ÉCOLE DOCTORALE DE LA VIE ET DE LA SANTÉ

U1118 Mécanismes centraux et périphériques de la neurodégénérescence

THÈSE présentée par :

Lavinia PALAMIUC

soutenue le : 10 Septembre 2014

pour obtenir le grade de : Docteur de l’Université de Strasbourg

Discipline/ Spécialité : Aspect Moléculaire et Cellulaire de la Biologie

Mention Neuroscience

THÈSE dirigée par :

Mme RENÉ Frédérique Dr., Université de Strasbourg

RAPPORTEURS :

M ANDRES Christian Prof., Université de Tours

M CHARBONNIER Frédéric Prof., Université de Paris Descartes

AUTRES MEMBRES DU JURY :

Mme FLORENTZ Catherine Prof., Université de Strasbourg

M GENY Bernard Prof., Université de Strasbourg

M WEYDT Patrick Dr., Université de Ulm

ETUDES DES ALTÉRATIONS MÉTABOLIQUES MUSCULAIRES AU COURS DE LA

SCLÉROSE LATÉRALE AMYOTROPHIQUE : RÔLE DANS LE DÉVELOPPEMENT DE LA PATHOLOGIE

UNIVERSITÉ DE STRASBOURG!

ACKNOWLEDGEMENTS

My studentship in the lab of CENTRAL AND PERIPHERAL MECHANISMS OF

NEURODEGENERATION shaped my development, and for that i have to thank all my

colleagues from whom i learned so much over these years. I would like to express my

gratitude to Dr. Jean-Philippe LOEFFLER, the director of the lab, who kindly welcomed me

in this great team. With care and patience, he ensures a great atmosphere for doing

research.

I will forever be indebted to my advisor, Dr. Frédérique RENÉ. It was a great

pleasure to work by her side on developing this scientific project. With dedication she

passed on to me invaluable skills and knowledge. I would have never achieved my goals

without her excellent guidance.

I owe special thanks and appreciation to Dr. Jose-Luis GONZALEZ DE AGUILAR, who

always had for me great advise and ideas, but also very useful criticism. I want to thank

also Dr. Luc DUPUIS who has been for me an example of dynamism and perseverance. To

Dr. Caroline ROUAUX and Dr. Alexandre HENRIQUES I am most grateful not only for their

scientific input, but also for their mentorship as young scientists. In this line of great

mentors i have to include Dr. Christian GAIDDON who believed in me when i was still a

novice with little experience and encouraged and helped me to pursue an academic

career. Jose, Caroline, Alex, Luc and Christian gave me invaluable lessons that will help

me make my first steps in the tough world of science.

I would also like to thank Prof. Maria Teresa CARRI who kindly welcomed me in her

lab at the University of Rome for a short visit and a fruitful collaboration. For this

extraordinary „roman“ experience i also have to thank Dr. Cristiana VALLE, a wonderful

host.

As a PhD student, i could never thank enough the technical team that was there

with me on the battle field. Through troubleshooting, organizing, incredibly useful tips and

suggestions, our work at the bench is so much easier thanks to you Annie, Sylvie,

Michèle and Marie-Jo. For the efficient logistic organization I want to thank Brigitte. Our

lab would simply not function without her prompt assistance!

I want to thank all my colleagues, current and former members of the lab. Thanks to

Judith, Yannick, Hus, Florent, Jérôme, Thiebault and Vania i quickly felt as part of the

team. Aurélia and Jelena, I found in you not only respected peers but also invaluable

friends. I have to thank you for all the support you showed me, especially through these

last months that have been particularly difficult. Hajer, Pauline, Laura, Christine, Gina

and Steph, you make our lab lively and colorful, not to mention sweet (thanks for all the

cookies and cakes). I learned something from each of you and for that I am grateful and

and really proud of having been your colleague!

Finally I would like to thank all the members of the jury, who took the time to read

and thoroughly evaluate this work.

TABLE OF CONTENTS

ABBREVIATIONS 2

INTRODUCTION 6

1 AMYOTROPHIC LATERAL SCLEROSIS – A CLINICALLY AND GENETICALLY DIVERS SYNDROME 7 1.1 Clinical diveristy 7 1.2 Genetic diversity 8

2 PATHOGENESIS: SUPPOSED MECHANISMS AND KEY PLAYERS 14 2.1 Oxidative stress 15 2.2 Protein aggregates 17 2.3 Mitochondrial pathology 20 2.4 Glutamate excitotoxicity 22

3 MULTICELLULAR PATHOLOGY IN ALS 25 3.1 Astrocytes 27 3.2 Microglia 28 3.3 Muscle 29

4 MUSCLE, METABOLISM AND ALS 33 4.1 Muscle structure and physiology 33 4.2 Metabolic regulators of muscle function and fiber type 37 4.3 Muscle metabolism in aging and disease 43 4.4 Metabolic alterations in ALS 46

OBJECTIVES 52

RESULTS I 55

RESULTS II 58

RESULTS III 61

CONCLUSIONS AND PERSPECTIVES 64

SUMMARY IN FRENCH 69

BIBLIOGRAPHY 68

ABBREVIATIONS

2

AD Alzheimer s disease

Akt/PKB Akt/protein kinase B

ALS Amyotrophic Lateral Sclerosis

AMP Adenosine monophosphate

AMPA α-amino-3-hydroxy-4-isoxazole propionic acid

AMPK AMP-activated kinase

Atg-1 atrogin 1

ATP Adenosine triphosphate

Bcl2 B-cell lymphoma 2

CaMK calmodulin-dependent protein kinase

CNS Central Nervous System

COX cytochrome oxidase

CPT 1 Carnitine palmitoyltransferase I

CSF cerebrospinal fluid

DRP1 dynamin related protein 1

ERR estrogen related receptor

FA Fatty acid

FALS Familial Amyotrophic Lateral Sclerosis

FAT/CD36 Fatty acid transporter CD36

FG fast glycolytic

FOG fast oxidative glycolytic

FoxO forkhead transcription factor, O box subfamily

FTD frontotemporal dementia

FUS fused in sarcoma

GLT-1/EAAT2 glutamate transporter/excitatory amino-acid transporter 2

GluR 1-4 glutamate receptors (AMPA) subunits 1-4

3

GLUT4 glucose transporter 4

HDAC histone de-acetylase

HK Hexokinase

HRE hexanucleotide repeat expansion

Hsc heat shock cognate

Hsp heat shock protein

IGF1 insulin-like growth factor 1

IGFR insulin-like growth factor receptor

iPSC induced pluripotent stem cells

iPSCs induced pluripotent stem cells

MEF 2 Myocyte enhancer factor 2

MND motor neuron disease

mSOD1 mutant Cu/Zn superoxide dismutase

mtDNA mitochondrial DNA

mTOR mammalian target of Rapamycin

MuRF 1 Muscle RING-finger protein 1

MyHC myosin heavy chain

MyLC myosin light chain

NAD+ nicotinamide adenine dinucleotide oxidized

NADH nicotinamide adenine dinucleotide reduced

NMDA N-methyl-D-aspartate

NMJ neuromuscular junction

NRF nuclear respiratory factor

PDH pyruvate dehydrogenase

PDK pyruvate dehydrogenase kinase

PFK1 phosphofructokinase

4

PGC-1α peroxisome proliferator-activated receptor γ coactivator α

PI3K phosphoinositide 3 kinase

PKB protein kinase B

PLS Primary Lateral Sclerosis

PMA Progressive Muscular Atrophy

PPAR α, γ, β/δ peroxisome proliferator-activated receptor α, γ, β/δ

ROS reactive oxygen species

SALS Sporadic Amyotrophic Lateral Sclerosis

SDH succinate dehydrogenase

Sirt Sirtuin

SO slow oxidative

SOD1 Cu/Zn superoxide dismutase

TDP-43 transactive response DNA-binding protein 43

UCP uncoupling protein

WT wild type

5

INTRODUCTION

6

1 AMYOTROPHIC LATERAL SCLEROSIS – A CLINICALLY AND

GENETICALLY DIVERS SYNDROME

Neurodegenerative disorders are devastating fatal diseases that

continue to challenge the scientific community to find adapted cures, with little

breakthroughs so far. This endeavor has a tremendous urgency considering

the increasing incidence of these diseases within the current aging population.

1.1 CLINICAL DIVERISTY

In this category, motor neuron diseases (MND) reached an incidence of

2.16/100,000 people in Europe to date (Logroscino et al., 2010). This group of

diseases is characterized by progressive degeneration of upper and/or lower

motor neurons accompanied by muscle atrophy. Amyotrophic lateral sclerosis

(ALS) is the most common adult MND and presents with degeneration of both

upper and lower motor neurons. The site of onset can be either spinal, with

symptoms usually appearing first in limbs (65% of all cases) or bulbar

affecting first the swallowing muscles (30% of all cases). Denervation and

atrophy of respiratory muscles lead to respiratory failure, which is the main

cause of death (Kiernan et al., 2011). For the majority of patients age of onset

is around 50 years of age and death occurs within 3-5 years from diagnosis. A

better prognosis is given for those patients with only upper or lower motor

neuron involvement, referred to as primary lateral sclerosis (PLS) and

progressive muscular atrophy (PMA) respectively (Hardiman et al., 2011). A

small percentage of ALS cases do not fall precisely within these

characteristics. Cases of juvenile ALS have been reported, with time of onset

before the age of 20. Juvenile ALS has a slow disease progression extending

over decades (Ben Hamida et al., 1990), but some aggressive forms have

also been reported (Conte et al., 2012). The clinical heterogeneity of ALS is

complicated by the association with several other syndromes and

7

neurodegenerative disorders (Table 1), amongst which frontotemportal

dementia (FTD) is the most common (Ling et al., 2013).

1.2 GENETIC DIVERSITY

About 10% of patients have a familial history (familial ALS or FALS), the

remaining 90% being sporadic (sporadic ALS or SALS) with unknown

aetiology but clinically indistinguishable from FALS. It is believed however that

FALS incidence is underestimated due to flaws in patient history and reduced

genetic penetrance of certain mutations. So far more than 20 genes have

been implicated in or associated with ALS pathogenesis, most of them

discovered within the last 5 years (Table 1). Mutations of all these genes only

account for 68% of FALS and 11% of SALS patients (Renton et al., 2014)

(Figure 1). These genes have different functions in the cell, which makes the

identification of a common pathogenic mechanism, leading to the same

disease, laborious. Moreover, the genetic variation introduces some

heterogeneity in the clinical characteristics of ALS regarding time of onset,

duration of disease and association with other diseases (Table 1). Some

mutations can lead to slow developing ALS, juvenile ALS and ALS cases

associated with other diseases (FTD, Parkinson, etc). For this reason, more

and more often, ALS is defined as a “syndrome” regrouping complex and

divers pathophysiological manifestations (Hardiman et al., 2011).

The first mutated gene identified in ALS patients was the Cu/Zn

superoxide dismutase 1 (SOD1)(Rosen et al., 1993), an enzyme involved in

superoxide scavenging and protection from oxidative stress. This discovery

enabled the development of the only animal model for ALS that we have

today, which recapitulates most of the clinical and pathological aspects of the

human disease including neuronal degeneration and paralysis. Many point

mutations (177 according to alsod.org) of the SOD1 gene have been

described since 1993, representing 12% of FALS and 1% of SALS cases

8

Table 1. Main genes involved in ALS pathogenesis

Gene Location Inheritance Putative protein function Clinical features

SOD1 21q22 AD Superoxide metabolism ALS, cerebellar ataxia

ALS 2 2q33 AR Vesicle trafficking Juvenile PLS, infantile HSP

SETX 9q34 AD RNA metabolism Juvenile ALS, ataxia, oculomotor

apraxia, motor neuropathy

FUS 16p11 AR and AD RNA metabolism ALS, ALS-FTD, FTD,

parkinsonism

VAPB 20q13 AD Vesicle trafficking PMA, FALS

ANG 14q11 AD Angiogenesis FALS, SALS, PBP, ALS-FTD,

parkinsonism

TARDBP 1p36 AD RNA metabolism ALS, ALS-FTD, PSP, PD, FTD,

Chorea

FIG4 6q21 AD and AR Vesicle traffickingFALS, CMT, cognitive

impairments

OPTN 10p13 AR and AD Vesicle trafficking ALS

ATXN2 12q23 Endocytosis, RNA translation SALS, ataxia

VCP 9p13 AD Proteasome; vesicle

trafficking FALS, IBMPFD syndrome

UBQLN2 Xp11 XD Proteasome ALS, ALS-FTD

PFN1 17p13 AD Cytoskeletal dynamics ALS, FTD

C9orf72 9p21 AD DENN protein ALS-FTD

CHMP2B 3p11 AD Vesicle trafficking FALS, SALS, FTD

DCTN1 2p13 AD Axonal transport PMA, Perry syndrome

SQSTM1 5q35 AD Ubiquitination, autophagy ALS, Paget’s bone disease

Adapted from Andersen & Al-Chalabi, 2011

9

Figure 1.1. ALS-related genes (from Renton et al., 2014). More than 20 genes have been implicated in or associated with ALS pathogenesis, most of them discovered within the last 5 years. Mutations of all these genes only account for 68% of FALS and 11% of SALS patients. Some of the most important are represented here with the percentage of ALS patients that present with these mutations in FALS and SALS.

10

(Renton et al., 2014). Using the SOD1 transgenic animals several putative

pathogenic mechanisms that may participate to the progressive degeneration

of motor neurons have been described. Among them, oxidative stress, protein

aggregates, mitochondrial defects, and glutamate excitotoxicity are the most

documented. However after 20 years of research, we still do not have the one

critical pathogenic mechanism for ALS. The problematic of SOD1-related

pathogenesis and the controversies around it will be detailed in the next

section.

In 2006, the seminal discovery that Transactive Response DNA-binding

protein (TDP-43) is the major component of the ubiquitinated protein

inclusions in degenerating motor neurons opened a new path towards

understanding ALS pathogenic mechanisms (Neumann et al., 2006). TDP-43

is part of a family of RNA binding proteins, involved in RNA splicing and

transport (Buratti et al., 2001; Wang et al., 2004). Subsequently, TDP-43

mutations have also been described, but only in 4% of FALS cases and

approximately 1% of SALS (Renton et al., 2014). TDP-43 binds to a myriad of

mRNA targets and for this reason the pathogenicity of its mutation is little

understood. Recent evidence seems to indicate that mutation of TDP 43

impairs its function of anterograde transport of essential mRNA species from

soma to distal neuronal compartments, including the nerve terminals at the

neuromuscular junction (NMJ) (Alami et al., 2014). Alterations of RNA

metabolism are now thought to be a key player in ALS pathogenesis, as well

as other neurodegenerative diseases. In support of this new paradigm,

mutations of other genes involved in RNA processing have been identified in

ALS patients. Fused in sarcoma (Fus) mutations are localized in the gene’s

RNA-binding region and represent 4% of FALS and 1% of SALS (Renton et

al., 2014). Hexanucleotide repeat expansion (HRE) in C9ORF72 gene

represents today the majority of patients, with incidence in 40% of FALS and

7% of SALS cases. Interestingly, all of these mutations are common feature

for both ALS and FTD, one of the most common syndromes associated with

ALS.

11

Developing new models for these newly identified mutations has been a

difficult challenge. Some TDP-43 rodent lines were described so far.

Transgenic lines expressing human mutant TDP-43 showed an extremely

short life span (between 14 and 49 days), motor neuron degeneration and

astrogliosis associated with a severe motor phenotype and weight loss

(Stallings et al., 2010). These pathological characteristics underline the

specificity of TDP-43 toxicity for the motor system and are congruent with an

early-onset severe ALS. However, transgenic animals expressing human WT

TDP-43 presented a similar phenotype. In view of this observation it was

argued that human TDP-43, WT or mutant, is toxic in a mouse background.

Nevertheless overexpressing mouse TDP-43 in cortex, hippocampus and

striatum induced neuronal pathology and led to a neurological phenotype

remembering FTD (Tsai et al., 2010). Equally partial ubiquitous loss of TDP-

43 led to progressive loss of neurons (specifically layer V and ventral horn

motor neurons), motor dysfunction, paralysis and death (Yang et al., 2014).

ALS-linked Fus mutants affect the ability of mutant FUS to bind RNA and

cause mislocalization in the cytoplasm (Daigle et al., 2013). Such mutations in

mouse models induce a so-called fusopathy characterized by motor axon

degeneration, severe motor phenotype and death (Shelkovnikova et al.,

2013). In a zebra fish (Danio rerio) model both mutant FUS and FUS

knockdown induced neuromuscular junction abnormalities (Armstrong and

Drapeau, 2013). But, like for TDP-43, overexpressing WT human FUS in mice

induced an aggressive phenotype with degeneration of spinal cord motor

neurons, denervation associated with muscle atrophy and death at 12 weeks

of age (Mitchell et al., 2013).

Both loss and gain of function mechanisms have been proposed for

C9ORF72. The lack of animal or cellular models expressing mutant C9ORF72

has been a serious drawback in understanding the C9ORF72 pathogenicity.

The HREs pose specific technical problems due to their instability, but some

advances have been made using the induced pluripotent stem cell (iPSCs)

technology (Almeida et al., 2013). Recent reports clearly attest for a gain of

12

toxic function. Using iPSCs from ALS patients, it was shown that C9ORF72

expression is not particularly modified, and inactivating it rescues the

associated phenotype in motor neurons (Sareen et al., 2013). HREs in the

C9ORF72 sequence induce the formation of RNA foci, such as G-

quadruplexes and RNA-DNA hybrids (Haeusler et al., 2014). This leads to

abortive transcription, sequestration of specific HRE-binding proteins and

nucleolar stress.

Epidemiological studies have also showed that the incidence of disease

and the particularity of the mutations can differ from one geographical area to

the other, from one ethnic group to the other, suggesting an important role for

environmental factors (Andersen & Al-Chalabi, 2011; Sabatelli et al., 2013).

One of the most cited environmental risk factor is physical activity. An active

sports-oriented life style has been associated with ALS patients (Scarmeas et

al., 2002) and increased incidence amongst professional athletes has also

been reported (Chiò et al., 2005). Other factors include diet (Nelson et al.,

2000; Okamoto et al., 2007) and toxic substances (e.g. heavy metals,

pesticides).

This genetic, clinical and epidemiological diversity of ALS undoubtedly

hampered all efforts to find therapeutic targets and design efficient therapeutic

approaches. Moreover, the insidious pathology and the limited diagnostic

tools lead to a late diagnosis, when therapeutic interventions may no longer

be effective. Therefore future lines of research have to concentrate on finding

early diagnostic markers on one hand. On the other hand, a big challenge is

the development of new animal models that will reflect this genetic diversity

and therefore contribute to a better understanding of the complex

pathogenicity in ALS.

13

2 PATHOGENESIS: SUPPOSED MECHANISMS AND KEY

PLAYERS

Several mechanisms are suspected to intervene in the pathogenesis of

ALS. A multitude of pathologic alterations have been described and they

appear intricately linked at different levels, making it quite difficult to discern

between cause and consequence. For this reason their respective

participation to the pathogenesis of ALS remains little understood and for

most, a matter of controversy.

Since the first mutated gene identified in ALS patients was the SOD1

gene, one of the first causes investigated was the oxidative stress related to

the supposed SOD1 loss of function. However, compelling arguments quickly

dismissed this possibility. An anecdotal experiment showed that human

mutated SOD1 rescues SOD1 knockout Saccharomices cerevisiae just as

effectively as the human WT SOD1, to the point where the two strains are

phenotypically undistinguishable (Rabizadeh et al., 1995). Moreover, knockout

mouse models for SOD1 do not present ALS-like symptoms (Reaume et al.,

1996), and the phenotype of transgenic SOD1 mice cannot be rescued with

the WT SOD1. On the contrary, overexpressing human WT SOD1 aggravates

disease progression in ALS animal models (Jaarsma et al., 2000). The

expression of a murine mutant SOD1 that does not have dismutase activity

(G86R) leads to the development of an ALS in mice, even if the endogenous

SOD1 is still active (Morrison et al., 1998). Therefore the hypothesis of a toxic

gain of function has been investigated and a plethora of potential mechanisms

have been described.

14

2.1 OXIDATIVE STRESS

Considering oxidative stress as a causative factor of ALS was a

reasonable assumption, since the main function of SOD1 is superoxide

scavenging (Figure 2.1-a). Initially it was believed that a decrease in SOD1

activity facilitates the reaction between superoxide and nitric oxide producing

peroxynitrite (-ONOO). Peroxynitrite was one of the first “non-physiological”

substrates thought to bind to mutant SOD1 (mSOD1) (Figure 2.1-c) inducing

deleterious nitration of tyrosine protein residues (Beckman et al., 1993).

However, as it was mentioned earlier, it became quickly clear that things are

not that simple, since several mSOD1 maintain there scavenging activity. This

theory was developed and modified over the years, revealing mechanisms

that are a lot more complex than the original simplistic idea of “just” oxidative

stress (Beckman et al., 2001; Cleveland & Rothstein, 2001).

The discovery that some mutations induce a looser folding of SOD1

protein (Deng et al., 1993) led to the hypothesis that this is the basis of the

SOD1 toxicity. The improper folding of mSOD1 affects the binding specificity

for the metal ions essential for its activity (Cu2+ and Zn2+), the misfolded

mutant SOD1 showing low copper-to-zinc ratios (Goto et al., 2000). Copper

ions seem to facilitate the toxic activity of mSOD1 augmenting the catalytic

oxidation of substrates by peroxide H2O2 (Fig. 2.1-b) and cupper-chelators

efficiently inhibit apoptosis in neurons expressing mSOD1 (Wiedau-Pazos et

al., 1996). In the same time, Zn2+ ion deficiency is toxic selectively to motor

neurons increasing tyrosine nitration (Crow et al., 1997). In favor of the low

metal binding capacity, when replete with both Cu2+ and Zn2+ mSOD1 protects

neurons even in the absences of trophic factors and does not induce

apoptosis (Est vez et al., 1999). Estévez and colleagues showed that Zn-

deficient SOD facilitates the production of peroxynitrite through the

intermediary of nitric oxide (Figure 2.1-d).

15

Figure 2.1. Chemistry of mSOD1 toxicity (adapted from Cleveland and Rothstein, 2001). A. SOD1 enzymatic function is that of scavenging superoxide free radicals, by dismutating O2- to O2 and peroxide. B-D. Point mutations of SOD1 gene, associated with ALS, change the chemistry of SOD1, conferring new toxic properties. Several chemical mechanisms of SOD1 toxicity have been proposed that arise from use of aberrant substrates, having as a result an increased in oxidative stress, rather than ROS scavenging.

16

All these proposed mechanisms revolve around the accumulation of

peroxynitrite (Bruijn et al., 1997), which is strong oxidant compound that

induces apoptosis in neuronal cells. However, deletion of nitric oxide synthase

(NOS), aimed at reducing the levels of nitric oxide necessary for peroxynitrite

production, has no effects in vivo, suggesting that these might not be the main

toxic mechanism of mSOD1 (Facchinetti et al., 1999). Moreover, clinical

attempts to reduce oxidative stress have been largely discouraging so far

(Orrell et al., 2007).

2.2 PROTEIN AGGREGATES

The accumulation of toxic protein aggregates is a common feature for

neurodegenerative diseases (AD, HD) and it has been showed that these

aggregates are involved in neuronal apoptosis. But whether they are cause or

consequence of disease, or even a protective mechanism, remains to be

confirmed. This is also the case in ALS.

Protein aggregates positive for mSOD1 have been described in patients

with SALS and FALS (Shibata et al., 1996) and animal models (Bruijn et al.,

1998; Shibata et al., 1998; Watanabe et al., 2001). These aggregates have

been described in motor neurons as well as astrocytes. As Bruijn and

colleagues pointed out, the accumulation of SOD1-positive aggregates

coincide with disease onset in mice. The authors argued that the aggregates

might more easily explain the toxic function of misfolded SOD1, since

overexpression of human WT SOD1 does not rescue neuronal death. If it

were to be any of the oxidant mechanism described before, the WT would

compete with the mutant and reduce erroneous oxidative reactions and the

concentration of toxic products, which was not the case. However it has been

pointed out that since aggregates do not appear before muscle weakness, it

may not be a triggering factor, but on the contrary, that it could be an attempt

17

to protect the cell from toxic damage issued from the enzymatic activity of

misfolded SOD1 (Brown et al., 1998).

Regardless of this debate, SOD1 aggregates entangle within proteins

essential for cell function and protein control (Figure 2.2). For instance,

several proteins involved in protein quality control and degradation have been

showed to interact with mSOD1 from transgenic mice: proteasome, ubiquitin,

Hsc70 (Watanabe et al., 2001) or Hsp 105 (Yamashita et al., 2007). Equally,

SOD1 may interact with other members of the heat shock protein family

Hsp70 and Hsp40 (Shinder et al., 2001) as it was shown in neuronal cell

cultures expressing mSOD1. While most of the Hsp family members that are

upregulated in transgenic animal models, some are downregulated. For

instance, Hsp70 or Hsp105 (Yamashita et al., 2007) seem to have a

protective role, preventing formation of aggregates and increasing cell viability

when overexpressed in neuronal cell cultures expressing mSOD1.

SOD1 aggregates also contribute directly/physically to neuronal

apoptosis. In fact the WT SOD1 has anti-apoptotic properties while mSOD1

promotes apoptosis, by binding incorrectly to the anti-apoptotic protein Bcl2

and forming aggregates in spinal cord mitochondria from G93A transgenic

mice (Pasinelli et al., 2004). Therefore it seems that by sequestering the anti-

apoptotic protein Bcl2, mSOD1 promotes apoptosis in motor neurons. In

support of this, it is known that overexpressing the protective Bcl2 in

transgenic animal considerably extends life span delaying neuronal

degeneration (Kostic et al., 1997).

More than 20 years of accumulating evidence suggest that misfolded

SOD1 has toxic functions that lead to the same course of disease every time.

Independent of the position of the mutation, the result is invariably the same:

destabilization of the tertiary structure of SOD1. This is reinforced by the fact

that even non-genetic alterations of WT SOD1 leading to protein misfolding

(oxidation, metal depletion) give toxic properties similar to those of mSOD1

that are selectively detrimental to motor neurons (Kabashi et al., 2007;

18

Figure 2.2. Mechanisms of misfolded SOD1 toxicity (from Cleveland ans Rothstein, 2001). SOD1 point mutations associated with ALS alter the structural conformation of mSOD1. The loosely folded mSOD1 is prone to form aggregates, that entangle within several essential enzymes of the protein degradation pathway.

19

Rotunno & Bosco, 2013). Despite all efforts however, we have not yet been

able to identify a clear toxic mechanism that is common to all mutant variants

of SOD1 and that could trigger key pathogenic events in FALS and explain

disease etiology.

2.3 MITOCHONDRIAL PATHOLOGY

Several pathological modifications in mitochondria from ALS patients

have been described: ultrastructural changes like vacuolization and

fragmentation, but also Ca2+ handling, and axonal transport (Cozzolino and

Carrì, 2012). Transferring mitochondrial DNA (mtDNA) from patients into

mtDNA-depleted neuroblastoma cell line was enough to recapitulate ALS

mitochondrial pathology (Swerdlow et al., 1998). Mitochondrial alterations are

also very well documented in various ALS mouse models (Bendotti et al.,

2001; Kong et al., 1998; Wong et al., 1995).

The ultrastructural changes (vacuolization and fragmentation) described,

are related to alterations of mitochondrial fusion-fission dynamics, processes

essential for mitochondrial renewal. An initial increase in both fusion and

fission proteins is replaced by a decreased expression of fusion proteins in

the pre-symptomatic stage of mSOD1 mice (Liu et al., 2013). The co-

expression mSOD1 with a dominant negative of dynamin related protein 1

(DRP1), one of the fission proteins, prevented mitochondrial fragmentation

and neuronal apoptosis in vitro (Song et al., 2013). The same effect was

observed when co-expressing mSOD1 with mitochondrial metabolic

regulators, Sirtuin 3 and Peroxisome Proliferator Activated Receptor γ

Coactivator 1α (PGC-1α).

The ultrastructural modifications are accompanied by alterations in

mitochondrial function. Altered function of the respiratory electron chain,

reduced ATP production together and increased ROS generation have been

20

described in patients and mouse models. Decreased activity of complex IV of

the respiratory electron chain has been described in ventral horn motor

neurons (Fujita et al., 1996) and muscle (Echaniz-Laguna et al., 2006;

Echaniz-Laguna et al., 2002; Vielhaber, 2000) of SALS patients.

decreased activity of complexes II and IV, and increased sensitivity to

inhibition of glycolysis (Menzies, 2002). Detailed analysis of isolated

mitochondrial from spinal cord of an ALS rat model revealed increased resting

oxygen consumption correlating with increased ROS production, while state 3

respiration (oxidative phosphorylation) was significantly impaired (Panov et

al., 2011).

Ca2+ is essential signaling molecule for mitochondrial function, coupling

ATP demand with synthesis (Jouaville et al., 1999). Dysfunction in

mitochondrial Ca2+ handling was proposed to increase intracellular Ca2+ levels

and to induce depolarization of mitochondrial membrane (Kawamata and

Manfredi, 2010). Depolarized mitochondria are found at the level of

neuromuscular junction, in nerve terminals (Nguyen et al., 2009) and in

muscle fibers (Zhou et al., 2010). In mSOD1 mice increasing mitochondrial

Ca2+ buffering capacity improved the ATP synthesis and preserved

mitochondrial function in spinal cord. Moreover, this was accompanied by a

decrease of astrogliosis, and significant reduction of motor neuron death

(Parone et al., 2013). However, the improvement of mitochondrial Ca2+

buffering capacity did not prevent axonal degeneration and denervation, thus

eliminated SOD1-mediated loss of Ca2+ buffering capacity as a primary

contributor to ALS pathogenesis in these animal models.

The connection between mSOD1 and mitochondrial pathology are still

under investigation, but it seems to be related to the localization, at least to

some extent, of mSOD1 into the mitochondria (Carrì and Cozzolino, 2011).

Increasing mSOD1 solubility in mitochondria, but not in cytoplasm, prevented

mitochondrial fragmentation and neuronal apoptosis in vitro. Zinc seems to

play an important role in mSOD1 mitochondrial toxicity. Expression of a zinc-

21

Overexpression of mSOD1 in cultured motor neuron-like cells (NSC34) lead to

deficient SOD1 in Drosophila melanogaster induces vacuolization associated

with inefficient ATP production and alterations in motor behavior (Bahadorani

et al., 2013).

2.4 GLUTAMATE EXCITOTOXICITY

Glutamate is the major excitatory neurotransmitter in the CNS, with

approximately 80-90% of synapses in the brain being glutamatergic. The post-

synaptic cells are equipped with three main classes of inotropic glutamate

receptors (NMDA, AMPA and kainate receptors) and three main classes of

metabotropic glutamate receptors (I, II and III). In the 70’s, a series of

experiments revealed that glutamate could act as a potent neurotoxin inducing

neurodegeneration (Hassel and Dingledine, 2012). Since then, glutamate

excitotoxicity has been associated with many pathological conditions like

epilepsy, ischemic brain injury and several neurodegenerative disorders

including ALS. The first report evidencing glutamate excitotoxicity in ALS,

described an increase of 100 to 200% of glutamate and aspartate in the

cerebrospinal fluid (CSF) of 18 ALS patients (Rothstein et al., 1990). This

explained the potent toxic effect that the CSF from patients has on healthy

neuronal cell cultures (Couratier et al., 1993).

This neurotoxic action of glutamate on neurons was explained by the

deleterious effect that calcium ions exert when in high concentration. The

glutamate excitotoxicity theory posits that under certain circumstances,

and a promising therapeutic target for several reasons. Firstly, it is known that

22

stimulation of the glutamate receptors on the post-synaptic membrane.

glutamate is found in excess in the synaptic cleft leading to an over-stimulation

Specififically, AMPA and NMDA receptors, when over-stimulated, facilitate large

quantities of Ca2+ ions to enter into the cytoplasm.

The glutamate excitotoxicity was a particularly exciting theory for ALS

motor neurons have low calcium buffering capacity. This makes them

particularly vulnerable to calcium-mediated glutamate toxicity. Secondly,

motor neurons express mainly glutamate receptors that are highly permeable

to Ca2+. Indeed, motor neurons are particularly vulnerable to AMPA-induced

calcium toxicity. The experiments conducted by Couratier and colleagues in

the early 90’s clearly showed that AMPA but not NMDA antagonists could

block the toxic effect of CSF from ALS patients on cultured motor neurons

(Couratier et al., 1993). AMPA receptors are composed of 4 subunits (GluR1-

4), out of which the GluR2, impermeable to Ca2+ ions and the most frequent in

other neuronal populations in the CNS, is little expressed in human motor

neurons (Kawahara et al., 2003; Williams et al., 1997). Mice lacking the GluR2

AMPA subunit do not present with motor neuron disease (Jia et al., 1996),

however deleting the GluR2 subunit in a mouse line expressing the mutated

G93A SOD1 accelerated the progression of the disease (Van Damme et al.,

2005). Taken all together, these data indicate that glutamate excitotoxicity is a

selective pathologic mechanism for motor neuron degeneration.

But what could explain the excess of glutamate present in the synaptic

cleft in ALS? The fate of glutamate is under the control of astrocytes

responsible for its clearance through glutamate transporters, critical for

maintaining low concentrations of glutamate in the synaptic cleft. The absence

of glutamate transporters, specifically Glut1/EAAT2 and GLAST leads to

neurodegeneration and progressive paralysis (Rothstein et al., 1996). ALS

patients present a dramatic loss of GLT-1/EAAT2 transporters compared to

healthy patients, a decrease visible in both motor cortex and spinal cord

(Rothstein et al., 1995). However, the overexpression of EAAT2 in transgenic

SOD1 mice revealed a delay in motor neuron death but did not delay disease

onset nor did it increase the life span of transgenic animals (Guo et al., 2003).

Moreover, Riluzole, the only therapeutic molecule used as treatment for ALS,

has been a major disappointment. Riluzole targets glutamate excitotoxicity

and has been used with some success in transgenic models (Gurney et al.,

1996; Gurney et al., 1998) but its administration extends patient life span for

23

about three months (Miller et al., 2012). While this approach did not give the

expected results, it brought attention on one essential aspect: the involvement

of astrocytes in pathological events in ALS.

As it is outlined is this section multiple mechanisms have been

associated with SOD1 mutations but so far a clear-cut pathogenic mechanism

is missing. Although it is evident that all these alterations, from oxidative

stress to glutamate excitotoxicity are detrimental for neurons, some with a

degree of selectivity for motor neurons, they do not stand out as causative

factors, at least not by themselves. Blocking either one of them did not stop

ALS in transgenic mice. For this reason the therapeutic approaches had

extremely limited results. Understanding the chemistry of mSOD1 will

probably be a big step in our understanding of mSOD1 related pathologic

mechanisms and bring us closer to an efficient therapeutic approach.

24

3 MULTICELLULAR PATHOLOGY IN ALS

As it was originally defined, ALS is solely a disease of motor neurons!,

and for the last two decades scientists tried to understand why the disease is

so selective for this neuronal population. Several theories have been

postulated, as it was described in the previous section. Interestingly, some of

the molecular and ultrastructural mSOD1-related modifications described

above, were also found in cells other than motor neurons, like astrocytes and

microglia. Moreover independent studies overexpressing different variants of

mSOD1 specifically in motor neurons have demonstrated that motor neurons

are not the sole participants to the pathogenesis and progression of ALS. Two

initial studies showed that expression of mSOD1 in motor neurons does not

induce motor neuron death, or an ALS-like pathology (Lino et al., 2002;

Pramatarova et al., 2001). However, a subsequent study that used a different

promoter reported a late onset ALS, with motor neuron degeneration and

aggregates associate with muscular atrophy (Jaarsma et al., 2008). This late

onset of disease in animal expressing mSOD1 specifically in motor neurons

indicated that other cellular population might accelerate disease onset and/or

progression, supporting the theory of non-cell autonomous mechanisms

involved in ALS.

Nevertheless, the question of selectivity did not become obsolete, just

more complicated. As Boillée et al. defined it, ALS is a disease of motor

neurons and their non-neuronal neighbors (Boill"e et al., 2006a). Different

cellular populations surround the motor neuron and each of them has distinct

roles in maintaining its integrity, like astrocytes and microglia. Astrocytes have

an important metabolic function, supplying the substrate (lactate) for neuronal

energy production. They form complex networks around neurons aimed at

coupling the blood flow with the local energetic demands (Allaman et al.,

2011). Microglia are the macrophages of the CNS and they play a major role

in neurodegenerative diseases. They eliminate pathogens, dead and dying

neurons, but also neuronal processes and live neurons that show sign of

25

Figure 3.1. Cell autonomous and non-cell autonomous pathogenic mechanisms in ALS (from Dion et al., 2009). The mSOD1 pathology in ALS is the best characterized so far. Several cellular types present with mSOD1 aggregates: motor neurons, astrocytes, microglia and muscle. The mSOD1-related pathology in each of these cells contribute to motor neuron degeneration and disease progression.

26

stress (Brown et al., 2014). At the same time, muscle, so far considered as a

simple victim of denervation, emerges as a target of mSOD1 toxicity

(Dobrowolny et al., 2008). Muscle tissue pathology in ALS and its relevance

for disease progression is probably the least understood so far. In order to

design new efficient therapies for ALS we have to understand the participation

of each of these cell types to the progressive deterioration and subsequent

selective death of motor neurons (Figure 3.1).

3.1 ASTROCYTES

The astrocyte net is extremely important in maintaining extracellular and

intracellular energy homeostasis in neurons. It controls pH and ion buffering,

supplies metabolic substrates and clears waste products such as excess

glutamate (B"langer and Magistretti, 2009). It is noticeable that in spinal cord,

astrogliosis is one of the hallmarks of ALS in patients and mouse models. As

mentioned previously, in ALS, astrocytes came into the spotlight mainly due to

their crucial role in protecting neurons from glutamate excitotoxicity through

the astrocyte-specific glutamate transporter EAAT2. The expression of

mSOD1 exclusively in this cell type proved to be detrimental to astrocytes,

inducing hypertrophy and astrocytosis but did not induce motor neuron loss

nor muscle atrophy (Gong et al., 2000). While not excluding a role for astroglia

in ALS, the logical conclusion was that they do not initiate the disease.

Reducing mutant SOD1 expression specifically in astrocytes did not affect

disease onset, but significantly slowed disease progression and microglial

activation (Yamanaka et al., 2008).

A series of elegant in vitro studies showed that astrocytes carrying

SOD1 mutations induce apoptosis exclusively in motor neurons (when

compared to other neuronal and non-neuronal lines) through soluble toxic

factors (Cassina et al., 2005; Marchetto et al., 2008; Nagai et al., 2007). In

these studies, the apoptotic mechanism seemed to be independent of

27

glutamate excitotoxicity, but rather dependent on the production of nitric oxide.

Importantly, astrocyte toxicity seems to be a conserved mechanism in ALS,

independent of the gene mutation involved. Astrocytes derived from patients

with both FALS and SALS without SOD1 mutations had the same selective

apoptotic effect on motor neurons (Haidet-Phillips et al., 2011). Interestingly,

deleting WT SOD1 from these astrocytes prevented the neuronal death in this

experimental setting.

In line of this evidence it became clear that astrocytes play an important

part in neuronal degeneration. This role goes beyond glutamate excitotoxicity

as other factors seem to be the crucial mediators of astrocyte-dependent

neuronal damage.

3.2 MICROGLIA

Microglia are the macrophages of the nervous system. They become

activated following neuronal injury, secreting several toxic molecules like

reactive oxygen, nitrogen species and cytokines that are damaging for the

surrounding cells. Inflammation accompanies neuronal injury in several

degenerative diseases. It has also been described in ALS patients in affected

areas (motor cortex, brainstem, corticospinal tract and spinal cord)

(Kawamata et al., 1992). In animal models inflammation correlates with

disease progression (Alexianu et al., 2001).

Several molecules that inhibit microglial activation were shown to have a

beneficial effect on disease progression in animal models. Best results were

obtained with the antibiotic and anti-inflammatory minocycline that delayed

disease onset and extended survival by approximately 16% (Van Den Bosch

et al., 2002; Zhu et al., 2002). The beneficial effect of minocycline seems to be

mediated by the inhibition of cytochrome c release from the mitochondria, a

potent activator of caspases 3 and 9. In order to completely isolate the role of

microglia in the progression of the disease a transgenic mouse, expressing a

28

removable mSOD1, was created (Boill"e et al., 2006b). By diminishing

mSOD1 expression specifically in microglia disease onset was not

significantly delayed. However, the mean survival was extended by more than

30%, suggesting that microglia are not pathogenic but they considerably

modulate disease progression. It is important to note that in the experiments

performed by Boillée and colleagues the activation of microglia and astrocytes

was not reduced nor delayed, suggesting that factors other than inflammation-

related molecules may be involved.

3.3 MUSCLE

The observation that the first event in disease progression is the

retraction of nerve terminals and loss of neuromuscular synapses (Frey et al.,

2000; Pun et al., 2006; Vinsant et al., 2013) turned the attention towards the

distal end of the motor axis (Figure 3.2). From this perspective, ALS was

proposed to be a distal axonopathy, with the dismantlement of the

neuromuscular junction as a premier pathologic event, preceding denervation

and any sign of motor neuron death (Fischer et al., 2004). Several series of

experiments followed in support of this hypothesis attesting the fact that the

neuronal cellular body is a late event and that rescuing the neuronal body is

not enough to salvage the NMJ and prevent muscular atrophy (Gould et al.,

2006; Rouaux et al., 2007).

These observations encouraged investigations of muscle pathology in

ALS. The role of muscle tissue in disease pathogenesis and/or progression is

probably the most debated. Muscle is considered a simple bystander merely

reflecting the effects of denervation. For this reason mSOD1 pathology in

muscle cells has not been extensively explored. Several mitochondrial defects

have been described in muscles from patients (Echaniz-Laguna et al., 2006;

Echaniz-Laguna et al., 2002) and animal models (Luo et al., 2013; Zhou et al.,

2010). In animal models this defects consisting in reduced mitochondrial

29

Figure 3.2. Timeline of physiopathological changes in the SOD1G93A ALS mouse model (from Vinsant et al., 2013). Several pathological alterations have been associated with mSOD1. One way to understand the pathogenesis of ALS is to identify the sequence of events leading to motor neuron degeneration. In the ALS mouse model expressing mSOD1G93A these alterations are measurable starting after the first week of life, both in spinal cord and at the level of NMJ.

30

dynamics, fragmentation and membrane depolarization that appear before

disease onset. Moreover, targeting mSOD1 specifically to muscle

mitochondria in healthy animals, induces the same type of mitochondrial

defects (Luo et al., 2013). This suggests that these alterations are more likely

related to mSOD1 toxicity than to the retraction of nerve endings. Equally,

increased ROS production in non-symptomatic muscle of SOD1 mice has

been shown to induce the over-expression of Ras-related associated with

diabetes (Rad), a potent inhibitor of voltage-dependent calcium channels. Rad

up-regulation correlates with disease severity in patients diagnosed with

sporadic ALS (Halter et al., 2010). As it was mentioned earlier, protein quality

control is altered due to SOD1 aggregates. While inclusions are not visible in

muscle tissue, a robust activation of the protein quality control system and

induction of autophagic response was evidenced in muscle from SOD1 mouse

model. The activation was more important than in motor neurons (Crippa et

al., 2013). This can be explained by differences in SOD1 chemistry according

to cellular environment. In the muscle cell line C2C12 mSOD1 remains soluble

without forming aggregates that affect the proteasome function. That allows a

better clearance of misfolded mSOD1 than in the motor neuron cell line

NSC34 (Onesto et al., 2011).

By applying the same strategy used to underpin the role of astrocytes

and microglia, muscle came into the spotlight as a premiere target of SOD 1

toxicity. Two independent studies have showed that restricted expression of

mSOD1 induces muscle atrophy and oxidative stress (Dobrowolny et al.,

2008; Wong and Martin, 2010). The expression of mSOD1 specifically in

muscle tissue recapitulates many aspects of the disease, including motor

neuron death and glial activation (Wong and Martin, 2010).

Several lines of evidence suggest that muscle can play an active role in

motor neuron degeneration. For instance the neurite outgrowth inhibitor Nogo-

A was found to be upregulated in muscle tissue of patients and in pre-

symptomatic SOD1 mouse model, in strong correlation with disease severity.

