Basement membrane assembly and differentiation of cultured corneal cells: importance of culture environment and endothelial cell interaction. Exp Cell Res, 214(2), 621-633.