For this reason Nogo-A was proposed to participate to the destabilization of

31

the NMJ and retraction of nerve terminals. The ablation of Nogo A in muscle

of SOD1 mouse model extends survival by 10%, while overexpression in WT

mice induces atrophy and denervation (Jokic et al., 2006). Altered muscle

metabolism is another potential mechanism of muscle-induced denervation.

Inducing a hypermetabolism in muscle by uncoupling mitochondrial respiration

is enough to affect NMJ stability and function and to induce distal

degeneration of motor neurons (Dupuis et al., 2009). Since mitochondrial

defects come out as the most evident SOD1-related muscle defect in ALS,

protection of mitochondria was another potential target. However, it has been

shown that by rescuing muscle mitochondria through the upregulation of

PGC-1α atrophy is prevented but is not enough to prevent neuronal death in

an ALS mouse model (Da Cruz et al., 2012).

The evidence available so far indicates an early muscle pathology that

parallels the neuronal pathology. It is noticeable that targeting muscle opens

therapeutic possibilities aimed at preventing muscle denervation and atrophy.

It seems however that the mechanisms involved in mSOD1-related muscle

pathology are different from those in neurons, since the chemical behavior of

mSOD1 is different in the two cell types. Further characterization of muscle

pathology in ALS is imperatively needed. Equally the cause-consequence

relationship remains a matter of controversy. The experiments presented here

proposed several potential pathways of muscle-nerve signaling that could

participate to the destabilization of the NMJ. However, the extent to which

muscle tissue may participate to disease progression and the potential

mechanisms involved are less clear, the scientific literature remaining poor

and inconclusive.

32

4 MUSCLE, METABOLISM AND ALS

Skeletal muscle is perfectly shaped to fulfill its function of transforming

chemical energy into mechanic energy and movement. In order to do so

continuous amounts of energy are needed, therefore it is not surprising that

the muscular system consumes 30% of the overall body energetic supply at

rest (Zurlo et al., 1990). In the same time, muscle fibers adapt perfectly to

variations in energetic demands and nutrient supply just by tuning their

metabolism. For instance, during periods of nutrient scarcity, muscle

metabolism is tuned down in order to preserve energy for essential life

supporting processes. Due to its intrinsic plasticity, muscle ultrastructure and

metabolic profile are shaped by changes in activity, aging and disease. From

this perspective muscle is a metabolic organ of high importance for whole

body energy homeostasis.

4.1 MUSCLE STRUCTURE AND PHYSIOLOGY

From standing to running, from writing to boxing, skeletal muscles are

designed to produce a diversity of movements with different energetic

demands. Muscle fibers have the capacity of instantly providing high amounts

of ATP for intense/acute activities, but also continuously providing ATP for

longer periods of enduring physical activities. This is possible due to the

structural and metabolic diversity of muscle fibers (Schiaffino and Reggiani,

2011).

Every muscle fiber is comprised of a multitude of protein complexes

called myofibrils that are strings of smaller units called sarcomeres. The main

sarcomeric proteins are the thick myosin filaments interposed by thin, shorter,

actin filaments. The actin filaments slide during contraction over the thick

filaments, toward the center of the sarcomere shortening the length of the

33

myofibrils and generating muscle contraction (Huxley, 1957). The number of

aligned sarcomeres per area unit gives the force of one muscle.

The hexameric thick filament is a molecular motor. A thick filament

consists of two myosin heavy chains of 220 kd (MyHCs), two myosin light

chains of 20kd (MyLC20) and two myosin light chains of 17kd (MyLC17). The

myosin heavy chain has an enzymatic function that consists in transforming

the chemical energy stored in ATP molecules into mechanical energy through

ATP hydrolysis. The mechanical function of myosin relies on conformational

changes and binding of actin filaments through so-called cross-bridges or

myosin heads. In fact a contraction is given by cyclic tightening and loosening

of actin binding onto the myosin chain and this interaction requires ATP

hydrolysis (Rayment et al., 1993). The MyLC17 is involved in maintaining the

structural stability of the cross-bridges, while the MyLC20 has a regulatory

function that is not well understood.

Muscle fibers are heterogeneous, and that is visible to the naked eye.

The different muscle types can be distinguished by their color. The fact that

muscle can be categorized into white and red is a known fact since the 19th

century (Schiaffino and Reggiani, 2011). Advances in histochemical methods

allowed the classification of muscle fibers using their enzymatic activity profile.

The red slow-twitch muscles are rich in oxidative enzymes such as succinate

dehydrogenase (SDH) and cyclooxygenase (COX), as opposed to white fast-

twitch muscles that depend on glycolysis for fast ATP production (Burke et al.,

1971; Edstr m and Kugelberg, 1968). Histochemical determination of

enzymatic activities of such proteins is today a well-accepted method for fiber

type characterization (SDH, COX or ATP-ases). Moreover, differences in size

and mitochondrial content have equally been thoroughly characterized. The

SDH positive fibers are generally smaller and have higher mitochondrial

content than the bigger SDH-negative fibers (Schiaffino et al., 1970).

Today this classification has become more complex with the discovery of

different myosin heavy chain (MyHC) isoforms that give the specificity of

muscle fiber type. There are four main types of MHC isoforms: I, IIa, IIx and

34

IIb. The type I corresponds to slow oxidative fibers (SO or IA fibers), IIa and

IIx for fast oxidative glycolytic (FOG or IIA and IIX fibers) and IIb for purely

glycolytic fibers (FG or IIB fibers). A minority of fibers is hybrid, expressing

more than one MyHC isoform. The ATP-ase activity differs between the

different MyHC isoforms and that is reflected in the contractile properties of

muscles. The rate of ATP hydrolysis is slower in type I fibers but the energetic

cost of contraction is also lower (Bottinelli et al., 1994). That is why type I

fibers are more suited for long duration but moderate activity. The glycolytic

fibers are recruited for high intensity efforts but they fatigue quicker than the

oxidative fibers because the capacity of providing enough energy at a

sufficient rate is limited. That is due in part to the depletion glycogen stores,

which are the main source of glucose during high intensity exercise. In the

same time glycolytic metabolism induces acidosis through the accumulation of

lactic acid, which seems to negatively affect the activity of several key

enzymes involved in glycolytic ATP production (Sahlin et al., 1998).

From this rough characterization of muscle fiber types, it is obvious that

between the MyHC isoforms present in one fiber, resistance to fatigue and

fiber metabolism there is a strict correlation. This specialization is extended at

the level of the entire motor unit, including the nerve terminals and the

neuromuscular junction (Deschenes et al., 1994). Motor units are therefore

classified according to their physiological properties in fast-fatiguable

(corresponding to FG fibers), fast fatigue resistant (corresponding to FOG

fibers) and slow fatigue resistant (corresponding to SO fibers) (Burke et al.,

1971; Dum and Kennedy, 1980).

The neuromuscular junction is the synapse between a motor neuron and

the muscle. One motor neuron branches and innervates a group of muscle

fibers of the same type constituting a motor unit. The main neurotransmitter is

acetylcholine, and specialized acetylcholine receptors (AChRs) coupled to ion

channels are present on the sarcolemma of muscle fibers. At the synaptic

level the muscle forms junctional folds, in order to enlarge the surface of the

sarcolemma and enrich the expression of AChRs and voltage gated Na2+

35

Figure 4.1. Structure of neuromuscular junction (from Sadava, 2010). The neuromuscular junction is the synapse between a motor neuron and the muscle. The sarcolemma of the muscle fibers present invagination named junctional folds, that increase the surface of interaction. The main neurotransmitter is acetylcholine, and specialized acetylcholine receptors (AChRs) coupled to ion channels are present on the sarcolemma of muscle fibers. Voltage gated Na+ channels present in the junctional folds help spreading the action potential along the postsynaptic membrane.

36

channels (Figure 4.1). Between the different types of fibers variations in the

surface of the NMJ area but also density of AChRs (Sterz et al., 1983;

Waerhaug and L!mo, 1994) and ion conductance (Milton et al., 1992) have

been described. The NMJs of fast-twitch muscle necessitate a higher

depolarization than the slow-twitch. This is accomplished through a higher

degree of folding and higher density of AChRs and voltage gated Na2+

channels is higher (Hughes et al., 2006). Motor neurons innervating the

different fiber types also present variations. Neurons innervating fast-twitch

muscles are thicker and with bigger cell bodies and a complex dendritic

ramification, which correlates with a higher conductance velocity (Henneman

et al., 1965; Mendell, 2005).

4.2 METABOLIC REGULATORS OF MUSCLE FUNCTION

AND FIBER TYPE

Physical exercise has been used as a tool in order to understand the

dynamics between glucose and fat metabolism during exercise and the long-

term effects of training on muscle metabolism. It was firstly observed that

changes in intensity and duration of exercise employ differently the energy

source for ATP production and mobilization of energy stores (Figure 4.2).

During high intensity exercise less than half of energy comes from lipid

breakdown. Carbohydrate metabolism prevails and inhibits fatty acids

transport into the mitochondria (Holloszy et al., 1998; Wolfe, 1998). Lipolysis

in the white adipose tissue and fatty acid uptake in muscle decrease with

increased exercise intensity, while fatty acid oxidation is maximal during

moderate prolonged exercise, and lower during low and high intensity

exercise (Romijn et al., 1993).

During contraction changes in energetic homeostasis act as a signal in

order to activate important pathways involved in preserving energy stores and

ensuring substrate availability. Exercise increases translocation of

37

Figure 4.2. Metabolic profile of the different types of muscle fibers (from Schiaffino & Reggiani, 2011). According to intensity and duration of exercise, muscle fibers employ different energy sources for ATP production and mobilization of energy stores. Muscle fiber types are specialized in order to respond to different energetic demands. Fast glycolytic and and fast oxidative glycolytic muscle fibers depend on glucose metabolization (in red) to produce ATP. Slow oxidative muscle fibers depend on lipid oxidation to produce the energy necessary for muscle contraction. Abbreviations: GLUT4-glucose transporter4; HK-hexokinase; G-6-P-glucose 6 phosphate; F-6-P-fructose 6 phosphate; F-2,6 (1,6)-P-fructose 2,6 (1,6) biphosphate; PFK-phosphofructokinase; DHAP-dihydroxyacetone phosphat; G-3-P-glyceraldehyde 3 phosphate; MCT (1,4)-monocarboxylate transport protein (1,4); LDH-lactate dehydrogenase; FFA-free fatty acid; TG-triglyceride; LPL-lipoprotein lipase; FAT/CD36-fatty acid transporter CD36; PDH-pyruvate dehydrogenase; GPD2-glycerol-3-phosphate dehydrogenase 2

38

sarcoplasmic glucose transporter GLUT4, fatty acids (FAs) transporter

FAT/CD36 and induces substrate uptake and utilization. Several key

metabolic regulators participate in concert to modulate these processes and

ensure efficient energy production.

Contraction induces the opening of calcium pumps on the membrane of

the sarcoplasmic reticulum and the release of calcium into the cytoplasm

(Smith et al., 2013). Calcium signaling plays a central role in regulating

muscle metabolism during contraction by activating calmodulin-dependent

protein kinase (CaMK) in an intensity dependent manner (Egan et al., 2010).

CaMK regulates muscle plasticity and activates mitochondrial biogenesis (Wu

et al., 2002). It also upregulates glucose transport by enhancing GLUT4

exocytosis (Li et al., 2014) and lipid uptake and oxidation (Raney and

Turcotte, 2008).

Increased ATP turnover (increased AMP/ATP ratio) activates AMP-

activated protein kinase (AMPK). AMPK acts as a gatekeeper for metabolic

equilibrium. During energy-deprived states, such as physical exercise, it

switches off anabolic energy-consuming pathways and enhance substrate

breakdown. Specifically, the primary role of AMPK during exercise is to

reduce protein synthesis. Also it phosphorylates and inhibits glycogen

synthase activity preventing glucose to be diverted to glycogen stores.

Pharmacological up-regulation of AMPK with AICAR has also been shown to

increase glucose uptake (Merrill et al., 1997) and lipid uptake and oxidation at

rest (Raney et al., 2005). However its role in glucose and lipid utilization

during exercise is not well understood (J!rgensen et al., 2006). It has been

shown that FAT/CD36 and lipid uptake is not dependent on AMPK activity

during contraction (Jeppesen et al., 2011). More likely it acts as a facilitator,

by releasing inhibition exerted over lipid uptake pathway at rest (Catoire et al.,

2014). Knock down of muscle AMPK in vitro reduces GLUT4 translocation in

response to Ca2+ entry following nervous stimulation (Li et al., 2014). However

in vivo inactivation of this enzyme only partially reduced contraction-stimulated

glucose uptake (Mu et al., 2001). Another important role of AMPK is the

39

activation of several other metabolic regulators essential for muscle activity

and plasticity like PGC-1α, class II histone deacetylases (class II HDACs) and

class III histone deacetylases (sirtuins).

Physical activity modulates muscle fiber function, inducing changes in

fiber-type specific contractile proteins, changes in enzymatic activity and

mitochondrial content (Egan and Zierath, 2013). Training has long lasting

effects on muscle function, reducing its capacity to use glucose for ATP

production and increasing its respiratory capacity (Spina et al., 1996). This is

reflected by an increased mitochondrial biogenesis (Hood et al., 1994) and

increased activities of mitochondrial enzymes like citrate synthase,

cytochrome c oxidase (Gollnick and Saltin, 1982; Murakami et al., 1994).

The most important intrinsic regulator of muscle function is Peroxisome

Proliferator Activated Receptor γ Coactivator 1α (PGC-1α). Initially PGC-1α

was characterized as a key element of adaptive thermogenesis, an important

component of energy homeostasis. Upon exposure to cold PGC-1α was found

to up-regulate key genes encoding mitochondrial enzymes involved in

respiration (ATP-synthase, cytochrome c oxidase, uncoupling protein 1) and

induced mitochondrial biogenesis in brown adipose tissue (Puigserver et al.,

1998). The role of PGC-1α in muscle physiology was outlined later by

overexpressing Pgc-1α specifically in type II muscle fibers. The result was a

potent induction of oxidative metabolic program together with a switch in fiber-

specific protein content and increased fatigue resistance, white muscles

becoming red (Lin et al., 2002). An essential aspect of this program of muscle

fiber switch is that the induction of Pgc-1α is activity- dependent. Physical

activity was shown to induce its mRNA expression in muscle (Goto et al.,

2000). Transcription and activity of Pgc-1α is ensured by the upstream

activity-sensitive elements CaMK and AMPK. The promoter region of Pgc-1α

includes myocyte enhancer 2 (MEF2) and c-AMP responsive element (CRE)

binding regions. CaMK and AMPK activate MEF2 and CREB that in turn

activate Pgc-1α transcription (Egan et al., 2010). AMPK also regulates PGC-

1α activity through direct phosphorylation (J ger et al., 2007). The regulation

40

Figure 4.3. Remodeling of skeletal muscle phenotype (adapted from Egan & Zierath, 2013). Physical training induces metabolic and ultrastructural changes in muscle fibers, inducing a switch in muscle fiber type, from fast glycolytic to slow oxidative. This remodeling of skeletal muscle fibers is highly complex and necessitates the coordination of several pathways within the cell. The master regulator of skeletal muscle phenotype is PGC-1α, that upregulates the oxidative metabolism, associated with increased mitochondrial biogenesis and respiration. Abbreviations: HDAC-hystone de-acetylase; PGC1α-peroxisome proliferator-activated receptor γ coactivator α; MEF2-myocyte enhancer factor2; CREB-cAMP response element binding protein; GEF-Glut4 enhancer factor; FOXO-forkhead transcription factor, O box subfamily; ERRα-estrogen related receptor α; NRF1/2-nuclear respiratory factor 1&2; PPARα-peroxisome proliferator-activated receptor α; mtDNA-mitochondiral DNA; TFAM-mitochondrial transcription factor A; P-phospho; Ac-acetyl

41

of muscle fiber type following training (Figure 4.3) is realized through a series

of target genes for which PGC-1α acts as a transcriptional factor as follows:

several genes involved in mitochondrial biogenesis (nuclear respiratory

factors nrf1 and 2, estrogen-related receptors err), lipid oxidation (peroxisome

proliferator-activated receptors PPARs) but also genes involved in ROS

scavenging (e.g. SOD) (Lin et al., 2005). Activation of ROS scavenging

enzymes is of great importance because an increased mitochondrial

respiration is usually accompanied by increased ROS production.

HDACs have an important regulatory role in muscle function, repressing

the transcription of several genes involved in mitochondrial function and

substrate utilization like PGC-1α, hexokinase II (HKII), GLUT 4, carnitine

palmitoyltransferase 1 (CPT1) and ATP-synthase (McGee and Hargreaves,

2011). Exercise alleviates HDACs inhibitory effect by translocating them from

the nucleus into the cytoplasm (McGee et al., 2008). They have also been

shown to repress MEF2, and in doing so they suppress the oxidative program

and the formation of type I fibers (Potthoff et al., 2007). Some class II HDACS,

like HDAC 4 and 5, are not even expressed in type I fibers (Potthoff et al.,

2007), confirming their role in regulating fiber type specification. The class III

HDACs, sirtuins, are another family of metabolic sensors, responding mainly

to nutrient scarcity during states of energetic stress (caloric restriction, post-

exercise recovery). Sirtuins are NAD+ dependent deacetylases. After exercise

the ratio NAD+/NADH is dramatically increased, reflecting an acute energetic

stress. In this context, muscle fibers regulate their metabolism so that

energetic stores are replenished. More specifically, after exercise, glucose

utilization for energy production is diminished in order to replenish the

glycogen reserves. Sirt1 de-acetylates and activates PGC-1α, in an AMPK-

dependent manner, being directly involved in increased transcription of

mitochondrial genes, increased lipid usage and glucose sparing (Cantó et al.,

2010).

Muscle metabolic network is highly complex, with tight connections and

regulations between several metabolic sensors. This complexity ensures the

42

incredible capacity of muscle to rapidly adapt to changes in energy demands.

However this equilibrium is fragile and anything from life stile to aging and

disease can compromise it, leading to muscle wasting and atrophy.

4.3 MUSCLE METABOLISM IN AGING AND DISEASE

Muscular disuse due to reduction in nervous and physical activity has

dramatic effects on muscle function, muscle fiber type, and inevitably leads to

muscular atrophy. This type of modifications can be seen in pathological

conditions, such as denervation due to neurodegenerative disease or spinal

cord injury, but also during aging. Equally, systemic diseases that affect

whole body energetic homeostasis, like sepsis, diabetes and cancer-related

cachexia are often accompanied by muscle atrophy. However, while the

results are almost always the same, reduction in muscle mass and muscle

weakness, the molecular modifications that the muscle is subjected to, are not

similar between the different atrophy-inducing conditions.

All these pathologic conditions will affect preferentially certain fiber types

more than others and are also accompanied by changes in fiber type. For

instance disuse conditions such as immobilization or experimental sciatic

nerve axotomy induce atrophy preferentially in type I muscle fibers and induce

a switch of slow-to-fast fiber type. This situation can be seen in human

pathologies like spinal cord injury and some muscular dystrophies. Other

conditions like aging, diabetes or pathological conditions associated with

glucocorticoids secretion (e.g. starvation and cancer cachexia), muscular

atrophy is more pronounced in glycolytic type II fibers and accompanied by a

fast-to-slow fiber type switch. This selectivity of the atrophic process and the

differences between the different atrophic-inducing conditions are not yet

understood.

43

43

Figure 4.4. Mechanisms regulating muscle mass (from Rajan et al., 2007). Muscle mass depends on the balance between protein synthesis and protein degradation. Protein synthesis is mainly regulated by the activation of the Insulin-like Growth Factor 1 pathway (IGF1). In the absence of insulin signaling, two members of the ubiquitin ligase family are upregulated and induce muscle protein degradation and muscle wasting: muscle atrophy F-box/atrogin 1 and muscle RING-finger protein-1. Abbreviations: IGF-1-insulin-like growth factor1; TNF1α-tumor necrosis factor 1 α; PI3K-phosphoinositide 3 kinase; Akt-protein kinase B; FoxO-forkhead transcription factor, O box subfamily; S6K-S6 kinase; GSK3β-glycogen synthase kinase 3 β; MuRF1- muscle RING finger protein-1; IKK-I kappa B kinase; P-phospho;

44

Muscle mass is the reflection of two antagonist processes: protein

synthesis and protein degradation. Protein synthesis is mainly regulated by

the activation of the Insulin-like Growth Factor 1 pathway (IGF1) (Schiaffino et

al., 2013). Ablation of muscle IGF1 receptor leads to decreased number of

muscle fibers and fiber area, but also to insulin resistance (Mavalli et al.,

2010). Overexpression of muscle IGF1 specifically in muscle tissue induces

muscle hypertrophy and prevents aging-related atrophy (Musar! et al., 2001).

Activation of the IGF1 intervenes on two levels. Firstly, by stimulating

Akt/Protein Kinase B (Akt/PKB) phosphorylation by Phosphoinositide 3 kinase

(PI3K), it activates mammalian target of rapamycin (mTOR) and protein

synthesis program (Bodine et al., 2001a; Latres et al., 2005). As Bodine and

colleagues showed, overexpression of Akt can prevent muscle atrophy even

after sciatic nerve axotomy through mTOR activation, highlighting the crucial

role of Akt-mTOR pathway in muscle mass regulation. The second level of

action of Akt is the inhibition of protein degradation pathway phosphorylation

of FOXO (Figure 4.4).

Two members of the ubiquitin ligase family regulate muscle protein

degradation during muscle wasting: muscle atrophy F-box/atrogin 1

(MAFbx/Atg-1) and muscle RING-finger protein-1 (MuRF1). These atrophic

factors are induced in several atrophy models: denervation, immobilization,

but also interleukin-1 and glucocorticoid treatments, making them the

universal pathway for muscle protein degradation. Silencing MAFbx/Atg-1 and

MuRF1 prevents muscle atrophy following sciatic nerve axotomy (Bodine et

al., 2001b). In an in vitro model for muscle atrophy, IGF-1 counteracted the

effect of the atrophy-inducing glucocorticoid dexamethasone, reducing the

activation of both Atg-1 and MuRF1 (Sacheck et al., 2004). Equally in vivo

local injection with IGF1 in muscles of animals treated with dexamethasone

prevented muscle atrophy and upregulation of the atrophic genes (Stitt et al.,

2004). Two concomitant studies revealed that the inhibitory effect of IGF1-Akt

pathway on Atg-1 and MuRF1 is mediated by forkhead family of transcription

factors FOXO (Sandri et al., 2004; Stitt et al., 2004). FOXO responds to

45

energetic and oxidative stress (Figure 4.5), conditions often associated with

metabolic deregulations (e.g. starvation, diabetes and aging).

Maintenance of mitochondrial function is essential for preventing age-

related muscular atrophy and AMPK-Sirt1-PGC axis is a potential protective

mechanism (Johnson et al., 2013). PGC-1α is a protective factor, preventing

ROS accumulation and enhancing mitochondrial function (Figure. 4.5). In

consequence, exercise, a potent activator of PGC-1α, protects muscle and

ensures a better adaptation to age-related atrophy (Mosole et al., 2014).

Overexpression of PGC-1α in skeletal muscle protects from sarcopenia,

prevents oxidative damage and increases insulin sensitivity in ages mice

(Wenz et al., 2009). PGC-1α has been proposed as the basis of selectivity for

type II fibers in atrophy, since it is more expressed in oxidative fibers

compared to glycolytic fibers (Wang and Pessin, 2013). Exercise is essential

in preventing life-stile related metabolic disorders as well. For instance

exercise is more effective in preventing type II diabetes than pharmacological

intervention (Knowler et al., 2002). The relationship between muscle function

and metabolism is two-sided: metabolic dysfunction has detrimental effects on

muscle function, and muscle is a potential therapeutic target in preventing

metabolic disease.

4.4 METABOLIC ALTERATIONS IN ALS

As it was outlined in the previous sections, there is a tight connection

between muscle function and integrity and whole body energy homeostasis.

Unlike most other cell types, the adaptive response of muscle cells to

increased energetic demands (e.g. exercise), depend on the interplay

between lipid and glucose metabolism, external challenges leading to

physiological modifications and changes in fiber type. Muscle modifications

response to nutrient availability contributes to ensuring the organism’s

homeostasis in times of metabolic stress (e.g. high fat diet, caloric restriction).

46

Figure 4.5. ROS regulation of muscular atrophy (from Vinciguerra, 2010). Increased ROS production is a hallmark of aging. ROS production was proposed to activate atrophy programs through activation of Foxo and NFkB. This in turn activate ubiquitin/proteasome and autophagy catabolic pathways. PGC-1a offers protection against atrophy by reducing ROS production. Abbreviations: ROS-reactive oxygen species; PGC1α-peroxisome proliferator-activated receptor γ coactivator α; FoxO-forkhead transcription factor, O box subfamily; MuRF1-muscle RING finger protein-1; LC3-Microtubule-associated protein 1A/1B-light chain 3;

47

However prolonged alterations of the energetic balance can have detrimental

effects on muscle function and can induce muscular atrophy (e.g. diabetes,

starvation).

ALS patients present with several metabolic alterations, reflecting

profound impairments of the energetic balance (Dupuis et al., 2011).

Alterations of the carbohydrate metabolism have long been associated with

ALS, reflected in glucose intolerance and insulin resistance in patients

diagnosed with ALS (Reyes et al., 1984; Pradat et al., 2010). Decreased

weight and body mass index (BMI) have often been reported. The range of

patients presenting with low BMI vary between 15% (Desport et al., 1999) and

55% (Mazzini et al., 1995), and constitute a negative prognostic factor for

survival (Desport et al., 1999). Some of the causes that have been associated

with this state of malnourishment in patients are swallowing difficulties,

problems related to salivary secretion and inability to swallow saliva,

constipation and physiological distress leading to anorexia (Desport et al.,

2001). Low respiratory quotient (RQ=0.81±0.03), measured by indirect

calorimetry (CO2 produced/O2 consumed), and decrease in body fat has also

been reported (Kasarskis et al., 1996). A recent study, that used MRI

technique for analyzing body fat distribution, characterized an altered fat

distribution, with increase in visceral and decreased subcutaneous fat pads.

The subcutaneous fat deposition positively correlate with disease progression,

and is consistent with previous reports of glucose intolerance and increased

circulating fatty acids (Lindauer et al., 2013). Taken all together, these data

indicate a hypermetabolic state in ALS patients, where energy consumption

exceeds energy intake. Hypermetabolism is now well documented in ALS

patients, and the increase in resting energy expenditure negatively correlates

with survival (Bouteloup et al., 2009; Desport et al., 2001).

Metabolic alterations have also been documented in ALS mouse models.

Transgenic animals expressing mSOD1 are leaner, with decreased fat stores,

increased corticosterone levels (the main glucocorticoid in rodents) and

increased oxygen consumption (RQ<1). More importantly, in animals these

48

alterations occur early, before disease onset (Dupuis et al., 2004). Taken

altogether these data suggest increased lipid consumption and supplementing

the lipid reserves with a high fat diet increases life span in ALS mice models.

On the contrary, caloric restriction shortens life span, and exacerbates ROS

production (Patel et al., 2010). Stress, which leads to increased corticosterone

secretion, is another factor that was shown to accelerate disease onset and

progression (Fidler et al., 2011). Moreover, the basal levels of corticosterone

positively correlate with paralysis onset. The metabolic alterations in animal

models appear as an early event with pathological significance, correlating

with/aggravating disease progression.

As muscle is highly connected to the overall body metabolism, these

early metabolic alterations are expected to have a major impact on muscle

physiology. Changes in muscle fiber type have been described in patients and

animal models. Overexpression of mSOD1 specifically in muscle triggers a

switch from fast glycolytic to slow oxidative and activation of protein

degradation pathways (Dobrowolny et al., 2008). Muscle has also been

proposed as a contributor to the hypermetabolic profile, as the site of high

substrate (glucose and lipid) uptake (Dupuis et al., 2004). Moreover,

increased expression of the protein UCP3 was described in animal models

and patients (Dupuis et al., 2003). UCP3 is a muscular isoform of the UCP

family, mitochondrial proteins that separate oxidative phosphorylation from

ATP production dissipating energy as heat. UCP3 responds to increase FFAs

and has been proposed to have a role in fatty acid oxidation (Nabben and

Hoeks, 2008). It was shown recently that UCP3 mild overexpression in

skeletal muscle acts as an exercise mimetic, increasing fatty acid oxidation

and increasing energy expenditure (Aguer et al., 2013). On the other hand

mitochondrial uncoupling can have detrimental effects on neuromuscular

junction stability. For example, it was shown that by overexpressing the brown

adipose tissue isoform UCP1 specifically in muscle induces muscle

hypermetabolism and age-dependent neuromuscular junction pathology and

even late onset neuronal pathology (Dupuis et al., 2009).

49

Surprisingly, exercise, that is normally benefic for metabolism and

muscle function, is considered as a risk factor in ALS. Several studies

reported increased incidence of ALS/MND among professional athletes (Chi

et al., 2005) or people with an active life style (Scarmeas et al., 2002). A

recent study reported a similar tendency towards an active life style but

without a dose-dependent effect (Huisman et al., 2013). Therefore it was

proposed that exercise itself does not constitute a risk factor, but more likely a

genetic predisposition to physical fitness is associated with ALS (Turner,

2013). This association remains controversial, and several studies reported

no association between physical activity, professional or leisure (Longstreth et

al., 1998; Valenti et al., 2005). On the other hand, moderate aerobic exercise

has been used in a few small clinical trials and improvement on the ALS

functional rating scale have been reported (Dal Bello-Haas and Florence,

2013). In animal models the effect of exercise was proved to be beneficial,

however choice of training protocol is crucial. Several studies reported

neuroprotective effect of moderate exercise, accompanied by a delay in onset

and disease progression (Deforges et al., 2009; Carreras et al., 2010).

Exercise and IGF1 administration have a synergistic effect on SOD1 mouse

model, extending survival, improving motor function and reducing neuronal

apoptosis and motor neuron loss (Kaspar et al., 2005). High intensity

endurance training had the opposite effect, hasting disease onset and

shortening survival (Mahoney et al., 2004). However the detrimental effect

remain somewhat controversial, as other studies using similar protocols no

adverse effect of high intensity training was noted (Carreras et al., 2010).

Metabolic alterations in ALS (hypermetabolism) represent a negative

prognosis factor, correlating with shorter lifespan. As proven by studies in

animal models, these alterations are an early event, preceding disease onset,

which indicates that it constitutes a separate pathologic event. However the

origins of hypermetabolism are little understood. Several lines of evidence

suggest that muscle can be a potential site of increased energy consumption.

50

However the relation between muscle pathology and metabolic pathology

remains to be further investigated.

51

OBJECTIVES

52

Muscle alterations, while yet not sufficiently described, emerge as an

important aspect of ALS pathology, with potential therapeutic significance

(Dobrowolny et al., 2008; Wong et al., 2010). First of all, delaying muscle

atrophy could have an enormous impact on patient’s quality of life. Secondly,

the importance of muscle-nerve collaboration for NMJ stabilization has been

indicated by several experimental approaches (Dupuis et al., 2009). For this

reason therapeutic interventions targeting muscle could have a beneficial

effect on NMJ, therefore delaying onset and potentially disease progression.

At the same time, as previously shown in (Chapter 4.4), due to the tight

relation between muscle and metabolism, it is possible to identify targets that

could modulate whole body energy homeostasis and improve muscle function.

Several interventions aimed at improving overall body metabolic status

showed beneficial effects. For instance moderate exercise (Carreras et al.,

2010) or high fat diet (Dupuis et al., 2004) increased survival and improved

motor function in animal models. However, so far we do not have enough

information and viable precise therapeutic targets are still lacking. The link

between metabolism and ALS is still unclear. As muscle is an important

metabolic tissue it is possible that understanding muscle pathology would

provide some insight into this problematic.

One of the main objective of the studies presented here, was to better

understand muscle pathology and its relation to the metabolic disequilibrium

described in patients and animal models. In order to achieve this general goal,

in the first paper we performed a detailed analysis of muscle metabolic profile.

The goal was to identify potentially pathologic alterations that would appear

before denervation and could account for the systemic metabolic imbalance

and constitute potential therapeutic targets. In a second time, we evaluate the

therapeutic potential of known metabolic regulators, histone deacetylases

(HDACs) and sirtuins, by comparing their expression in both spinal cord and

muscle, in two different animal models. These enzymes regulate important

metabolic targets through de-acetylation and they have been previously

proposed as potential targets, despite lack sufficient information. In the last

part of the work presented here we sought investigating another essential

53

aspect of ALS-related muscle pathology, spasticity. Spasticity occurs in ALS

patients from loss of inhibition from upper motor neurons. It consists of a

velocity-dependent increase of muscle tone or stiffness of muscle, which

might interfere with speech and movement, or be associated with discomfort

or pain. Spasticity is also an aspect of ALS with great importance for

managing quality of life of patients that present with such symptoms

(McClelland et al., 2008). Spasticity has also received little attention so far and

there are limited clinical interventions for the management of these symptoms.

54

RESULTS 1

A metabolic switch towards lipid use in glycolytic muscle is

an early pathologic event in a mouse model of Amyotrophic

Lateral Sclerosis

55

The metabolic changes characterized so far in ALS patients and animal

models seem to point towards increased lipid consumption. The cause of this

phenomenon and its pathological significance is still elusive. Since muscle

tissue is an important metabolic organ, with an important role in whole body

energy homeostasis, we hypothesized that muscle tissue could be affected by

or participate to these systemic changes.

There are two important aspects that were considered in this study. In

order to separate the events with a pathological significance, an early time

point was considered, before apparent denervation or muscle weakness.

Several techniques have been employed to thoroughly attest the absence of

overt clinical manifestations at the selected time point (65 days of age). The

second aspect was the choice of muscle studied. As it was shown previously

in a different mouse model, glycolytic muscles seem to be the first affected

during disease progression, while oxidative muscle are largely spared

(Hegedus et al., 2007). This was the case in our animal model, the SOD1G86R,

as well, and for this reason we chose to focus on the hind limb muscle Tibialis

anterior, comprised mainly of glycolytic fibers.

Systemic metabolic alterations trigger metabolic inflexibility, which can

reflect in a reduced physical capacity. Young SOD1G86R mice were tested for

their capacity to adapt to physical exercise using two exercise paradigms:

anaerobic versus aerobic capacity. Surprisingly, while their anaerobic capacity

was reduce significantly, their aerobic capacity was significantly enhanced.

These experiments pinpointed an early metabolic alteration in skeletal

muscles, hinting towards an enhanced oxidative metabolism.

In order to understand the nature of this change in physical capacity, the

main metabolic pathways, glycolytic and oxidative, were assessed. An

increased expression of genes involved in lipid uptake and transport was

evidenced. In the same time the glycolytic pathway was downregulated, as

evidenced by the reduce enzymatic activity of PFK1, the rate limiting enzyme

of the glycolytic pathway (Figure 4.2).

56

Untrained SOD1G86R acted as trained animals. However, the activation of

the lipid pathway was not pendent of PGC-1α, indicating a pathologic switch

in fuel preference. Pyruvate dehydrogenase kinase 4 (PDK4) is known to be a

primary signaling molecule during times of energetic stress

(exercise/fasting/high fat diet) playing a key role in the regulation of muscle

physiology and muscle fiber type in response to external stimuli (Spriet et al.,

2004; Watt et al., 2004). PDK4 accomplishes its role by regulating fuel

selection through inhibition of pyruvate dehydrogenase complex (PDC), the

enzyme responsible for coupling glycolysis to mitochondrial oxidation. While

this is supposed to be a protective mechanism activated in times of nutrient

scarcity aiming to preserve glucose for the central nervous system (as it is the

case for exercise and fasting), under certain circumstances it becomes a non-

adaptive response leading to metabolic inflexibility and reflects deeper

pathological deregulations. Pdk4, together with the up-stream regulator

PPARδ were found upregulated in glycolytic muscles of young asymptomatic

animals.

By inhibiting PDK4 activity with a pharmacological inhibitor,

dichloroacetate (DCA) we sought restoring the metabolic equilibrium in

glycolytic fibers. This treatment had several beneficial effects. The muscular

strength was preserved until the end of the experiment, when non-treated

transgenic animals already lost approximately 30% of their grip strength.

Analyzing the expression of denervation markers, we also evidenced a

delayed denervation of glycolytic muscle fibers. Interestingly, this was

accompanied by increased expression of PGC-1α and its main target genes,

and a decreased expression of ROS-activated genes.

These results clearly indicate an early non-adaptive alteration of

metabolic equilibrium in glycolytic muscle fibers, confirming the initial

hypothesis. Targeting muscle metabolism has beneficial effects, delaying

disease onset and improving muscle function.

57

!"#$"!%&!'(!)&*+& !&

!

!"#$%&'()*+" ,-*%+." %(-&/0," )*1*0" 2,$" *3" 4)5+()5%*+" #2,+)$" *," &3" $&/)5"

1&%.()(4*+"$6$3%"*3"&"#(2,$"#(0$)"(7"!#5(%/(1.*+"8&%$/&)"9+)$/(,*,:"

!"#$%&%#! '#(#)%*+

,-.-! /&&#! 0+1(#23456%

7-8!! /*9:(%#! ;:9&#<

,-.-! 0<($%:! =935+1

,-.-! /&&:>

"#*9:&+:! ?3*@%((%:9A-! B3CC9:<! D3((

7-8-! 01<*#&! EF! G23

H-I! B:#&>'1%(%JJ:! "3:CC(:9

,-.-K-!

L9MNM9%O*:!P:&M,-.-K!

!,!QG0RPS-!T,,,U-!SM+#&%5):5!V:&@9#*W!:@!'M9%J1M9%O*:5!N:!(#!G:*93NM2M&M9:5+:&+:-!0@9#5X3*92-!L9#&+:!

.!T&%$:95%@M!N:!0@9#5X3*92-!TSP0,,,U-!0@9#5X3*92-!L9#&+:F!

7!RO*%J:!NY/++*:%(!7ZI.-!S%@3+13&N9%:-!0@9:55!3W<N#&@!:@!'93@:+@%3&!S*5+*(#%9:-!LMNM9#@%3&!N:!SMN:+%&:!

E9#&5(#@%3&:((:!N:!0@9#5X3*92-!T&%$:95%@M!N:!0@9#5X3*92-!L9#&+:F!

8!0:9$%+:!N:!'1<5%3(32%:!:@!NYRWJ(39#@%3&5!L3&+@%3&&:((:5-!'[(:!N:!'#@13(32%:!E139#+%O*:!\[J%@#*W!

T&%$:95%@#%9:5-!V\PT!N:!0@9#5X3*92-!L9#&+:F!

A!TSPI7H8!"#X39#@3%9:!N:!G:*935+%:&+:5!V32&%@%$:5!:@!/N#J@#@%$:5-!T&%$:95%@M!N:!0@9#5X3*92>VGP0-!

=]P!VGP0!.^ZA-!L#+*(@M!N:!'5<+13(32%:-!0@9#5X3*92-!L9#&+:F!

H!0+133(!3C!?%3):N%+#(!0+%:&+:5-!E1:!T&%$:95%@<!3C!_*::&5(#&N-!0@!"*+%#-!_*::&5(#&N-!/*5@9#(%#F!

I! T&%$:95%@<! 3C! _*::&5(#&N! V:&@9:! C39! V(%&%+#(! P:5:#9+1-! E1:! T&%$:95%@<! 3C! _*::&5(#&N-! \:95@3&-!

_*::&5(#&N-!/*5@9#(%#F!

;(//$,1(30*34"&2%.(/,`!!

L9MNM9%O*:!P:&M`!J13&:!ab77c!7HU!UA7!ZUHd!C#W`!ab77c!7HU!UA7!ZHA!

R>)#%(`!C9:N:9%O*:F9:&:e*&%5@9#FC9d!!

B:#&>'1%(%JJ:!"3:CC(:9`!J13&:!ab77c!7HU!UA7!ZU,d!C#W`!ab77c!7HU!UA7!ZHA!

R)#%(`!(3:CC(:9e*&%5@9#FC9!!

<233*34"%*%)$`!R#9(<!)*5+(:!):@#X3(%+!+1#&2:5!%&!/"0!!

=$5-(/0,`!#)<3@93J1%+!(#@:9#(!5+(:935%5-!:W:9+%5:-!2(*+35:-!(%J%N5-!)*5+(:!

!

V1#9#+@:9!+3*&@!a4%@13*@!X%X(%329#J1<!#&N!:WJ:&N:N!)#@:9%#(c`!HA,I7!

! !

!"#$"!%&!'(!)&*+& #&

!

!

!"#$%!&$''

'

'

"#$%&'%()*+!,-&.'-/!0+/.'%1*1!*1!&).!#%1&!+%##%2!3-&-/!#%&%'2.4'%2!5*1.-1.!*2!-54/&16!74#.'%41!1&45*.1!

*25*+-&.! &)-&!",0! *1! -! 1$1&.#*+! 5*1.-1.! &)-&! -33.+&1!8)%/.! 9%5$! ()$1*%/%:$! -25!#.&-9%/*+! )%#.%1&-1*16!

;1*2:!-!#%41.!#%5./!%3! &).!5*1.-1.!<0=>?@ABCDE!8.!*2F.1&*:-&.5!#41+/.!()$1*%/%:$!-25!#%&%'!9.)-F*%'!

8*&)!'.1(.+&!&%!#41+/.!#.&-9%/*+!+-(-+*&$6!G.!3%425!&)-&!('*%'!&%!5.2.'F-&*%2E!0=>?@ABC!#*+.!('.1.2&.5!

8*&)!*#('%F.5!.254'-2+.!+-(-+*&$!-11%+*-&.5!8*&)!-2!.-'/$!*2)*9*&*%2!*2!&).!+-(-+*&$!3%'!:/$+%/$&*+!#41+/.!

&%!41.!:/4+%1.!-1!-!1%4'+.!%3!.2.':$!-25!-!18*&+)!*2!34./!('.3.'.2+.!&%8-'51!/*(*516!H25..5E! *2!:/$+%/$&*+!

#41+/.1! 8.! 1)%8.5! ('%:'.11*F.! *254+&*%2! %3! ($'4F-&.! 5.)$5'%:.2-1.! I*2-1.! J! .K('.11*%26!

L)%1()%3'4+&%I*2-1.!?!8-1!*2)*9*&.5E!-25!&).!.K('.11*%2!%3! /*(*5!)-25/*2:!#%/.+4/.1!8-1!*2+'.-1.56!M)*1!

#.+)-2*1#!'.('.1.2&1!-!+)'%2*+!(-&)%/%:*+!-/&.'-&*%2!*2!#41+/.!#.&-9%/*1#!&)-&!*1!.K-+.'9-&.5!8*&)!5*1.-1.!

('%:'.11*%26!N4'&).'E! *2)*9*&*%2!%3!($'4F-&.!5.)$5'%:.2-1.!I*2-1.!J!-+&*F*&$!8*&)!5*+)/%'%-+.&-&.!5./-$.5!

1$#(&%#!%21.&!8)*/.! *#('%F*2:!#*&%+)%25'*-/! 5$1342+&*%2! -25!-#./*%'-&*2:!#41+/.!5.2.'F-&*%26! H2! &)*1!

1&45$E! 8.! ('%F*5.! &).! 3*'1&! #%/.+4/-'! 9-1*1! 3%'! &).! (-'&*+4/-'! 1.21*&*F*&$! %3! :/$+%/$&*+! #41+/.1! &%! ",0!

(-&)%/%:$6!!

!

&

!

!

!"#$"!%&!'(!)&*+& )&

!"#$%&'(#!%")

)

!"#$%&$'()*+,-%.&-,+/*,.&$/)/+0!123+)/+%(.+"$/%+*$""$4+-56,%+"$%$&+4.6&$4+5)/.-/.7+!,%($68(+()/%$&)*-,,#+

5.9)4.5+-/+-4+-8.:&.,-%.5+4.6&$5.8.4.&-%);.+5)/.-/.+/'.*)9)*-,,#+-99.*%)48+6''.&+-45+,$<.&+"$%$&+4.6&$4/=+

>?@+ #.-&/+ $9+ &./.-&*(+ (-/+ 4$<+ )5.4%)9).5+ 9$&+ !12+ %$+ A.+ 64B6./%)$4-A,#+ "$&.+ *$"',.C+ %(-4+ )4)%)-,,#+

5./*&)A.57+D4+&.*.4%+#.-&/=+/.;.&-,+4$4:4.6&$4-,+*.,,/+)4*,65)48+")*&$8,)-+0E$),,F.+!"#$%&+GHHI3=+-/%&$*#%./+

0J-"-4-K-+!"#$%&+GHHL3=+-45+/K.,.%-,+"6/*,.+0M$48+-45+N-&%)4=+GH>H3+(-;.+A..4+'&$'$/.5+%$+)49,6.4*.+%(.+

*$6&/.+ $9+ %(.+5)/.-/.7+N$&.$;.&=+"6%-%)$4/+ )4+ -4+ )4*&.-/)48+46"A.&+$9+ 8.4./+(-;.+A..4+ -//$*)-%.5+<)%(+

9-"),)-,+-45+/'$&-5)*+9$&"/+$9+!12+0O(.4+!"#$%&#GH>P37+D4+-**$&5-4*.+<)%(+%()/+8.4.%)*+(.%.&$8.4.)%#=+!12+

!"# $%&%'()*# +%%'# $%,%-.'%,# !"# !# /"*',$01%23# $%4$056.'4# &016)%7# !',# ,.8%$"%# 6!( 06 *".0)04.&!)# !',#

*,)4)*-,+"-4)9./%-%)$4/+%(-%+%&-4/8&.//+%(.+"$%$&+/#/%."+0!45.&/.4+-45+!,:O(-,-A)=+GH>>Q+R-&5)"-4+!"#$%&+

GH>>37++

+

S6".&$6/+/%65)./+)45)*-%.+%(-%+!12+)/+-+/#/%.")*+5)/.-/.+%(-%+-99.*%/+<($,.+A$5#+'(#/)$,$8#+-45+.4.&8#+

($".$/%-/)/7+ D4+GHH>=+-+/#/%."-%)*+-4-,#/)/+$9+.4.&8#+.C'.45)%6&.+ &-%./+ )4+-+'$'6,-%)$4+$9+/'$&-5)*+!12+

'-%).4%/+ &.;.-,.5+ %(-%+ %<$+ %()&5/+ $9+ %(./.+ '-%).4%/+ <.&.+ (#'.&".%-A$,)*+ 0T./'$&%+ !"# $%&+ GHH>37+ U(./.+

$A/.&;-%)$4/+<.&.+96&%(.&+*$49)&".5+-45+.C%.45.5+%$+9-"),)-,+!12+*-/./+)4+9$,,$<:6'+&.'$&%/+0T./'$&%+!"#

$%&#GHH@Q+E$6%.,$6'+!"#$%&#GHHV37+!12+'-%).4%/+-/+<.,,+-/+"$6/.+"$5.,/+$9+!12+'&./.4%+<)%(+<.)8(%+,$//+

-45+&.56*.5+9-%+"-//=+-,%.&.5+8,6*$/.+-45+,)')5+(-45,)48=+-45+)4*&.-/.5+&./%)48+.4.&8#+.C'.45)%6&.+0T6'6)/+

!"# $%&# GH>>37+ D4+ ")*.=+ &.56*.5+ ,)')5+ /%$&./+ -45+ )4*&.-/.5+ &./%)48+ .4.&8#+ .C'.45)%6&.+ '&.*.5.+ "$%$&+

/#"'%$"/+0T6'6)/+!"#$%&#GHH?37+D4%.&./%)48,#=+%(.+A6&5.4+$9+%(./.+".%-A$,)*+-,%.&-%)$4/+-''.-&/+%$+-99.*%+%(.+

4.6&$5.8.4.&-%);.+ '&$*.//7+ D45..5=+".%-A$,)*+ -,%.&-%)$4/+ *$&&.,-%.+<)%(+ 56&-%)$4+$9+ /6&;);-,=+ -45+ *,)4)*-,+

5-%-+ /688./%/+ %(-%+ -4+ )"A-,-4*.+ )4+ .4.&8#+".%-A$,)/"+ (-/+ -+ 4.8-%);.+ )"'-*%+ $4+ %(.+ '-%($8.4)*+ '&$*.//+

0T./'$&%+!"#$%&+>VVVQ+W-<-)5+!"#$%&#GH>H37+N$&.$;.&=+)4*&.-/.5+5).%-&#+,)')5+*$4%.4%+$99.&/+4.6&$'&$%.*%)$4+

-45+.C%.45/+/6&;);-,+)4+"$6/.+"$5.,/+$9+!12+0T6'6)/+!"#$%&#GHH?Q+N-%%/$4+!"#$%&+GHHX3=+<(),.+&./%&)*%)48+

*-,$&).+ )4%-K.+ .C-*.&A-%.5+ "$%$&+ /#"'%$"/+ )4+ !12+ ")*.+ 0Y.5.&/.4+ -45+N-%%/$4=+ >VVV37+ !,%($68(+ %(.+

$&)8)4+$9+".%-A$,)*+5#/964*%)$4+)4+!12+&."-)4/+64*,.-&=+"-4#+$9+%(.+".%-A$,)*+"$5)9)*-%)$4/+$A/.&;.5+-%+

%(.+/#/%.")*+,.;.,+)4+!12+'-%).4%/+-45+&.,-%.5+"$6/.+"$5.,/+)"',#+%(-%+/K.,.%-,+"6/*,.+*$4%&)A6%./+%$+!12+

'&$8&.//)$47++

+

!%+ &./%=+ /K.,.%-,+"6/*,.+-**$64%/+ 9$&+GH:PHZ+$9+ %(.+ %$%-,+.4.&8#+.C'.45)%6&.7+[);.4+ %(-%+ /K.,.%-,+"6/*,.+

',-#/+ -+ *&)%)*-,+ &$,.+ )4+ "-)4%-)4)48+ ".%-A$,)*+ ($".$/%-/)/=+ -,%.&.5+ .4.&8#+ A-,-4*.+ )4+ %()/+ %)//6.+ $;.&+

.C%.45.5+'.&)$5/+$9+%)".+"-#+&.'&./.4%+-+&)/K+9-*%$&+9$&+%(.+5.;.,$'".4%+$9+!127+ D4%.&./%)48,#=+%($&$68(+

"-'')48+ $9+ 4.6&$"6/*6,-&+ \64*%)$4+ 0SNW3+ 5.4.&;-%)$4+ '-%%.&4/+ )4+ %(.+ 2]T>[VP!+"$6/.+"$5.,+ $9+!12+

&.;.-,.5+ )4*&.-/.5+ /6/*.'%)A),)%#+ $9+ 8,#*$,#%)*+ 9)A.&/+ %$+ 645.&8$+ 5.4.&;-%)$47+ U(.+ ,$//+ $9+ 9-/%+ 9-%)8-A,.+

!"#$"!%&!'(!)&*+& %&

!"#"$%&'(#)%*"!+"),-%".%/0$1,%!"#"$%',&$"')%('',$20#('1%#3+,%445%.0)#%1/3*"/3#(*%.(5,$)%5,."$,%0'3%0++0$,'#%

!"#"$%)3!+#"!)%67$,3%!"#$%&%8999:%;,1,-&)%!"#$%&#899<=%)&11,)#)%#>0#%#>,%!,#05"/(*%)(1'0#&$,%".%1/3*"/3#(*%

.(5$,)%!03%+$,-()+"),%#>,!%#"%?@A%-()!0'#/,!,'#:%"',%".%#>,%.($)#%+0#>"/"1(*%,2,'#)%('%#>,%*"&$),%".%#>,%

-(),0),% 67()*>,$% !"# $%&% 899B=C% 4'-,,-:% D,% >02,% +$,2("&)/3% )>"D'% #>0#% +$"!"#("'% ".% !&)*/,E)+,*(.(*%

>3+,$!,#05"/()!%()%)&..(*(,'#%#"%('-&*,%)"!,%>0//!0$F)%".%GHI%('*/&-('1%-,)#$&*#("'%".%#>,%',&$"!&)*&/0$%

J&'*#("'%6?@A=%0'-%#>,%-,0#>%".%!"#"$%',&$"')%6K&+&()%!"#$%&#899L=C%M"//,*#(2,/3:%#>,),%-0#0%)&11,)#%#>0#%

!,#05"/(*%*>0'1,)%('%)F,/,#0/%!&)*/,%*"&/-%*"'#$(5&#,%#"%,0$/3%-,)#05(/(N0#("'%".%#>,%?@A%('%GHIC%%

%

4'% #>()% )#&-3% D,% ('2,)#(10#,-% ,0$/3% !&)*/,% !,#05"/(*% 0/#,$0#("')% #>0#% !(1>#% 0**"&'#% ."$% #>,% !,#05"/(*%

(!50/0'*,%0'-%,0$/3%?@A%-,',$20#("'%"5),$2,-%('%IOKPQ<RS%!(*,C%T,%$,+"$#%0'%,0$/3%0/#,$0#("'%('%!&)*/,%

!,#05"/(*%>"!,")#0)()%('%IOKPQ<RS%!(*,C%U>,%)D(#*>%#"D0$-)%/(+(-%&),%('%1/3*"/3#(*%!&)*/,%+$,*,-,)%?@A%

-,',$20#("'% -,#,*#,-% 53% V@Q% 0'-% #>,% ('*$,0),% ('% ,W+$,))("'% ".% -,',$20#("'%!0$F,$)C% X3% 0-!('()#,$('1%

-(*>/"$"0*,#0#,%6KMG=%#"%IOKPQ<RS%!(*,%D,%$,2,$),-%!,#05"/(*%(!50/0'*,:%(!+$"2,-%!,#05"/(*%.&'*#("':%

0'-% '"$!0/(N,-% #>,% ,W+$,))("'% ".% -,',$20#("'% !0$F,$)% ('% IOKPQ<RS% !(*,C% O&$% $,)&/#)% $,2,0/% 0'% ,0$/3%

!,#05"/(*%+0#>"/"13%('%)F,/,#0/%!&)*/,%#>0#%*"'#$(5&#,)%#"%#>,%),2,$(#3%".%#>,%-(),0),:%0'-%0--)%',D%(')(1>#%

('#"%#>,%0/$,0-3%*"!+/,W%GHI%)3'-$"!,C%%

!

"#$%&'$!%

()*+,-.+/-01!$234567"

!+018!9/:8!0;1<8/)8=!/8<.>01!1/,/10-*!

K&$('1%GHI%-(),0),%+$"1$,))("':% 0%+$"1$,))(2,% )>(.#% ('% )F,/,#0/%!&)*/,% .(5,$% )&5#3+,% .$"!% .0)#E#D(#*>% #"%

)/"DE#D(#*>%D"&/-%+$,)&!05/3%$,)&/#%('%0%*"'*"!(#0'#%)>(.#%#"D0$-)%!"$,%"W(-0#(2,%!,#05"/()!%6K,'1/,$%!"#

$%&%PLL9Y%7$,3%!"#$%&%8999Y%Z&'%!"#$%&%899R:%K,."$1,)%!"#$%&%899L=C%U>&):%D,%0(!,-%#"%-,#,$!(',%D>,#>,$%

IOKPQ<RS%!(*,%D"&/-%>02,%(!+$"2,-%*0+0*(#3%#"%)&++"$#%,'-&$0'*,%,W,$*(),C%T,%*"!+0$,-%0'0,$"5(*%'()%

0,$"5(*%*0+0*(#(,)%".%R[%-03%"/-%0)3!+#"!0#(*%IOKPQ<RS%!(*,%&)('1%#D"%,W,$*(),%+0$0-(1!)%"'%0%#$,0-!(//%

0++0$0#&)\%0'%('#,'),%0'0,$"5(*%,W,$*(),%#>0#%$,*$&(#)%1/3*"/3#(*%.0)#E#D(#*>%.(5,$)%67(1&$,%P%GEM=:%0'-%0%/"D%

('#,')(#3%,'-&$0'*,%,W,$*(),%#>0#%!"5(/(N,)%)/"DE#D(#*>%"W(-0#(2,%!&)*/,%.(5,$)%67(1&$,%P%KE7=C%G)%)>"D'%

('%7(1&$,%PG:%D>,'%#$,0-!(//%)+,,-%D0)%+$"1$,))(2,/3%('*$,0),-%('%#>,%('#,'),%0'0,$"5(*%,W,$*(),%+0$0-(1!:%

R[%-03%"/-%IOKPQ<RS%!(*,%>0-%)(1'(.(*0'#/3%+""$,$%+,$."$!0'*,%#>0'%#>,($%TU%/(##,$!0#,)Y%IOKPQ<RS%!(*,%

$0'%"'% #>,% #$,0-!(//% ."$% 0'% 02,$01,% ".% P]C[9!('% 6!,-(0'% 0#% PBC]]=:%D>(/,% #>,($%TU% /(##,$!0#,)% )+,'#% 0'%

02,$01,%".%P[C^<!('% 6!,-(0'%0#%P[C[9=%"'% #>,% #$,0-!(//% 67(1&$,%PX=C%G**"$-('1/3:%IOKPQ<RS%!(*,% $0'%0%

#"#0/% -()#0'*,% #>0#%D0)%P^CR_%)>"$#,$% #>0'% #>,%-()#0'*,% *"2,$,-%53% #>,($%TU% /(##,$!0#,)% 67(1&$,%PM=C%X3%

*"'#$0)#:% D>,'% *>0//,'1,-% D(#>% 0% !"-,$0#,% ,W,$*(),% +0$0-(1!% #>0#% ()% $,+$,),'#0#(2,% ".% 0'% ,'-&$0'*,%

D"$F"&#% 67(1&$,% PKE7=:% IOKPQ<RS% !(*,% +$"2,-% #"% >02,% )(1'(.(*0'#/3% 1$,0#,$% ,'-&$0'*,% #>0'% #>,($% TU%

/(##,$!0#,)% 67(1&$,% PK=C% 4'% $,)+"'),% #"% !"-,$0#,% ,W,$*(),:% IOKPQ<RS% !(*,% $0'% 0'% 02,$01,% ".% R^C]B!('%

6!,-(0'% 0#% R[CB]=% 5,."$,% $,0*>('1% ,W>0&)#("':% D>(/,% #>,($% TU% /(##,$!0#,)% $0'% 0'% 02,$01,% ".% BRCP9!('%

6!,-(0'% 0#% [LC]]=% +$("$% #"% ,W>0&)#("'% 67(1&$,% PK=C% 4'-,,-:% #>,% $,)()#0'*,% ".% IOKPQ<RS% !(*,% #"% $,0*>%

!"#$"!%&!'(!)&*+& $&

!"#$%&'()*+,#!*+&%-.!/'!0+')+'#(&+!"!1/(&!+2$1$0(34+1!&%5'!0+(*+'#!4+1%**(*3+$+')'$5+0(&'$*/!+'#$'+,$&+678+

31!$'!1+'#$*+'#!+0(&'$*/!+/)9!1!0+-:+'#!(1+;<+5(''!14$'!&+=>(3%1!+?@AB+

+

C(9!*+ '#$'+ &D!5!'$5+ 4%&/5!+ 2)&&!&&!&+ '#!+ /$2$/(':+ )E+ $0$2'+ 4!'$-)5(/$55:+ ')+ 2#:&(/$5+ $*0+ E%*/'()*$5+

/#$55!*3!&+=F)*&'$-5!+!"#$%&+?GHIJ+K$&&!5LM%-:+$*0+N5&)*J+OPP7AJ+'#!+!*#$*/!0+$!1)-(/+/$2$/(':+$*0+2))1+

$*$!1)-(/+/$2$/(':+)E+QNM?CH7R+4(/!+4(3#'+)//%1+$&+$+/)*&!S%!*/!+)E+4%&/5!+0!*!19$'()*B+T),!9!1J+$'+7U+

0$:&+ )E+ $3!+ QNM?+ CH7R+ 4(/!+ 0(0+ *)'+ 21!&!*'+ ,('#+ $*:+ &(3*+ )E+ 0!*!19$'()*J+ 1!3$105!&&+ )E+ '#!+ 4!'$-)5(/+

/$2$/(':+ )E+4%&/5!V+ 31(2+ &'1!*3'#+4%&/5!&+,!1!+ /)42$1$-5!+ ')+ '#$'+ )E+;<+ 5(''!14$'!&+ =>(3%1!+ OWAJ+@XC+

21)E(5!&+,!1!+*)14$5+=>(3%1!+OKAJ+$*0+'#!+4RYW+!"21!&&()*+)E+4)5!/%5$1+4$1D!1&+)E+0!*!19$'()*+=>(3%1!+

OFA+$*0+$'1)2#:+=>(3%1!+OMA+(*+35:/)5:'(/+"'('$%')#$*"!+',++)1+)"(0$'(9!+),%!-)+4%&/5!&+,!1!+&(4(5$1+')+;<+

5!9!5&B+K:+/)*'1$&'J+$'+?PU+0$:&+,#!*+QNM?CH7R+4(/!+$1!+2$1$5:Z!0+$*0+31(2+&'1!*3'#+(&+0!/1!$&!0+=>(3%1!+

OWAJ+ $55+ QNM?CH7R+ 21!&!*'!0+ ,('#+ (*/1!$&!0+ &2)*'$*!)%&+ $/'(9(':+ )*+ '#!(1+ @XC+ 21)E(5!&B+ X)1!)9!1J+

(*0%/'()*+)E+0!*!19$'()*+$*0+$'1)2#:+4$1D!1&+,!1!+4)1!+21)*)%*/!0+ (*+ '#!+ "'('$%')#$*"!+',++ =<WA+ '#$*+ (*+

'#!+ ),%!-)B+ <#!&!+ 0$'$+ &%22)1'+ 21!9()%&+ )-&!19$'()*&+ '#$'+ (*+ W[QJ+ 35:/)5:'(/+ 4%&/5!&+ $1!+4)1!+ &!9!1!5:+

$EE!/'!0+ -:+ 0(&!$&!+ 2$'#)5)3:+ '#$*+ )"(0$'(9!+4%&/5!&+ =M!*35!1+ !"# $%&+ ?GGPJ+ >1!:+ !"# $%&+ OPPPJ+ \%*+ !"# $%&+

OPP7AB+;!+'#!1!E)1!+E)/%&!0+)%1+&%-&!S%!*'+$*$5:&(&+)*+'#!+35:/)5:'(/+<WB++

!

"#!$%&'()!*(%'+&)!,)-./+(0&,!0&!0120/0-)3!01!.&4,5-+,.-0'!6789:;<=

!,0')!!

+

C5:/)5:&(&+ (&+ '#!+ )*5:+4!'$-)5(/+ 2$'#,$:+ '#$'+ 21)9(0!&+ $+ &)%1/!+ )E+ #(3#L!*!13:+ &%-&'1$'!&+ E)1+ $*$!1)-(/+

!"!1/(&!B+C(9!*+'#$'+(42$(1!0+35:/)5:'(/+2!1E)14$*/!+(*+QNM?CH7R+4(/!+/$**)'+-!+!"25$(*!0+-:+0!*!19$'()*+

)1+$'1)2#:J+,!+#:2)'#!&(Z!0+'#$'+1!0%/!0+$*$!1)-(/+2!1E)14$*/!+,$&+0%!+')+0!E!/'(9!+35%/)&!+%'(5(Z$'()*B+]*+

)10!1+')+9!1(E:+,#!'#!1+35%/)&!+4!'$-)5(&4+(&+$5'!1!0+(*+QNM?CH7R+4(/!+,!+E(1&'+$*$5:Z!0+'#!(1+1!&2)*&!+')+

35%/)&!+ $*0+ (*&%5(*B+ <#!+ 35%/)&!+ ')5!1$*/!+ '!&'+ =>(3%1!+ @?WA+ &#),!0+ '#$'+ $'+ 7U+ 0$:&J+ QNM?CH7R+ 4(/!+

21!&!*'!0+,('#+ #(3#!1+ -5))0+35%/)&!+ $'+ 6P+ $*0+^U4(*+,#!*+ /)42$1!0+ ')+;<+ 5(''!14$'!&J+ &%33!&'(*3+ '#$'+

(*('($5+35%/)&!+/5!$1$*/!+ (&+0!5$:!0+ (*+QNM?CH7R+4(/!B+T),!9!1J+ $E'!1+?OP4(*+-5))0+35%/)&!+ 5!9!5&+,!1!+

&(4(5$1+-!',!!*+;<+$*0+QNM?CH7R+4(/!J+&%33!&'(*3+'#$'+'#!1!+4$:+-!+(*/1!$&!0+35%/)&!+%2'$D!+-!',!!*+6P+

$*0+ ?OP+4(*%'!&+ (*+ QNM?CH7R+ 4(/!B+ <#!+ 1!&2)*&!+ ')+ (*&%5(*+,$&+ $5&)+ 0!5$:!0+ (*+ QNM?CH7R+ 4(/!+ ,#!*+

/)42$1!0+')+;<+5(''!14$'!&+=>(3%1!+@?KAB+<#!&!+0$'$+&#),+$*+$5'!1$'()*+(*+35%/)&!+#$*05(*3+(*+QNM?CH7R+

4(/!+$'+'#!+$&:42')4$'(/+&'$3!+)E+0(&!$&!B+

<)+0!'!14(*!+,#!'#!1+ $5'!1!0+ 35%/)&!+ #$*05(*3+)//%11!0+ $'+ '#!+ 5!9!5+ )E+ &D!5!'$5+4%&/5!+,!+ $&&!&&!0+ '#!+

$/'(9(':+ )E+ 2#)&2#)E1%/')D(*$&!+ ?+ =\>_?AJ+ '#!+ 1$'!L5(4('(*3+ !*Z:4!+ )E+ 35:/)5:&(&J+ (*+ <W+ /:')&)5(/+

#)4)3!*$'!&B+;#!*+/)42$1!0+')+;<+5(''!14$'!&J+QNM?CH7R+4(/!+#$0+$+&(3*(E(/$*'+O68+1!0%/'()*+(*+\>_?+

!*Z:4$'(/+ $/'(9(':+ $'+ 7U+0$:&+)E+ $3!B+K:+ '#!+ !*0L&'$3!+)E+0(&!$&!+ =?PU+0$:&+)E+ $3!AJ+\>_?+ $/'(9(':+,$&+

1!0%/!0+ -:+ HHBH8+ (*+ QNM?CH7R+ 4(/!+ ,#!*+ /)42$1!0+ ')+ ;<+ 5(''!14$'!&+ =>(3%1!+ 6WAB+ <#(&+ ,$&+

$//)42$*(!0+-:+$+ULE)50+0),*+1!3%5$'()*+(*+'#!+!"21!&&()*+)E+\./0#4RYW+(*+QNM?CH7R+4(/!+=>(3%1!+@?FAB++

!"#$"!%&!'(!)&*+& ,&

!"#$%"#&'&('&()*+,"-.*/(0#(-(1,20*)(%3(,4&.)*-2(-1/(/%51&.)*-2($%24%1*1.&6(7#),8-.*('&(.9*(*1/(4)%/,$.(

%3( +"#$%"#&'&( -1/( -( /%51&.)*-2( $%24%1*1.( '1( .9*( +"#$%"#.'$( 4-.95-#( .9-.( '19'0'.&( 2,&$"*( 7:;<(59'"*(

+"#$%+*1(&#1.9-&*('&(-(=*#(*1>#2*(.9-.($%18*).&(+",$%&*(.%(+"#$%+*16(?9,&@(5*(-&&*&&*/(4#),8-.*("*8*"&@(

+"#$%+*1(&#1.9-&*(-$.'8'.#@(-1/(+"#$%+*1(-$$,2,"-.'%1('1(.9*(?A(%3(BCD<!EFG(2'$*(-1/(H?("'..*)2-.*&(-.(

.9*(-&#24.%2-.'$(-1/(&#24.%2-.'$(&.-+*&(%3(/'&*-&*6(7#),8-.*(5-&(<6I(3%"/(2%)*($%1$*1.)-.*/('1(FJ(/-#&(

%"/(BCD<!EFG(2'$*( .9-1( '1( -+*K2-.$9*/(H?( "'..*)2-.*&( L:'+,)*(MNO6(N#(<PJ(/-#&( %3( -+*@( &#24.%2-.'$(

BCD<!EFG(2'$*(9-/(-(&'+1'3'$-1.()*/,$.'%1('1(4#),8-.*("*8*"&(59*1($%24-)*/(.%(H?("'..*)2-.*&6(Q9-1+*&(

'1( .9*( *R4)*&&'%1( %3( 4#),8-.*( "*8*"&( '1( BCD<!EFG( 2'$*( %$$,))*/( $%1$,))*1."#( 5'.9( -".*)*/( -$.'8'.#( %3(

+"#$%+*1(&#1.9-&*(-1/(-".*)*/(+"#$%+*1(-$$,2,"-.'%16(A.(FJ(/-#&(%3(-+*@(BCD<!EFG(2'$*(9-/(/*$)*-&*/(

49%&49%)#"-.'%1(%3(+"#$%+*1(&#1.9-&*(L:'+,)*(MQO(-1/(-($%))*&4%1/'1+('1$)*-&*('1(+"#$%+*1(-$$,2,"-.'%1(

L:'+,)*( MDO6(N#( $%1.)-&.@( +"#$%+*1( &#1.9-&*( 49%&49%)#"-.'%1( '1(BCD<!EFG(2'$*( -.( <PJ(/-#&(%3( -+*(5-&(

/)-2-.'$-""#('1$)*-&*/@('1/'$-.'1+(.9*('19'0'.'%1(%3('.&(-$.'8'.#6(?9*('1$)*-&*/(&#1.9*&'&(%3(+"#$%+*1(-1/('.&(

&,0&*S,*1.(-$$,2,"-.'%1(5-&(S,-1.'3'*/('1(.)-1&8*)&*(&*$.'%1&(%3(?A!&.-'1*/(0#(4*)'%/'$(-$'/KB$9'33(L7ABO(

L:'+,)*(MDO6(

!

!"#$%&'()*+#,+-%,&./+0)1+#230)1+#4#'56&+/'7)*3.0#30#/7%8.7%*38#9'187+#*311'+#31#)0#+)&7%#+(+0*##

T1( &=*"*.-"( 2,&$"*@( 4#),8-.*( "*8*"&( -)*( 4)'2-)'"#( +%8*)1*/( 0#( 4#),8-.*( /*9#/)%+*1-&*( $%24"*R( L7DUO(

-$.'8'.#@(59'$9('.&*"3('&('19'0'.*/(59*1(49%&49%)#"-.*/(0#(4#),8-.*(/*9#/)%+*1-&*(='1-&*(V(L7D;VO6(?9,&@(

5*(-&&*&&*/(.9*(*R4)*&&'%1("*8*"&(%3("#$(V(2GWA(0#(G?KS7QG6(A&(&9%51('1(:'+,)*(VA@(-.(FJ(/-#&(%3(-+*(

BCD<!EFG(2'$*(9-/(-(X6XK3%"/('1$)*-&*('1("#$%(2GWA("*8*"&('1(?A(59*1($%24-)*/(.%(H?(2'$*(L:'+,)*(

VAO6( A.( .9*( *1/K&.-+*( %3( /'&*-&*@("#$%( 2GWA( *R4)*&&'%1(5-&( E6YK3%"/( 9'+9*)( '1( BCD<!EFG( 2'$*( 59*1(

$%24-)*/( .%( -+*K2-.$9*/( H?( "'..*)2-.*&6( N#( $%1.)-&.@( "#$&( .)-1&$)'4.( "*8*"&( 5*)*( &'2'"-)( 0*.5**1(

BCD<!EFG(2'$*(-1/(H?("'..*)2-.*&(-.(FJ(/-#(%3(-+*@(0,.(/*$)*-&*/(XK3%"/('1(BCD<!EFG(2'$*(-.(<PJ(/-#&(%3(

-+*(L:'+,)*(VAO6((

7D;V(*R4)*&&'%1('&(&.'2,"-.*/(0#(8-)'%,&(4-)-2*.*)&('1$",/'1+(&=*"*.-"(2,&$"*(/*1*)8-.'%1@('1$)*-&*/(3-..#(

-$'/( L:AO( ,&*( .9)%,+9( ZK%R'/-.'%1( L[*%1+( '(! )*+( XP<XO@( -1/( .)-1&$)'4.'%1( 3-$.%)&( 4*)%R'&%2*( 4)%"'3*)-.%)K

-$.'8-.*/( )*$*4.%)&( Z\ ( L77AGZ\ O( -1/( 3%)=9*-/( N%R( C<A( L:C]C<O6( B$'-.'$( 1*)8*( -R%.%2#K'1/,$*/(

/*1*)8-.'%1('1(H?(2'$*()*&,".*/( '1(-(<6EK3%"/( '1$)*-&*( '1("#$%(2GWA(L:'+,)*(^XAO@(59'"*( '1( .9*(,-*'.,(

2,&$"*(%3(BCD<!EFG(2'$*@("#$%(*R4)*&&'%1(5-&($%24-)-0"*(.%(.9-.(%3(H?(2'$*(-.(FJ(-1/(<PJ(/-#&(%3(-+*(

L:'+,)*(^XNO6(?9*&*()*&,".&($"*-)"#(/*2%1&.)-.*(.9-.(/*1*)8-.'%1('&(1%.(.9*(4)'2-)#($-,&*(%3("#$%!'1/,$.'%1(

'1(?A(2,&$"*6(U*1$*@(5*(1*R.( $%1/,$.*/(G?KS7QG(-1-"#&*&( %3( +*1*&( '18%"8*/( '1( "'4'/( 9-1/"'1+6(H9*1(

$%24-)*/( .%(H?( "'..*)2-.*&@( FJ( /-#&( %"/( BCD<!EFG(2'$*( 9-/( -( &'+1'3'$-1.( '1$)*-&*( '1( .9*( *R4)*&&'%1( %3(

+*1*&( *1$%/'1+( "'4%4)%.*'1( "'4-&*( L/0*@( E<6X_O@( Q/MF( L<E6I_O@( -$#"Q%A( &#1.9*.-&*( L12,3&@( JP_O@( -1/(

$-)1'.'1*(4-"2'.%#"K.)-1&3*)-&*(<N(L40(56!@(IP_O(L:'+,)*(VNO6(A.(.9*(*1/K&.-+*(%3(/'&*-&*@(.9*(*R4)*&&'%1(%3(

/0*(-1/(4#78('1(BCD<!EFG(2'$*(5-&($%24-)-0"*(.%(.9-.(%3(H?("'..*)2-.*&@(59'"*(12,3&!5-&(/*$)*-&*/(0#(

VP_(-1/(40(56!(5-&('1$)*-&*/(0#(VJ_(L:'+,)*(VNO6((

!"#$"!%&!'(!)&*+& ,&

!"#$%&'%()%*+$%'',-")-.)/%"%')%"#-(,"/)&")%"012%)34&3)41($-51'%')3$,/51#%$,(%') 3-).&#,5,3&3%)34%)6+3&7%)-.)

.$%%) .&331) &#,(') 89:9;) 8<%&()!"# $%&) =>>=;?) ) &)2%2@$&"%) 3$&"'5-#&'%) 34&3) +$-2-3%')AB)%"3$1) ,"3-) 34%) #%55)

8CDEF;?)&")%"012%)34&3)#&3&51'%')34%)#-"G%$',-")-.)AB)3-)B#15C-B)8BCHA=;?)&"()34%)$&3%I5,2,3,"/)%"012%)

.-$) I-*,(&3,-")$%'+-"',@5%).-$)34%)AB)3$&"'.%$),"3-)34%)2,3-#4-"($,&)8C:JIKL;)8<#M&$$1)!"#$%&#KNOE;),")

&'12+3-2&3,#)HPDKMOFQ)2,#%)'6//%'3') 34&3)&"),"#$%&'%)6+3&7%)-.).&331)&#,('),"3-)/51#-513,#)26'#5%)3,''6%)

R4%")B9H) -##6$'S) J&7%") 3-/%34%$)R,34) 34%) ,"#$%&'%() %*+$%'',-") -.)'()*?) -6$) (&3&) ,"(,#&3%') 34&3) 4,/4%$)

5%G%5') -.) I-*,(&3,-") %*,'3) ,") /51#-513,#)26'#5%) +$,-$) 3-) (%"%$G&3,-"S)M,G%") 34&3) &(%"-',"%) 3$,+4-'+4&3%)

8BJ:;)&"()$%(6#%()",#-3,"&2,(%)&(%","%)(,"6#5%-3,(%)8TBDU;)&$%)3R-)%"%$/%3,#)'6@'3$&3%')+$-(6#%()@1)VI

-*,(&3,-")&"()-*,(&3,G%)+4-'+4-$15&3,-"),")34%)2,3-#4-"($,&)34&3)&$%)7"-R")3-)'3,265&3%):DW)&#3,G,31)8.-$)

$%G,%R)'%%)U&$$,')!"#$%&)=>>=;?)R%)2%&'6$%()34%)G&$,&3,-"),")34%'%)2-5%#65%'),")34%)JB)-.)HPDKMOFQ)2,#%)

&"()XJ) 5,33%$2&3%') &3) FY) &"() K>Y) (&1') -.) &/%S)X%) %G,(%"#%() &) ',/",.,#&"3) ,"#$%&'%) ,")BJ:) &"()TBDU)

5%G%5')8KSEZI)&"()KS[NI.-5()#4&"/%)$%'+%#3,G%51;),")FY)(&1)-5()HPDKMOFQ)2,#%)#-2+&$%()3-)XJ)R4,5%)TBD\)

5%G%5')R%$%)#-2+&$&@5%)8A,/6$%)[C;S)!"3%$%'3,"/51?)BJ:)&"()TBDU)5%G%5')R%$%)',2,5&$)@%3R%%")HPDKMOFQ)

2,#%)&"()XJ) 5,33%$2&3%')&3) K>Y)(&1')-.) &/%)R4,5%)TBD\) 5%G%5')R%$%) ,"#$%&'%()=SFI.-5(S)A,"&551?)2QTB)

5%G%5')-.)'+$,-. )&"()/0102)R%$%),"#$%&'%(),")FY)(&1)-5()HPDKMOFQ)2,#%)8A,/6$%)Y)B?)L;S)A6$34%$?)2QTB)

5%G%5')-.)#,3$&3%)'1"34&'%?)34%).,$'3)%"012%)-.)34%)W$%@')#1#5%?)R%$%)#-2+&$&@5%)3-)XJ)&3)FY)(&1')-.)&/%)@63)

',/",.,#&"351) $%(6#%() &3) %"(I'3&/%) 8A,/6$%) YC;S) J4%'%) (&3&?) 3-/%34%$) R,34) 34%) ,"4,@,3,-") -.) /51#-51',')

(%'#$,@%(),")34%)+$%G,-6')'%#3,-"?)#5%&$51)(%2-"'3$&3%)34&3)&")%&$51)#4&"/%),").6%5)+$%.%$%"#%).$-2)/56#-'%)

3-R&$()5,+,('),")/51#-513,#)26'#5%).,@%$')-##6$')@%.-$%)(%"%$G&3,-"),")HPDKMOFQ)2,#%S))

)

!"#$%&#'&()*+,-.#/0-(.%#-1#2,3.+,3(-.#'4/.,&#+..45/#-16&7&16&1(,3#+8#9:;<=!#

J4%) +$-#%''%') 34&3) +$-2-3%) 34%)2-@,5,0&3,-") &"() 6'%) -.) .&331) &#,(') .-$) BJ:) '1"34%',') (6$,"/)2-(%$&3%)

%*%$#,'%)&$%)'6@]%#3%()3-)2653,+5%)$%/65&3-$1)'3%+'S)J1+,#&551?),"#$%&'%()-*,(&3,G%)#&+&#,31)&"()5,+,()6'%),")

26'#5%),')&##-2+&",%()@1)&)'R,3#4),")26'#5%).,@%$)'6@31+%?)&)+4%"-2%"-")34&3),').&#,5,3&3%()@1):%$-*,'-2%)

:$-5,.%$&3-$IB#3,G&3%() Q%#%+3-$) M&22&) C-I&#3,G&3-$) KI&5+4&) 8:MCK ! ;?) 34%) 2&'3%$) $%/65&3-$) -.)

2,3-#4-"($,&5)@,-/%"%',')&"().6"#3,-")8)X6)!"#$%&)KNNN^)9,")!"#$%&)=>>=;S)X%)346')&"&510%()34%)%*+$%'',-")

-.):MCK!),")34%)JB)-.)HPDKMOFQ)2,#%S)B3)FY)(&1')-.)&/%)'3452!)2QTB)&"()+$-3%,")5%G%5')R%$%)',2,5&$)

@%3R%%")HPDKMOFQ)&"()XJ)2,#%)8A,/6$%)YD?)_;)R4%$%&')34%1)R%$%)',/",.,#&"351)(%#$%&'%()&3)K>Y)(&1')-.)

&/%),")HPDKMOFQ)2,#%S)!2+-$3&"351?)&3)34%)%"(I'3&/%)-.)34%)(,'%&'%)34%)(%#$%&'%),"):MCIK!)+$-3%,")5%G%5')

#-$$%5&3%() R,34) &) (%#$%&'%) ,") 34%) 2QTB) %*+$%'',-") -.) 34%) 2&,") 3&$/%3) /%"%') -.) :MCIK! ) +&34R&1?)

%'3$-/%"I$%5&3%() $%#%+3-$) ! ) 8677! ;?) 2,3-.6',") =) 889:;;) &"() "6#5%&$) $%'+,$&3-$1) .&#3-$) K) 8<,92;)

8:6,/'%$G%$?)=>>Y^)`,55%"&)&"()W$&55,?)=>>O;)8A,/6$%)Y_;S)677!)2QTB)%*+$%'',-")R&')$%(6#%()@1)2-$%)

34&") .,G%I.-5(?)89:;) 2QTB) 5%G%5') R%$%) (%#$%&'%() @1) 3R-I.-5() &"() <,92# R%$%) (%#$%&'%() @1) E>a) ,")

HPDKMOFQ)2,#%)R4%")#-2+&$%()3-)XJ)&",2&5')&3)K>Y)(&1')8A,/6$%)YA;S)!")&((,3,-"?)2,3-#4-"($,&5)DTB)

b6&"3,.,#&3,-") ,"(,#&3%() &) (%#$%&'%() "62@%$) -.)2,3-#4-"($,&) ,")JB)-.) HPDKMOFQ)2,#%) 3-R&$(') 34%) %"(I

!"#$"!%&!'(!)&*+& ,&

!"#$%& '(& )*!%#!%& +,*$-.%&/012& 34"%.%!"*4$56& "7*!& )%8.%#!%& *4&9*"'87'4).*#5&:;0&<#!& 4'"& '=!%.>%)& *4& "7%&

!"#$%!& 9-!85%2& ?7%!%& )#"#& !-$$%!"& "7#"& *48.%#!%)& #8"*>#"*'4& '(& "7%& 5*@*)& 'A*)#"*'4& @#"7<#6!& *4& !B%5%"#5&

9-!85%&'(&CD:EFG/H&9*8%&'88-.!&*4)%@%4)%4"56&'(&IFJE K&#4)&"7#"&"7*!&9%"#='5*8&87#4$%&)'%!&4'"&7#>%&

"7%&!-@@'."&'(&"7%&9*"'87'4).*#5&9#87*4%.6&'(&"7%&8%552&I.%!-9#=56K&"7*!&<'-5)&7#>%&)%5%"%.*'-!&%((%8"!&)-%&

"'& #88-9-5#"*'4& '(& ! L'A*)#"*'4& =6L@.')-8"!& #4)& HDC& +M'44#.)& $&' (#)& NOOG12& 34)%%)K& $5-"7#"*'4%&

@%.'A*)#!%&E&+*+,-1K&#4&*9@'."#4"&*4)*8#"'.&'(&'A*)#"*>%&!".%!!K&<#!&*48.%#!%)&*4&"7%&?0&=-"&4'"&"7%&!"#$%!&

'(&CD:EFG/H&9*8%&#"&%4)L!"#$%&'(&)*!%#!%&+,*$-.%&/M12&&

!

"#!$%&'()*+,!-%'./(0*1!%23*0*/)*3-!4.1*0*'.'%&!5%*,6'!,.*+!.+7!7%0.8&! '6%!(+&%'!(4!-('()!&8-9'(-&!

.+7!7%+%):.'*(+!*+!;<=>?@A$

!-*1%!!

34&'.)%.&"'&#!8%."#*4&<7%"7%.&)%8.%#!%)&$568'56"*8&8#@#8*"6&*4&CD:EFG/H&9*8%&!*$4*(*8#4"56&*9@#8"!&<%*$7"&

5'!!&+)-%&"'&"7%&9'=*5*P#"*'4&'(&(#"1&#4)&9-!85%&(-48"*'4&#4)&@#"7'5'$6&"7#"&*!&8'99'456&'=!%.>%)&*4&0QC&

+:-@-*!& $&' (#)& NOEE1K& 9*8%& <%.%& ".%#"%)& <*"7& )*875'.'#8%"#"%& +:J01K& #& 7#5'$%4#"%)& '.$#4*8& #8*)& "7#"&

*47*=*"!&"7%&#8"*>*"6&'(&I:R&#4)&(#8*5*"#"%!&"7%&%4".6&'(&@6.->#"%&*4"'&"7%&R.%=!&8685%&#4)&"7%&'A*)#"*'4&'(&

$5-8'!%2&M6&*47*=*"*4$&I:R&#4)&@.%>%4"*4$&I:S&@7'!@7'.65#"*'4K&<%&#*9%)&"'&('.8%&9%"#='5*!9&"'<#.)!&

$5-8'!%&'A*)#"*'4&+0=)%5L#5%%9K&ETT/1K&"7%.%=6&.%>%.!*4$&"7%&9%"#='5*8&#5"%.#"*'4!&'=!%.>%)&*4&CD:EFG/H&

9*8%K&@.%>%4"*4$&<%*$7"&5'!!K&.%)-8*4$&"7%&"'A*8&%((%8"!&'(&5*@*)!&'4&9*"'87'4).*#K&#4)&)%5#6*4$&)%4%.>#"*'4&

*4&$568'56"*8&9-!85%&(*=%.!2&U%&#)9*4*!"%.%)&:J0&)#*56&*4&).*4B*4$&<#"%.&(.'9&/O&)#6!&"'&TV&)#6!&'(&#$%2&

0"& "7%& =%$*44*4$& '(& ".%#"9%4"& +?O1K& CD:EFG/H&9*8%& *4& ='"7& ".%#"%)& +:J01& #4)& 4'4L".%#"%)& +J?1& $.'-@!&

<%.%& !*$4*(*8#4"56& 5%#4%.& "7#"& U?& 9*8%2& D>%.& (*>%& <%%B!& '(& ".%#"9%4"K& CD:EFG/H& 9*8%& "7#"& .%8%*>%)&

).*4B*4$&<#"%.&+J?1&9#*4"#*4%)&"7%*.&*4*"*#5&<%*$7"2&M6&8'4".#!"K&CD:EFG/H&9*8%&.%8%*>*4$&:J0&*48.%#!%)&

"7%*.&*4*"*#5&<%*$7"&=6&EO2GWK&#4&*48.%#!%&"7#"&<#!&!*9*5#.&"'&"7#"&'=!%.>%)&*4&J?&U?&9*8%&'>%.&"7%&!#9%&

".%#"9%4"&@%.*')2&:J0&7#!&4'&%((%8"&'4&"7%&<%*$7"&$#*4&'(&U?&#4*9#5!&+,*$-.%&XY0K&M12&&

&

:#*56& #)9*4*!".#"*'4& '(& :J0& <#!& #=5%& "'& .%>%.!%& "7%& 87#4$%!& *4& +./0K& +1(234 !!#4)& 5"6"-& 9H;0&

%A@.%!!*'4&*4&CD:EFG/H&9*8%&+:J01&<7%4&8'9@#.%)&"'&4'4L:J0&".%#"%)&CD:EFG/H&9*8%&+J?K&,*$-.%&Z0K&

MK& J12& 0"& "7%& 8%!!#"*'4& '(& ".%#"9%4"K& +7/-K& 89!7:& #4)& 9;&2(&$' !<=&>(!$& 9H;0& 5%>%5!& *4& :J0L".%#"%)&

CD:EFG/H& 9*8%& <%.%& 8'9@#.#=5%& "'& :J0L".%#"%)& U?& 9*8%& +,*$-.%& Z:K& XK& ,1K& *4)*8#"*4$& !-88%!!(-5&

.%!"'.#"*'4&'(&$568'56!*!&#4)&#8"*>#"*'4&'(&"7%&R.%=!&8685%2&39@'."#4"56K&J?&CD:EFG/H&9*8%&@.%!%4"%)&<*"7&

!*$4*(*8#4"56&.%)-8%)&+7/-&#4)&9;&2(&$'!<=&>(!$&%A@.%!!*'4&<7%4&8'9@#.%)&"'&:J0L".%#"%)&CD:EFG/H&9*8%&

#4)['.&J?&U?&9*8%2&:J0& ".%#"9%4"&<#!& #5!'& #=5%& "'&@.%!%.>%& "7%& %A@.%!!*'4&'(&+?9@- & #4)& *"!& "#.$%"&

$%4%&A7=:& *4&:J0L".%#"%)&CD:EFG/H&9*8%&#"&5%>%5!&8'9@#.#=5%&"'&"7#"&!%%4&*4&J?&U?&#4)&:J0L".%#"%)&

U?&9*8%&+,*$-.%&ZFK&S12&?7%&*48.%#!%&*4&"7%&%A@.%!!*'4&'(&$%4%!&*4>'5>%)&*4&9*"'87'4).*#5&=*'$%4%!*!&<#!&

#88'9@#4*%)&=6&#&)%8.%#!%&*4&"7%&%A@.%!!*'4&'(&"7%&*16-&+,*$-.%&Z312&;'"#=56K&#4)&*4&!-@@'."&'(&'-.&.%!-5"!&

#='>%K&TV&)#6&'5)&J?&CD:EFG/H&9*8%&@.%!%4"%)&<*"7&#&!*$4*(*8#4"&)%8.%#!%&*4&"7%&%A@.%!!*'4&'(&+?9@- &

#4)&A7=:&9H;0K&#4)&#4&*48.%#!%&*4&"7%&%A@.%!!*'4&'(&*16-&9H;0&+,*$-.%&ZFK&SK&312&J'55%8"*>%56K&"7%!%&

!"#$"!%&!'(!)&*+& ,&

!"#"$%&''(%#$#)"#$*+,$-%$"./($#0$1(%#01($'/230/2#-3$4&53#-05$6)-/%#$!(31("%-5'$07-!"#-8($%#1(%%$-5$'/230/2#-3$

9&%3/($04$:;*<=>?@$9-3(A$

$

,#$"$4&53#-05"/$/(8(/B$*+,$6"%$"./($#0$"/90%#$309C/(#(/2$C1(%(18($9&%3/($%#1(5'#)A$D)-/($+E$:;*<=>?@$

9-3($/0%#$FGH$04$#)(-1$'1-C$%#1(5'#)B$*+,I#1("#(!$:;*<=>?@$9-3($05/2$/0%#$>H$04$#)(-1$'1-C$%#1(5'#)$6)(5$

309C"1(!$#0$-5-#-"/$'1-C$4013($"#$#)($-5-#-"#-05$04$#1("#9(5#$JK-'&1($>,LA$,5"/2%-%$04$9@M,$(7C1(%%-05$04$

9&%3/($"#10C)2$9"1N(1%$%)06(!$"$901($90!(%#$-9C108(9(5#$JK-'&1($>OLA$!"#$%&$9@M,$(7C1(%%-05$6"%$

1(!&3(!$4109$"$<A?I40/!$-531("%($-5$#)($505I#1("#(!$+E$:;*<=>?@$9-3($#0$<AFI40/!$-531("%($-5$*+,I#1("#(!$

:;*<=>?@$ 9-3(A$ :-9-/"1/2B$ '()%&$ 9@M,$ (7C1(%%-05$ 6"%$ !(31("%(!$ 4109$ "$ <API40/!$ -531("%($ -5$ +E$

:;*<=>?@$9-3($#0$"$<AQI40/!$-531("%($-5$*+,I#1("#(!$:;*<=>?@$9-3(A$*+,$#1("#9(5#$"/%0$C1(8(5#(!$#)($

-531("%($-5$#)($(7C1(%%-05$04$#)($!(5(18"#-05$9"1N(1%$JK-'&1($>+LA$E)($-531("%($-5$(7C1(%%-05$04$'*+, -

9@M,$ -5$ *+,I#1("#(!$ :;*<=>?@$ 9-3($ 6"%$ 05/2$ FARI40/!$ "%$ 309C"1(!$ #0$ "5$ >A>I40/!$ -531("%($ -5$ +E$

:;*<=>?@$9-3(A$'*+,!$9@M,$6"%$-531("%(!$.2$FASI40/!$-5$*+,I#1("#(!$:;*<=>?@$9-3($$"%$309C"1(!$

#0$"$<TA>PI40/!$-531("%($-5$9("%&1(!$-5$+E$:;*<=>?@$9-3(A$U"%#/2B$!"./$'(5($(7C1(%%-05$6"%$"/%0$/06(1$

40//06-5'$ #1("#9(5#$ 6-#)$ *+,B$ !(31("%-5'$ 4109$ "$ RI40/!$ -531("%($ -5$ +E$ :;*<=>?@$ 9-3($ #0$ "$ <AFI40/!$

-531("%($ -5$ *+,I#1("#(!$ :;*<=>?@$ 9-3(A$ DE$ 9-3($ #1("#(!$ 6-#)$ *+,$ !-!$ 50#$ C1(%(5#$ 6-#)$ "52$

90!-4-3"#-05%$ 04$ #)(%($ "#10C)2$ 01$ !(5(18"#-05$ 9"1N(1%A$ ,/#0'(#)(1B$ #)(%($ 1(%&/#%$ !(905%#1"#($ #)"#$ .2$

4"3-/-#"#-5'$#)($(V&-/-.1-&9$.(#6((5$'/&30%($"5!$/-C-!$07-!"#-05$#)10&')$#)($"!9-5-%#1"#-05$04$*+,B$6($"1($

"./($#0$C1090#($6(-')#$'"-5B$1(%#01($9-#03)05!1-"/$'(5($(7C1(%%-05B$-9C108($9&%3/($%#1(5'#)B$"5!$!(31("%($

#)($(7C1(%%-05$04$!(5(18"#-05$9"1N(1%$-5$:;*<=>?@$9-3(A$

!

!

"#$%&$$#'($

W(1($6($C108-!($(8-!(53($04$"$3)"5'($-5$#)($9(#".0/-3$3"C"3-#2$04$'/230/2#-3$9&%3/($-5$:;*<=>?@$9-3(A$,$

%6-#3)$4109$'/&30%($9(#".0/-%9$#0$/-C-!$9(#".0/-%9$033&1%$("1/2$-5$#)($!-%("%($C103(%%B$"5!$C1-01$#0$"52$

!(#(3#"./($MXY$!(5(18"#-05A$O2$-9C108-5'$'/230/2#-3$3"C"3-#2$04$:;*<=>?@$9-3($ #)10&')$"!9-5-%#1"#-05$

04$*+,B$6($C1090#(!$"$!(/"2$-5$#)($05%(#$04$90#01$%29C#09%$"5!$"9(/-01"#-05$04$9&%3/($!(5(18"#-05$"5!$

"#10C)2A$E)&%B$6($!(905%#1"#($401$#)($4-1%#$#-9($#)"#$"5$("1/2$%6-#3)$#0$/-C-!$9(#".0/-%9$-5$%N(/(#"/$9&%3/($

9"2$&5!(1/-($("1/2$C"#)0/0'-3"/$9(3)"5-%9%$#)"#$/("!$#0$MXY$!(%#".-/-Z"#-05$-5$,U:A$$

E)($ !(31("%(!$ 3"C"3-#2$ 401$ :;*<=>?@$ 9-3($ #0$ (5!&1($ "3&#($ C)2%-3"/$ (7(13-%($ #)"#$ %0/-3-#%$ "5"(10.-3$

9(#".0/-%9$-5$9&%3/($033&11(!$.(401($"52$9("%&1"./($9&%3/($6("N5(%%$01$!(5(18"#-05$JK-'&1($<$"5!$RLA$

E)-%$/06$1(%-%#"53($#0$-5#(5%($(7(13-%($305#1"%#(!$#)(-1$(5)"53(!$(5!&1"53($3"C"3-#2$!&1-5'$"3&#($"(10.-3$

(7(13-%(A$ E)-%$ 0.%(18"#-05$ %&''(%#%$ #)"#$ :;*<=>?@$ 9-3($ "3V&-1($ 5(6$ C10C(1#-(%$ -5$ %N(/(#"/$ 9&%3/($ #)"#$

(5)"53($ '/0."/$ "(10.-3$ 3"C"3-#2$ "5!$ C1090#($ (5!&1"53($ ".-/-#2A$ [#$ -%$ C/"&%-./($ #)"#$ "/#(1(!$ '/&30%($ "5!$

-5%&/-5$ 1(%C05%(%$ -5$ :;*<=>?@$ 9-3($ JK-'&1($ \<L$ 9-')#$ &5!(1/-($ #)-%$ 3)"5'($ -5$ (7(13-%($ 3"C"3-#2$ %-53($

-5%&/-5$C/"2%$"$31-#-3"/$ 10/($ -5$!1-8-5'$'/&30%($&C#"N($ -5#0$ %N(/(#"/$9&%3/($ 401$&%($"%$"5$(5(1'2$ %&.%#1"#($

!"#$"!%&!'(!)&*+& !'&

!"#$%&' ()*##*+' ,-.,' -)/-*#)/#0' 1$' .23/10#' -)412#"5)/#' ,56#' 7##)' 170#"6#*' -)' 854-#)40' *-5.)10#*' 9-4,'

081"5*-/':;<'!="5*54'!"#$%&'>?@?%,& A19#6#"+'50'75052'.23/10#'3845B#'-)'!'"!()*+#,-.-"*+/0#%*(./)'!CD;E'

5)14,#"'.2F/12F4-/'G30/2#%'1$'4,#'<HD@IJK:'G130#'G1*#2'1$':;<'-0')1"G52'7#$1"#'*#)#"654-1)'!<G-44B5G8'

!"#$%&'>?@L%+'-4'9132*'0##G'3)2-B#2F'4,54'524#"#*'-)032-)'0#)0-4-6-4F'3)*#"2-#0'4,#'G#45712-/'/,5).#0'170#"6#*'

-)'4,-0'043*F&''

C)*3"5)/#'#M#"/-0#'-0'5201'03881"4#*'7F'0219N49-4/,'1M-*54-6#'4F8#'('$-7#"0'9,-2#'-)4#)0#'#M#"/-0#'"#O3-"#0'

G16#G#)40' -)6126-).' 04"#).4,' 5)*' 08##*' 4,54' 5"#' .#)#"54#*' 7F' $504N49-4/,' .2F/12F4-/' 4F8#' ((7' $-7#"0'

!P500#2ND37F'Q'H201)'>??R%&'I-6#)'4,54'5'09-4/,'-)'$-7#"'4F8#'$"1G'.2F/12F4-/'41'1M-*54-6#'$-7#"0',50'7##)'

*#0/"-7#*'-)':;<'854-#)4'G30/2#'7-180-#0'!S#2#"G5)NS188#4'Q'T1U"0'@JVW%+'5)*' -)' 4,#'<HD@IJK:'G130#'

G1*#2'1$':;<' !:4B-)'!"#$%&'>??X+'A#.#*30'!"#$%&'>??W+'D#$1".#0'!"#$%&'>??J%+' 4,#'170#"6#*'524#"54-1)' -)'

#M#"/-0#' /585/-4F' -)' <HD@IWRY' G-/#'G-.,4' 5201' "#$2#/4' 5' 09-4/,' 1$'G30/2#' $-7#"' 4F8#&' ()' 2-)#'9-4,' 4,-0+'

#),5)/#*'5#"17-/'/585/-4F' -0' 4F8-/522F'170#"6#*'5$4#"'#)*3"5)/#' 4"5-)-).+'5)*' 4,-0'1//3"0'/1)/3""#)4'9-4,'

G#503"572#'/,5).#0'-)'$-7#"'4F8#'/1G810-4-1)'!=#44#'5)*'<45"1)'>??@%&''

=Z[@' -0' 4,#' "54#N2-G-4-).' #)\FG#' 1$' 4,#' .2F/12F0-0+' 5)*' 5)' -)/"#50#' -)' .2F/1.#)' 0F)4,50#' 5/4-6-4F' 5)*'

.2F/1.#)'5//3G3254-1)'-)'0B#2#452'G30/2#'-0'/,5"5/4#"-04-/'1$'G30/2#'4,54'-0'037]#/4#*'41'#)*3"5)/#'4"5-)-).'

!^#04#".55"*+' @JJJ%&' S,30+' 4,#' -)/"#50#' -)' #)*3"5)/#' /585/-4F' -)' <HD@IWRY' G-/#' G-""1"0' 5' 8"1$13)*'

524#"54-1)'1$'$3#2'8"#$#"#)/#'-)'G30/2#'$-7#"0&'()'5//1"*5)/#'9-4,'4,-0+'9#'170#"6#*'5'8"1."#00-6#'*#/"#50#'

1$' =Z[@' 5/4-6-4F+' 5)*' 5)' -)/"#50#' -)' .2F/1.#)' 0F)4,50#' 5/4-6-4F' 5)*' .2F/1.#)' 5//3G3254-1)' -)' 0B#2#452'

G30/2#&' S,#' -)-4-52' *#/"#50#' -)' =Z[@' 5/4-6-4F' -)' <HD@IWRY' G-/#' G5F' 7#' 5)' 5*58454-6#' "#081)0#' 41' 4,#'

8"1."#00-6#'5//3G3254-1)'1$'8F"3654#'5)*'-)/"#50#*'$544F'5/-*0'3845B#+'491'9#22NB)19)'814#)4'-),-7-41"0'1$'

=Z[@'!_50051'A-"575"5'!"#$%&'>??K%&'Z3"4,#"G1"#+'50'4,#'#)4"F'1$'.23/10#'-)41'G30/2#'$-7#"0'-)':;<'G-/#'

-0')14'5$$#/4#*'#5"2F'-)'*-0#50#'!D383-0'#4'52&'>??L`'<G-44B5G8'!"#$%&'>?@K%+'13"'*545'03..#040'4,54'.23/10#'-0'

"#"134#*'4195"*0'.2F/1.#)'041"#0'"54,#"'4,5)'7#-).'30#*'50'5)'-GG#*-54#'#)#".F'013"/#&'PF'4,#'#)*N045.#'

1$'*-0#50#+'"#*3/#*'5/4-6-4-#0'1$'=Z[@'5)*'.2F/1.#)'0F)4,50#+'41.#4,#"'9-4,'5)'-)/"#50#'1$'.2F/1.#)'041"#0'

5)*' "#*3/#*' 2#6#20' 1$' 8F"3654#' *#G1)04"54#' -),-7-4-1)' 1$' 4,#' .2F/12F4-/' 854,95F&' T122#/4-6#2F+' 4,#0#'

170#"654-1)0' 03..#040' 4,54' .2F/12F4-/' G30/2#' -0' )1' 21).#"' 572#' 41' G17-2-\#' .2F/1.#)' 041"#0' 41' 8"1*3/#'

#)#".F+'5)*'4,54'4,#'-),-7-4-1)'1$'.2F/12F0-0'588#5"0'41'1"-.-)54#'*19)04"#5G'1$'=Z[@'!Z-.3"#'J%&'

()'/1)4"504'41'-),-7-4-1)'1$'.2F/12F0-0'-)'<HD@IWRY'G-/#+'4,#'2-8-*'854,95F'950'04-G3254#*'54'RX'*5F0'1$'5.#+'

5)*'"#G5-)#*'$3)/4-1)52'3)4-2'4,#'#)*N045.#'1$'*-0#50#'!Z-.3"#'LP+'T%&'(4'-0'B)19)'4,54'-)/"#50#*'#)*3"5)/#'

0,132*' /1""#254#'9-4,' -)/"#50#*' "#2#50#' 1$' $544F' 5/-*0' $"1G' 2-8-*' 041"#0+' 5)*' #),5)/#*' 3845B#' 7F'G30/2#'

4-003#'!S525)-5)'!"#$%&'>?@?%&'="#6-130'170#"654-1)0'1$'*#/"#50#*'$54'85*'G500'5)*'"#08-"541"F'O314-#)4'54'5)'

#5"2F'045.#'-)'<HD@IWRY'G-/#'!D383-0'!"#$%&'>??L%+'5)*'-)/"#50#*'2-8-*'/2#5"5)/#'-)'4,#0#'G-/#'!Z#".5)-'!"#

$%&'>??V%'5"#'-)*-/54-6#'1$'-)/"#50#*'2-8-*'30#&'_1"#16#"+'-)'854-#)40'*-5.)10#*'9-4,'081"5*-/':;<+'="5*54'

5)*'/122#5.3#0'"#81"4#*'-)/"#50#*'/-"/3254-).'$"##'$544F'5/-*0'!ZZ:0%'!="5*54'!"#$%&'>?@?%&& :241.#4,#"+'4,#0#'

170#"654-1)0' -)*-/54#' 4,54'G30/2#' 4-003#'1$'<HD@IWRY' -0' 4,#'814#)4-52'0-4#'1$'57)1"G52' 2-8-*'/1)03G84-1)&&

!"#$%"&'()*#+,(&"-#.+)/#'!"&"#)0&"+1,'()*&#2,&#2!"'!"+#'!"#/)+"#3"..(4("*'5#)6(-,'()*#-%+(*7#"6"+4(&"#(&#

*3#' 41' 5' .-6#)' ."138' 1$' G30/2#0' 4,54' 91"B' G1"#' #$$-/-#)42F+' 1"' 9,#4,#"' 14,#"' ."1380' 1$' G30/2#0' 5"#'

!"#$"!%&!'(!)&*+& !!&

!"#$%&'() $*&+,-&.") -$) /,0-&#&/,-") &') -1") "*"0#&2") -,234) 51") 6,--"0) #,2") ,//",02) -$) $##70) 2&'#") 8&!"0) -9/")

2:&-#1&'() -$:,0+2)%$0")$*&+,-&.")%"-,!$6&2%) ;<"8$0("2)"-)!"#) =>>?@A) ,'+) &'#0",2"+)"*/0"22&$')$8)("'"2)

"'#$+&'()"'B9%"2) &'.$6."+) &') 6&/&+)%"-,!$6&2%) ;<7/7&2)$%&!"#) =>>CA)D"0(,'&)$%&!"#) =>>E@) &2)$!2"0."+),-)

6,-"0A)29%/-$%,-&#)2-,("2)$8)+&2",2")&')FGH)%$72")%$+"624)I')6&'"):&-1)-1&2A):")21$:),')",069)&'#0",2")&')

-1")("'")"*/0"22&$')$8)&%/$0-,'-)#$%/$'"'-2)&')6&/&+)%$!&6&B,-&$'),'+)7/-,3");'("A))*+,A)-)./0),'+))(%1

23A)D&(70")CJ@A),'+)&'#0",2"+) K$*&+,-&$')!9K/0$+7#-2);F5L),'+)MF<N),-)OP)+,92@)-1,-),#-&.,-")L<QC)

,'+)&'1&!&-)L<N),#-&.&-9);<"'-$')$%&!"#)R?EP@)&')8,2-K-:&-#1)(69#$69-&#)%72#6"4)

L<QC),//",02)-$)/6,9),)/&.$-,6)0$6")&')-1")2:&-#1)&')87"6)/0"8"0"'#")!9)$0#1"2-0,-&'()27!2-0,-")#$%/"-&-&$')

&') HS<RTUOV) (69#$69-&#)%72#6") 8&!"024) I') 23"6"-,6) %72#6"A) L<QC) &2) -1")%$2-) 1&(169) "*/0"22"+) /907.,-")

+"19+0$("',2")3&',2")&2$8$0%),'+)&2)#$'2&+"0"+)-$)!"),)#0&-&#,6)0"(76,-$0)$8)/907.,-")+"19+0$("',2");L<N@)

,#-&.&-9) ;J$:3"0KQ&'6"9) $%& !"#) R??U@4) J9) /1$2/1$096,-&'() L<NA) L<QC) #$%/6"-"69) &'1&!&-2) -1") "'-09) $8)

/907.,-") &'-$) -1")Q0"!2) #9#6"A) -172) 1,%/"0&'() (67#$2") $*&+,-&$') ;8$0) 0".&":A) 2"")N$6'"22) ,'+) H7(+"'A)

=>>W@4)L<N),'+)L<QC),0")3'$:')-$),#-),2)%"-,!$6&#)1$%"$2-,-2)&')0"2/$'2")-$)"'"0(9)&%!,6,'#"4)I'+""+A)

L<QC) -0,'2#0&/-&$') &2) &'#0",2"+) +70&'() /0$6$'("+) "*"0#&2"A) ,8-"0) !$-1) 21$0-K-"0%) 1&(1K&'-"'2&-9) ,'+)

/0$6$'("+) 6$:K&'-"'2&-9) "*"0#&2") $0) +70&'() 8,2-&'(A) 2&-7,-&$'2) -1,-) 0"/0"2"'-) %"-,!$6&#) 2-,-"2) :1"0") -1")

:1$6")!$+9)(67#$2"),.,&6,!&6&-9) &2) &')+"8&#&-) ;H/0&"-)$%&!"#)=>>CX)Y,--)$%&!"#)=>>CX) Z"$'()$%&!"#)=>R=@4) I-2)

"*/0"22&$')&2)#$'-0$66"+)+&0"#-69)$0)&'+&0"#-69)!9).,0&$72)-0,'2#0&/-&$')8,#-$02[-0,'2#0&/-&$',6)#$,#-&.,-$02)$0)

2-&%76&) &'#67+&'() LLFV\[ A) DS]SRA) LT^KR!A) _VV!A) $0) DF24) I') ^=^R=) %$72") %9$!6,2-2A) '7-0&"'-)

+"/0&.,-&$')&'+7#"2)4*56)("'")"*/0"22&$');D7079,%,)$%&!"#)=>>W@4)I')0,-)%72#6")-&227"A)-0&(69#"0&+")&'872&$')

6",+2)-$)&'#0",2"+)/6,2%,)DF),'+)&'#0",2"+)"*/0"22&$')$8)4*56)%VMF);Q&%)$%&!"#)=>>O@4)`$0"$."0A)&-)1,2)

!""')21$:')-1,-)&')0"2/$'2")-$)&'#0",2"+)"'-09)$8)DF)&')23"6"-,6)%72#6")$0)-$)8,2-&'(A)&'+7#-&$')$8)LLFV\[ )

2-&%76,-"2) DS]SR) -0,'2#0&/-&$'A):1&#1) &') -70') ,#-&.,-"2)4*56) "*/0"22&$') ;M,16") $%& !"#) =>>U@4)N"0"A):")

21$:)-1,-)4*56),#-&.,-&$')%&(1-)$##70) &')0"2/$'2") -$) -1") &'#0",2") &')4(!789 ),'+)/:;:2)%VMF2A)0,-1"0)

-1,').&,) -1") #6,22&#,6) -0,'2#0&/-&$') 8,#-$02)LT^KR![_VV!4) I8) -1&2):"0") -1") #,2"A) -1"') ,') &'#0",2")$8)DF)

0"6",2")+7")-$)-1")&'+7#-&$')$8)'("),'+)-<=>0):$76+)2-&%76,-")L<QC)"*/0"22&$').&,)LLFV\[ ),'+)DS]SRA)

:1&#1):$76+) &') -70') 8,#&6&-,-") DF)$*&+,-&$')!9) #$'2"0.&'()/907.,-") 8$0) $*,6$,#"-,-") 8$0%,-&$') -$) ,66$:)

"'-09)$8),#"-96K#$F)&'-$)-1")Q0"!2)#9#6");D&(70")?@4)

I'#0",2"+) K$*&+,-&$') $8) 8,--9) ,#&+2) 6",+2) -$) -1") ("'"0,-&$') $8) 6&/&+) !9K/0$+7#-2) -1,-) #$'-0&!7-") -$)

6&/$-$*&#&-9) ,'+)VSH) /0$+7#-&$') ;a1,'() $%& !"#) =>R>@4) VSH) ,##7%76,-&$') &')%72#6") -&227") $8) HS<RTUOV)

%&#")&2),')",069)"."'-)&')-1")#$702")$8)-1")/,-1$6$(9)-1,-)/0"#"+"2)$."0-)2&('2)$8)+"'"0.,-&$');N,6-"0)$%&!"#)

=>R>@4)N"0"):")21$:),')7/K0"(76,-&$')$8)?(;2A),')&'+&#,-$0)$8)VSH),##7%76,-&$'A)&')-1")5F)!7-)'$-)&')-1")

=:"$@=)%72#6")$8)HS<TUOV)%&#")&')-1"),+.,'#"+)2-,("2)$8)-1")+&2",2"4)I-)&2)"*/"#-"+)-1,-)-1&2)#10$'&#[6$'()

-"0%),#-&.,-&$')$8)6&/&+)72"):$76+)1,.")-$*&#)"88"#-2)$')%&-$#1$'+0&,);J$'',0+)$%&!"#)=>>U@A):1&#1)%&(1-)

"*/6,&') -1") $!2"0."+) +"#0",2") $8) #&-0,-") 29'-1,2") ;D&(70") P^@A) -1") +"#0",2") &') -1") "*/0"22&$') $8) ("'"2)

0"2/$'2&!6")8$0)%&-$#1$'+0&,6)+9',%&#2A),'+)-1")0"+7#-&$')&')-1")b7,'-&-9)$8)%-<MF)2/"#&8&#)-$)(69#$69-&#)

%72#6") ;D&(70") O@4) I'+""+A) 0"2#7&'() %72#6") %&-$#1$'+0&,) &') ,) %$72") %$+"6) 8$0) FGH) -10$7(1) -1")

!"#$"!%&!'(!)&*+& !#&

!"#$#%&$#''(!)* !+* ,-'./#0'&#.(+(.* 12304 * 56'* 7##)* '5!8)* 9!* &$#"#)9* ,-'./#* 69$!&5:* 6);* (,&$!"#*

,(9!.5!);$(6/* +-).9(!)* <=6*3$->*!"#$%&*?@4?AB*C/95!-D5*12304 * ('* !"#$%& $'()#*#)%+'% ",#%-+($%.!(/#*%

9:&#* $#D-/+" *0% ",+"%& $"*(/1"#'% " %-1'&2#%3,4'( 2 5(&+2%32+'"(&("4%1$)#*%$ *-+2%3,4'( 2 5(&+2%& $)("( $'6%

12304 *('*;!8)0$#D-/69#;*8(95*;('#6'#*&$!D$#''(!)*()*!-$*EF=42GHI*,(.#J*6);*.6)*95#$#+!$#*)!9*6..!-)9*

+!$* 95#* ();-.9(!)*!+*'()*B*C/9#$)69("#/:J*,-'./#0'&#.(+(.*!"#$0#%&$#''(!)*!+*11CIKL * ()* 'M#/#96/*,-'./#*

$#'-/9'* ()* 6* D$#69#$* )-,7#$* !+* !%(;69("#* 9:&#* 4* +(7#$'* <N-O-#9* !"# $%&* ?@@PAJ* 6);* !"#$0#%&$#''(!)* !+*

.!)'9(9-9("#/:* 6.9("#* 11CIKL * $#'-/9'* ()* *,(9!.5!);$(6/* 7(!D#)#'('* 6);* 6* '5(+9* +$!,* +6'9* 98(9.5* 9!* '/!8*

98(9.5*+(7#$'*<Q6)D*!"#$%&*?@@RAB*S5-'J*95#*#6$/:*'8(9.5*!+*+-#/*&$#+#$#).#*()*CNE*,(.#*.!-/;*7#*;$("#)*7:*

95#*().$#6'#;*#%&$#''(!)*!+*11CITL B*C/9!D#95#$J*95#'#*+();()D'*'5!8*9569*,#967!/(.*(,76/6).#*()*,-'./#*

+(7#$'*!+*EF=42GHI*,(.#*('*6)*#6$/:*#"#)9B*C'*D/:.!/:9(.*,-'./#*+(7#$'*7#.!,#*&$!D$#''("#/:*-)67/#*9!*-'#*

D/-.!'#* 6'* #)#$D:* '-7'9$69#J* 95#:* '8(9.5* 9!* /(&(;* -'#* 9!*,6()96()* 6* '-++(.(#)9* 6,!-)9* !+* #)#$D:* '-&&/:B*

U)9$(D-()D/:*95('*,#.56)(',*('*'&#.(+(.*9!*D/:.!/:9(.*,-'./#*+(7#$'*6'*95#*;#$#D-/69(!)'*!7'#$"#;*()*95#*SC*

;(++#$*+$!,*9569*'##)*()*95#*!%(;69("#*+,%!-+*,-'./#B**

T#.6-'#*1=VR*6&&#6$'*9!*7#*6*M#:*6.9!$*()*95#*'8(9.5*()*+-#/*&$#+#$#).#*7:*'-&&$#''()D*D/-.!'#*-9(/(>69(!)J*

8#*-'#;*95#*56/!D#)69#;*.6$7!%:/(.*6.(;*=3CJ*6*'&#.(+(.*()5(7(9!$*!+*1=VJ*9!*$#'9!$#*D/-.!'#*,#967!/(',*

6);*,-'./#* ,#967!/(.* &/6'9(.(9:B* U);##;J*,6()96()()D* 1=W* ()* (9'* -)&5!'&5!$:/69#;* 6.9("#* +!$,*8(//* $#0

6.9("69#* 1=W* +-).9(!)* 6);* $#.!"#$* D/-.!'#*,#967!/(',* 7:* $#'9!$()D* D/-.!'#* !%(;69(!)* <Q5(9#5!-'#* 6);*

I6);/#J*4XYPAB* U)*6*,!;#/*!+* '969()0();-.#;*,-'./#*69$!&5:J*=3C* 9$#69,#)9*56'*7##)*'5!8)* 9!* ().$#6'#*

D/-.!'#*!%(;69(!)* ()* 9:&#* UU7*,-'./#* +(7#$'* 6);* $#;-.#* 95#* #%&$#''(!)*!+*,6$M#$'*!+*&$!9#()*;#D$6;69(!)*

<Z6//()'!)*!"#$%&*?@4?AB*S5('*('*()*/()#*8(95*95#*$#'-/9'*&$#'#)9#;*5#$#B*U);##;J*()*95('*'9-;:J*8#*;#,!)'9$69#*

9569*=3C*9$#69,#)9*#%#$9'*&$!9#.9("#*#++#.9'*!)*,-'./#*+(7#$'*()*95#*EF=42GHI*,(.#*7:*$#'9!$()D*95#*67(/(9:*

!+*D/:.!/:9(.*,-'./#* 9!* -'#*D/-.!'#* 6'* +-#/B*Q5#)* .!,&6$#;* 9!*)!)0=3C* 9$#69#;*EF=42GHI*,(.#J* 95!'#*

'-&&/#,#)9#;*8(95*=3C*'5!8*6*;#.$#6'#*()*95#*,I[C*#%&$#''(!)*!+*'()*J*.,/,0*6);*'1$234 *()*&6$6//#/*

8(95*6)*();-.9(!)*!+*'5)0*6);*67"2$"!#+89":$+!B*Z!$#!"#$J*=3C09$#69#;*EF=42GHI*,(.#*6/'!*56;*;#.$#6'#;*

#%&$#''(!)* !+* ;#)#$"69(!)* 6);* 69$!&5:* ,6$M#$'* 85#)* .!,&6$#;* 9!* -)9$#69#;* EF=42GHI* ,(.#B* C9* 6*

+-).9(!)6/*/#"#/J*95('*86'*$#+/#.9#;*7:*6*&$#'#$"69(!)*!+*,-'./#*'9$#)D95B*=3C*9$#69,#)9*()*EF=42GHI*,(.#*

6/'!*#%#$9#;*7#)#+(.(6/*,#967!/(.*#++#.9'*!)*95#*85!/#*!$D6)(',*7:*'9(,-/69()D*8#(D59*D6()*;-$()D*;('#6'#*

;#"#/!&,#)9J*85(.5*('*'(,(/6$*9!*8569*56'*7##)*!7'#$"#;*6+9#$*=3C*9$#69,#)9*!+*'969()0();-.#;*,:!&695:*

()* ,(.#* <Z6//()'!)* !"# $%&* ?@4?AB* U9* ('* (,&!$96)9* 9!* )!9#* 9569* =3C* 9$#69,#)9* (,&$!"#;* ,(9!.5!);$(6/*

+-).9(!)*()*EF=42GHI*,(.#*<\(D-$#*YAB*Q#*!7'#$"#;*6)*-&0$#D-/69(!)*!+*,I[C*#%&$#''(!)*!+*';6<0 *6);*

=59>&#6*12304!*96$D#9*D#)#*9569*('*()"!/"#;*()*,(9!.5!);$(6/*;:)6,(.'B*Q5(/#*=3C*56'*)!9*7##)*'5!8)*

9!* ;($#.9/:* $#D-/69#* 95#* 12304 * &69586:J* (9* 56'* 7##)* '5!8)* 9!* $#"#$'#* 95#* ()5(7(9(!)* !+* 12304 * 6);*

,(9!.5!);$(6/* 7(!D#)#'('* 9569* ('* ();-.#;* ()* ,:!9-7#'* 7:* .5$!)(.* ()5(7(9(!)* !+* D/-.!'#* !%(;69(!)* 8(95*

&:$-"69#*<15(/&*!"#$%&*?@4@AB*S5#*7#)#+(.(6/*#++#.9'*!)*,(9!.5!);$(6/*,#967!/(',*+!//!8()D*=3C*9$#69,#)9*

()*EF=42GHI*,(.#*86'*6/'!* $#+/#.9#;*7:*.!,&6$67/#* /#"#/'*!+*?1/0* ()*=3C09$#69#;*EF=42GHI*,(.#*6);*

3S0*6);*=3C09$#69#;*QS*,(.#B*3!//#.9("#/:J*95#'#*;696*'5!8*9569*$#'9!$69(!)*!+*,#967!/(.*#O-(/(7$(-,*()*

!"#$"!%&!'(!)&*+& !)&

!"#$%"#&'$()*+$",( -'.,/+( '+( 0.",( &%( 1/%&,$&()*+$",()'&%$2%34/'0( 034( 1/,5,3&( %6'40&'5,( +&/,++7(82'",( 0"+%(

1/,5,3&'3!(4,3,/50&'%3(034(0&/%12#9((

:;<(20+(1/,5'%*+"#(.,,3(*+,4( '3( &2,(=>:?@AB<()%*+,()%4,"(%-(<C=( DE'F*,"(!"#$%&( GH?GI9(J#( "')'&'3!(

1#/*50&,( &*/3%5,/( &%( "0$&0&,( 034( -0$'"'&0&'3!( &2,( ,3&/#( %-( 1#/*50&,( '3&%( &2,( K/,.+( $#$",7( :;<( /,4*$,4(

0+&/%!"'%+'+( 034( )%&%/( 3,*/%3( 4,0&2( DE'F*,"( !"# $%&( GH?GI9( L2'+( '34'$0&,+( &20&( M:K( 0$&'50&'%3( )0#( .,( 0(

$%))%3(),$203'+)('3(0+&/%$#&,+(034()*+$",9(N3&,/,+&'3!"#7(E'F*,"(034($%"",0!*,+(0"+%(4,)%3+&/0&,4(&20&(

:;<O&/,0&,4(=>:?@AB<()'$,(1/,+,3&,4(8'&2(0()0/P,4(')1/%5,),3&('3(&2,(+&/*$&*/,(%-(QER+('3(&2,(!'"!()*+#

,-.-"*+/0#%*(./)(D!"#$%"#&'$()*+$",(-'.,/I(.*&(3%&()*%!/)(D%6'40&'5,()*+$",(-'.,/I9(L0P,3(&%!,&2,/(8'&2(%*/(

40&0( +2%8'3!( 03( ,--,$&( %-(:;<( '3( /,+&%/'3!( !"#$%"#+'+( '3()*+$",7( %3,( $03( $%3$"*4,( &20&(:;<( &/,0&),3&(

,6,/&+( '&+( 1/%&,$&'5,( ,--,$&+( &2/%*!2( +&0.'"'S'3!( &2,(QER9(T%8,5,/7( .0+,4( %3( &2,( 0$&'%3( %-(:;<(%3( .%&2(

)*+$",(034(0+&/%$#&,+7(8,($033%&($%3$"*4,(82,&2,/( &2,(3%/)0"'S0&'%3(%-(!"#$%"#&'$()*+$",(),&0.%"'+)('+(

+*--'$',3&( '3( '&+,"-( &%( )0'3&0'3( &2,( 1%+'&'5,( ,--,$&( %.+,/5,4( 0&( &2,( QER9( ;%"",$&'5,"#7( &2,+,( 40&0( 1/%5'4,(

$%35'3$'3!( ,5'4,3$,( &20&( :;<( &/,0&),3&( 1/%)%&,+( &2,( *+,( %-( !"*$%+,( 0+( &2,( 1/,-,//,4( ,3,/!#( +*.+&/0&,(

D'3+&,04(%-("'1'4+I7(&2,/,.#(1/,5,3&'3!(4,3,/50&'%3(034()0'3&0'3'3!(-*3$&'%3(0&(QER9(

N3($%3$"*+'%37(%*/(+&*4#(1/%5'4,+($%)1,""'3!(,5'4,3$,(&%(+*11%/&(0(4/0)0&'$($203!,('3(!"#$%"#&'$()*+$",(

),&0.%"'+)( &20&( +1,$'-'$0""#( 0"&,/+( )*+$",( ),&0.%"'$( 1"0+&'$'&#( '3( 2'!2"#( +*+$,1&'.",( !"#$%"#&'$( -'.,/+9(

N)1%/&03&"#( &2,+,(),&0.%"'$(0"&,/0&'%3+(%$$*/(5,/#(,0/"#( '3( &2,($%*/+,(%-( &2,(4'+,0+,7(.,-%/,( &2,(%3+,&(%-(

4,3,/50&'%37( 034( 1/'%/( &%( )%&%/( 3,*/%3( 4,0&2( '3( =>:?@UVW( )'$,9( L2,+,( 40&07( '3( $%).'30&'%3( 8'&2( %*/(

+$'0&'$(3,/5,(06%&%)#(,61,/'),3&+(+*!!,+&(&20&(!"#$%"#&'$(4,-,$&+(0/,(3%&(%-(3,*/%!,3'$(%/'!'39(N)1%/&03&"#7(

+'3$,(0"&,/,4(),&0.%"'$(1"0+&'$'&#()'!2&(*34,/"',(&2,(+*+$,1&'.'"'&#(%-(!"#$%"#&'$(-'.,/+(&%(4,3,/50&'%3(82'"+&(

"')'&'3!(&2,($010$'&#(-%/()*+$",(&%(.,$%),(/,O'33,/50&,47(&2'+(8%*"4(205,(4,&/'),3&0"(,--,$&+(%3(&2,(/0&,(%-(

4'+,0+,( 1/%!/,++'%39( J#( 4,)%3+&/0&'3!( &2,( '35%"5,),3&( %-( )*"&'1",( $,""( &#1,+( '3( <C=( 10&2%"%!#( 034(

'4,3&'-#'3!( 0( 1%++'.",( $%))%3( ),&0.%"'$( &2/,04( .,&8,,3( !"#$%"#&'$( )*+$",( 034( 0+&/%!"'0( '3( <C=(

10&2%!,3,+'+7( %*/( 8%/P( -*/&2,/( ,6,)1"'-',+( &2,( $%)1",6'&#( %-( <C=9( X'30""#7( %*/( 8%/P( 20+( ')1%/&03&(

&2,/01,*&'$(')1"'$0&'%3+(0+(8,(1/,+,3&(,5'4,3$,(&%(+*!!,+&(&20&(.#(')1/%5'3!(),&0.%"'$(-*3$&'%3('3()*/'3,(

<C=(03')0"()%4,"+( &2/%*!2(:;<7( '&( '+(1%++'.",( &%( ')1/%5,()%&%/( -*3$&'%37()0'3&0'3()*+$*"0/( '3&,!/'&#(

034(4,"0#(4,3,/50&'%39(

!

"#$%&'#()!#*+!"%$,-+)!

1"2-3)#)"$"!0!("#

<""( ,61,/'),3&+( -%""%8,4( $*//,3&( Y*/%1,03( Z3'%3( /,!*"0&'%3+( D:'/,$&'5,( GH?H[VB[YZI9( L2,#( 8,/,(

011/%5,4(.#(&2,(/,!'%30"(,&2'$+($%))'&&,,(;WYEY<=(B\(*34,/(Q%9(<C[H?[GH[HA[?G(034(8,/,(1,/-%/),4(

.#(0*&2%/'S,4('35,+&'!0&%/+9(

!"#$"!%&!'(!)&*+& !%&

!"#$%&'(

!"#$%& '()*+& ,-*.*/0.*++123& '4.12*& 5678& 91:;& :;*& <=>?& '4:(:1,2&9*.*& 3*2,:@0*A& (+& A*+B.1C*A&

0.*-1,4+)@& D?100+& )*( %&+& 8EEFGH& I1)AJ:@0*& )1::*.'(:*+& 9*.*& 4+*A& (+& B,2:.,)+H& K1B*& 9*.*& ;,4+*A&12& (&

:*'0*.(:4.*J&(2A&;4'1A1:@JB,2:.,))*A&*2-1.,2'*2:&(:&LMNO&(2A&42A*.&(&8L&;,4.+&)13;:$A(.P&B@B)*H&K1B*&;(A&

(BB*++&:,&9(:*.&(2A&.*34)(.&QRS&B;,9&%,(&#-#*.$H&&

/0)12#')(3%1%,#4$'T&&U;*&9**P&C*V,.*&+:(.:123&:;*&*/0*.1'*2:W&())&(21'()+&9*.*&(BB)1'(:*A&:,&:;*&:.*(A'1))&

*/*.B1+*&DU.*(A'1))&O,2:.,)W&X*:1B(W&50(12G&C@&.422123&(:&LF&B'$+*B&91:;&(&FN&12B)12(:1,2&V,.&F&'12&V,.&M&

A(@+H&

Y2:*2+*&(2(*.,C1B&*/*.B1+*&T&(&'(/1'()&12B.*'*2:()&:*+:&9(+&B(..1*A&,4:H&U;*&12B)12*&9(+&+*:&(:&Z&8RN&(2A&

:;*&+0**A&(:&SR&B'$+&(2A&9(+&'(12:(12*A&(:& :;1+&.(:*&V,.&L&'12H&U;*&+0**A&9(+& :;*2& 12B.*(+*A&C@&M&B'$+&

*-*.@& ER& +*B& 42:1)& */;(4+:1,2& ,V& :;*& (21'()H& U;*& +0**A& (:& 9;1B;& *(B;& ',4+*& +:,00*A& .422123& 9(+&

B,2+1A*.*A&:,&C*&:;*&'(/1'()&.422123&+0**A&D"'(/G&

X,9& 12:*2+1:@& *2A4.(2B*& */*.B1+*T& U,& A*:*.'12*& '(/1'()& *2A4.(2B*& B(0(B1:@W& (& .*B:(234)(.& :*+:& 9(+&

*+:(C)1+;*AH&Q))&'1B*&.(2&(:&=R[&,V&:;*&"'(/&(::*'0:&A4.123&:;*&'(/1'()&12B.*'*2:()&:*+:H&U;*&12B)12*&9(+&

+*:& (:& Z& 8RNW& (V:*.& L'12& ,V& (BB)1'(:1,2& (:& SRB'$+W& :;*& +0**A&9(+&'(12:(12*A& (:& =R[&,V& :;*&"'(/& 42:1)&

*/;(4+:1,2H&

U;*&B.1:*.1,2&V,.&*/;(4+:1,2&9(+&(&:1'*&,V&F&+*B&+0*2:&,2&:;*&*)*B:.1B()&3.1A&91:;,4:&.422123H&#),,A&+('0)*+&

V.,'&:;*&:10&,V&:;*&:(1)&9*.*&,C:(12*A&1''*A1(:*)@&(:&:;*&*2A&,V&*/*.B1+*&:,&'*(+4.*&C),,A&)(B:(:*&4+123&(&

)(B:(:*&0.,JXU&A*-1B*&DX(B:(:*&\.,&XUJ8]8RW&Q?^?Q_`W&O;12(GH&

&

5.'2&)(41#3('*1)"4*6(

K4+B)*& 3.10& +:.*23:;&9(+&'*(+4.*A& 4+123& (& +:.*23:;&'*:*.& D#1,+*C&<.10& :*+:W& #1,+*CW& !.(2B*GH& Q21'()+&

9*.*&0)(B*A&,-*.&(&'*:())1B&3.1A& :;(:& :;*@& 12+:12B:1-*)@&3.(C& :,&+:,0& :;*& 12-,)42:(.@&C(BP9(.A&',-*'*2:&

B(..1*A&,4:&C@&:;*&'(2104)(:,.&42:1)&:;*&04))123&V,.B*&,-*.B,'*+&:;*1.&3.10&+:.*23:;H&a(B;&(21'()&9(+&04))*A&

,-*.& :;*& *2:1.*& )*23:;& ,V& :;*&'*:())1B& 3.1A& 42:1)& 1:& ),+:& 1:+& 3.10H&<.10& +:.*23:;W& */0.*++*A& 12&%*9:,2W&9(+&

.*B,.A*A&,-*.&:;.**&:.1()+&V,.&*(B;&(21'()&12&*(B;&:*+:&+*++1,2H&U;*&'(/1'()&3.10&+:.*23:;&9(+&,C:(12*A&C@&

(-*.(3123&:;*&:;.**&3.10&+:.*23:;&+B,.*+&V,.&*(B;&(21'()H&

/&)2*17$8741%368(

Q))&.*B,.A123+&9*.*&0*.V,.'*A&91:;&(&+:(2A(.A&aK<&(00(.(:4+&D7(2:*BW&X*+&b)1+W&!.(2B*G& 12&(BB,.A(2B*&

91:;& :;*& 341A*)12*+& ,V& :;*& Q'*.1B(2& Q++,B1(:1,2& ,V& a)*B:.,A1(32,+1+& K*A1B12*& DQQaKGH& K1B*& 9*.*&

(2*+:;*:1c*A&91:;&8RR&'3$P3&P*:('12*&B;),.;@A.(:*&(2A&F'3$P3&/@)(c12*&(2A&'(12:(12*A&(:&M>NO&,-*.&(&

:;*.',+:(:1B& C)(2P*:H& Y2& ,.A*.& :,& '121'1c*& -(.1(C1)1:@W& ())& .*B,.A123+& 9*.*& 0*.V,.'*A& C@& :;*& +('*&

*/0*.1'*2:*.H& ?*B,.A123+& 9*.*& ',21:,.*A& V,.& L'12& 91:;& (& B,2B*2:.1B& 2**A)*& *)*B:.,A*& DER8M5RR88W&

A1('*:*.&RHM''W&K*A:.,21BW&b5QG&12+*.:*A&12:,&:;*&4%'*172")$#.'&'4+B)*H&Q&',2,0,)(.&2**A)*&*)*B:.,A*&

DER8M?RM8LW&A1('*:*.& RHM''W&K*A:.,21BG&9(+& 12+*.:*A& 12:,& :;*& :(1)& ,V& :;*&',4+*& :,&3.,42A& :;*& +@+:*'H&

!"#$"!%&!'(!)&*+& !$&

!"#$%&'()*+ *,$-'()+ .$/0(12%3+ 2#1'.'13+ -"%"+ &'*#2%&"&4+ 56$(12("$0*+ 2#1'.'13+ 782'(/3+ 9':%'//21'$(*;+

#,2%2#1"%'*1'#+$9+80*#/"+&"("%.21'$(+-2*+&'99"%"(1'21"&+ 9%$8+.$/0(12%3+2#1'.'13+ 7%")0/2%+&'*#,2%)"*+-,'#,+

&'*266"2%+-'1,+80*#0/2%+%"/2<21'$(;+:3+.'*02/+2(&+20&'1$%3+'(*6"#1'$(4+56$(12("$0*+2#1'.'13+-'1,+2+6"2=>1$>

6"2=+286/'10&"+$9+21+/"2*1+?@ A+-2*+#$(*'&"%"&+1$+:"+*')('9'#2(14++

!"#$%&'()%"'*+,$'()'&)(+,-(.,&#".,()%"'*+,$'()'&)(

B2/"+1%2(*)"('#+2(&+($(>1%2(*)"('#+8'#"+-"%"+92*1"&+9$%+CD+,$0%*+7*12%1'()+21+E+FB;+6%'$%+1$+1,"+)/0#$*"+

1$/"%2(#"+1"*1+7GHH;I+$%+92*1"&+9$%+J+,$0%*+7*12%1'()+21+KLB;+6%'$%+1$+1,"+'(*0/'(+1$/"%2(#"+1"*1+7MHH;4+N/$$&+

)/0#$*"+/"."/*+-"%"+".2/021"&+0*'()+2+#$88"%#'2/+O%""513/"+F26'//$(+M(*0P'(<+)/0#$8"1"%+7L::$1I+O%2(#";4+

N/$$&+-2*+&%2-(+9%$8+2+*82//+'(#'*'$(+21+1,"+1'6+$9+1,"+12'/4+O$%+GHH*I+'('1'2/+:/$$&+)/0#$*"+-2*+8"2*0%"&+

6%'$%+ 1$+ 2(+ MF+ '(Q"#1'$(+ $9+ R)S=)+:$&3+82**+ $9+ )/0#$*"4+ O$%+ MHH*I+ '(*0/'(+ 9%$8+:$.'("+ 62(#%"2*+ 75')82+

L/&%'#,I+T5L;+-2*+'(Q"#1"&+MF+7@4?TS=)+:$&3+82**;+291"%+'('1'2/+:/$$&+)/0#$*"+-2*+8"2*0%"&4+U,2()"*+'(+

:/$$&+)/0#$*"+-2*+9$//$-"&+9$%+CR@+8'(01"*+-'1,+8"2*0%"8"(1*+12="(+"."%3+C?+8'(01"*+9$%+:$1,+GHH*+2(&+

MHH*4+O$%+"2#,+8'#"I+:/$$&+)/0#$*"+-2*+"<6%"**"&+2*+1,"+6"%#"(12)"+$9+'('1'2/+:/$$&+)/0#$*"+#$(#"(1%21'$(+

7H@;4+

/0%)%12(

L<$1$83+ $9+ 1,"+ *#'21'#+ ("%."+ -2*+ 6"%9$%8"&+ $(+ ($(>1%2(*)"('#+ 82/"*4+ B'#"+ -"%"+ 2("*1,"1'V"&+ :3+

'(1%26"%'1$("2/+7MF;+'(Q"#1'$(+$9+C@@+8)S=)+="128'("+#,/$%,3&%21"+2(&+?8)S=)+<3/2V'("4+H,"+*#'21'#+("%."+

-2*+"<6$*"&+21+8'&+1,'),+/"."/+2(&+*"#1'$("&+0*'()+8'#%$*#'**$%*4+H,"+*='(+'(#'*'$(+-2*+*010%"&I+2(&+8'#"+

-"%"+2//$-"&+1$+%"#$."%4+U$(1%2/21"%2/+,'(&+/'8:*+*"%."&+2*+($(>2<$1$8'V"&+#$(1%$/*4+B'#"+-"%"+*2#%'9'#"&+

:3+/"1,2/+'(Q"#1'$(+$9+6"(1$:2%:'12/+21+R+-""=+9$//$-'()+1,"+*0%)'#2/+'(1"%."(1'$(4+

3.$4"%*%+$')+)'()*'+)1',)(

H,"+6,2%82#$/$)'#2/+1%"218"(1+#$(*'*1"&+'(+&2'/3+2&8'('*1%21'$(+$9+W'#,/$%$2#"121"+7WULI+5')82+L/&%'#,;+

'(+&%'(='()+-21"%+21+2+#$(#"(1%21'$(+#$%%"*6$(&'()+1$+2+&2'/3+&$*"+$9+?@@8)S=)+:$&3+82**+2*+6%".'$0*/3+

&"*#%':"&+ 7B'X0"/+ ')( +"5+ R@CR;4+ H,"+ #$(#"(1%21'$(+ -2*+ #2/#0/21"&+ :2*"&+ $(+ 2+ 6%"&'#1"&+ -21"%+ '(12="+ $9+

?8/S&23S2('82/+7N2#,82($9+')(+"5+R@@R;4+Y21"%+'(12="+-2*+#2%"90//3+8$('1$%"&+1,%$0),$01+1,"+&0%21'$(+$9+

1,"+"<6"%'8"(14+512(&2%&+&%'(='()+-21"%+-2*+0*"&+2*+#$(1%$/+7UH;4+B$0*"+-"'),1*+-"%"+8$('1$%"&+-""=/34+

6#+,).)+).7'(89:;<8(

O%$V"(+80*#/"+*286/"*+-"%"+,$8$)"('V"&+'(+C8/SC@@8)+1'**0"+H%'V$/+%"2)"(1+7M(.'1%$)"(I+T5L;+1$)"1,"%+

-'1,+ 2+ *12'(/"**+ :"2&4+ H-$+ Z8'(+ ,$8$)"('V21'$(+ #3#/"*+ -"%"+ 6"%9$%8"&+ '(+ 2+ H'**0"P3*"%+ 7['2)"(I+

G"%82(3;+21+Z@\V4+!]L+-2*+"<1%2#1"&+0*'()+#,/$%$9$%8S'*$6%$63/+2/#$,$/S"1,2($/+2(&+*1$%"&+21+>D@^U4+C

)+ $9+ 1$12/+ !]L+-2*+ 0*"&+ 1$+ *3(1,"*'V"+ #W]L+ 0*'()+ M*#%'61+ %"."%*"+ 1%2(*#%'612*"+ 7N'$!2&I+T5L;+ 2(&+

$/')$>&H+ 6%'8"%+ 2*+ *6"#'9'"&+ :3+ 1,"+82(092#10%"%4+ G"("+ "<6%"**'$(+-2*+8"2*0%"&+ 0*'()+ 1,"+ R_+ 5`N!+

)%""(+5*$L&. !"#$% &# '#!(% )*+,- $.% "",&$+!'% (,% (/#%0 !12 "(1&#&34% +!4(&1"(+,!4%,!% %*+,- $% +56"7#&8%

!"#$"!%&!'(!)&*+& !,&

!"#$%&'$()*+,*-).$/0.)*$,(12-23).$4,0.212,0'$&'$+,55,%'6$789"$.)0&1/*&12,0$+,*$:;')4<$+,55,%).$=>$?;$

4>45)'$,+$@;')4$&1$789"$&0.$:;')4$&1$A;9"B$CD)$)E1)0.).$52'1$,+$(*2-)*'$FG/*,H)01)4<$I)5H2/-J$2'$(*,K2.).$

20$C&=5)$L@B$#)5&12K)$M/&012+24&12,0$%&'$&4D2)K).$=>$4&54/5&120H$1D)$*&12,$=)1%))0$1D)$4>45)$0/-=)*$F"1J$&1$

%D24D$'2H0&5$4*,'').$&$1D*)'D,5.$')1$%21D20$1D)$5,H&*21D-24$(D&')$,+$ 1D)$H)0)$,+$ 201)*)'1$&0.$1D&1$,+$CI!$

D,/')N))(20H$H)0)B$"1$K&5/)'$%)*)$-)&0'$,+$./(524&1)'B$$

!"#$%&'&(#%&)$*)'*+&%)(,)$-.&#/*012*

L0&($+*,3)0$12''/)$%&'$.2H)'1).$20$OCC$=/++)*$FC*2'$@;-P$(Q$7<$C*21,0$R@;;$;B@S<$O"5$8;-PJ$%21D$TS$

(*,1)20&')$O$FL2H-&$U5.*24DJ$,K)*02HD1$&1$8?9"$/0.)*$4,0'1&01$&H21&12,0B$!*,1)20&')$O$%&'$20&412K&1).$&1$

@;;9"$ +,*$ 8$ -20/1)'B$ #VU$ %&'$ .)H*&.).$ %21D$ ;B: HW 5$ #VU&')$ +,*$ @D$ &1$ :X9"B$ C,1&5$ YVU$ %&'$

)E1*&41).$/'20H$&$-2E$,+$#,12Z!D)0,5$*)&H)01$F#,1D<$[LUJ<$4D5,*,+,*-$&0.$2',&->5&54,D,5$FT8WT?W@JB$YVU$

%&'$M/&012+2).$/'20H$#CZM!"#$F20212&5$.)0&1/*&12,0$'1)($&1$7\9"$+,*$T-20<$+,55,%).$=>$?;$4>45)'$,+$@;')4$

&1$ 7\9"$ &0.$ T;')4$ &1$ AT9"JB$ CD)$ +,55,%20H$ (&2*'$ ,+$ (*2-)*'$%)*)$ /').$ +,*$ 0/45)&*$YVU$ M/&012+24&12,0$

! "#$%&"&'()*(+#,-.,/(01Z"C]Z]CCZ]"]Z]UCZ]]CZ]]CZCUZ21(.'/(,343,53(01Z"CCZ"""ZUUUZ]U"Z

"U"ZUC]Z"CZ216( 7%3( +#""#-&'8( $.&,5( #+( $,&93,5( -3,3( :53/( +#,(9&;# %#'/,&."( <#=>*( +#,-.,/( 01ZC""Z

U"CZUCCZC]CZ"C]ZUC"Z"]CZU"CZ21( .'/( ,343,53( 01ZU]CZU]CZUCUZ]CUZUC]Z""CZ]"]Z]"CZ

UZ216(7%3(,3".;&43(9;?@)("343"5(-3,3( ." :".;3/(A!('#,9."&B&'8(;%3(,3".;&K)$)E(*)''2,0$,+$-21,4D,0.*2&5$

",E@$1,$1D)$*)5&12K)$)E(*)''2,0$,+$1D)$0/45)&*$">45,(D2520$UB$

345%4.$*6/)%%&$7*

L0&($+*,3)0$-/'45)$ 12''/)$%&'$(/5K)*23).$ 20$&$C2''/)^>')*$ F_2&H)0J$ +,*$T$E$T;')4$/0.)*$ 52M/2.$021*,H)0$

/'20H$ '1&205)''$ '1))5$ =)&.'B$ C2''/)$ (,%.)*$ %&'$ D,-,H)023).$ 20$ #`!U$ 5>'2'$ =/++)*$ F8;-P$C*2'$ (Q$ XB?<$

@8;-P$V&"5<$ @-P$ GYCU<$ @S$ C*21,0$ @;;R<$ ;B@S$ LYL<$ ;B8S$ L,.2/-$ Y),E>4D,5&1)J$ &1$ @-5W@;;-H$

12''/)$4,01&2020H$@6@;;$(*,1)&')$20D2=21,*$4,4N1&25$F"&5=2,4D)-<$[LUJ$&0.$(D,'(D&1&')$20D2=21,*$4,4N1&25$T$

&0.$ :$ FL2H-&$U5.*24D<$])*-&0>JB$Y)1)*-20&12,0$ ,+$ (*,1)20$ 4,04)01*&12,0$%&'$ 4&**2).$ ,/1$ /'20H$ &$I"U$

U''&>$#)&H)01$O21$ F[!78?T?$[(12-&<$ a*&04)JB$ !*,1)20$%&'$ .)0&1/*&1).$ =>$ =,2520H<$ *)',5K).$ =>$ ',.2/-$

.,.)4>5$ '/5+&1)C(,5>&4*>5&-2.)$ H)5$ )5)41*,(D,*)'2'$ &0.$ 1*&0'+)**).$ 1,$ T -$ 021*,4)55/5,')$ -)-=*&0)'$

FI2,#&.<$ a*&04)J$ /'20H$ &$ ')-2Z.*>$ C*&0'=5,1$ C/*=,$ '>'1)-$ FI2,#&.<$ a*&04)JB$ U+1)*$ /'20H$ &$

4D)-25/-20)'4)01$ =5,4N)*$ FP2552(,*)<$ a*&04)J<$-)-=*&0)'$%)*)$ (*,=).$%21D$ (*2-&*>$ &012=,.2)'$ &H&20'1$

]5>4,H)0$L>01D&')$#&==21$-U=$F:\\A<$")55$L2H0&520H<$[LUJ<$!D,'(D,Z]5>4,H)0$L>01D&')$L)*A?@$F:\7@<$

")55$ L2H0&520H<$ [LUJ<$ !]"@! $ FUI:T?T<$ P2552(,*)<$ a*&04)J$ &0.$ 1,1&5$ &4120$ FUT@;:<$ L2H-&$ U5.*24D<$

a*&04)JB$!*2-&*>$&012=,.2)'$%)*)$.)1)41).$%21D$&012Z*&==21$Q#!$FI`T?;X<$!BUB#B`BL<$a*&04)JB$CD)$(*,1)20$

=&0.'$ %)*)$ .)1)41).$ =>$ 4D)-25/-20)'4)04)$ /'20H$ G"^$ ^/-20&$ a,*1)$ FP2552(,*)<$ a*&04)J$ &0.$ &$

4D)-25/-20)'4)04)$.)1)41,*$FI2,Z#&.<$a*&04)JB*

8,)59,)'."(%):&$#54*4$;<+#%&(*#(%&=&%<*

!"#$"!%&!'(!)&*+& !,&

!"#$%&"'()*&'+,$+-+,./&/0$*&')$1)#)$/+'#&2&')3$+-3$4&//5)/$1)#)$65&'7,.$3&//)'4)30$2#"8)-$&-$,&65&3$-&4#"9)-$

!"#$%&'("# %#)*+,-#.!%/0#.$(1$:,,$'()*&'+,/$1)#)$;5#'(+/)3$2#"*$<=>?:@$!#"8)-$!"#"$%"&'$(!)*"+*$*5/',)/$

1)#)$;5,A)#&8)3$1&4($+$*"#4+#$+-3$;)/4,)$5-3)#$,&65&3$-&4#"9)-@$B()$;"13)#$1+/$#)/5/;)-3)3$&-$C$A",5*)/$

D1EAF$"2$)G4#+'4&"-$%522)#$'"-4+&-&-9$HI*?$B#&/JKL,$;KM@C0$I@NC?$O+L,$+-3$P#"4)+/)$=-(&%&4"#$L"'74+&,$

DL+,%&"'()*0$Q<:F@$<+*;,)/$1)#)$("*"9)-&8)3$%.$A"#4)G&-9$2"#$R*&-$;#&"#$ 4"$ &-'5%+4&"-$2"#$NI*&-$"-$

#",,)#$ +4$ #""*$ 4)*;)#+45#)@$ :24)#$ +$ 2&-+,$ ("*"9)-&8+4&"-$ %.$ A"#4)G&-9$ 2"#$ H*&-0$ /+*;,)/$ 5-3)#1)-4$

')-4#&259+4&"-$ 2"#$NC*&-$ +4$ NIIII9$ +4$ STL@$B()$ /5;)#-+4+-4$1+/$5/)3$ 2"#$ 4()$ +//+.$"2$P!U$+'4&A&4.$ +-3$

3)4)#*&-+4&"-$"2$;#"4)&-$'"-')-4#+4&"-$+/$3)/'#&%)3$+%"A)@$

P!U$+'4&A&4.$1+/$3)4)#*&-)3$+4$HCTL$&-$VWJ1),,$*&'#";,+4)/$&-$+$4"4+,$A",5*)$"2$HSI ,@$:-$+,&65"4$DNI

,F$"2$4&//5)$)G4#+'4$1+/$+33)3$4"$HII ,$"2$#)+'4&"-$'"'74+&,$/",54&"-$DCI*?$B#&/JKL,$;KX@I0$R*?$?9L,H$0$

R*?$ YBB0$ I@N*?$ Z>B:0$ I@R*?$ O:YK0$ H*?$ !#5'4"/)JWJ;("/;(+4)0$ NI=Q$ :,3",+/)0$ XI=Q$ B#&"/)$

;("/;(+4)$&/"*)#+/)0$NS=Q$>,.')#",JRJ;("/;("3)/(.3#"9)-+/)$+-3$NI ,$"2$3&/4&,,)3$1+4)#@$B()$#)+'4&"-$

1+/$/4+#4)3$1&4($4()$+33&4&"-$"2$HI ,$"2$NI*?$:BP@$P!U$+'4&A&4.$1+/$*)+/5#)3$)A)#.$*&-54)$"A)#$HI*&-$

+-3$'+,'5,+4)3$2#"*$4()$,&-)+#$#+4)$"2$'(+-9)$&-$+%/"#%+-')$+4$RSI-*$DB#&/4+#$[\$VSN$+;;+#+45/0$\)#4(",3$

B)'(-","9&)/0$>)#*+-.F@$L+,'5,+4&"-/$1)#)$%+/)3$"-$4()$)G4&-'4&"-$'")22&'&)-4$"2$W@HHGNIJR?$2"#$O:YK$

+-3$'"##)'4)3$%.$4()$A",5*)$"2$4()$/+*;,)$+33)30$4"$"%4+&-$-*",$"2$O:YK$"G&3&8)3E*&-E ,$"2$/+*;,)@$:/$

"-)$*",)$"2$O:YK$'"##)/;"-3/$4"$"-)$*",)$"2$P!U0$4()$+'4&A&4.$"2$P!U$1+/$'+,'5,+4)3$2"#$)+'($/+*;,)$

#),+4&A)$4"$4()$;#"4)&-$'"-')-4#+4&"-$"2$)+'($/+*;,)@'

,(!)*-)."$*/'-)!$#+%"!)&'''

:,,$ &-4)#*)3&+#.$*)4+%",&4)/$ +-+,.8)3$1)#)$ )G4#+'4)3$ 2#"*$ 2#)/($ /-+;J2#"8)-$ 4&//5)@$ ]5+-4&2&'+4&"-$1+/$

;)#2"#*)3$ 5/&-9$ '"**)#'&+,$ '","#&*)4#&'$ +//+./$ 2"#$ ;.#5A+4)$ DUWIVJNII$\&"^&/&"-0$Q<:F$:BP$ DURCSJ

NII$\&"^&/&"-0$Q<:F0$+-3$O:Y_$+-3$O:YK$D+%WCRSX$:%'+*0$QUF@$<+*;,)/$1)#)$3);#"4)&-&8)3$5/&-9$

NI7Y+$'54"22$ /;&-$ 2&,4)#/$ D+%VRRSV$:%'+*0$QUF$+-3$+//+./$1)#)$;)#2"#*)3$+''"#3&-9$ 4"$*+-52+'45#)#`/$

&-/4#5'4&"-/@$ B()$ ";4&'+,$ 3)-/&4&)/$ 2"#$ +,,$ +//+./$1)#)$ "%4+&-)3$ 5/&-9$ +$ B#&/4+#$ [\$ VSN$*5,4&*"3)$ ;,+4)$

#)+3)#$D\)#4(",3$B)'(-","9&)/0$!#+-')F0$+-3$#+1$'"-')-4#+4&"-$A+,5)/$1)#)$'+,'5,+4)3$+/$&-3&'+4)3$%.$4()$

*+-52+'45#)#@$$

0"&!+12)-"&!*/'

>,.'"9)-$3);"/&4&"-$&-$*5/',)$%&";/&)/$1+/$3)4)#*&-)3$5/&-9$4()$/4+-3+#3$;)#&"3&'$+'&3J/'(&22$DP:<F$/4+&-$

B#+-/A)#/)$ DNI *F$B:$ /)'4&"-/$1)#)$ "%4+&-)3$ 2#"*$ /-+;$ 2#"8)-$ 4&//5)$ )*%)33)3$ &-$B&//5)B)7$a@L@B@$

'"*;"5-3$D<+75#+0$b+;+-F$"-$+$'#."/4+4$D[)&'+$L?$RICI<0$>)#*+-.F$+4$JHSTL@$!#)/(,.$'54$/)'4&"-/$1)#)$

%#&)2,.$ 3#&)3$ +4$ RMTL$ 2"#$ RI*&-@$ <)'4&"-/$ 1)#)$ 4()-$ &-'5%+4)3$ 2"#$ NI*&-$ &-$ P)#&"3&'$ :'&3$ Nc$ Dd"4(0$

2('3 !456#7&00&8("#94#:+3/!#/!#;<=/77#>( ?(!%#@>&%=6#2('3 !45#A'/&'#%&# #B3/!#<&.!%('$% /!#/!#C 4('D$#

/",54&"-$ Dd"4(0$ >)#*+-.F@$ :24)#$ 4("#"59($ 1+/(&-90$ /,&3)/$ 1)#)$ 3)(.3#+4)3$ 1&4($ /5'')//&A)$ +,'"(",$ E$

4",5)-)$ %+4(/$ +-3$ *"5-4)3$ &-$ d"4&JK&/4"7&44$ Dd"4(0$ >)#*+-.F@$ ?&'#";("4"9#+;(/$ 1)#)$ "%4+&-)3$ +4$ +$

!"#$"!%&!'(!)&*+& !,&

!"#$%&%'"(%)$*)&*+,--*./%0)$1*23"$'456*7)8$(9*:434*;43&)3!4<*89%$#*/"(%)$"=*>$9(%(8(49*)&*?4"=(@*>ABCD*

E439%)$*,6FG*9)&(:"34*.HIB56*

!"#"$%"$&#'(#)#'*%$%(

H$=499* )(@43:%94* %$<%'"(4<1* <"("* "34* 4J;34994<* "9* (@4* !4"$* K* IDA6* LM>IA* E439%)$* N6-"* 9)&(:"34*

.C3";@L"<1*HIB5*:"9* 894<* &)3* 9("(%9(%'"=* "$"=O9%96* P49(9* "34* %$<%'"(4<* %$* (@4* =4#4$<9* 8$<43* (@4* &%#83496*

Q%&&434$'49*:%(@*+R !"#$%&'&()(*&+$,$&-./%01$,$1&%02/030-!/4)*

*

!"#$%&'(%)#&*+"#*%),'

SL* TU* TLS* "$<* 2M* ')$'4%E4<* "$<* <49%#$4<* (@4* 4J;43%!4$(9* "$<* %$(43;34(4<* <"("V* SL1*BW1*BX* "$<*IC*

;43&)3!4<* (@4* 4J;43%!4$(9V*SL1*BW1*IC1*BSY1* TU1*IP/1* TLS*"$<*2M*'"33%4<*)8(* (@4*<"("* "$"=O9%96*SL1*

IP/1*TLS*"$<*2M*:3)(4*(@4*!"$89'3%;(6*

-").*)/'

P@%9* :)30* :"9* 98;;)3(4<* ZO* &8$<9* &3)!* *56%%.-0!40./& 7.#,& "!& 8$-9$,-9$& %#,& "!& :-";,.%$& <!4;,!"$&

6=>.4,.790?#$& $4& !#4,$%& @!"!10$%& 1#& @.4./$#,./$A* .2M51* [B99)'%"(%)$* ;)83* ="* 34'@43'@4* 4(* =4*

<\E4=);;4!4$(*<4*!)O4$9*<4* =8((4* ')$(34* =49*!"="<%49*$483)<\#\$\3"(%E49[* .BMDAB/D5*.T6L6S65*B$<3\*

7)!Z"(* ="* ISB* .H,,,]* >/IDMA5* "$<* D83)!)()3* .H,,,]* >/IDMA56* SL*0%& 2,!/4$1& B>& 56%%.-0!40./&

C,!/D!0%$& 1$& "#44$& -./4,$& "$%& @>.7!490$%A*"$<* BX* %9* #3"$(4<* ZO* [M4#%)$* B=9"'4[* "$<* >/IDMA6* IP/*

"'0$):=4<#49* (@4* 98;;)3(* )&* "$* A)()3* /483)$4* Q%94"94* M494"3'@* >$9(%(8(4* )&* B89(3"=%"* Y%==* C)=4*

24==):9@%;1*P@4*H$%E439%(O*)&*^844$9="$<1*"$<*P@4*B89(3"=%"$*B'"<4!O*)&*I'%4$'46*P@4*&8$<439*@"<*$)*

3)=4*%$*9(8<O*<49%#$1*<"("*')==4'(%)$*"$<*"$"=O9%91*<4'%9%)$*()*;8Z=%9@1*)3*;34;"3"(%)$*)&*(@4*!"$89'3%;(6*

!(0)%123./343)#,'

_4*(@"$0*B$$%4*L%''@%$4$$"*"$<*A"3%4*T)9\*M8%E)*&)3*4J'4==4$(*(4'@$%'"=*"99%9("$'46*_4*"34*"=9)*%$<4Z(4<*

()*Q396*2=)3%"$4* >!@)&&R_@%(4* "$<*Y"9(%4$*23%'043* &)3* (@4%3* "%<*:%(@*;"3(*)&* (@4* %$%(%"=*I`Q,C]FM*!)894*

4J;43%!4$(96( (

!"#$"!%&!'(!)&*+& !,&

!"#$%&%#'$#(%)&*+#,$

%'-.)#/$

!"#$%&$'()*+ ,-%.&-,+ /*,.&$/)/+ )/+ %(.+ "$/%+ *$""$0+ -12,%+ "$%$&+ 0.2&$0+ 1)/$&1.&+ *(-&-*%.&)3.1+ 4#+ "$%$&+

0.2&$0+1.-%(+-01+"2/*2,-&+-%&$'(#5+6()*(+2,%)"-%.,#+,.-1/+%$+1.-%(7+8$+1-%.+%(.&.+)/+0$+.99)*).0%+%(.&-'#+

9$&+ %()/+ 9-%-,+ 1)/.-/.7+ :2/*,.+ 1.0.&;-%)$0+ )0+ 1)/.-/.+ '&$<&.//)$0+ /.."/+ %$+ 4.+ -+ 1#0-")*+ '&$*.//+ $9+

1.0.&;-%)$0+ -01+ &.)00.&;-%)$0+ %(-%+ )/+ 1)99.&.0%+ 9$&+ %(.+ 1)99.&.0%+ "2/*,.+ 9)4.&/+ %#'./5+ 6)%(+ %(.+ <,#*$,#%)*+

"2/*,.+ 9)4.&/+ 4.)0<+ %(.+ 9)&/%+ -99.*%.17+ :$&.$;.&5+ -/+ )/+ %(.+ *-/.+ 9$&+ $%(.&+ '-%($,$<)*-,+ *$01)%)$0/+

-**$"'-0).1+ 4#+ "2/*,.+ -%&$'(#5+ %(.+ /.;.&)%#+ $9+ -%&$'(#+ /.."/+ %$+ 4.+ .=-*.&4-%.1+ )0+ <,#*$,#%)*+ "2/*,.+

9)4.&/7+ >0+ %(.+ '&./.0%+ 6$&?+6.+ )0;./%)<-%.1+ %(.+ '$%.0%)-,+ ".*(-0)/"/+ )0;$,;.1+ )0+ %()/+ /.0/)%);)%#+ $9+ %(.+

<,#*$,#%)*+9)4.&/+)0+-+"$2/.+"$1.,+9$&+!@A7+

'#01)!0$!

8(.+"$/%+)"'$&%-0%+9)01)0</+$9+$2&+/%21#+)0+%()/+0.2&$"2/*2,-&+1)/.-/.+)/+-0+)0*&.-/.+)0+.012&-0*.+*-'-*)%#+

12&)0<+'&$,$0<.1+$=)1-%);.+.=.&*)/.+-//$*)-%.1+6)%(+-+/6)%*(+)0+92.,+'&.9.&.0*.+)0+<,#*$,#%)*+"2/*,.+9)4.&/+

%$6-&1/+ ,)')1+ $=)1-%)$05+ '&)$&+ %$+ "$%$&+ /#"'%$"/+ -01+ 1.0.&;-%)$07+ 8(.+ )0*&.-/.1+ .='&.//)$0+ $9+ <.0./+

)0;$,;.1+ )0+ ,)')1+ (-01,)0<+ )/+ -**$"'-0).1+ 4#+ -+ 1.*&.-/.+ )0+ .='&.//)$0+ -01+ -*%);)%#+ $9+ BCDE5+ %(.+ &-%.F

,)")%)0<+.03#".+$9+<,#*$,#/)/7+G,#*$,#/)/+ )0()4)%)$0+ )/+-+4$%%$"F%$F%$'+'&$*.//5+$&*(./%&-%.1+4#+BHDI5+-+

")%$*($01&)-,+.03#".+%(-%+4,$*?/+%(.+.0%&#+$9+'#&2;-%.5+%(.+.01F'&$12*%+$9+<,#*$,#/)/5+)0%$+%(.+8J!+*#*,.7+

8(.+)0*&.-/.+)0+,)')1+2/.+)/+0$%+-**$"'-0).1+4#+-0+)0*&.-/.+)0+")%$*($01&)-,+4)$<.0./)/5+42%+(-/+1.,.%.&)$2/+

.99.*%/+$0+")%$*($01&)-+-01+)/+-//$*)-%.1+6)%(+)0*&.-/.1+$=)1-%);.+/%&.//7+K.+92&%(.&+/($6+%(-%+)%+)/+'$//)4,.+

%$+'(-&"-*$,$<)*-,,#+"$12,-%.+%()/+'-%(6-#+-01+&./%$&.+".%-4$,)*+.L2),)4&)2"7+M#+1$)0<+/$+6.+6.&.+-4,.+

%$+'&.;.0%+1.0.&;-%)$0+-01+"2/*2,-&+-%&$'(#+-01+)"'&$;.+".%-4$,)*+'&$9),.+)0+$2&+!@A+"$2/.+"$1.,7++

*/%&2!$

K.+/($6+9$&+ %(.+ 9)&/%+ %)".+ %(-%+"2/*,.+ %)//2.+ /299.&/+".%-4$,)*+-,%.&-%)$0/+.-&,#+ )0+ %(.+*$2&/.+$9+1)/.-/.+

1.;.,$'".0%5+ -,%.&-%)$0/+ %(-%+ )09,2.0*.+ %(.+ *$2&/.+ $9+ %(.+ '-%($,$<#7+ 8(./.+ -,%.&-%)$0/+ -&.+ /'.*)9)*+ %$+

<,#*$,#%)*+ "2/*,.+ 9)4.&/+ -01+ %(.&.9$&.+ *-0+ .=',-)0+ %(.+ /.0/)%);)%#+ $9+ <,#*$,#%)*+ 9)4.&/+ %$+ -%&$'(#+ -01+

1.0.&;-%)$07+ M#+ .=',$&)0<+ %()/+ ".*(-0)/"+ 6.+ ')0'$)0%+ %(.+ "$,.*2,-&+ *$"'$0.0%/+ )0;$,;.1+ )0+ %(./.+

"$1)9)*-%)$0/+-01+6.+)1.0%)9#+-+'$%.0%)-,+%(.&-'.2%)*+%-&<.%+)0+%()/+'-%(6-#7+

!"#$"!%&!'(!)&*+& #'&

!"!#"$%&'()*+

',-./0'/..1+ 2+ 345567+ &.89/:;<=>+ =?+ @:;;A+ 'B<-+ $C<-:;<=>+ ,A+ 'B.;A/0D='+ %.>.E:;.-+ ?E=1+ %/9B=F.+

G;</<H:;<=>+<>+"F=/:;.-+IA=BA;.FJ+!"#$%"&'%%"&()*+$%+,-K+LMN LOOJ+

'>-.EF.>+ (I+ :>-+ '/0DP:/:,<+ '+ 3MQ447+ D/<><B:/+ 8.>.;<BF+ =?+ :1A=;E=RP<B+ /:;.E:/+ FB/.E=F<FK+ SP:;+ -=+ S.+

E.://A+T>=SU+.(/"0'1".'2)$%+3K+6QO 64NJ+

';T<>+VWX++2B=;;+&#X+Y.F;+VIX+#=R.F+ZX+[9:P+'\X+DP..1:+22+3MQQN7+(E=R.E;<.F+=?+F/=S0+:>-+?:F;0;S<;BP+

19FB/.+?<,E.F+<>+:+1=9F.+1=-./+=?+:1A=;E=RP<B+/:;.E:/+FB/.E=F<FJ+.'2)$42562%"7+5$)*"4NK+O]] OLLJ+

!:BP1:>=^+''X+&..-+W&X+!.:9BP:1R+%\X+_=E-=??+I%+3MQQM7+@==-+<>;:T.X+S:;.E+<>;:T.X+:>-+-E<>T<>8+

FR=9;+F<-.+RE.?.E.>B.+=?+ML+1=9F.+F;E:<>FJ+8'9(1":';'/+OM367K`ON0`OJ+

!:FF./0W9,A+&X+$/F=>+Za+3MQQ67+2<8>:/<>8+R:;PS:AF+ <>+FT./.;:/+19FB/.+ E.1=-./<>8J+<;;2"0'1"8+$69'4+]NK45 O]J+

!=<//b.+2X+*:1:>:T:+\X+#=,F<8.E+D2X+D=R./:>-+a%X+V.>T<>F+a'X+\:FF<=;<F+%X+\=//<:F+%X+D/.^./:>-+WY+

3MQQ67+$>F.;+:>-+RE=8E.FF<=>+<>+<>P.E<;.-+'#2+-.;.E1<>.-+,A+1=;=E+>.9E=>F+:>-+1<BE=8/<:J+=6+';6'+O4MK+

4OL5 4O5MJ+

!=>>:E-+ DX+ W9E:>-+ 'X+ (.AE=/+ 2X+ DP:>F.:91.ZX+ DP:9^<>+ I'X+ I=E<=+ !X+ c<-:/+ )X+ &<.9FF.;+ V+ 3MQQL7+

I<;=BP=>-E<:/+ -AF?9>B;<=>+ E.F9/;F+ ?E=1+ =C<-:;<^.+ F;E.FF+ <>+ ;P.+ FT./.;:/+ 19FB/.+ =?+ -<.;0<>-9B.-+ <>F9/<>0

E.F<F;:>;+1<B.J+!"&%+;">;1'5/+44LK+]L5 LQQJ+

!=9;./=9R+ DX+ W.FR=E;+ VDX+ D/:^./=9+ (X+ %9A+ aX+ W.E91.:9C0!9E./+ )X+ @.EE<.E+ 'X+ D=9E:;<.E+ (+ 3MQQ57+

)AR.E1.;:,=/<F1+<>+'#2+R:;<.>;FK+:>+.:E/A+:>-+R.EF<F;.>;+RP.>=1.>=>J+!".'2)$%+MN6K+4MO6 4M`MJ+

!=ST.E0\<>/.A+IIX+W:^<F+Y"X+Y9+(X+):EE<F+&'X+(=R=^+\I+ 3455L7+Z^<-.>B.+ ?=E+ .C<F;.>B.+ =?+ ;<FF9.0

FR.B<?<B+E.89/:;<=>+=?+;P.+1:11:/<:>+RAE9^:;.+-.PA-E=8.>:F.+B=1R/.CJ+8+$69'4"!"OM5K45406J+

DP.>+ 2X+ 2:A:>:+ (X+ dP:>8+ eX+ #.+Y+ 3MQ4O7J+ %.>.;<BF+ =?+ :1A=;E=RP<B+ /:;.E:/+ FB/.E=F<FK+ :>+ 9R-:;.J+#$%"

.'2)$*'?';')+LK+MLJ+

D=>F;:,/.+ 2)X+ @:^<.E+ &VX+ IB#:>.+ V'X+ @.//+ &WX+ DP.>+ IX+ )=//=FHA+ V$+ 345L]7+ Z>.E8A+ 1.;:,=/<F1+ <>+

B=>;E:B;<>8+E:;+FT./.;:/+19FB/.K+:-:R;:;<=>+;=+.C.EB<F.+;E:<><>8J+<4"!"@9A5+$%"&'%%"@9A5+$%"MNOK+DO46 DOMMJ+

W:+DE9H+2X+(:E=>.+(X+#=R.F+c2X+#<//=+DX+IB'/=><F0W=S>.F+IX+#..+2\X+c.;;=+'(X+(.;E=FA:>+2X+I:EF:/:+

IX+I9ERPA+'aX+Y<//<:1F+W2X+2R<.8./1:>+!IX+D/.^./:>-+WY+3MQ4M7J+Z/.^:;.-+(%D04 +:B;<^<;A+F9F;:<>F+

1<;=BP=>-E<:/+ ,<=8.>.F<F+ :>-+19FB/.+ ?9>B;<=>+S<;P=9;+ .C;.>-<>8+ F9E^<^:/+ <>+ :+1=9F.+1=-./+=?+ <>P.E<;.-+

'#2J+&'%%"#'/(B+4NK+]]L ]L6J+

W.?=E8.F+2X+!E:>BP9+VX+!<=>-<+$X+%E=>-:E-+DX+(:E<F.;+DX+#bB=//.+2X+#=R.F+(X+c<-:/+((X+DP:>=<>.+DX+

DP:E,=>><.E+@+3MQQ57+I=;=>.9E=>+F9E^<^:/+<F+RE=1=;.-+,A+FR.B<?<B+.C.EB<F.+<>+:+1=9F.+1=-./+=?+

:1A=;E=RP<B+/:;.E:/+FB/.E=F<FJ"!"@9A5+$%+NL]3(;+4`7KON640]MJ+

W.>8/.E+&X+\=>F;:>H.E+'X+\9;P.E+%X+).FF.+2X+Y=/?+YX+2;E9RR/.E+'+3455Q7+'1A=;E=RP<B+/:;.E:/+FB/.E=F<FK+

1:BE=0ZI%+:>-+;S<;BP+?=EB.F+=?+F<>8/.+1=;=E+9><;FJ+#256%'".')1'+4OKN`N NNQJ+

W.>;=>+ &IX+ &:>-/.+ (VX+ !E<-8.F+ !VX+ D==R.E+ &)X+ \.E,.A+ '#X+ (:FT+ )_X+ 2.^.EF=>+ W#X+ 2;:>F,<.+ WX+

YP<;.P=9F.+2+345]N7+&.89/:;<=>+=?+1:11:/<:>+RAE9^:;.+-.PA-E=8.>:F.J+#$%"&'%%"8+$69'4+5K+M] NOJ+

W.FR=E;+ VDX+ (I+ (E.9CX+ _D+ _E9=>8X+ VI+c://:;X+ W+ 2:9;.E.:9X+ (+ D=9E:;<.E+ 345557+a9;E<;<=>:/+ F;:;9F+ <F+ :+

RE=8>=F;<B+?:B;=E+?=E+F9E^<^:/+<>+'#2+R:;<.>;FJ+.'2)$%$?A+NOK+4QN5 4Q6OJ+

!"#$"!%&!'(!)&*+& #!&

!"#$%&'()*+(,&"-.(,/+(/012(3+(4%5&5"(6+(70880'()/+(4"0-9&:&"(4+(*%-&0'5"&(,(;<==>?@(A0B'%&#(B%&&"80'"C(

D5'E(E2$"&F"'0G%85#F(5H($0'5"H'#(D5'E(0F2%'&%$E5B(80'"&08(#B8"&%#5#@(!"#$#%&'(#)*+,(IJK(L<M LLJ@(

!"#$%&'( )*+(N%&H2(A+(30B%#'"(/+(,&"-.(,/+(*%-&0'5"&( ,( ;<==O?(P2$"&F"'0G%85#F( 5H(Q3RK( B%&&"80'5%H#(

D5'E(B85H5B08(0HC($0&0B85H5B08($0&0F"'"&#@()-*,./-0-(-,#1'2(3K(<=< <=I@(

!-$-5#(3+(S-C0&'(P+(T"HU(A+(V%HW08"W(C"(Q1-580&( )3+(3%"998"&(),( ;<==J?(XY5C"HB"(9%&(C"9"B'5Y"("H"&12(

E%F"%#'0#5#( 5H( 0F2%'&%$E5B( 80'"&08( #B8"&%#5#K( G"H"95'( %9( 0(E51EZ"H"&12(C5"'( 5H( 0( '&0H#1"H5B(F%-#"(F%C"8@(

4,.5#)6+&#!56/#75'#8#7#!(>=>K(>>>O[ >>>\J@(

!-$-5#(3+(V%HW08"W(C"(Q1-580&()3+(XBE0H5WZ301-H0(Q+(X#BEG0BE()+(T"HU(A+(S-C0&'(P+(P08'"&(4+(P-W"(*+(

RBE0"99"&(3+(4%-5880-C(A+(3%"998"&(),(;<==[?(/-#B8"(F5'%BE%HC&508(-HB%-$85H1(C5#F0H'8"#(H"-&%F-#B-80&(

]-HB'5%H(0HC('&511"&#(C5#'08(C"1"H"&0'5%H(%9(F%'%&(H"-&%H#@(49.7#:(-(;K"OL[=@(

!-$-5#(3+(,&0C0'(,A+(3-C%8$E(Q*+(3%"998"&(),(;<=>>?(XH"&12(F"'0G%85#F(5H(0F2%'&%$E5B(80'"&08(#B8"&%#5#@(

96(5-+#)-*,.&(>=K(IO M<@(

A"&10H5(Q+(S-C0&'(P+(V%HW08"W(!"(Q1-580&()3+(A&5B^"&(4+(T"HU(A+(P%B_-"''"()A+(/"5H5H1"&(7+(!-$-5#(3+(

3%"998"&(),(;<==I?(`HB&"0#"C($"&5$E"&08(85$5C(B8"0&0HB"(5H(0H(0H5F08(F%C"8(%9(0F2%'&%$E5B(80'"&08(#B8"&%#5#@(

$#9'<'/#=-2(JMK>OI>ZM=@(

A5#BE"&(3T+(*-8Y"&(!V+(N"HH0H'(,+(!0Y5#(QQ+(a0H1(/+(*0#'"880H%ZR0HBE"W(Q+(bE0H()+(,%80^(/Q+(V80##(

)!(;<==J?(QF2%'&%$E5B(80'"&08(#B8"&%#5#(5#(0(C5#'08(0.%H%$0'E2K("Y5C"HB"(5H(F5B"(0HC(F0H@(>?<#)-*,.&(>MOK(

<L< <J=@(

A&"2(!+(RBEH"5C"&(*+(c-(3+(4%&1()+(R$%%&"H(a+(*0&%H5(,(;<===?(X0&82(0HC(#"8"B'5Y"(8%##(%9(H"-&%F-#B-80&(

#2H0$#"(#-G'2$"#(D5'E(8%D(#$&%-'5H1(B%F$"'"HB"(5H(F%'%H"-&%H(C5#"0#"#@($#)-*,.25'#<=K(<OLJ <OJ<@(

A-&-20F0(N+(b5'020F0(b+(60F0#E5'0(P+(/%&5(d( ;<==L?(A%&^E"0C( '&0H#B&5$'5%H( 90B'%&(AScS>( ;AbPT?Z

C"$"HC"H'( 5HC-B'5%H( %9( ,!bJ( 1"H"( ".$&"##5%H( 5H( #^"8"'08(F-#B8"( C-&5H1( "H"&12( C"$&5Y0'5%H@(@'.5A-"# $(

LIOKL\OZI>@(

P08'"&(4+(V%HW08"W(C"(Q1-580&( )3+(T"HU(A+(,"'&5(R+(A&5B^"&(4+(XBE0H5WZ301-H0(Q+(!-$-5#(3+(30&F"'(6+(

3%"998"&(),(;<=>=?(S.5C0'5Y"(#'&"##(5H(#^"8"'08(F-#B8"(#'5F-80'"#("0&82(".$&"##5%H(%9(T0C(5H(0(F%-#"(F%C"8(

%9(0F2%'&%$E5B(80'"&08(#B8"&%#5#@(B,--#=6/'5#@'.&#C-/(JMK([>O [<L@(

P0&C5F0H(S+(Y0H(C"H(4"&1(3P+(b5"&H0H(/*(;<=>>?(*85H5B08(C501H%#5#(0HC(F0H01"F"H'(%9(0F2%'&%$E5B(

80'"&08(#B8"&%#5#@()6+#=-D#)-*,.&#IK(\L[ \J[@(

P0&&5#( TQ+( 4%D^"&Zb5H8"2( //@+( P-0H1( 4+( a-( ,( ;<==<?( T"1-80'5%H( %9( 'E"( 0B'5Y5'2( %9( 'E"( $2&-Y0'"(

C"E2C&%1"H0#"(B%F$8".@(!/D#>(EF"-#=-0*&(J<K(<J[ <O[@(

P"1"C-#( )+( ,-'F0H( *N+( N2&"F0H(d+(V%&C%H( N( ;<==M?( ,&"9"&"H'508(F%'%&( -H5'( 8%##( 5H( 'E"( RS!>(V[LQ(

'&0H#1"H5B(F%-#"(F%C"8(%9(0F2%'&%$E5B(80'"&08(#B8"&%#5#@($#4AF2'.&(OM\K(LLLI LLO>@(

P%8H"##( /)+( b&0-#( Q+( P0&&5#( TQ+( 0HC( R-1C"H( /*( ;<===?( N0&1"'"C( -$&"1-80'5%H( %9( $2&-Y0'"(

C"E2C&%1"H0#"( ^5H0#"( ;,!b?ZJ( 5H( #8%D( 'D5'BE( #^"8"'08( F-#B8"( -HC"&85"#( 'E"( #'0G8"( F%C595B0'5%H( %9( 'E"(

&"1-80'%&2(BE0&0B'"&5#'5B#(%9(,!b(5HC-B"C(G2(E51EZ90'(9""C5H1@(1'6G-+-2#J[K(IIO IM>+(<===@(

P%8H"##(/)+( R-1C"H(/*( ;<==L?( T"1-80'5%H( %9( $2&-Y0'"( C"E2C&%1"H0#"( B%F$8".( 0B'5Y5'2( G2( &"Y"&#5G8"(

$E%#$E%&280'5%H@(@'.5A-"#7.5#H,6(2#L>(K>>JLZO>@(

!"#$"!%&!'(!)&*+& ##&

!"#"$%&'(&)*+,-.&/0(&1$2345&')(&6*+73-$&/8(&'9+4&)!(&1-7",45&)(&/$9:345&;(&<"+",$&=(&/,+*,,&')(&

=4+>&)?(&/@-*2A&B;&CDEFEG&'&%7@+7"37&$5&H4%.&9"33&$5%7I&$3&"334@$",7%&#$,-&J"3,7+&:+4K+733$45&4J&94,4+&

3.9:,493&"5%&3-4+,7+&3*+L$L"2&$5&'M/N!"#$%&'%()!*+&,'+-!./-,'&FFCOGPQRDSTN&

!745K& !=(& !74*5K& U<(& B"+>& ?V(& M77& W?& CDEFDG& X+"53@+$:,$45"2& +7K*2",$45& 4J& :.+*L",7& %7-.%+4K75"37&

>$5"37N&01+2,&,3!4,&+2!5&YOCQGPYDTSYQN&&

?$9&=W(&M77&ZU(&[-4$&1/(&M77&/(&=4*5&!<& CDEEOG& W53*2$5& +7K*2",$45&4J& 3>727,"2&9*3@27&B\?R&9]U'&

7I:+733$45&$3&$9:"$+7%&$5&"@*,7&$53*2$5S+73$3,"5,&3,",73N!01+2,&,3&QQP&DYFF DYF^N&

M$5&!(&1*&<(&X"++&BX(&_-"5K&[=(&1*&_(&0433&`(&)$@-"72&MZ(&B*$K37+L7+&B(&W34,"5$&;(&`2345&;U(&M4#722&

00(&0"3372S\*H.&](&/:$7K729"5&0)&CDEEDG&X+"53@+$:,$45"2&@4S"@,$L",4+&BV[SF&"2:-"&%+$L73&,-7&J4+9",$45&

4J&324#S,#$,@-&9*3@27&J$H+73N&6+&7',&RFTP&^a^ TEFN&

M*b*7,& /(& M4:7AS/4+$"54& !(& <423,& \(& Z+7%75+$@-& '(& )72>$& !(& ]"334*2A"%7K"5& )(& V+$9"2%$& B'N& CDEEYG&

B7+4I$3497& :+42$J7+",4+S"@,$L",7%& +7@7:,4+& %72,"& @45,+423& 9*3@27& %7L724:975,& "5%& 4I$%",$L7& @":"H$2$,.N&

8".9:!5&F^CFQGPDDaaSYEFN&

)"22$5345& !;(&[453,"5,$5SX74%43$*&\(&V2"L73& B\(&)"+,$5& ;'(&\"L$73&1!(&173,#44%& Z](& /$%"#".& !;(&

V+775-"JJ&BM& CDEFDG&B-"+9"@424K$@"2& "@,$L",$45&4J& ,-7& :.+*L",7&%7-.%+4K75"37& @49:27I& +7%*@73& 3,",$5S

97%$",7%& *:+7K*2",$45&4J& Z`c`&K757& ,"+K7,3& "5%& :+4,7@,3& "K"$53,& 3,",$5&9.4:",-.& $5& +4%75,3N& 5!;)$31%-&

QaEP&OYTa OREDN&

)"33"4& <$+"H"+"& /(& %7& `2$L7$+"& ["+L"2-4& [](&)75%45d"& !](& B$2,@-7+& <"H7+& ;(& Z7+5"5%73& M[(& [*+$& ]&

CDEEYG&B"29$,",7&"@*,72.& +"$373&K2.@4K75&3.5,-73$3& $5& +",& 3427*3&9*3@27&H.&"&97@-"5$39& ,-",& +7b*$+73& $,3&

97,"H42$A",$45&C]"5%27&@.@27GN&89:.!*,&&&QRFP&FEa FFRN&

)",,345& )B(& [*,27+& ]V(& ["9"5%42"& /& CDEE^G& ;57+K.& $5,">7& "5%& "9.4,+4:-$@& 2",7+"2& 3@27+43$3N&

6,7'%#%-,/7-+'!4,<&aP&F^ DEN&

)@V"++.& !\(& )$223& /;(& M45K& [/(& Z43,7+& \1& CFaTYG& `H37+L",$453& 45& ,-7& "JJ$5$,.& J4+& @"+5$,$57(& "5%&

9"245.2S[4'&3753$,$L$,.(&4J&@"+5$,$57&:"29$,4.2,+"53J7+"37&W&$5&"5$9"2&"5%&-*9"5&,$33*73N&\79453,+",$45&4J&

,-7&:+7375@7&4J&9"245.2S[4'&$5&545S-7:",$@&,$33*73&4J&,-7&+",N&:1%/),#!5&DFRP&DF DTN&

)7"%& !](& W+L$57& /'(& ]"9e$& \B& CDEEDG& M$:4:+4,7$5& 2$:"37P& 3,+*@,*+7(& J*5@,$45(& +7K*2",$45(& "5%& +427& $5&

%$37"37N&5!4%-!4,<&C07+2GN&TEP&^QY ^OaN&

)$b*72&;(&["33$5"&'(&)"+,f57ASB"29"&M(&042",,4&[(&X+f"3&;(&V"5%729"5&)(&]"%$&](&0"+H7$,4&M(&["33$5"&B&

CDEFDG&)4%*2",$45& 4J& "3,+4@.,$@&9$,4@-45%+$"2& J*5@,$45& H.& %$@-24+4"@7,",7& $9:+4L73& 3*+L$L"2& "5%&94,4+&

:7+J4+9"5@7&$5&$5-7+$,7%&"9.4,+4:-$@&2",7+"2&3@27+43$3N&;*%.!=>,&^P&7YR^^ON&

U"-2g&_F(&<3$7-&)(&B$7,>"&X(&[4H*+5&[X(&V+$9"2%$&B'(&_-"5K&)6(&\"3&\(&'H*9+"%&U'&CDEETG&[\YOS

%7:75%75,&+7K*2",$45&4J&9*3@27&Z4I`F&"5%&B\?R&$5&,-7&BB']&%72,"hH7,"S97%$",7%&"%":,",$45&,4&97,"H42$@&

3,+733N!5!:1%-!?),#!DTYCDFGPFRYF^SDON&

B7%7+375&1'(&)",,345&)B& CFaaaGN&U4& H757J$,& 4J& %$7,"+.& +73,+$@,$45& 45& %$37"37& 4537,& 4+& :+4K+733$45& $5&

"9.4,+4:-$@&2",7+"2&3@27+43$3&[*h_5S3*:7+4I$%7&%$39*,"37&9*,"5,&9$@7N&0+"$5&]73N&@AA(&FF^ FDEN&

B7,,7& \(& /,"+45& ]/& CDEEFG& & X+"53$,$453& 4J& 9*3@27& J$H7+& :-754,.:$@& :+4J$273N& B13&%/),#! ?,--! :1%-&FFQCQGPYQaS^DN&

B-$2:& '(& B7+7AS/@-$5%27+& !(& V+775& [(& <"9$2,45& \M(& 0""+& ?& CDEFEG& B.+*L",7& 3*::+73373& BV[F"2:-"&

7I:+733$45&"5%&3*H3,+",7&*,$2$A",$45&%73:$,7&$5@+7"37%&+73:$+",4+.&@-"$5&@45,75,&$5&[D[FD&9.4,*H73N&"#!5!

;)$31%-!?,--!;)$31%-&DaaP&[DRE QEN&

!"#$"!%&!'(!)&*+& #)&

,-./.0&,12&3-45606.4&72&78-/85&,92&:4;4<=&>2&38556?850@A84==6B80&:2&C<D85&:2&C.B.EF.=&12&G8-E<.&,2&

1-8EF80& H2& >.E8-06& I+2& !"#$%&'()'(*+,,-%+'()'.%'/*#%,0-%#'1)'."2*34&%5'.)'.*%66&%#'!7)'8%-9-9:%#';'

J#'!'KL&MD;.<-6/&NB4E8=6&08B6-.5E6&<5&;.0<650=&O<0F&.DP80-8;F<E&B.06-.B&=EB6-8=<=L&!"#$%&$'()*+%,&+-)

./-,&&!!(&!QQ !R!L'

7+-:,%#<%#' 7' =>??@A' B-,,+%C,D%2-6-2' #%:+&"0-*9' *6' 3%0"4*&-2' D"0EF"G,' 0E#*+:E' 0E%' 0#"9,2#-D0-*9"&'

2*"20-<"0*#'7H(IC"&DE"J'!"#$%$&'()'=.*9$AJ'>K'L+DD&'IM'L@ KJ'

7+9' L)' L"90*,' N/)' L"O%9"' L)' P+' .)' ("#*9-' 7' =>??QA' L%&%20-<%' <+&9%#"4-&-0G' "9$' D#+9-9:' *6' DE",-2'

3*0*9%+#*9'"O*9,'-9'3*0*9%+#*9'$-,%",%'"&&%<-"0%$'4G'(1B/J'*+#$*(,-.)/0'KM'R?S RIKJ'

T-DD,'8U)'V+90&%G'HW)'V*6'7T)'8*##-,*9'!V)'H*#$*9'!W'=IKK@A'B#"9,:%9-2'3-2%'%OD#%,,-9:'"9'"&0%#%$'

3+#-9%' ,+D%#*O-$%' $-,3+0",%' :%9%' D#*<-$%' "9' "9-3"&'3*$%&' *6' "3G*0#*DE-2' &"0%#"&' ,2&%#*,-,J'1-./$*+#2$3/+4$5/0$653'K>M'QSK QKXJ'

L3-00Y"3D'LU)'8*##-,'!Z)'[*3E*66'H.)'(E%#0*66'8U)'H%-:%#'7()'L0"96*#$'!N'=>?IRA'L\]ICHKXN'8-2%'

UOE-4-0'8+,2&%C/-4%#CBGD%CLD%2-6-2']%2#%",%,'-9'H&+2*,%'^D0"Y%'-9'0E%'N4,%92%'*6'WE*&%C[*$G'(E"9:%,'

-9'8%0"4*&-,3J'*(,-.4(7("(-$80)'IX=IAM>KCX_J'

LD#-%0' ..)' B+9,0"&&' T!)' W"00' 8!)' 8%E"9' ZN)' V"#:#%"<%,' 8)' ("3%#*9CL3-0E' ]' =>??RA' 7G#+<"0%'

$%EG$#*:%9",%'"20-<"0-*9'"9$'Y-9",%'%OD#%,,-*9' -9'E+3"9',Y%&%0"&'3+,2&%'$+#-9:' 6",0-9:J' %$3992$1:;)0.2'

KQM'>?S> >?S_J'

B"&"9-"9'!.)'V*&&*F"G'H7)'L9**Y'.N)'V%-:%9E"+,%#'H!/)'[*9%9'N)'LD#-%0'..'=>?I?A'UO%#2-,%' 0#"-9-9:'

-92#%",%,' ,"#2*&%33"&' "9$' 3-0*2E*9$#-"&' 6"00G' "2-$' 0#"9,D*#0' D#*0%-9,' -9' E+3"9' ,Y%&%0"&' 3+,2&%J' 3<$ %$1:;)0.2$="4./-0".2$>(#+''>KKM'UIS? SJ'

B%&%#3"9CB*DD%0' 1)' (*`#,' (' =IK_SA' 8*0*#' -99%#<"0-*9' "9$' 6-4%#' 0GD%' D"00%#9' -9' "3G*0#*DE-2' &"0%#"&'

,2&%#*,-,'"9$'-9'(E"#2*0C8"#-%CB**0E'$-,%",%J'>,)/2($*(-?('I=>AMIXXCKJ'

'

;%,0%#:""#$' V' =IKKKA' L0+$-%,' *6' :%9%' %OD#%,,-*9' "9$' "20-<-0G' *6' E%O*Y-9",%)' DE*,DE*6#+20*Y-9",%' "9$'

:&G2*:%9' ,G90E",%' -9' E+3"9' ,Y%&%0"&' 3+,2&%' -9' ,0"0%,' *6' "&0%#%$' -9,+&-9C,0-3+&"0%$' :&+2*,%'3%0"4*&-,3J'

8+"$>(4$@,22$RQ=IAMIXCXRJ'

;-&&%9"' !N)'Z#"&&-' N' =>??SAJ' UTT"&DE"M' "'3%0"4*&-2' 6+920-*9' 6*#' 0E%' *&$%,0' *#DE"9J' A-("4)$ ="4./-0".2$

>(#+''IKM'>QK >_QJ'

W"9:'aP)'bE"9:'(.)'a+'TB)'(E*'VZ)'1%&,*9'8()'["G+:"C\2"3D*'(T)'V"3'!)'Z"9:'V)'U<"9,'T8'

=>??RA'T%:+&"0-*9'*6'3+,2&%'6-4%#'0GD%'"9$'#+99-9:'%9$+#"92%'4G'77NT$%&0"J'1B.5$@0.2$>=I?AM%>KRJ''

W"00'8!)'V%-:%9E"+,%#'H!/)' .%[&"92' 7!)' c9:&-,' !H)' LD#-%0' ..)' 7%0%#,' L!' =>??RA'T"D-$' +D#%:+&"0-*9' *6'

DG#+<"0%' $%EG$#*:%9",%' Y-9",%' "20-<-0G' -9' E+3"9' ,Y%&%0"&' 3+,2&%' $+#-9:' D#*&*9:%$' %O%#2-,%J' %$ 3992$1:;)0.2'K_M'I>QI I>Q_J'

WE-0%E*+,%' L)' T"9$&%' 7!' =IK_XA' N20-<"0-*9' *6' DG#+<"0%' $%EG$#*:%9",%' -9' D%#6+,%$' #"0' E%"#0' 4G'

$-2E&*#*"2%0"0%J'@0./:(<$%'IXRM'Q@I Q@XJ'

W*9:'8)'8"#0-9'.!'=>?I?A'LY%&%0"&'3+,2&%C#%,0#-20%$'%OD#%,,-*9'*6'E+3"9'L\]I'2"+,%,'3*0*#'9%+#*9'

$%:%9%#"0-*9'-9'0#"9,:%9-2'3-2%J$C,<$>.2$D("(#$IK=IIAM>>SRCX?>J'

W+'b)'7+-:,%#<%#'7)'N9$%#,,*9'^)'bE"9:'()'N$%&3"90'H)'8**0E"';)'B#*G'N)'(-90-'L)'.*F%&&'[)'L2"#D+&&"'

T)'LD-%:%&3"9'[8'=IKKKAJ'8%2E"9-,3,'2*90#*&&-9:'3-0*2E*9$#-"&'4-*:%9%,-,'"9$'#%,D-#"0-*9'0E#*+:E'0E%'

0E%#3*:%9-2'2*"20-<"0*#'7H(CIJ'E(22'KSM'II@ I>RJ'

!"#$"!%&!'(!)&*+& #%&

!"#"$"%"&'(&)*+$&,-(&./01122&,(&3+40#/5067/$/+&8(&!"#"9*0:"&;(&<+:#"$$&=;(&7"%"*"9*0&>(&?09"@"&

;(&)12A21"$B&=C&DEFFGH&I9:5/JK:29&"9&B2:25#0$"$:9&/L&B092"92&M5/N52990/$&0$&0$*250:2B&"#K/:5/M*0J&1":25"1&

9J125/909O&!"#$!%&'()*+$PPQ&ERP ERSO&&

T*"$N&U(&'2+$N&C(&,"#/%*A"1/A&V(&C"$N&C(&U/M"9J*+%&<=&DEFPFH&>/12&/L&L"::K&"J0B&+M:"%2&"$B&L"::K&

"J0B& W2:"6/X0B":0/$& 0$& #2B0":0$N& 0$9+10$& 52909:"$J2& 0$& *2"5:& "$B& 9%212:"1& #+9J12O& ,+(*-+.$ ,+(/-0)$ 1*#"$

PGFPDPHQP6EEO&

&

&

&

!"#$"!%&!'(!)&*+& #$&

!"#$%&'(&#&)*+!

!

"#$%&'!()!*+,(-./0

!1#2'!345'!#16&75'8!6'&97&14:2'!8%&#:$!':8%&4:2'!';'&2#<'=!

,-./' &0123451' 6127829:;31' 8;' :' <21:=94>>' :66:2:<?5' ?54;@' :;' 4;<1;51' 10123451A' 4;32191;<:>' 5611='

6:2:=4@9' <B:<' 21>415' 58>1>C' 8;' :;:128D43' 91<:D8>459E' *-!/' &0123451' 6127829:;31' 8;' :' <21:=94>>'

:66:2:<?5' ?54;@' :' 98=12:<1' 10123451A' 38;5<:;<' 5?D-9:049:>' 5611=' <B:<' 21>415' 8;' <B1' 2132?4<91;<' 87'

:128D43'91<:D8>459':;='<B:<'45'2162151;<:<4F1'87'1;=?2:;31'10123451E''

,' :;=' *E' G:6>:;-H1412' 3?2F15' 2162151;<4;@' F:>?15' 38221568;=4;@' <8' <B1' 61231;<:@1' 87' 9431' 5<4>>'

2?;;4;@':<':'@4F1;'<491'684;<E''

I' :;=' &E' H1=4:;' F:>?15' 87' <B1' <491' <B:<' 9431' 2:;' :21' 2162151;<1=' 4;' <B1' 94;' <8' 9:0' @2:6B43:>'

2162151;<:<48;J'KLEL94;' 782'M4>=<C61' NOPQ':;='KRESS94;' 782'+T*K#UV%' 4;'IJ'LWESS94;' 782'OP':;='

VLERS94;'782'+T*K#UV%'4;'&E''

.':;='!E'H1:;'=45<:;31'2?;' '+&H'DC'OP':;='+T*K#UV%'9431'4;'.A':;='DC'OP':;='+T*K#UV%'9431'

4;'!E'!"#$%$'OPA'&XYEYKZ'4;','NH:;<1>-.80'<15<QJ'[[&XYEYYZU'4;'IA'[[&XYEYYU'4;'.A'&XYEYSV'4;'*'

NH:;<1>-.80'<15<QA'[[&XYEYYZU'4;'&A':;='[[&XYEYYVK'4;'!A' !"#A'+<?=1;<\5'<'<15<E'

'

"#$%&'!>=!,'2&'4<'8!$&#6!<?&':$?3@!#:2&'4<'8!8':'&54?#7:@!4:8!#:2&'4<'8!';6&'<<#7:!79!

8':'&54?#7:!4:8!4?&763A!14&B'&<!?3&7%$37%?!8#<'4<'!6&7$&'<<#7:!#:!*+,(-./0

!1#2'='

,/'#246'<15<'M:5'61278291='<8'91:5?21'98?51'9?53>1'5<21;@<B':<'=477121;<'<491'684;<5'=?24;@'=451:51'

628@215548;E'#2:6B'2162151;<5'<B1'91:;'87'61231;<:@1'7289'4;4<4:>'78231'91:5?21=':<'KK'M11]5' '+&HE'

,<'KS'M11]5'&XYEYSA':<'KR'M11]5'&XYEYVA':<'KL':;='KV'M11]5'&$#%#&'( !)*'+,-./01-'2/-23%'

I/'&>13<289C8@2:6BC'N&H#Q'21382=4;@5'M121'61278291='M11]>C'=?24;@'=451:51'=1F1>8691;<A'5<:2<4;@'

7289'W'M11]5'87':@1E'+68;<:;18?5'1>13<243:>':3<4F4<C'M:5'38;54=121=':5'6854<4F1'&H#'8;>C'782'61:]-<8-

4/56'5748,29:/-';')#<=%'>./'4/0?/ 25@/'AB'7,?/'40/-/ 2, @'C,2.'4A-,2,D/'EFG', '/5?.'5@/'@0A94':21'

2162151;<1=E'%162151;<:<4F1' 10:96>15'87';1@:<4F1' N&H#' -Q' :;='6854<4F1' N&H#'^Q' 1>13<289C8@2:6BC'

62874>15':21'5B8M;'N !)QE'

./'%1>:<4F1'9%),'8/D/8-'AB':/ /0D52,A '7506/0-'HI.J'(-9K9 ,2-'L'5 :'M3'5 :'F9NO'C/0/'/D58952/:'

DC'_`.%':<'<B1'4;=43:<1=':@15'NVL':;='KYL'=:C5Q'4;'()*)+,)$'+-("#).#'N?6612'6:;1>5Q':;='$.,"%$'N>8M12'

6:;1>5Q'87'OP':;='+T*K#UV%'9431E'#2:6B5'2162151;<'91:;'78>='3B:;@1' '+&H'7289':@1-9:<3B1='OP'

!"#$"!%&!'(!)&*+& #,&

!"#$%&'(((!)*+,-./'"#'012'34&4445'678'$%&' 9'$%&'!'+":'()*+';"',-.-/0-#1/2,34-549'+":'((!)*+,-./'

"#'012'4&445'678'$%&' 9'+":'(((!)*+,-./'"#'012'4&444<' '678'$%&'!9'4&444=' '678'()*+' ;"'#503)#&

!"#$%&'#()%#)*+'

>2'?.,+@;*.'A?BC',.*.,/'76'A-/D,.'+@87EFG'A+8H.8/'I-?J5'+":'C@K)5'L.8.'A.+/-8.:'MG'NOP?'+@'

@F.' ;":;D+@.:' +K./' !Q$' +":' 54$' :+G/%' ;"' ,-.-/0-#1 /2,34-54' !-EE.8' E+".,/%' +":' #503)#' !,7L.8' E+".,/%&'

R8+EF/' 8.E8./."@' A.+"' 67,:' DF+"K.' "' STI' 687A' +K.)A+@DF.:' 01' 678' ",$&' (((!)*+,-./' "#' 012'

34&4445' 678' I-?J5' +":' C@K)5' ;"' ,-.-/0-#1 /2,34-54' +":' ((!)*+,-./' "#' 012' 4&44<' 678' I-?J5' +":'

!U4&44Q'678'C@K)5';"'#503)#' !"#$%&'#()%#)*+'

!

"#$%&'!()!*+,-.+,/&%01,2#34-'!5!#-!#3+#6#1'7!#3!$890,891#0!:%-08'!437!$8%0,-'!#-!&'&,%1'7!1,;4&7-!

$890,$'3!-1,&'-)!!

C2'T"VGA+@;D'+D@;*;@G'76'EF7/EF768-D@7H;"+/.';"'LF7,.',-.-/0-#'/2,34-54'A-/D,.'DG@7/7,;D'F7A7K."+@./'

;/'.WE8.//.:'+/'A.+"'67,:'DF+"K.'"'STI'687A'+K.)A+@DF.:'01'+@'Q$':+G/'76'+K.'(1!U4&45Q'!-,.9'

!"#$%&'#()%#)*/'+":'54$':+G/'76'+K.'(((1!34&4445'!"U$/(!"#$%&'#()%#)%&''

X2' OG8-*+@.' L+/' A.+/-8.:' ;"' LF7,.' ,-.-/0-#1 /2,34-54' A-/D,.' @;//-.' F7A7K."+@./&' 1F.' A.+"' 67,:'

DF+"K.'"'STI'D7AE+8.:'@7'+K.)A+@DF.:'01'+8.'8.E8./."@.:'L;@F'(1!U4&45Y'+@'Q$':+G/'76'+K.9'+":'(1

!U4&4Z5'+@'501(234#(56(37%( -,8/'!"#$%&'#()%#)*+('

P2' [.6@2' ?.E8./."@+@;*.' L./@.8"' M,7@' /F7L;"K' K,GD7K."' /G"@F+/.' +":' EF7/EF78G,+@.:' K,GD7K."'

/G"@F+/.' ,.*.,/&' ?;KF@2' N-+"@;6;D+@;7"' 8.E8./."@/' @F.' A.+"' 8+@;7' 76' 7E@;D+,' :."/;@;./' 76' K,GD7K."'

/G"@F+/.\K,GD7K."' /G"@F+/.)O' ]' STI&' C@' Q$' :+G/' 76' +K.' (1 !U4&45Q=9' +":' +@' 54$' :+G/' 76' +K.' (1

!90+0:.;( -,1/(!"#$%&'#()%#)*+'

>2'[.6@2'?.E8./."@+@;*.'A;D87EF7@7K8+EF/'76'OCS'/@+;";"K' 687A'01'+":'S^>5R_Q?' ,-.-/0-#1/2,34-54'

D87//)/.D@;7"/'+@'Q$'+":'54$':+G/'76'+K.'/F7L;"K'K,GD7K.")".K+@;*.'!,;KF@'E;"H%'+":'K,GD7K.")E7/;@;*.'

!:+8H' E;"H%' 6;M.8/&' SD+,.' M+82' =44#A&'?;KF@2' `-+"@;6;D+@;7"' 76' K,GD7K.")".K+@;*.' !)%' +":' K,GD7K.")

E7/;@;*.'!a%'6;M.8/'+@'Q$'+":'54$':+G/'76'+K.&'J78'!)%'6;M.8/2'((!)*+,-./'"#'012'4&44=Q'+@'Q$':+G/''+":'

4&44<Z'+@'54$':+G/9'678'!a%'6;M.8/2'bb!)*+,-./'"#'012'4&44=$'+@'Q$':+G/''+":'4&44<c'+@'54$':+G/'!"UZ)Q9'

S@-:."@d/'@'@./@%&'

'

"#$%&'! <)! =81'&'7! /%'8! .&'/'&'30'! #3! $890,891#0!:%-08'! ,/! >?! 749! ,87@! 4-9:.1,:41#0! ABC5DE>F

!

:#0')!!

!"#$"!%&!'(!)&*+& #,&

!"# $%&'()*%# +$,!# &%*%&-# ./# !"#$# '01# !"#%# %*'&2'(%1# 34# 567$# '(# (8%# )01)9'(%1# ':%-# )0# &'(')*'+,

)-&./'0/# ./#;<# '01# =>?@ABC$#+)9%D#AE'F8-# E%FE%-%0(#+%'0# /.&1# 98'0:%# G# /E.+# ':%H+'(98%1#;<D#

!"#$"#II!H*'&2%-#1+#;<"#JDJ@K#'(#CL#1'4-#'01#JDJ@B#'(#@JL#1'4-M#!"#%"#III!H*'&2%#1+#;<#NJDJJJ@#'(#

!"#$%&'#()*"+#,-'./01'#2/'2OD#

P"#$%&'()*%#+$,!#&%*%&-#./#:%0%-#)0*.&*%1#)0#&)F)1#8'01&)0:#%*'&2'(%1#34#567$#'(#(8%#)01)9'(%1#':%-#

)0#&'(')*'+,)-&./'0/#./#;<#'01#=>?@ABC$#+)9%D#AE'F8-#E%FE%-%0(#+%'0#/.&1#98'0:%#G#=QR#/E.+#':%H

+'(98%1#;<D#!H*'&2%-#1+#;<"#23*#II,!SJDJJJTU#4"56#I,!SJDJL@U#78+9%#III,!NJDJJJ@#'(#CL#1'4-U##II,

!SJDJJLT#'(#@JL#1'4-#'01#43&:;<#II,!#SJDJ@#'(#CL#1'4-##'01#I,!3!4!5#%2# !"#$%&'#()*"+#,-'./01'#2/'26D#

7"# $%&'()*%# &%*%&-# ./# V&%/(O# !<6# '01# VE):8(O# ,!?W# '01# ,!?X# +%'-2E%1# )0# (.('&# &'(')*'+, )-&./'0/#

8.+.:%0'(%-#./#;<#'01#=>?@ABC$#+)9%D#Y%/("#AE'F8-# E%FE%-%0(#+%'0# /.&1# 98'0:%# # =QR# )0#!<6#

/E.+# ':%H+'(98%1#;<D# II, !3!4!!5# ()*"+# ,-'./01'# 2/'264# 7-8.29# :./# '+.20(-# ./# ,!?W# '01#,!?X#

E%&'()*%#(.#FE.(%)0#9.0(%0(#)0#Z8.&%#&'(')*'+,)-&./'0/#8.+.:%0'(%-#'E%#E%FE%-%0(%1#'-#+%'0#G#=QRD#I,!#

SJDJ[\##'01#II,!#SJDJJ@#V0SLU#-(21%0(]-#(#(%-(OD#

!

"#$%&'! ()! *&+,-.&#/0#1,! 2+.01&-3! 45678!! +,9! .#0&+0'! -:,0;+-'! +&'! 9#22'&',0#+<<:! &'$%<+0'9! #,!

=>?85@AB

!C#.')!!

!H?"#$%&'()*%#+$,!# &%*%&-#./# V!O# !"#$%&U# VPO#=0>0;U# V7O#8'&/)&., +?-&@)+.U# '01# V?O#!A8:; ,Z%E%#

%*'&2'(%1# 34# 567$# '(# (8%# )01)9'(%1# ':%-# )0# &'(')*'+, )-&./'0/# ./# ;<# '01# =>?@ABC$# +)9%D# AE'F8-#

E%FE%-%0(#+%'0# /.&1# 98'0:%# G=QR# /E.+# ':%H+'(98%1#;<D# !"#$%&'#!H*'&2%-# 1+#;<"# JDJJ@C# '(# CL#

1'4-M#!H*'&2%-#1+#;<"#=0>0;#III!SJDJJJ@#'(#@JL#1'4-U#8'&/)&.,+?-&@)+.#III!NJDJJJ@#'(#@JL#1'4-U#

!A8:; ,II!B ! "#$%#" &#'$()#*+,&-#./)0123)#%1)%4!#

Q"#$%FE%-%0('()*%#Z%-(%E0#3&.(#./#6A7H"5#$+'#21)617%/81#$7%/+#%0$%#9$)#:)1'#;<2#+<2=$>/?$%/<+!#@ABH

"5#62<%1/+# >181>)#/+# &'(')*'+,)-&./'0/#+2-9&%#()--2%#'E%#E%FE%-%0(%1#'-#+%'0#/.&1#98'0:%#G#=QR#/E.+#

':%H+'(98%1#;<D#!H*'&2%-#*-#;<C# ! D#*+,&-#./)0123)#%1)%4!#

^"#$%&'()*%#+$,!#&%*%&-#./#())*U#C9-%#'01#D/9;#Z%E%#%*'&2'(%1#34#567$#'(# (8%# )01)9'(%1#':%-# )0#

&'(')*'+, )-&./'0/# ./#;<# '01#=>?@ABC$#+)9%D#AE'F8-# E%FE%-%0(#+%'0# /.&1# 98'0:%#G# =QR# /E.+# ':%H

+'(98%1#;<D#!H*'&2%-#1+#;<"#())*# III,!NJDJJJ@U#C9-%# II,!SJDJJ[,'01#D/9;# II,!SJDJJT# *+,&-#

./)0123)#%1)%4!#

!

"#$%&'!A)!!D<0'&'9!C#01.;1,9&#+<!2%,.0#1,!#,!$<:.1<:0#.!C%-.<'!12!=>?85@AB

!C#.')!

!"#$"!%&!'(!)&*+& #,&

!"#$%&'()'*+,%-.#/0!#12&/0!3#4-5#67-*&%8%9+#75%*:#6;<=>#=9.-&%?9#2&/0!#.9?9.5#-,9#9@A,9559+#-5#

&)9# ,-&%'# B9&499*# 2%&'()'*+,%-.# 9*('+9+# :9*9# !"#$% -*+# &)9# *7(.9-,# 9*('+9+# :9*9# &'&(")*+(+,% ->#

C,-A)5#,9A,959*&#29-*#8'.+#()-*:9#D#EF$#8,'2#-:9G2-&()9+#HI#8',#.+/+0(+1#0,.23+"3#1.98&#A-*9.3#-*+#

1"(241# 1,%:)&#A-*9.3#'8#HI#-*+#EJ/KCLM=#2%(9N#B-,5#,9A,959*&#5&-*+-,+#9,,',5>#OOO%5#PQ>QQQK# !"#$%

&'()*+,(%-*(-./%#

R"#=9.-&%?9#2=0!#.9?9.5#'8#6)#$%49,9#29-57,9+#BS#6;<=#-&# &)9# %*+%(-&9+#-:95# %*# .+/+0(+1%0,.23+"3#

1.98&#A-*9.3#-*+#1"(241#1,%:)&#A-*9.3#'8#HI#-*+#EJ/KCLM=#2%(9>#C,-A)5#,9A,959*&#29-*#8'.+#()-*:9#D#

EF$#8,'2#-:9G2-&()9+#HI>#OOO%5#PQ>QQQK# !"0$%&'()*+,(%-*(-./#

!

"#$%&'! ()! *+,! -&'.-/'0-! 1.2! 3'0'4#5#.6! '44'5-7! 80!/'-.386#7/! .02!/#-851802&#.6! 4%05-#80! 84!

9:*;<=>?

!/#5')!

=9.-&%?9#2=0!#.9?9.5#'8#1!3#5789N#1R3#5)03:; N#1<3#<"#"$N#1/3#5=8$N#1F3#-&1=>?#1T3#!+.30.2%1',.*012N#

1C3#56!@$!N#1U3#A=,>?#-*+#1V3#6)#$#49,9#9?-.7-&9+#BS#6;<=#%*#.+/+0(+1%0,.23+"3#'8#('*&,'.#1<I3#',#

/<!G&,9-&9+#1/<!3#HI#-*+#EJ/KCLM=#2%(9>#C,-A)5#,9A,959*&#29-*#8'.+#()-*:9#D#EF$#8,'2#<IG

HI# :,'7A># 5G?-.795# B1# HI"# 5789# OOO5WQ>QQX# -*+# YY5WQ>QQZ[N# 5)03:; # Y5WQ>QK\LN# <"#"$%

OO5WQ>QQZZ##-*+#YY5WQ>QQZLN#5=8$#OOO5WQ>QQQX#-*+# YY5WQ>QQLQN#-&1=>#O5WQ>Q]Z\N#&+.30.2%1',.*012#

YYY5WQ>QQQ]N#5C&@$!#OO5WQ>QQL]#-*+#YYY5WQ>QQQ[N#A=,>%O5WQ>QX\XN#^5WQ>QK]_#-*+#YYY5WQ>QQQX#-*+#

6)#$#OOO5PQ>QQQK#-*+#YYY5PQ>QQQK# !"1$%&'()*+,(%-*(-.>#

#

"#$%&'!=)!*+,!-&'.-/'0-!1.2!@&8-'5-#A'!'44'5-7!80!/%756'!7-&'0$-1!.02!@&'A'0-'2!-1'!'B@&'77#80!

2'0'&A.-#80!/.&C'&7)!!

!"# C,%A# 5&,9*:&)# %5# ,9A,959*&9+# -5# 29-*# '8# A9,(9*&# 8,'2# IQ# 8',# 9-()# 9@A9,%29*&-.# :,'7A# D# EF$>#

YY5WQ>QQ]_#-*+#OOO523/3334% !"1$%&'()*+,(%-*(-.#

R"#=9.-&%?9#2=0!#.9?9.5#'8#275(7.-,#-&,'A)S#2-,`9,5#A43=$#-*+#-.C@$#49,9#29-57,9+#BS#6;<=#%*#

.+/+0(+1% 0,.23+"3# '8# ('*&,'.# 1<I3# ',#/<!G&,9-&9+# 1/<!3#HI# -*+# EJ/KCLM=#2%(9>#C,-A)5# ,9A,959*&#

29-*#8'.+#()-*:9#D#EF$#8,'2#<IGHI#:,'7A>#OO5WQ>QQ\[#-*+#OOO5WQ>QQKL#1!"1$%&'()*+,(%-*(-./#

#<"#=9.-&%?9#2=0!#.9?9.5#'8#+9*9,?-&%'*#2-,`9,5# !"#$N#-!*D%#-*+#A4EF%49,9#29-57,9+#BS#6;<=#

%*#.+/+0(+1%0,.23+"3#'8#('*&,'.#1<I3#',#/<!G&,9-&9+#1/<!3#HI#-*+#EJ/KCLM=#2%(9>#C,-A)5#,9A,959*&#

29-*#8'.+#()-*:9#D#EF$#8,'2#<IGHI#:,'7A>#OO5WQ>QK_#8',# !"#$N#O5WQ>QXL#-*+#OO5WQ>Q\]#8',#

!"#%N#O5WQ>Q]X#-*+#OO5WQ>QQX[#8',#A4EF# !"1$%&'()*+,(%-*(-.#

!"#$"!%&!'(!)&*+& #,&

!"#$%&' ()' *+,&-./"+' %&0%&1&2/./"32' 34' /,&' 5&1+%"6&5'-&/.637"+' "-6.7.2+&' "2' #78+378/"+'-$1+7&'

4"6&%1'34'*9:;<=>?

'-"+&@''

!"#$%&'(#%)(*+,#-)%&./.)%0#.%#12#*.-'3#4)/5#6,7-)0'#+%&#,.8.&0#'%/'(#/5'#-',,#+%&#+('#70'&#+0#-',,7,+(#

97',0:# ;%# /5.0#0./7+/.)%3#4)/5#8+/5<+=0#+('#70'&#+%&#+('#&(.>'%#4=#?@AB#+--)(&.%6# /)#%''&0#+%&#97',#

+>+.,+4.,./=:#

C"# ;%# /5'# -+0'# )9# !DE3# *'/+4),.-# 9,'F.4.,./=# .0# ,)0/# 4'-+70'# )9# -5()%.-+,,=# .%-('+0'&# ?@AB# +%&#

0740'G7'%/#.%5.4./.)%#)9#?@H#+%&#?IAJ#,'+&.%6#/)#6,=-)6'%#+--7*7,+/.)%:#;%-('+0'&#,.8.&#70'#/5()765#

KL)F.&+/.)%# /5+/# -+%# )%,=# 97%-/.)%# 7%&'(# +'()4.-# -)%&./.)%0# *+=# 7%&'(,.'# /5'# 6('+/'(# '%&7(+%-'#

-+8+-./=# .%# EM@JNOPQ# *.-':# # 1./5# /.*'3# /5'# -',,# 8()&7-'0# *)('# ('+-/.>'# )F=6'%# 08'-.'03# /5'('4=#

.%&7-.%6# -',,7,+(# &+*+6':# R@SP"# R@SP# +%/.6'%T9+//=# +-.&# /(+%0,)-+0'3# R?2J"# -+(%./.%'# 8+,*./)=,#

/(+%09'(+0'# J3# I!0"# 9+//=# +-.&03# I!LR)!"# +-=,L9+//=# +-.&03# ND$2B"# 6,7-)0'# /(+%08)(/'(# B3# D?D"#

,.8)8()/'.%#,.8+0'3#?@H"#8=(7>+/'#&'5=&()6'%+0'#-)*8,'F3#?@AB"#8=(7>+/'#&'5=&()6'%+0'#U.%+0'#B3#

?IAJ"#85)085)9(7-/)U.%+0'#J3#QME"#('+-/.>'#)F=6'%#08'-.'0:#

'

A.67&'B;)'*&C$&2+&1'34'0%"-&%1'$1&5'43%'CDE?@'

'

!"#$%&'B;@'B.%78'+,.2#&1'"2'#7$+31&',.257"2#'+,.2#&1'"2'*9:;<=>?

'-"+&@''

!"#!#6,7-)0'# /),'(+%-'# /'0/#<+0#8'(9)(*'&#+9/'(#JO#5)7(0#)9# 9+0/.%6:#V+-5#8).%/# ('8('0'%/0#*'+%0#W#

EVX#)9#8'(-'%/+6'#9()*#.%./.+,#4,))&#6,7-)0'#-)%-'%/(+/.)%#+/#2Y#)>'(#/.*':#25'#0.6%.9.-+%/#&.99'('%-'0#

)40'(>'&#-)(('08)%&#/)#!ZY:YS[#+/#SY#*.%7/'0#+%&#!ZY:YSO#+/#B\#*.%7/'0#+9/'(#6,7-)0'#+&*.%.0/(+/.)%#

]%Z^3#*7,/.8,'#/#/'0/0_:'

C"#!%# .%07,.%# /),'(+%-'# /'0/#<+0# 8'(9)(*'&# +9/'(# B# 5)7(0# )9# 9+0/.%6:#`+,7'0# ('8('0'%/# 8'(-'%/# 9()*#

.%./.+,# 4,))&# 6,7-)0'# -)%-'%/(+/.)%# +/# 2Y# )>'(# /.*'# W# EVX:# 25'# ('08)%0'# /)# .%07,.%# 8('0'%/'&# +#

0.6%.9.-+%/# &.99'('%-'# 4'/<''%# /5'# /<)# 6()780# +/# 2SY#8)0/L.%a'-/.)%# <./5" !# !"!#$%& '()*%& +,-/.8,'# /#

/'0/0_:##

R"#Q',+/.>'#*Qb!#,'>',0#)9#85)085)9(7-/)U.%+0'#J# ]!#$%_#<'('#*'+07('&#4=#G?RQ#+/# /5'# .%&.-+/'&#

+6'0# ]P\# +%&#JY\#&+=0_# .%# &'(')*'+"),&-.'/.# )9#12#+%&#EM@JNOPQ#*.-':#N(+850# ('8('0'%/#*'+%# 9),&#

-5+%6'#W#EVX#9()*#+6'L*+/-5'&#12:#ccc!dY:YYYJ#'().%&/0123451&63167"#

#

!"#$"!%&!'(!)&*+& )'&

!"#$%&'()*'+,-./'+,-)'012'!3435'&67%&88"91'"1'!"#"$%"&'$(!)*"+*'0:;&%'069;9<='9:'>?'<"@&'9%'

"1'&+%),&'9:'>?'012'A3,5BCDE

'<"@&F'

!"!#$%&'!()*+,-./!0%*1'23%!,04"!*%3%*5!)&!!"#$!#')6!61-%*.7!!"#%!#,288*%!61-%*.!1-8!&'(')*#9)''),!

61-%*.! :%;%! ,%15+;%8! 9<! =>?0! 2-! +,-,./,0* .1+23,'3! ':)! :%%@5! 1&'%;! 1A)'),<! #2652.! );! 2-! 'B%!

();;%56)-82-C!()-';1*1'%;1*!,+5(*%!#?D.!)&!ED!,2(%F!G;16B5!;%6;%5%-'!,%1-!&)*8!(B1-C%!H!IJK!&;),!

?DL,1'(B%8!2652F!!"#$/!MM!NOFOPQR!!"#%/!MMM!SOFOOOPR!&'(')/!M!NOFOTPU!#-NV7!5'+8%-'W5!'!'%5'.F!

X!#02CB'!()*+,-./!0%*1'23%!,04"!*%3%*5!)&!!"#$!#')6!61-%*.7!!"#%!#,288*%!61-%*.!1-8!&'(')!#9)''),!

61-%*.!:%;%!,%15+;%8!9<!=>?0!2-!0'/240*1'!'B%!2-82(1'%8!1C%55*G;16B5!;%6;%5%-'!,%1-!&)*8!(B1-C%!H!

IJK!&;),!1C%L,1'(B%8!EDF!!L31*+%5!60!ED/!>"#%!!NOFOOYZ!1'!POT!81<5R!&'(')!!NOFOOOP!1'!POT!

!"#$%&'()$*+#,-./#$0-#012!

!"#$%&'(G'

"/! E%2CB'! )3%;! '2,%! 2-! ED! 1-8! I[\PGV]0! 1-2,1*5! 2-! ?D! 1-8! \?"! ';%1'%8! C;)+65F! J1(B! 6)2-'!

;%6;%5%-'5! ,%1-! :%2CB'! H! IJK! 1'! 1! C23%-! '2,%! 6)2-'! &);! 1! C23%-! C;)+6F! "'! :%%@! T! )&! ';%1',%-'!

M!342455$%&'6)$7890+:9-$0$0-#0$;-0<--&$=>?5GV]0!?D!35!\?".F!!

X/!E%2CB'!C12-!1'!'B%!%-8L6)2-'!)&!';%1',%-'!%A6;%55%8!,%1-5!H!IJK!)&!6%;(%-'!&;),!DO!R!MM!NOFOOPZ!

9%':%%-!ED!?D! 1-8! I[\PGV]0! ?D! C;)+657! 1-8! ^^!NOFOOTO! 9%':%%-! I[\PGV]0! ?D! 1-8! I[\PGV]0!

?@A$%&'6)$*+#,-./#$0-#012$!

?/!0%*1'23%! ';1-5(;26'! *%3%*5!)&!>"#%! 2-!ED!1-8!I[\PGV]0! 1-2,1*5! 2-!?D!1-8!\?"! ';%1'%8!C;)+65F!

G;16B5!;%6;%5%-'!,%1-!&)*8!(B1-C%!H!IJK!&;),!1C%L,1'(B%8!?D!EDF!MMM!NOFOOOT!9%':%%-!ED!?D!

1-8!I[\PGV]0!?D!C;)+657!1-8!^^!NOFOO]U!9%':%%-!I[\PGV]0!?D!1-8!I[\PGV]0!?@A$%&'6)$*+#,-./#$

'%5'.F!!

Figure 1.

Moderate exercise - constant speed

D.

Intense exercise - incremental speed

A. B.

E. F.

C.

Soleus

Tibialis anterior

Atrophy markersD.

Figure 2.

B.

EMG -

EMG +

A.

Denervation markersC.

Tibialis anterior

Soleus

WT G86R

WT G86R

65 days

105 days

GS

P-GS

GS

P-GS

Figure 3.

A. B.

C.

D.

105 days

G86R

WT

65 days

Figure 4.

B.

C.

A.

Pdk4

Pdk2

Pdk isoforms Lipid handling pathway

Lpl Cd36

Acsf2 Cpt-1β

ATP and NAD levels

ATP NADH and NAD+

Figure 5.

E.D.

F.Errα Nrf1Mfn2

A. B. C.Ppar β/δ Foxo1 Citrate synthase

Pgc-1α PGC-1α

Figure 6.

A. Mitochondrial DNA

B. Glutathione peroxidase

Figure 7.

A. B.Pdk4

H. I.Mfn2 Gpx1

Ppar β/δ Foxo 1

C.

D.Pfk1

E.Acsf2 Citrate synthase

G.

F.

Pgc-1α

Figure 8.

A. B.MuRF-1 Atg-1

C. AChR α AChR γ MuSK

Figure 9.

A. B.

Table 1.

Gene ID 5’-3’ 3’-5’

Acetylcholine receptor α AChR α CCA-CAG-ACT-CAG-GGG-AGA-AG AAC-GGT-GTGTGT-TGA-TG

Acetylcholine receptor γ AChR γ GAG-AGC-CAC-CTC-GAA-GAC-AC GAC-CAA-CCT-CAT-CTC-CCT-GA

Acyl-CoA synthetase family

member 2Acsf2 CTC-TTT-CCC-ACC-ACA-ACA-TCG TCT-GCA-GTC-TTT-GTG-GGC-A

Atrogin1/F-box only protein 32Atg-1/

Fbxo32AGT-GAG-GAC-CGG-CTA-CTG-TG GAT-CAA-ACG-CTT-GCG-AAT-CT

Carnitine palmitoyl transferase 1 Cpt-1β GGC-TCC-AGG-GTT-CAG-AAA-GT TGC-CTT-TAC-ATC-GTC-TCC-AA

Citrate synthase Cs TAG-CAA-ATC-AGG-AGG-TGC-TTG-T TCT-GAC-ACG-TCT-TTG-CCA-AC

CyclophilinA Cypa CTG-GTT-GCT-GAT-GGT-GGT-TA CTT-CCC-AAA-GAC-CAC-ATG-CT

Cytochrome c oxidase subunit 1 Cox1 TCC-ACT-ATT-TGT-CTG-ATC-CGT-ACT AGT-AGT-ATA-GTA-ATG-CCT-GCG-GCT-A

Estrogen related receptor α Errα CCT-GGT-CGT-TGG-GGA-TGT GGA-CAG-CTG-TAC-TCG-ATG-CTC

Fatty acid translocase/CD36

antigenCD36 ATT-AAT-GGC-ACA-GAC-GCA-GC TTC-AGA-TCC-GAA-CAC-AGC-GT

Forkhead box O1 Foxo1 GTG-AAC-ACC-AAT-GCC-TCA-CAC CAC-AGT-CCA-AGC-GCT-CAA-TA

Glutathione peroxidase 1 Gpx1 CAC-CCG-CTC-TTT-ACC-TTC-CT TCG-ATG-TCG-ATG-GTA-CGA-AA

Lipoprotein lipase Lpl GGG-CTC-TGC-CTG-AGT-TGT-AG CCA-TCC-TCA-GTC-CCA-GAA-AA

Mitofusin 2 Mfn2 CGA-GGC-TCT-GGA-TTC-ACT-TC CAA-CCA-GCC-AGC-TTT-ATT-CC

Muscle specific ring finger

protein1

MuRF1/

Trim63GCA-GGA-GTG-CTC-CAG-TCG TCT-TCG-TGT-TCC-TTG-CAC-AT

Nuclear respiratory factor 1 Nrf1 TGG-AGT-CCA-AGA-TGC-TAA-TGG GCG-AGG-CTG-GTT-ACC-ACA

Peroxisome proliferator-activated

receptor β/δPpar β/δ ATG-GGG-GAC-CAG-AAC-ACA-C GGA-GGA-ATT-CTG-GGA-GAG-GT

Peroxisome proliferator-activated

receptor γ coactivator 1α PGC1α TGC-TGC-TGT-TCC-TGT-TTT-C CCC-TGC-CAT-TGT-TAA-GAC-C

Phosphofructo-

kinase 1Pfk 1 GCC-AAA-GGT-CAG-ATT-GAG-GA CAG-GTT-CTT-CTT-GGG-GAG-AGT

Pyruvate dehydrogenase

kinase 2Pdk 2 TTC-AGC-AAT-TTC-TCC-CCG-TC AGG-CAT-TGC-TGG-ATC-CGA-AG

Pyruvate dehydrogenase

kinase 4Pdk 4 GCT-GGA-TGT-TTG-GTG-GTT-CT TGC-TTT-GAT-TCC-TCC-CAT-CC

RNA Polymerase II polypeptide A Polr2a AAT-CCG-CAT-CAT-GAA-CAG-TG CA-TCC-ATT-TTA-TCC-ACC-ACC

TATA box binding protein Tbp CCA-ATG-ACT-CCT-ATG-ACC-CCT-A CAG-CCA-AGA-TTC-ACG-GTA-GAT

Figure E1.

A.

B.

C.

Glucose tolerance test

Pfk1

Insulin resistance test

Figure E2.

A.

Pdk4

Pdk2

Foxo1

Axotomy B. Soleus

Pdk4

Pdk2

Foxo1

A.

Figure E3.

B. C.Pdk2

RESULTS 2

Tissue specific deregulation of selected HDACs characterizes

ALS progression in mouse models

58

The numerous HDACs expressed in mammalian tissues are classified in

four different classes. Classes I, II and IV are considered typical Zn2+-

dependent HDACs (from 1 to 11), while class III comprises NAD+-dependent

deacetylases also called sirtuins (from 1 to 7).

Globally, typical HDACs are considered as transcription inhibitors due to

their role in histone deacetylation and chromatin condensation. In the past

decade several studies indicated a protective effect of HDACs inhibitors on

neurons (Chuang et al., 2009). Several positive results have also been

obtained in SOD1 transgenic mice treated with 4-phenylbutyrate, either alone

(Ryu et al., 2005) or in combination with other molecules (Petri et al., 2006;

Del Signore et al., 2009). Valproate (Rouaux et al., 2007) or trichostatin A had

more limited benefits (Yoo and Ko, 2011). Sirtuins, and especially Sirt1,

occupy a special position amongst HDACs, due to the important role they

have in controlling metabolism and extending life span (Guarente and Picard,

2005). Sirt1 is a highly conserved NAD+-dependent deacetylase that acts as

an energy sensor, orchestrating a series of adaptive response in times of

nutrient deprivation (Bordone and Guarente, 2005). Sirt1 deacetylates and

activates several important targets like PGC-1α, FOXO, but it also inactivates

the pro-apoptotic factor p53. Sirt1 activation has been documented as

neuroprotective in animal models for Alzheimer’s disease and ALS (Kim et al.,

2007). In general, targeting HDACs in neurodegeneration shows some

promising result. However due to the multitude of targets regulated by

HDACs, undesired deleterious effects can sometimes accompany the

beneficial effects and they should be used with consideration (Dietz and

Casaccia, 2010). The aim of our study was to better characterize the

expression of HDACs in two different mSOD1 ALS models (G93A and G86R),

with emphasis on Sirt1 and Sirt2 as potential therapeutic targets.

In the spinal cord of both models mRNA and protein levels of Sirt1 were

decreased, while Sirt2 was increased. The same trend was observed in

neuroblastoma cell line SH-SY5Y expressing mSOD1G93A. However in this

59

setting, overexpression of mSOD1G93A had no effects on the acetylation levels

of target proteins like PGC-1α, acetyl-tubulin or p53. Using a Sirt1 specific

activator (Sirt1720) did not rescue neurons expressing mSOD1G93A. Equally,

inhibiting Sirt2 had no effect on neuronal survival. On the other hand using a

known inhibitor of Sirt1, Ex527, we observed an increased in cell viability

accompanied by a decrease in caspase 3 activation. The effect of Ex527

bypassed Sirt1, as no changes in acetylation of target proteins were

observed. These puzzling results seemed to suggest that Sirt1 could not

rescue neurons from apoptosis. This was further confirmed by overexpressing

a constitutively active Sirt1 in neuronal cells expressing mSOD1G93A that did

not rescue neurons from apoptosis.

The effects of mSOD1 on the two considered sirtuins are different in

muscle tissue or in the myoblast cell line C2C12. Sirt2 expression does not

change during disease progression, however an upregulation of both mRNA

and protein expression of Sirt1 were observed at late stages of the disease.

The same trend was observed in C2C12 overexpressing mSOD1G93A. As it

was mentioned previously, Sirt1 plays an essential protective role in muscle

metabolism, especially during times of energetic stress. The fact the mSOD1

can trigger Sirt1 activation in muscle C2C12 cell line, in absence of neuronal

cells, is of outmost importance, underpinning the direct effect of mSOD1 on

muscle metabolic homeostasis.

Taken altogether, these data show a different regulation of Sirt1 and 2 in

spinal cord and muscle tissue. While Sirt1 emerges as an interesting potential

target in muscle tissue, no beneficial effects of Sirt1 modulation were

observed in differentiated motor neurons. For this reason future therapeutic

approaches targeting Sirt1 should be carefully considered.

60

OPEN

Tissue-specific deregulation of selected HDACscharacterizes ALS progression in mouse models:pharmacological characterization of SIRT1 and SIRT2pathways

C Valle1,2, I Salvatori2,3, V Gerbino2,3, S Rossi2,3, L Palamiuc4,5, F Rene4,5 and MT Carrı*,2,3

Acetylation homeostasis is thought to play a role in amyotrophic lateral sclerosis, and treatment with inhibitors of histonedeacetylases has been considered a potential and attractive therapeutic approach, despite the lack of a thorough study of thisclass of proteins. In this study, we have considerably extended previous knowledge on the expression of 13 histonedeacetylases in tissues (spinal cord and muscle) from mice carrying two different ALS-linked SOD1 mutations (G93A-SOD1 andG86R-SOD1). We have then focused on class III histone deacetylases SIRT1 and SIRT2 that are considered relevant inneurodegenerative diseases. SIRT1 decreases in the spinal cord, but increases in muscle during the progression of the disease,and a similar expression pattern is observed in the corresponding cell models (neuroblastoma and myoblasts). SIRT2 mRNAexpression increases in the spinal cord in both G93A-SOD1 and G86R-SOD1 mice but protein expression is substantiallyunchanged in all the models examined. At variance with other sirtuin modulators (sirtinol, AGK2 and SRT1720), the well-knownSIRT1 inhibitor Ex527 has positive effects on survival of neuronal cells expressing mutant SOD1, but this effect is neithermediated by SIRT1 inhibition nor by SIRT2 inhibition. These data call for caution in proposing sirtuin modulation as a target fortreatment.Cell Death and Disease (2014) 5, e1296; doi:10.1038/cddis.2014.247; published online 19 June 2014

Accumulating evidence indicates that altered acetylation

homeostasis has a determinant role in the pathogenesis of

amyotrophic lateral sclerosis (ALS), a late-onset neurode-

generative disorder characterized by progressive muscle

atrophy and paralysis because of the death of upper and

lower motoneurons.1

Acetylation is controlled by two classes of enzymes with

opposite function: histone acetyltransferases (HATs) and

histone deacetylases (HDACs). During neurodegeneration,

the levels of acetylation in neurons are decreased globally2,3

as a consequence of an imbalance in the acetylation

apparatus because of general loss of HATs.4–6 Once the

balance is disturbed and the HAT/HDAC ratio shifts in favor of

HDAC in terms of availability and enzymatic functionality, an

altered transcription profile is observed, typically represented

by the repression of pro-survival molecules and the derepres-

sion of several pro-apoptotic gene products.2,3 Thus, in the

past decade, the use of HDAC inhibitors has been considered

a potential and attractive therapeutic approach.5,7–11

In mammals, 18 HDACs have been identified and classified

based on cofactor dependency and sequence similarity. Two

families have been described: the ‘classical’ HDACs with 11

members that require Zn2þ for deacetylase activity, and the

sir2-related HDACs called Sirtuins (silent information regu-

lator (SIRT)) with 7 members that require NADþ as cofactor.

Up to date, little is known about the involvement of the

individual HDAC isoforms in ALS onset and progression and a

thorough survey of all isoforms has never been carried out.

Previous work on post-mortem ALS brain and spinal cord

specimens indicates a reduction of HDAC11 mRNA and

increased HDAC2 levels.12

A crucial role of muscle HDAC4 and its regulator microRNA-

206was suggested in theG93A-SOD1mousemodel of ALS13

and, more recently, it has been observed that HDAC4 mRNA

and protein levels in muscle are greater in patients with rapidly

progressive ALS, and this negatively influences reinner-

vation.14 These studies strongly suggest a negative role of

muscle HDAC4 upregulation on the reinnervation process.

The role of HDAC6 is still debated, possibly because it

catalyzes multiple reactions.15 An in vitro interaction between

TDP-43 and HDAC6 has been demonstrated, suggesting that

the lack of activity of HDAC6 induced by TDP-43 may be a

pathogenic factor in ALS.16 More recently, Taes et al.17

reported that the deletion of HDAC6 in an ALS mouse model

1Institute for Cell Biology and Neurobiology, CNR, Rome, Italy; 2Fondazione Santa Lucia IRCCS, Rome, Italy; 3Department of Biology, University of Rome Tor Vergata,Rome, Italy; 4INSERM U1118, Laboratoire de Mecanismes Centraux et Peripheriques de la Neurodegenerescence, Strasbourg, France and 5Universite de Strasbourg,Faculte de Medecine, UMRS1118, Strasbourg, France*Corresponding author: MT Carrı, Department of Biology, University of Rome Tor Vergata, Via della Ricerca Scientifica, Rome 00133, Italy. Tel: þ 39 6 501703087;Fax: þ 39 6 501703323; E-mail: carri@Bio.uniroma2.it

Received 05.3.14; revised 22.4.14; accepted 23.4.14; Edited by A Verkhratsky

Abbreviations: HDAC, histone deacetylase; HAT, histone acetyltransferase; ALS, amyotrophic lateral sclerosis; SOD1, Cu–Zn superoxide dismutase; SIRT, silentinformation regulator-sirtuin; RT-PCR, real-time PCR; UPL, universal probe library

Citation: Cell Death and Disease (2014) 5, e1296; doi:10.1038/cddis.2014.247

& 2014 Macmillan Publishers Limited All rights reserved 2041-4889/14

www.nature.com/cddis

significantly extends survival and maintains motor axon

integrity without affecting disease onset. This protective effect

is associated with increased a-tubulin acetylation. However, it

has also been reported that HDAC6 knockdown increases

mutant Cu–Zn superoxide dismutase (SOD1) aggregation in

cultured cells and mutant G93A-SOD1 can modulate HDAC6

activity and increase tubulin acetylation.18

Some experimental evidence for a role of Sirtuins in ALS is

also available. SIRT1 overexpression protects neurons

against toxicity induced by mutant G93A-SOD1 in both

cultured neurons and mouse brain.19 SIRT1 is upregulated

in the spinal cord of mutant G37R-SOD1mice,19 in the cortex,

hippocampus, spinal cord and thalamus of G93A-SOD1

transgenic mice20 and in spinal neurons from post-mortem

patient samples,21 whereas it is reduced in primary motor

cortex.21 Deletion of SIRT2 fails to affect the disease course,

and also does not modify a-tubulin acetylation in the G93A-

SOD1 mouse,17 whereas SIRT3 protects against mitochon-

drial fragmentation and neuronal cell death induced by mutant

SOD1.22

Thus, the proposed neuroprotective/neurotoxic role of

Sirtuins still remains debated.21

With the aim to better understand whether specific HDAC

isoforms play a major role in ALS onset and progression and

whether their modulation may rescue the ALS phenotype, in

this work we analyzed the specific expression pattern of all

HDACs in spinal cord and muscle from two ALS transgenic

mice models (G93A-SOD1 and G86R-SOD1) and in neuronal

and muscle cell cultures expressing mutant SOD1.

Only a few HDACs showed an altered expression profile in

ALS tissues and therefore we focused our interest on themost

extensively studied SIRT1 and on treatment with its known

modulators.

Results

Expression of selected HDAC isoforms is modulated

during progression of the disease in mice. In order to get

a complete picture of known HDACs in the course of ALS, we

have performed an extended analysis of the expression of all

HDACs by real-time PCR (RT-PCR) on mRNA extracted

from the spinal cord of two well-characterized models for

mutant SOD1-linked ALS. Both G93A-SOD1 and G86R-

SOD1 transgenic mice essentially recapitulate the human

form of the disease, although with a difference in age of onset

and survival (see Materials and Methods). In this paper, we

report data on all the 11 canonical class I–II–IV isoforms and

two class III Sirtuins (SIRT1 and SIRT2). We have not been

able to monitor SIRT4–7, possibly because of their low level

of expression. Data on SIRT3 are the subject of a separate

paper (C Valle et al., manuscript in preparation). In the spinal

cord, mRNA expression of most HDACs is not grossly

affected (Supplementary Figure S1) during the course of the

disease in both mice strains compared with age-matched

nontransgenic littermates, with the notable exception of

HDAC5 and SIRT1 that clearly decrease during progression

and HDAC11 and SIRT2 that clearly increase in this tissue

during progression of the disease (Figure 1). As observed in

HDAC5

**

*

145d

155d

125d

133d

93d

103d

113d

0

0.2

0.4

0.6

0.8

1

1.2 #

*

SIRT1

0

0.5

1

1.5

93d

103d

113d

125d

133d

155d

145d

*

#

fold

of

exp

ressio

n

0.5

1.5

0

1

2

SIRT2

93d

103d

113d

133d

125d

145d

155d

* *

#

SIRT1

0

0.5

1

1.5

*

65d

90d

105d

*

#

fold

of

exp

ressio

n

0

0.5

1

1.5

2

SIRT2

105d

65d

90d

**

#

HDAC11fo

ld o

f exp

ressio

n

#

65d

90d

105d

0

0.5

1

1.5

2

2.5

3

3.5

4*

*

HDAC11

fold

of

exp

ressio

n

#

*

155d

125d

145d

133d

113d

103d

93d

0

0.5

1

1.5

2

2.5

3

3.5

**

*

*

*

HDAC5

65d

105d

90d

fold

of

exp

ressio

n

#

0

0.2

0.4

0.6

0.8

1

1.2

*

fold

of

exp

ressio

n

fold

of

exp

ressio

n

fold

of

exp

ressio

n

Figure 1 Expression of selected mRNAs coding for HDACs in the spinal cord of ALS mice. The cDNAs obtained from total RNA extracted from spinal cord of G93A-SOD1(dark bars) and G86R-SOD1 (light bars) transgenic mice and their nontransgenic littermates were analyzed by quantitative RT-PCR to assess mRNA expression of HDAC5,HDAC11,SIRT1 and SIRT2. Analysis was performed at different stages of disease starting from early presymptomatic to end stage. The mRNA levels from control mice are setas 1. Results were obtained from at least three different mice from each stage and are expressed as the ratio between the average of values, normalized to the average valuesof two different housekeeping genes, from nontransgenic and transgenic mice. *Po0.05 with respect to nontransgenic mice of the same age; #Po0.05 with respect topresymptomatic or early symptomatic transgenic mice for G93A-SOD1 genotype, and with respect to presymptomatic or symptomatic transgenic mice for G86R-SOD1genotype

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

2

Cell Death and Disease

western blot analysis from the same tissue, this trend is

conserved at the level of immunoreactive protein for HDAC5,

HDAC11 and SIRT1, although changes are slightly delayed

in the course of the disease, whereas SIRT2 protein level is

not significantly altered (Figures 2a–d and Supplementary

Figure S2). Furthermore, expression of mutant SOD1 does

not change the localization of SIRT1, which is mainly nuclear,

and of SIRT2, which is mainly cytosolic, as in nontransgenic

mice (Figure 2e). Interestingly, the expression pattern of

SIRT1 and SIRT2 is not conserved in the muscle (tibialis

anterior) from G93A-SOD1 transgenic mice, where SIRT1

increases and SIRT2 is not changed during the disease

(Figures 3a and b).

The trend observed in mice tissues is reproduced quite

faithfully in both corresponding cell models examined. In

differentiated neuronal cells expressingmutant SOD1, protein

levels are again decreased for HDAC5 and SIRT1 and

increased for HDAC11 (Figures 4a and b). However, upon

expression of mutant SOD1, there are no changes in the

acetylation state of SIRT1 main targets p53 and PGC1a

(Figures 4a, c and d) or main target of SIRT2 tubulin

(Figure 4a). Moreover, expression of mutant SOD1 does not

123d 132d 145d 155d

!-actin

hSOD1

mSOD1

HDAC5

HDAC11

Spinal cord

-- -+ + + - +

HD

AC

11 e

xp

ressio

n

123d

132d

145d

159d

0

50

100

150

200

250

*

**

**

##

123d

132d

145d

159d

0

20

40

60

80

100

120

HD

AC

5 e

xp

ressio

n

**

**

##

SIRT2

!-actin

Spinal cord

113d 132d123d 145d

-- -+ + + - + - +

Brain

155d

- + -

155d

SIR

T1 e

xp

ressio

n

0

20

40

60

80

100

120

113d

123d

132d

145d

155d

###

**

*

- +

cyt

nu

c

cyt

nu

c

Lamin b

SIRT1

SIRT2

hSOD1

mSOD1

Spinal cord

113d 123d 132d 145d 155d

- +

Brain

155d

SIRT1

!-actin

- - + + - - + + - - + ++ --- ++ +-

SIR

T2 e

xp

ressio

n

0

20

40

60

80

100

120

113d

123d

132d

145d

155d

Figure 2 HDAC protein expression in spinal cord of ALS mice. (a) Western blot analysis of 30 mg of total protein extract from spinal cord of transgenic (þ ) andnontransgenic (" ) G93A-SOD1mice from symptomatic (123d) to end stage (155d) of disease using antibodies against HDAC5 and HDAC11, b-actin as a loading control andSOD1 to confirm genotypes. hSOD1 indicates exogenous human SOD1, and mSOD1 is endogenous mouse SOD1. (b and c) Same as (a) but starting from early symptomaticstage of disease (113d) using antibodies against SIRT1 and SIRT2. Total brain protein extract was used to confirm tissue specificity. (d) Densitometric analysis of data fromn¼ 4 G93A-SOD1 and n¼ 4 nontransgenic mice from different experiments. *Po0.05 and **Po0.01 with respect to nontransgenic mice of the same age; ##Po0.01 withrespect to symptomatic transgenic mice. (e) Western blot analysis of cytosolic (cyt) and nuclear (nuc) protein extract from late symptomatic (145 days) G93A-SOD1(G93A) and nontransgenic (" ) mice using antibodies against SIRT1 and SIRT2. Fractions were controlled for the presence of the nuclear marker lamin B and the cytosolicmarker SOD1

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

3

Cell Death and Disease

change the localization of these proteins as in differentiated

SH-SY5Y cells, HDAC5, HDAC11 and SIRT1 are mainly

nuclear whereas SIRT2 is cytosolic, as in control cells

(Figure 4e). In addition, SIRT1 increases in C2C12 muscle

cells expressing G93A- SOD1 (Figures 5a and b) where, at

variance with SH-SY5Y cells, p53 is a target of SIRT1 (see

below).

Modulation of sirtuins and protection from cell damage.

SIRT1 is considered a pro-survival protein,23 whereas the

role of SIRT2 is still not clearly established.23 Based on the

results reported above, we further investigated whether

known inhibitors or activators of SIRT1 are able to mimic

the effects of G93A mutant SOD1 or to revert its toxicity in

neurons. To this aim, we treated differentiated SH-SY5Y

cells expressing Wt or mutant G93A-SOD1 with AGK2

(SIRT2 inhibitor), Ex527 (SIRT1 inhibitor), SIRTinol (SIRT1

and SIRT2 inhibitor) and SRT1720 (SIRT1 activator)

(Figure 6a).

As shown in Figure 6, only Ex527 is able to restore viability

in neuronal cells infected with viral vectors coding for the

mutant protein (Figure 6b) and to prevent caspase-3 activa-

tion in a dose-dependent manner (Figure 6c). SIRTinol, which

similarly to Ex527 efficiently inhibits SIRT1 activity, has no

positive effect in preventing toxicity by mutant SOD1 and

SRT1720, which efficiently increases SIRT1 activity, neither

affects basal viability nor modulates SOD1 toxicity.

G93A-SOD1 toxicity is not mediated by p53 acetylation

state or by IRS-2/Ras/ERK1/2 pathway. Overall, the above

results suggest that Ex527 counteracts mutant SOD1 toxicity

in neuronal cells independently from SIRT1 inhibition.

Indeed, by western blot analysis we could neither detect

significant differences in the level of acetylated p53 (SIRT1

direct target) nor in the level of Erk1/2 and phospho-Erk1/2 in

SH-SY5Y cells (Figures 7a and b). At the same time, the

level of acetylated tubulin also remains unchanged (Figures

7a and b). Furthermore, the MEK1/2 inhibitor SL327, which is

known to act immediately upstream of ERK1/2 in the IRS-2/

Ras/Erk1/2 pathway, does not protect SH-SY5Y cells from

G93A-SOD1 toxicity (Figure 7c). Similar results were

obtained with MEK inhibitor UO126 (not shown). Interest-

ingly, p53 is a target of SIRT1 acetylation in C2C12 cells

(Figures 7d and e) but not in SH-SY5Y cells.

That the protective effect of Ex527 is independent from

SIRT1 inactivation is further demonstrated by results reported

in Figure 8. Constitutive overexpression of SIRT1 in SH-SY5Y

cells (Figures 8a and b) efficiently increases SIRT1 activity

(Figure 8c) but is not able to protect cells from mutant SOD1

toxicity in terms of viability (Figure 8d), caspase-3 activation

(Figure 8e) and PARP cleavage (Figures 8f and g).

Discussion

The use of HDAC inhibitors has been repeatedly suggested

as a potential and attractive therapeutic approach for ALS

treatment. However, in our opinion, the results in the literature

and in this work should be pondered critically before any

clinical attempt.

This consideration arises from the following observations:

(1) The pattern of expression of the various HDAC isoforms

is not conserved between spinal cord and muscle of ALS

mice. This suggests that systemic administration of any

known modulator of these enzymes would have conflicting

outcomes in different tissues and possibly bring no benefit to

patients.

(2) Current knowledge of HDAC activity is still incomplete.

For instance, data in this work suggest that p53 is not a

molecular target of SIRT1 in neuronal cells, whereas it is

SIRT1 dependent in muscle cells, at least in culture conditions

where there is no neuron–muscle cross-talk. This implies that

HDAC targets may be different in different cell types or tissues

andmay reflect a different role of these proteins in specific cell

types, where they may exert a protective role or contribute to

increase toxicity from the expression of G93A-SOD1. This is

in line with a recent report17 that tubulin is not a major target of

SIRT2 in the nervous system.

(3) Current knowledge of HDAC modulators is still

incomplete. Based on the observation that SIRT1 is down-

regulated during progression of the disease in spinal cords of

ALS mice, in this work we have focused on the possibility to

activate SIRT1 as a neuroprotective strategy.

SIRT1 mediates heterochromatin formation through dea-

cetylation of histones H1, H3 and H4,24,25 and is also involved

in the acetylation of nonhistone proteins, mainly transcription

factors or coactivators, including p53, FOXOs, PGC1a, p73,

BCL6 and others.26–28 Because of its ability to deacetylate a

variety of substrates, SIRT1 is considered an important

regulatory key in a broad range of physiological functions,

including tumorigenesis,29 metabolism,30 aging31 and

neurodegeneration.32–34

0

20

40

60

80

100

120

140

113d

123d

132d

145d

159d

Sir

t12 e

xp

ressio

n#

0

20

40

60

80

100

120

140

160

180

113d

123d

132d

145d

159d

Sir

t1 e

xp

ressio

n

***

Sirt1

Sirt2

Tibialis Anterior

-

-

++-- ++- ++- - - ++-

123d113d 132d 145d 159d

++- -

!-actin

Figure 3 SIRT1 and SIRT2 expression in the muscle of G93A-SOD1 mice.(a) Western blot analysis of 20mg of total protein extract from Tibialis anterior oftransgenic (þ ) and nontransgenic (" ) G93A-SOD1 mice from symptomatic(113d) to end stage (159d) of disease using antibodies against SIRT1 and SIRT2.b-Actin was used as loading control. (b) Densitometric analysis of n¼ 4 G93A-SOD1 and n¼ 4 nontransgenic mice from different experiments. Valuessignificantly different from relative controls are indicated with *Po0.05 with respectto nontransgenic mice of the same age; #Po0.05 with respect to early symptomatictransgenic mice

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

4

Cell Death and Disease

We analyzed the effects of different activators/inhibitors on

SH-SY5Y cells infected with adenoviral vector coding for

G93A-SOD1. Unexpectedly, SIRT1 inhibitor Ex527 is the only

drug that is able to rescue the ALS phenotype in the neuronal

cells expressing the mutant protein. Ex527 was originally

described as a compound inhibiting the activity of SIRT1 in

nanomolar concentration (and SIRT2 at micromolar concen-

trations). However, SIRTinol, which similarly to Ex527

efficiently inhibits SIRT1 activity, and AGK2, which inhibits

SIRT2 activity, have no positive effect in this model.

Furthermore, the beneficial effect of Ex527 seems to be

independent of the known SIRT1 pathway in these cells

and overexpression of SIRT1 per se does not counteract

mutant SOD1 toxicity. Interestingly, SRT1720 efficiently

increases SIRT1 activity without affecting basal viability or

modulating SOD1 toxicity. This supports that SIRT1 is not a

pro-survival protein in the ALS context.

Finally, Ex527 efficiently stimulates p53 acetylation in

muscle cells where SIRT1 is increased by mutant SOD1

expression whereas it has no effect on the same target in

neuronal cells (Figure 7).

Overall, these data suggest that SIRT1 inhibitor Ex527 has

other, previously unappreciated and possibly tissue-specific

properties that should be further investigated. Understanding

the mechanisms underlying the neuroprotective effects of

Ex527 on neurons may offer new perspective to develop

IP: Ac-lys

WB: PGC1!

Input

WB: PGC1!

Wt

G9

3A

90kd

Ctr

l

Wt

G9

3A

SIRT1

Ac-Tub

SIRT2

Tub

SOD1

"-actin

p53-Ac

p53 tot

HDAC11

HDAC5

53kd IP: Ac-lys

WB: p53

Input

WB: p53

Wt

G9

3A

Wt

G93A

HDAC11 dapi merge

HDAC11 dapi merge

G93A

Wt

HDAC5 dapi merge

HDAC5 dapi merge

Wt

G93A

SIRT1 hoechst merge

SIRT1 mergehoechst

Wt

G93A

SIRT2 merge

SIRT2 merge

hoechst

hoechst

HD

AC

11

ex

pre

ss

ion

0

50

100

150

200

250

**

##

0

20

40

60

80

100

120

HD

AC

5 e

xp

res

sio

n

**

##

Ctr

l

Wt

G9

3A

Ctr

l

Wt

G9

3A

0

20

40

60

80

100

120

SIR

T2

ex

pre

ss

ion

Ctr

l

Wt

G9

3A

0

20

40

60

80

100

120

SIR

T1

ex

pre

ss

ion

**

##

Ctr

l

Wt

G9

3A

Figure 4 Protein expression patterns of HDAC5, HDAC11, SIRT1 and SIRT2 in differentiated human SH-SY5Y neuroblastoma cells. SH-SY5Y cells were uninfected (Ctrl)or infected with adenoviral vectors coding for wild-type SOD1 (Wt) or G93A-SOD1 (G93A). (a) Western blot analysis of 20mg of cell lysate using antibodies against HDAC5,HDAC11, SIRT1, SIRT2, p53-Ac and Ac-tubulin. b-Actin was used as loading control, SOD1 as infection control, and P-53 and tubulin to monitor the acetylation rate.(b) Densitometric analysis of n¼ 3 experiments as in (a). Values significantly different from relative controls are indicated with **,##Po0.01. (c and d) Western blot analysis todetect PGC1a and p53 acetylation, respectively, in the immunoprecipitate with anti Ac-lysine antibody. In the lower panel, 5% of input is shown. (e) Immunolocalization ofHDAC5, HDAC11, SIRT1 and SIRT2. Panels show typical images observed in n¼ 3 independent experiments. Scale bar: 5mm

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

5

Cell Death and Disease

innovative strategies for treating ALS and neurodegenerative

disorders.

Materials and MethodsAntibodies and reagents. The antibodies used in this study are:anti-HDAC1, anti-HDAC2, anti-SIRT2 and anti-PGC1 rabbit polyclonal (SantaCruz Biotechnology, Dallas, TX, USA); anti-HDAC3, anti-HDAC6 and anti-lamin Bgoat polyclonal (Santa Cruz Biotechnology); anti-HDAC4 mouse polyclonal (SantaCruz Biotechnology); anti-HDAC5 and anti-HDAC11 rabbit polyclonal (Abcam,Cambridge, UK); anti-HDAC7 rabbit polyclonal (Novus Biologicals, Littleton, CO,USA); anti-HDAC8 and anti-HDAC9 mouse monoclonal (Novus Biologicals); anti-HDAC10 rabbit polyclonal (Millipore, Burlington, MA, USA); anti-SIRT1 (mousespecific), anti-acetylated-lysine, anti-cleaved-PARP, anti-ERK1/2 and anti-Phos-pho-ERK1/2 rabbit polyclonal (Cell Signaling Technology, Beverly, MA, USA); anti-SIRT1 clone 10E4 mouse monoclonal (Millipore); anti-SIRT1 rabbit polyclonal(Millipore); anti-acetyl-p53 rabbit monoclonal (Millipore); anti-p53 mouse mono-clonal (Abcam); anti-tubulin, anti-acetyl-tubulin and anti-b-actin mouse monoclonal(Sigma-Aldrich, St. Louis, MO, USA); anti-SOD1 rabbit polyclonal (Enzo LifeScience, Plymouth Meeting, PA, USA); anti-rabbit, anti-mouse and anti-goatperoxidase-conjugated secondary antibody (Amersham, Pittsburgh, PA, USA);and anti-rabbit, anti-mouse FITC or Cy3-conjugated secondary antibody(Sigma-Aldrich). All antibodies were used at the dilution recommended by themanufacturer’s instructions.AGK2, Ex527, Sirtinol, SRT1720 and SL327 were from Tocris Bioscience

(Bristol, UK); all of them were resuspended in an appropriate volume of DMSO andkept stored at ! 801C before use.All reagents used, unless otherwise specified, were from Sigma-Aldrich.

hSOD1

Ctr

l

mSOD1

SIRT1

SIRT2

Ctrl

G93

ACtrl

G93

A0

25

50

100

125

75

% o

f S

IRT

2 e

xp

ressio

n

n.s.

% o

f S

IRT

1 e

xp

ressio

n

**

0

100

200

300

400

!-actin

G93A

Figure 5 Protein expression patterns of SIRT1 and SIRT2 in mouse myoblastC2C12 cells. Untransfected C2C12 (Ctrl) and C2C12 cells constitutively expressingG93A-SOD1 (G93A) were subjected to differentiation protocol to induce expression ofthe transgene under the myosin heavy chain promoter. (a) Western blot analysis of20mg protein from cells lysates obtained 5 days after differentiation of C2C12 cellsexpressing G93A-SOD1 (G93A) or untransfected (Ctrl) using antibodies againstSIRT1 and SIRT2. SOD1 was used to control genotype, b-actin as loading control.(b) Densitometric analysis of n¼ 3 experiments as in (a). Values significantly differentfrom relative controls are indicated with **Po0.01; n.s. indicates values that do notdiffer significantly

120

0

20

40

60

80

100

DM

SO

AG

K2

Ex

52

7

SIR

Tin

ol

% o

f c

ell

via

bil

ity

Ctrl

Wt

SR

T1

72

0

G93A

*

##

Ctrl

Wt

G93A

0

25

50

100

125

150

175

a

75

% o

f S

irt1

ac

tiv

ity

##

**

##

#

AG

K2

**

Ex

52

7

*

SIR

Tin

ol

SR

T1

72

0

DM

SO

0

50

100

150

200

250

% o

f c

as

pa

se

3 a

cti

vit

y

Ctrl

Wt

G93A

*

*

##

SR

T1

72

0

20

0n

M

SR

T1

72

0

10

nM

SR

T1

72

0

50

nM

DM

SO

SIR

Tin

ol

5"M

SIR

Tin

ol

20"M

SIR

Tin

ol

10"M

AG

K2

3"M

AG

K2

7.5

"M

AG

K2

15"M

Ex

52

7

0.3

"M

Ex

52

7

1"M

Ex

52

7

3"M

b

c

Figure 6 Effect of SIRT1 and SIRT2 modulation in differentiated SH-SY5Y cells. (a) SIRT1 activity was measured by a fluorometric assay on 40mg of total protein extractfrom either uninfected (Ctrl) and cells infected with adenoviral vectors coding for Wt-SOD1 (Wt) and G93A-SOD1 (G93A) treated with one of the following: 15mM AGK2, 3mMEx527 and 20mM SIRTinol that inhibit SIRT2, SIRT1 and both Sirtuins, respectively; and 10 nM SRT1720 that activates SIRT1. Activity is reported as percent of the relativeuninfected DMSO-treated control and reported as the mean±S.D. of three independent experiments with each sample in triplicate. Values significantly different from relativecontrols are indicated with *Po0.05 and **Po0.01 with respect to Ctrl; and #

Po0.05 and ##Po0.01 with respect to DMSO-treated cells. (b) SH-SY5Y cells either uninfected

(Ctrl) or infected with adenoviral vectors coding for Wt-SOD1 (Wt) and G93A-SOD1 (G93A) were treated with 15mM AGK2, 3 mM Ex527, 20mM SIRTinol and 10 nMSRT1720. Cell viability was assessed by the MTS assay 48 h after infection and drug treatments. Absorbance at 490 nm are expressed as percent of the relative uninfectedcontrol cells and reported as the mean±S.D. of three independent experiments made in triplicate. Values significantly different from relative controls are indicated with*Po0.05 with respect to Ctrl and ##

Po0.01 with respect to DMSO-treated cells. (c) Cells either uninfected (Ctrl) or infected with adenoviral vectors coding for Wt-SOD1 (Wt)and G93A-SOD1 (G93A) were treated with three increasing doses of AGK2, Ex527, SIRTinol or SRT1720. Cell protein extracts were assayed, 48 h after infection and drugtreatment, for Caspase-3 activity by a fluorescence enzymatic assay and reported as percent of the relative uninfected control cells. Mean±S.D. of four independentexperiments is given. Values significantly different from the relative controls are indicated with *Po0.05 with respect to Ctrl and ##

Po0.01 with respect to DMSO-treated cells

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

6

Cell Death and Disease

Animals. All animal procedures have been performed according to theEuropean Guidelines for the use of animals in research (86/609/CEE) andthe requirements of Italian and French laws (D.L. 116/92, Directive 2010/63/EU).The ethical procedure has been approved by the Animal welfare office,Department of Public Health and Veterinary, Nutrition and Food Safety, GeneralManagement of Animal Care and Veterinary Drugs of the Italian Ministry of Health(Application number 32/08 of 7 July 2008; Approval number 744 of 9 January2009) and the regional ethics committee CREMEAS 35 (approval numberAL/01/20/12). All the experiments were performed by authorized investigators.All animals have been raised and crossed in the indoor animal house in a 12 h

light/dark cycle in a virus/antigen-free facility with controlled temperature andhumidity and have been provided with water and food ad libitum.G93A-SOD1 mice B6.Cg-Tg(SOD1 G93A)1Gur/J were purchased from The

Jackson Laboratory (Bar Harbor, ME, USA) and were on C57BL/6J background. Inour animal house, these mice have an onset of disease at 113±6 days (determinedas previously described35) and survival of 156±8 days.G86R-SOD1mice were initially obtained from JonWGordon (NewYork, NY, USA).

In our animal house, these mice have an onset of disease at 90±4 days andsurvival of 108±5 days.Mice compared in this study were all littermates and housed together to minimize

environmental factors. Mice were genotyped using PCR protocols fromThe Jackson Laboratory or as previously described.36 At the indicated time, micewere anesthetized with 40þ 5mg/kg ketamine–xylazine, killed and dissected forthe different experiments. All efforts were made to minimize suffering.

For the staging of the disease of transgenic mice we relied on previous studiesfrom our laboratories.5,35,37

Cell culture, adenoviral infection and plasmid transfection.Human neuroblastoma cells (SH-SY5Y, from European Collection of Cell Cultures,Salisbury, UK) and murine myoblasts (C2C12, either untransfected or transfectedfor the inducible expression of G93A-SOD1, a kind gift of Dr A Musaro) weregrown in DMEM-Glutamax (Invitrogen, Carlsbad, CA, USA) supplemented with10% FCS (Invitrogen) at 371C in an atmosphere of 5% CO2 in air.

Where specified, SH-SY5Y cells were subjected to a differentiation protocol aspreviously described.38 Briefly, cells plated at the density of 25" 103 cells/cm2 werewashed with PBS and differentiated in DMEM-Glutamax supplemented with 1% N-2(Invitrogen) without serum by the addition of 10 mM retinoic acid for 3 days, afterwhich with 100 ng/ml brain-derived neurotrophic factor was added to the mediumand cells were kept for 3 more days in culture.

Myogenic differentiation of C2C12 cells atB80% cell confluence was obtainedby substituting the medium with fresh medium supplemented with 2% horse serum(EuroClone, Milan, Italy) to induce expression of mutant SOD1 under the myosinheavy chain promoter.39,40

Construction of recombinant adenoviruses expressing Wt-SOD1 as well asG93A-SOD1 was carried out in a previous work.37 Infection of SH-SY5Y cells wascarried out for 1 h in OPTIMEM (Invitrogen); after removal of the virus, cells weresubjected to the differentiation protocol and grown for the indicated period of timesbefore being used for further experimental manipulations.

DMSO

G93A

G93A

G93

A

Ctr

l

Ctrl

G93

ACtrl

Ctr

l

Ex527

p53

p53-Ac

!-actin

SIRT1

#

Ctrl

Wt

G93A

DM

SO

Ex527

SL327

Ex527

/SL32

70

20

40

60

80

100

120

140

% o

f v

iab

ilit

y

* *

G9

3A

G9

3A

P Erk1/2

Tubulin

Ac-Tubulin

!-actin

Wt

Wt

DMSO Ex527

SIRT1

Erk1/2

p53

p53-Ac

G93

AWt

G93

AWt

Ac

ety

lati

on

Ra

tio

0

1p53-Ac

p53

DMSO Ex527

G93

AWt

G93

AWt

Ac

ety

lati

on

Ra

tio

0

1Ac-Tub

Tub

DMSO Ex527

Acety

lati

on

Ra

tio

0

1 p53

p53-Ac

DMSO Ex527

Figure 7 G93A-SOD1 toxicity is not mediated by p53 acetylation state or by IRS-2/Ras/ERK1/2 pathway in SH-SY5Y cells. (a) Western blot analysis of 20mM of totalprotein extract from cells infected with adenoviral vectors coding for Wt-SOD1 (Wt) and G93A-SOD1 (G93A) and treated with 3 mM Ex527 or DMSO. Antibodies againstSIRT1, Erk1/2, pErk1/2, p53, p53-Ac, tubulin and Ac-tubulin were used. b-Actin was used as loading control. One representative blot is shown from three independentexperiments giving comparable results. (b) Densitometric analysis of results as in (a); data are expressed as acetylation ratio of p53 and tubulin. (c) Cells infected withadenoviral vectors coding for Wt-SOD1 (Wt) and G93A-SOD1 (G93A) were treated with 3 mM Ex527 or with 3 mM SL327 or both. Cell viability was assessed and reported forFigure 5a. Values significantly different from relative controls are indicated with *Po0.05 with respect to Ctrl and #

Po0.05 with respect to DMSO. (d) Western blot analysis of20mM of total protein extract from C2C12 cells differentiated for 5 days and expressing G93A-SOD1 (G93A) or untransfected (Ctrl). Antibodies against SIRT1, p53 and p53-Acwere used. b-Actin was used as loading control. One representative blot is shown from three independent experiments giving comparable results. (e) Densitometric analysis ofdata as in (d); data are expressed as acetylation ratio of p53

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

7

Cell Death and Disease

Human cDNA coding for SIRT1 (accession number AF083106) was cloned byreverse transcription-PCR from human SH-SY5Y neuroblastoma cell cDNA using theforward primer 50-AAAAAGCTTATGGCGGACGAGGCGGCC-30 and the reverseprimer 50- TTTCTCGAGCTATGATTTGTTTGATGGATAG-30. The resulting PCR

fragment was inserted into HindIII/XhoI restriction sites of pcDNA3 (Invitrogen). Plasmidconstruction was verified by automated sequencing. Transfection for either transient orstable expression of SIRT1 was obtained with Lipofectamine Plus reagent (Invitrogen)according to the manufacturer’s instructions.

SIRT1

!-actin

% o

f c

as

pa

se

ac

tiv

ity

0

20

40

60

80

100

120

140

160

180

200

SIRT1

Ctrl

Wt G93A

Ex527

#

n.s.

Ctrl

SIRT1

Wt G93A

Ex527

#

n.s.

0

20

40

60

80

120

100

0

25

50

100

150

125

75

175

% o

f d

en

sit

om

etr

ic u

nit

0

Ctrl

SIRT1

Ctrl

SIRT1

Ctrl

SIRT1

20

40

60

80

100

120

140

Ex527

n.s.

Cleaved

PARP

!-actin

Ctrl

Ex527

SIRT1

% S

IRT

1 a

cti

vit

y

% o

f v

iab

ilit

y

(+) (+)(-) (-) (-)

(+) (+)(-) (-) (+) (+)(-) (-)

* *

Figure 8 Constitutive overexpression of SIRT1 does not protect differentiated SH-SY5Y neuroblastoma cells from G93A-SOD1 toxicity. (a) Immunofluorescenceanalysis on SH-SY5Y cells untransfected or stably transfected for SIRT1 overexpression using antibodies against SIRT1. Scale bar: 10 mm. (b) Western blot analysis of20 mg of total protein extract from cells either untransfected (Ctrl) or stably transfected for SIRT1 overexpression (SIRT1) using antibodies against SIRT1 and b-actin as aloading control. One representative blot from three independent experiments giving comparable results is shown. (c) SIRT1 activity was measured by a fluorometric assayon 40 mg of total protein extract from either untransfected (Ctrl) or stably transfected cells (SIRT1). Activity is reported as percent of control cells and as the mean±S.D. ofthree independent experiments with each sample done in triplicate. Values significantly different from relative controls are indicated with **Po0.01 with respect to Ctrl.(d) Cell viability of untransfected (Ctrl) and stably transfected (SIRT1) cells infected with adenoviral vectors coding for Wt-SOD1 (Wt) and G93A-SOD1 (G93A). Values arethe mean±S.D. of three independent experiments in triplicate. Values that do not differ significantly are marked with n.s. (e) Total protein extracts from cells as in (d) andtreated with 3 mM Ex527 were assayed after 48 h for Caspase-3 activity. Data are reported as the mean±S.D. of three independent experiments. Values that do not differsignificantly with respect to the relative control are marked with n.s; #Po0.05 significantly different with respect to DMSO. (f) Western blot analysis of cleaved PARP in20 mg of total protein extract from cells as in (d) and treated with DMSO (! ) or 3 mM Ex527 (þ ). Antibodies against b- actin were used as loading control.One representative blot is shown from three independent experiments giving comparable results. (g) Densitometric analysis of n¼ 4 experiments as in (f). n.s. indicatesvalues that do not differ significantly

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

8

Cell Death and Disease

For stable expression, after selection with 400mg/ml G418 (Gibco BRL, GrandIsland, NY, USA), B25 clones were isolated independently and analyzed inwestern blot with anti-SIRT1 antibodies. Three clones were chosen for equivalentexpression of SIRT1 proteins and used for further analysis. All the clones analyzedgave consistent results and data from one clone are shown.Conditions for treatments with Sirtuins modulators are given in the Figure

legends. All drugs were added to the culture medium starting from infection/differentiation protocol and were maintained in all medium changes. Medium with orwithout experimental drugs was replaced every 3 days.

RNA extraction, reverse transcription and RT-PCR. Total RNA wasextracted from spinal cord and muscle of transgenic mice and their nontransgeniclittermates at different stages of disease using TRIzol reagent (Invitrogen). TheSuperScript III First-Strand reverse transcription system (Invitrogen) was used tosynthesize cDNA, with 1mg of total RNA and random hexamers, according to themanufacturer’s instructions. Appropriate negative controls were included (withoutreverse transcriptase) to determine the presence of genomic DNA contamination.Samples with genomic contamination were treated with DNase I, Amp Grade(Invitrogen) following the manufacturer’s instructions.RT-PCR analysis was performed on custom-designed plates from Roche (Hilden,

Germany). Each well contained primers (see Table 1) and probes (UPL (UniversalProbe Library) probe) specific for the genes of interest (all canonical HDACs and SIRT1and SIRT2) designed to pair up within regions to be amplified. Each test was performedin duplicate. As a control for the efficiency of reverse transcription and RNA quality,some wells were prepared with specific oligonucleotides designed to amplify the 30, 50

and central regions of the template; in order to exclude genomic contamination,untranscribed RNA samples were loaded in two wells as negative controls. Ashousekeeping genes we chose b-actin and glucose-6-phosphate dehydrogenase(G6pdx); both were used for normalization of each sample through the dedicatedsoftware (see below). Finally, two wells contained the specific reagents for the humanSOD1 in order to have a further control of mice genotype. RT-PCR was performed onG93A-SOD1, G86R-SOD1 and the corresponding nontransgenic control littermatemice. The plates were sealed with a sheet of adhesive plastic and the reaction wascarried out in the thermal cycler LightCycler 480 (Roche).Data analysis was made using LightCycler 480 SW1.5 software (Roche) and the

subsequent analysis to make a comparison of different plates was made usingLightCycler 480 Multiple Plate Analysis software (Roche).

Tissue homogenates and cell lysis. Total tissue homogenates wereobtained by mechanical dissociation using a Teflon manual homogenizer for 30 sin ice in RIPA buffer (50mM Tris-HCl, pH 8.0, 1% Triton X-100, 0.25%Na-deoxycholate, 0.1% SDS, 250mM NaCl, 5 mM EDTA and 5mM MgCl2)containing a 1 : 1000 dilution of protease inhibitor cocktail (Sigma-Aldrich). Fortibialis anterior homogenates, samples had been previously incubated for 30min in0.25% Trypsin/EDTA (Invitrogen) at 371C.Cell lysates were obtained by resuspending pelleted cells in RIPA buffer.A clear supernatant was obtained by centrifugation of tissue homogenates or cell

lysates at 17 000! g for 10min and protein content was determined using theBradford protein assay (Bio-Rad, Hercules, CA, USA). Nuclear and cytosolic

fractions from spinal cord were obtained using a low-salt buffer (10mM Hepes, pH7.4, 42mM KCl, 5 mM MgCl2, 0.5% CHAPS, 1 mM DTT, 1 mM PMSF and 1mg/mlleupeptin) to homogenate samples; homogenates were then centrifugated at2000! g for 10min, supernatants were collected and analyzed as cytosolicfractions in western blot with antibodies anti-SOD1, whereas pellets were lysed inhigh-salt buffer (50mM Tris-HCl, pH 7.5, 400mM NaCl, 1 mM EDTA, 1% TritonX-100, 0.5% Nonidet-P40, 10% glycerol, 2 mM DTT, 1mM PMSF, protease inhibitorcocktail (Sigma-Aldrich)) for 30min on ice. Nuclear lysates were then centrifuged at20 000! g, supernatants were collected and analyzed in western blot withantibodies anti-lamin B.

Immunoblot analysis. Protein samples were resolved on SDS-polyacryla-mide gels and transferred to Hybond-P PVDF membranes (Amersham). Membraneswere blocked for 1 h in TBS, 0.1% Tween 20 and 5% non-fat dry milk, followed byan overnight incubation with primary antibodies (see Materials and Methods) dilutedin the same buffer. After washing with 0.1% Tween in Tris-buffered saline, themembrane was incubated with peroxidase-conjugated secondary antibody for 1 h,and then washed and developed using the ECL chemiluminescent detection system(Roche). Densitometric analyses were performed using ImageJ software program(National Institutes of Health, Bethesda, MD, USA; http://imagej.nih.gov/ij/) andnormalized against the signal obtained by reprobing the membranes with mouseanti-b-actin or anti-tubulin. The apparent molecular weight of proteinswas determined by calibrating the blots with prestained molecular weight markers(Bio-Rad Laboratories, Richmond, CA, USA).

Immunofluorescence analysis. Cell cultures were grown on poly-L-lysine-coated glass slides, fixed in 4% paraformaldehyde for 10min at room temperature,subsequently permeabilized with 0.1% Triton X-100 for 8min and washed in PBS.Cells were blocked for 30min in 2% horse serum in PBS and incubated for 1 h at371C with primary antibodies followed by fluorescein- or Cy3-conjugated secondaryantibodies. After rinsing in PBS, cells were counterstained with 1mg/ml Hoechst 33342and examined with a Zeiss LSM 510 Confocal Laser Scanning Microscope.Fluorescence images were processed using ZEN 2009 (Carl Zeiss, Milan, Italy) andAdobe Photoshop software (Adobe, San Jose, CA, USA).

Immunoprecipitation. Cell lysis was performed in RIPA buffer as describedabove, protein content was determined using Bradford protein assay (Bio-Rad)and 500mg of lysates were incubated at 41C for 2 h with a rabbit polyclonal anti-acetyl-lysine antibody diluted 1 : 100. The immunocomplexes were collected bybinding to protein A-Agarose beads (Roche), followed by three washes with lysisbuffer and then directly resuspended in Laemmli sample buffer 1! .

Biochemical assays. Caspase 3 activity was measured with a TruePointCaspase 3 assay kit (PerkinElmer, Waltham, MA, USA), according to themanufacturer’s instructions. Cell viability was assessed by a colorimetric assayusing the 3(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay (CellTiter 96 Aqueous One Solution Assay, Promega,Madison, WI, USA) according to the manufacturer’s instructions. Absorbance at490 nm was measured in a multilabel counter (Victor3-V, PerkinElmer).

Table 1 List of primers and probes used for Real Time PCR

Target Forward primer (50–30) Reverse primer (50–30) UPL probe number

Mm|Hdac1 TGGTCTCTACCGAAAAATGGAG TCATCACTGTGGTACTTGGTCA 73Mm|Hdac2 AAAGGAGCAAAGAAGGCTAGG GTCCTTGGATTTGTCTTCTTCC 94Mm|Hdac3 TTCAACGTGGGTGATGACTG TTAGCTGTGTTGCTCCTTGC 32Mm|Hdac4 CACACCTCTTGGAGGGTACAA AGCCCATCAGCTGTTTTGTC 53Mm|Hdac5 GAGTCCAGTGCTGGTTACAAAA TACACCTGGAGGGGCTGTAA 105Mm|Hdac6 CGCTGTGTGTCCTTTCAGG CAGATCAATGTATTCCAGGCTGT 17Mm|Hdac7 CCATGGGGGATCCTGAGT GCAAACTCTCGGGCAATG 71Mm|Hdac8 GGTGATGAGGACCATCCAGA TCCTATAGCTGCTGCATAGTCAA 5Mm|Hdac9 TTGCACACAGATGGAGTGG GGCCCATAGGAACCTCTGAT 32Mm|Hdac10 TTCCAGGATGAGGATCTTGC ACATCCAATGTTGCTGCTGT 60Mm|Hdac11 GACGTGCTGGAGGGAGAC AAAACCACTTCATCCCTCTTCA 26Mm|Sirt1 TCGTGGAGACATTTTTAATCAGG GCTTCATGATGGCAAGTGG 104Mm|Sirt2 CAAGGAAAAGACAGGCCAGA GCCTTCTTGGAGTCAAAATCC 10Mm|Actb AAGGCCAACCGTGAAAAGAT GTGGTACGACCAGAGGCATAC 56Mm|G6pdx CAGCGGCAACTAAACTCAGA TTCCCTCAGGATCCCACAC 53

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

9

Cell Death and Disease

The activity of SIRT1 was measured using the SIRT1 Fluorescent Activity Assay Kit(Enzo Life Science) according to the manufacturer’s instructions using a fluorescentemission at 460 nm with excitation at 360 nm.

Statistical analysis. All data are expressed as means±S.D. of nZ3independent experiments. One-way analysis of variance (ANOVA) followed byStudent’s t-test was used for statistical evaluations. Values significantly differentfrom the relative control are indicated with an asterisk, and values significantlydifferent from another group are indicated with a hash. The level of significancewas chosen as Po0.05.

Conflict of Interest

The authors declare no conflict of interest.

Acknowledgements. We thank Jean-Philippe Loeffler (INSERM U1118,Strasbourg, France) and Mauro Cozzolino (CNR, Rome, Italy) for critical reading ofthe manuscript and Monica Nencini (Fondazione Santa Lucia) for skilful technicalassistance. Antonio Musaro kindly provided C2C12 cells expressing G93A-SOD1.This work was supported by an ‘Association Francaise contre les Myopathies’ grantto LP and an ‘Association pour la Recherche sur la Sclerose LateraleAmyotrophique et autres Maladies du Motoneurone’ grant to FR.

1. Cozzolino M, Pesaresi MG, Gerbino V, Grosskreutz J, Carrı MT. Amyotrophic lateral

sclerosis: new insights into underlying molecular mechanisms and opportunities for

therapeutic intervention. Antioxid Redox Signal 2012; 17: 1277–1330.

2. Schmalbach S, Petri S. Histone deacetylation and motor neuron degeneration. CNS

Neurol Disord Drug Targets 2010; 9: 279–284.

3. Saha RN, Pahan K. HATs and HDACs in neurodegeneration: a tale of disconcerted

acetylation homeostasis. Cell Death Differ 2006; 13: 539–550.

4. Rouaux C, Jokic N, Mbebi C, Boutillier S, Loeffler JP, Boutillier AL. Critical loss of

CBP/p300 histone acetylase activity by caspase-6 during neurodegeneration. EMBO J

2003; 22: 6537–6549.

5. Rouaux C, Panteleeva I, Rene F, Gonzalez de Aguilar JL, Echaniz-Laguna A, Dupuis L et al.

Sodium valproate exerts neuroprotective effects in vivo through CREB-binding protein-

dependent mechanisms but does not improve survival in an amyotrophic lateral sclerosis

mouse model. J Neurosci 2007; 27: 5535–5545.

6. Rouaux C, Loeffler JP, Boutillier AL. Targeting CREB-binding protein (CBP) loss of

function as a therapeutic strategy in neurological disorders. Biochem Pharmacol 2004; 68:

1157–1164.

7. Ryu H, Smith K, Camelo SI, Carreras I, Lee J, Iglesias AH et al. Sodium phenylbutyrate

prolongs survival and regulates expression of anti-apoptotic genes in transgenic

amyotrophic lateral sclerosis mice. J Neurochem 2005; 93: 1087–1098.

8. Sugai F, Yamamoto Y, Miyaguchi K, Zhou Z, Sumi H, Hamasaki T et al. Benefit of valproic

acid in suppressing disease progression of ALS model mice. Eur J Neurosci 2004; 20:

3179–3183.

9. Del Signore SJ, Amante DJ, Kim J, Stack EC, Goodrich S, Cormier K et al. Combined

riluzole and sodium phenylbutyrate therapy in transgenic amyotrophic lateral sclerosis

mice. Amyotroph Lateral Scler 2009; 10: 85–94.

10. Yoo YE, Ko CP. Treatment with trichostatin A initiated after disease onset delays disease

progression and increases survival in a mouse model of amyotrophic lateral sclerosis. Exp

Neurol 2011; 231: 147–159.

11. Garbes L, Riessland M, Wirth B. Histone acetylation as a potential therapeutic target in

motor neuron degenerative diseases. Curr Pharm Des 2013; 19: 5093–5104.

12. Janssen C, Schmalbach S, Boeselt S, Sarlette A, Dengler R, Petri S. Differential histone

deacetylase mRNA expression patterns in amyotrophic lateral sclerosis. J Neuropathol Exp

Neurol 2010; 69: 573–581.

13. Williams AH, Valdez G, Moresi V, Qi X, McAnally J, Elliott JL et al. MicroRNA-206 delays

ALS progression and promotes regeneration of neuromuscular synapses in mice. Science

2009; 326: 1549–1554.

14. Bruneteau G, Simonet T, Bauche S, Mandjee N, Malfatti E, Girard E et al. Muscle histone

deacetylase 4 upregulation in amyotrophic lateral sclerosis: potential role in reinnervation

ability and disease progression. Brain 2013; 136(Pt 8): 2359–2368.

15. d’Ydewalle C, Bogaert E, Van Den Bosch L. HDAC6 at the intersection of neuroprotection

and neurodegeneration. Traffic 2012; 13: 771–779.

16. Fiesel FC, Schurr C, Weber SS, Kahle PJ. TDP-43 knockdown impairs neurite outgrowth

dependent on its target histone deacetylase 6. Mol Neurodegener 2011; 6: 64.

17. Taes I, Timmers M, Hersmus N, Bento-Abreu A, Van Den Bosch L, Van Damme P et al.

Hdac6 deletion delays disease progression in the SOD1G93A mouse model of ALS. Hum

Mol Genet 2013; 22: 1783–1790.

18. Gal J, Chen J, Barnett KR, Yang L, Brumley E, Zhu H. HDAC6 regulates mutant SOD1

aggregation through two SMIR motifs and tubulin acetylation. J Biol Chem 2013; 288:

15035–15045.

19. Kim D, Nguyen MD, Dobbin MM, Fischer A, Sananbenesi F, Rodgers JT et al. SIRT1

deacetylase protects against neurodegeneration in models for Alzheimer’s disease and

amyotrophic lateral sclerosis. EMBO J 2007; 26: 3169–3179.

20. Lee JC, Shin JH, Park BW, Kim GS, Kim JC, Kang KS et al. Region-specific changes in the

immunoreactivity of SIRT1 expression in the central nervous system of SOD1(G93A) transgenic

mice as an in vivo model of amyotrophic lateral sclerosis. Brain Res 2012; 1433: 20–28.

21. Korner S, Boselt S, Thau N, Rath KJ, Dengler R, Petri S. Differential sirtuin expression

patterns in amyotrophic lateral sclerosis (ALS) postmortem tissue: neuroprotective or

neurotoxic properties of sirtuins in ALS? Neurodegener Dis 2013; 11: 141–152.

22. Song W, Song Y, Kincaid B, Bossy B, Bossy-Wetzel E. Mutant SOD1G93A triggers

mitochondrial fragmentation in spinal cord motor neurons: neuroprotection by SIRT3 and

PGC-1a. Neurobiol Dis 2013; 51: 72–81.

23. Donmez G, Outeiro TF. SIRT1 and SIRT2: emerging targets in neurodegeneration. EMBO

Mol Med 2013; 5: 344–352.

24. Imai S, Armstrong CM, Kaeberlein M, Guarente L. Transcriptional silencing and longevity

protein Sir2 is an NAD-dependent histone deacetylase. Nature 2000; 403: 795–800.

25. Vaquero A, Scher M, Lee D, Erdjument-Bromage H, Tempst P, Reinberg D. Human SirT1

interacts with histone H1 and promotes formation of facultative heterochromatin. Mol Cell

2004; 16: 93–105.

26. Pucci B, Villanova L, Sansone L, Pellegrini L, Tafani M, Carpi A et al. Sirtuins: the molecular

basis of beneficial effects of physical activity. Intern Emerg Med 2013; 8(Suppl 1): S23–S25.

27. Nakagawa T, Guarente L. Sirtuins at a glance. J Cell Sci 2011; 124(Pt 6): 833–838.

28. Zhang F, Wang S, Gan L, Vosler PS, Gao Y, Zigmond MJ et al. Protective effects and

mechanisms of sirtuins in the nervous system. Prog Neurobiol 2011; 95: 373–395.

29. Song NY, Surh YJ. Janus-faced role of SIRT1 in tumorigenesis. Ann N Y Acad Sci 2012;

1271: 10–19.

30. Li X. SIRT1 and energy metabolism. Acta Biochim Biophys Sin (Shanghai) 2013; 45: 51–60.

31. Belden WJ, Dunlap JC. Aging well with a little wine and a good clock. Cell 2013; 153:

1421–1422.

32. Donmez G. The neurobiology of sirtuins and their role in neurodegeneration. Trends

Pharmacol Sci 2012; 33: 494–501.

33. Yang Y, Duan W, Li Y, Yan J, Yi W, Liang Z et al. New role of silent information regulator 1

in cerebral ischemia. Neurobiol Aging 2013; 34: 2879–2888.

34. Pasinetti GM, Bilski AE, Zhao W. Sirtuins as therapeutic targets of caprylic triglyceride in

ALS therapy. Cell Res 2013; 23: 1073–1074.

35. Crosio C, Valle C, Casciati A, Iaccarino C, Carrı MT. Astroglial inhibition of NF-kB does not

ameliorate disease onset and progression in a mouse model for amyotrophic lateral

sclerosis (ALS). PLoS One 2011; 6: e17187.

36. Ripps ME, Huntley GW, Hof PR, Morrison JH, Gordon JW. Transgenic mice expressing an

altered murine superoxide dismutase gene provide an animal model of amyotrophic lateral

sclerosis. Proc Natl Acad Sci USA 1995; 92: 689–693.

37. Pesaresi MG, Amori I, Giorgi C, Ferri A, Fiorenzo P, Gabanella F et al. Mitochondrial redox

signalling by p66Shc mediates ALS-like disease through Rac1 inactivation. HumMol Genet

2011; 20: 4196–4208.

38. Encinas M, Iglesias M, Liu Y, Wang H, Muhaisen A, Cena V et al. Sequential treatment of

SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully

differentiated, neurotrophic factor-dependent, human neuron-like cells. J Neurochem 2000;

75: 991–1003.

39. Song KS, Scherer PE, Tang Z, Okamoto T, Li S, Chafel M et al. Expression of caveolin-3 in

skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma

and co-fractionates with dystrophin and dystrophin-associated glycoproteins. J Biol Chem

1996; 271: 15160–15165.

40. Tang Z, Scherer PE, Okamoto T, Song K, Chu C, Kohtz DS et al. Molecular cloning of

caveolin-3, a novel member of the caveolin gene family expressed predominantly in

muscle. J Biol Chem 1996; 271: 2255–2261.

Cell Death and Disease is an open-access journal

published by Nature Publishing Group. This work is

licensed under a Creative Commons Attribution-NonCommercial-

NoDerivs 3.0 Unported License. The images or other third party

material in this article are included in the article’s Creative Commons

license, unless indicated otherwise in the credit line; if the material is

not included under the Creative Commons license, users will need to

obtain permission from the license holder to reproduce thematerial. To

view a copy of this license, visit http://creativecommons.org/licenses/

by-nc-nd/3.0/

Supplementary Information accompanies this paper on Cell Death and Disease website (http://www.nature.com/cddis)

Tissue-specific deregulation of HDACs in ALS mice

C Valle et al

10

Cell Death and Disease

RESULTS 3

Degeneration of serotonergic neurons in amyotrophic lateral

sclerosis: a link to spasticity

61

Upper motor neuron degeneration is often associated with spasticity of

skeletal musculature. This is a debilitating painful condition, considerably

affecting motility and voluntary strength, which contributes to the pour quality

of life of PLS but also ALS patients (McClelland et al., 2008). Although

spasticity is a neurogenic condition, most treatments applied in these cases

target the periphery, nerves and skeletal muscle. In ALS the therapeutic

approaches targeting spasticity are extremely limited. One study evidenced

limited benefits after moderate daily exercise (Ashworth et al., 2012).

The mechanisms of muscle spasticity were mostly studied in spinal cord

injury models, where the monoamine neurotransmitter serotonin (5HT) was

found to play an important part in the development of this condition. Serotonin

has multiple functions in the CNS, where it acts through 7 different types of

receptors (5HT1-7) with 14 subtypes (Nichols and Nichols, 2008). In the motor

system 5HT plays a modulatory role. Serotonergic projection from the

brainstem into the spinal cord facilitate motor output increasing the excitability

of motor neurons (Jacobs et al., 2002; Perrier et al., 2005). Following spinal

cord injury, 5HT2B and 5HT2C receptors become constitutively active in spinal

cord motor neurons. This is a mechanism of compensating for the reduced

serotonergic input which ultimately contributes to the emergence of muscle

spasms (Murray et al., 2011).

In the present work we describe degeneration of serotonergic neurons in

the brainstem of a group of seven ALS patients. Although the loss of cellular

bodies was heterogeneous amongst patients and the different serotonergic

nuclei studied, there we found an obvious loss of serotonergic neurites. Also,

we observed a massive systematic loss of serotonergic projections into spinal

cord and hippocampus of ALS patients.

Next we sought validating our findings in the ALS mouse model

expressing the mSOD1G86R. We showed decrease in mRNA of cellular

markers of serotonergic neurons in brain stem of pre-symptomatic SOD1G86R

mice. This is indirect evidence for an early degeneration of serotonergic

neurons. This was further confirmed by a decreased in serotonin levels in

62

brain stem, spinal cord and cortex evident before symptom onset. At

symptomatic stages, immunohistochemical analysis of serotonergic neurons

in the brain stem of mSOD1 mice revealed shrinkage of neuronal bodies and

neurite fragmentation.

To understand the relevance of this impairment of the serotonergic

system, we further focused on spasticity. Spasticity is visible in the tail of

mSOD1 mice at disease onset, but at this stage it is difficult to quantify due to

the presence of voluntary movements. However, we were able to quantify

spasticity in end stage mice by performing electromyography (EMG) of the tail

muscles.

At this stage we found that mRNA levels of the 5HT2B receptor ware

significantly increased in lumbar spinal cord. By using two different inverse

agonists of the 5HT2B/2C receptors (SB206553 and cyproheptadine) we were

able to alleviate spasticity, as confirmed by EMG analysis. Since the levels of

5HT2C receptors were unchanged, spasticity in this ALS mouse model is most

likely due to overexpression of constitutively active 5HT2B receptors, following

the reduction of serotonergic input.

Our work brings evidence of a serotonergic pathology in ALS patients

and in an ALS mouse model. We further outline a potential mechanism for

spasticity, linked to the degeneration of serotonergic neurons. This has

important implication for the alleviating spasticity in PLS and ALS patients, a

debilitating condition for which limited clinical intervention is available so far.

63

BRAINA JOURNAL OF NEUROLOGY

Degeneration of serotonergic neurons inamyotrophic lateral sclerosis: a link to spasticityChristel Dentel,1,2,3 Lavinia Palamiuc,1,2 Alexandre Henriques,1,2 Beatrice Lannes,2,4

Odile Spreux-Varoquaux,5,6,7 Lise Gutknecht,8,9 Frederique Rene,1,2 Andoni Echaniz-Laguna,1,2,3

Jose-Luis Gonzalez de Aguilar,1,2 Klaus Peter Lesch,8,10 Vincent Meininger,11,12

Jean-Philippe Loeffler1,2 and Luc Dupuis1,2,12,13

1 U692, INSERM, 67085 Strasbourg, France

2 Faculte de Medecine, Universite de Strasbourg, 67000 Strasbourg, France

3 Departement de Neurologie, Hopitaux Universitaires de Strasbourg, 67000 Strasbourg, France

4 Departement d’Anatomopathologie, Hopitaux Universitaires de Strasbourg, 67000 Strasbourg, France

5 Departement de pharmacologie, Faculte de Medecine Paris-Ile de France-Ouest, 78180 Paris, France

6 Universite de Versailles Saint-Quentin-en-Yvelines, 78000, Versailles, France

7 Centre Hospitalier Versailles, 78150, Le Chesnay, France

8 Unit for Molecular Psychiatry, Department of Psychiatry, Psychosomatics and Psychotherapy, University of Wurzburg, 97080, Wurzburg, Germany

9 Department of Neurobiology, Functional Genomic Institute, CNRS /INSERM UMR 5203, University of Montpellier, 35000 Montpellier, France

10 Department of Neuroscience, School for Mental Health and Neuroscience, Maastricht University, 6229, Maastricht, The Netherlands

11 Departement des maladies du systeme nerveux, Universite Pierre et Marie Curie, 75000 Paris, France

12 Departement des Maladies du Systeme Nerveux, Centre Referent Maladie Rare SLA Hopital de la Pitie-Salpetriere (AP-HP), 75000, Paris, France

13 Department of Neurology, Ulm University, 89081, Ulm, Germany

Correspondence to: Luc Dupuis,

INSERM U692, Faculte de medecine,

11 rue Humann,

67085 Strasbourg, France

E-mail: ldupuis@unistra.fr

Spasticity is a common and disabling symptom observed in patients with central nervous system diseases, including amyotrophic

lateral sclerosis, a disease affecting both upper and lower motor neurons. In amyotrophic lateral sclerosis, spasticity is tradition-

ally thought to be the result of degeneration of the upper motor neurons in the cerebral cortex, although degeneration of other

neuronal types, in particular serotonergic neurons, might also represent a cause of spasticity. We performed a pathology study in

seven patients with amyotrophic lateral sclerosis and six control subjects and observed that central serotonergic neurons suffer

from a degenerative process with prominent neuritic degeneration, and sometimes loss of cell bodies in patients with amyo-

trophic lateral sclerosis. Moreover, distal serotonergic projections to spinal cord motor neurons and hippocampus systematically

degenerated in patients with amyotrophic lateral sclerosis. In SOD1 (G86R) mice, a transgenic model of amyotrophic lateral

sclerosis, serotonin levels were decreased in brainstem and spinal cord before onset of motor symptoms. Furthermore, there was

noticeable atrophy of serotonin neuronal cell bodies along with neuritic degeneration at disease onset. We hypothesized that

degeneration of serotonergic neurons could underlie spasticity in amyotrophic lateral sclerosis and investigated this hypothesis

in vivo using tail muscle spastic-like contractions in response to mechanical stimulation as a measure of spasticity. In SOD1

(G86R) mice, tail muscle spastic-like contractions were observed at end-stage. Importantly, they were abolished by

5-hydroxytryptamine-2b/c receptors inverse agonists. In line with this, 5-hydroxytryptamine-2b receptor expression was strongly

increased at disease onset. In all, we show that serotonergic neurons degenerate during amyotrophic lateral sclerosis, and that

this might underlie spasticity in mice. Further research is needed to determine whether inverse agonists of

5-hydroxytryptamine-2b/c receptors could be of interest in treating spasticity in patients with amyotrophic lateral sclerosis.

doi:10.1093/brain/aws274 Brain 2013: 136; 483–493 | 483

Received April 25, 2012. Revised July 24, 2012. Accepted August 16, 2012. Advance Access publication October 31, 2012

! The Author (2012). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.

For Permissions, please email: journals.permissions@oup.com

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

Keywords: ALS; animal models; motor neuron; serotonin; spasticity

Abbreviations: ALS = amyotrophic lateral sclerosis; 5-HIAA = 5-hydroxyindoleacetic acid; 5-Ht = 5-hydroxytryptamine;Tph2 = tryptophan hydroxylase 2

IntroductionSpasticity is a symptom of many motor diseases that consists of

velocity-dependent increase in muscle tone and exaggerated

muscle responses to stretching. Spasticity develops either after

trauma, in particular spinal cord injury, or in the course of degen-

erative diseases such as amyotrophic lateral sclerosis (ALS), a fatal

neurodegenerative disorder affecting upper and lower motor neu-

rons (Kiernan et al., 2011). Spasticity represents the major pheno-

type of the upper motor neuron predominant subtype of ALS

called primary lateral sclerosis and might be under recognized in

other patients with ALS, as the physiological basis for detecting

spasticity is disrupted by the degenerative process involving motor

neurons of all classes (Swash, 2012). Spasticity is a painful and

disabling symptom, and treatment options remain limited, espe-

cially in patients with ALS and those with primary lateral sclerosis

(Ashworth et al., 2012).

Mechanisms of spasticity have been mostly studied after spinal

cord injury. In the current view, spinal cord injury-associated spas-

ticity arises from several mechanisms, a major one being injury to

serotonergic axons. Indeed, serotonergic axons, descending from

several brainstem serotonergic nuclei, densely innervate lower

motor neurons and maintain motor neuron excitability through

increased persistent calcium current (Heckman et al., 2009).

After spinal cord injury, the transection of serotonergic axons

leads to transient hypoexcitability of lower motor neurons. After

a few weeks, lower motor neurons compensate for loss of sero-

tonin input through the production of constitutively active

5-hydroxytryptamine (5-Ht)-2b and 5-Ht2c receptors, leading to

an intrinsic hyperexcitability and subsequent spasticity (Murray

et al., 2010, 2011).

In ALS, degeneration of upper motor neurons, whose axons

form the corticospinal tract, is traditionally thought to cause spas-

ticity as part of the ‘upper motor neuron syndrome’ (Ivanhoe and

Reistetter, 2004), but direct evidence linking upper motor neurons

and spasticity in ALS is lacking. Other hypotheses, in particular the

implication of serotonergic neurons, have not been explored so

far. Indeed, studies on serotonergic involvement in ALS are

scarce and limited. Early studies focusing on the quantification of

serotonin and its metabolites yielded inconsistent results, most

likely owing to the very limited numbers of post-mortem brain

tissues included (Bertel et al., 1991; Sofic et al., 1991; Forrest

et al., 1996). More recent imaging studies have shown decreased

binding of serotonin 1A (5-HT1A) ligands in ALS raphe and cortex

(Turner et al., 2005, 2007). To address the potential involvement

of serotonin in ALS, we recently measured levels of platelet sero-

tonin in a cohort of 85 patients with ALS and a control group of

29 healthy subjects. We found that platelet serotonin levels were

significantly decreased in patients with ALS, and that higher plate-

let serotonin levels were positively correlated with increased sur-

vival of the patients (Dupuis et al., 2010), suggesting that

serotonin might influence the course of ALS disease. However,

investigation of a direct involvement of central serotonin in

ALS has not been performed until now. Here, we show that cen-

tral serotonergic neurons degenerate during ALS. From a func-

tional point of view, our animal studies also suggest that

spasticity might arise from serotonergic loss, at least in animal

models.

Materials and methods

Patient tissuesAutopsy samples from hippocampus, brainstem and spinal cord were

obtained from seven patients with ALS and six control subjects. Patient

2 had familial history of ALS, but gene analysis demonstrated no

pathogenic variations in the SOD1 gene. Hippocampus and brainstem

samples were available for all patients. Spinal cord specimens were

available for all patients with ALS and control subjects. Patients and/

or families had provided written informed consent. Clinical details are

presented in Supplementary Tables 1 and 2. ALS diagnosis was ob-

tained using El Escorial criteria (Brooks et al., 2000) and was confirmed

after autopsy. During autopsy, tissues were fixed in 4% formaldehyde

and embedded in paraffin using standard protocols. Use of these tis-

sues for research was declared at the French ministry for research and

higher education (DC-2011-1433).

Transgenic miceTransgenic mice carrying the SOD1 (G86R) mutation (Ripps et al.,

1995; Dupuis et al., 2000) and their non-transgenic littermates on a

FVB/N background were housed in our animal facility with unre-

stricted access to food and water. Mice were sacrificed at different

stages of the disease to perform the studies using the following clinical

scale: asymptomatic mice show normal gait and no paralysis and were

scored 4. EMG is typically normal in these mice. Animals with a score

of 3 showed a mildly abnormal gait or one hindlimb with paralysis.

Score 3 typically occurs between 90 and 100 days of age, and is

associated with already detectable EMG abnormalities, i.e. spontan-

eous muscle electrical activity, but no loss of motor neuron cell

bodies (Halter et al., 2010). Frank paralysis of one limb is scored 2

and of both hindlimbs is scored 1. Profound weight loss and kyphosis

are typical of score 0, and mice are euthanized at this stage. In this

study, asymptomatic mice used were all scored 4, and were 75 days

old. Mice at disease onset were mice with a score of 3. These mice

were followed daily and were sacrificed the second day on which they

showed a score of 3. End stage mice used in the EMG studies were

scored 1 and thus showed frank paralysis of both hindlimbs. For ethical

reasons, we did not use mice scored 0 in experiments but proceeded

to their euthanasia.

For histology, brains were fixed by immersion in 4% formaldehyde

in phosphate buffer 0.1M pH 7.4, and tissues were post-fixed 24 h

before paraffin embedding. For molecular biology, brainstem and

lumbar spinal cord tissues were snap frozen in liquid nitrogen.

Animal experiments were performed under the supervision of

484 | Brain 2013: 136; 483–493 C. Dentel et al.

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

authorized investigators (L.D. and F.R.), and approved by the local

ethical committee for animal experiments (CREMEAS, agreement N!

AL/01/02/02/12).

HistologyParaffin embedded tissues were cut in 4 mm sections using a HM 340E

Microtome (Microm). Luxol Fast blue/Cresyl violet stain was performed

using a standard histological technique. Immunohistochemistry was per-

formed in a Benchmark XT automate slide system using the Ventana

NexES! software and EZ Prep Ventana Roche! reagent. Sections were

heated, and endogenous peroxidases were inactivated using H2O2

(Ventana Roche!). Primary and secondary antibodies were incubated

for 2 h at 37!C. Staining was performed using ultraview DAB (Ventana

Roche!). Human sections were counterstained with haematoxylin

(Ventana Roche!). Primary antibodies were as follows: rabbit polyclonal

anti-ubiquitin (Dakocytomation 1/200), rabbit polyclonal TDP-43

(Proteintech LTD, 1/800) and rabbit polyclonal tryptophan hydroxylase

2 (Tph2) [described in Gutknecht et al. (2009), 1/1000].

Quantification of tryptophanhydroxylase 2 positive neurons inhuman samplesThe number of Tph2-positive cell bodies in various regions of interest

was evaluated semi-quantitatively in at least two sections of the con-

sidered nuclei identified as shown in Supplementary Fig. 1. Number of

neurons per section: negative = 0–10, + = 11–20, + + = 21–30,

+ + + =430. We systematically compared sections stained in parallel

in matched regions. Regions of interest were identified in adjacent

sections using Luxol Fast blue/Cresyl violet staining, and counting of

neurons were performed at "20 magnification in a blinded manner,

on two sections of each region of interest.

Measurement of perikaryon size oftryptophan hydroxylase 2 positiveneuronsSagittal brain sections (4 mm) were cut in series starting from the mid-

line. In each animal, one of every five serial sections was sampled for

Tph2 immunostaining. Using the second edition of the mouse brain in

stereotaxic co-ordinates atlas (Franklin and Paxinos, 1997), position

of the dorsalis raphe nucleus was determined on each section

(medio-lateral: 0 to + 0.48mm; antero-posterior: #4 to #5.3mm

from Bregma; dorso-ventral: + 2.75 to +4mm). Images of the dorsalis

raphe nucleus were captured using a Nikon digital camera DXM1200

connected to a Nikon eclipse E800 microscope. Tph2-positive neurons

were analysed in seven to nine sections per animal in each group. The

cell body area of all Tph2-positive neurons with a visible nucleus in the

dorsalis raphe nucleus was measured using the NIH Image analysis

software (ImageJ, version 1.45r), and 200–800 neurons were mea-

sured per animal.

Real-time quantitative polymerasechain reactionTotal RNA was extracted using TRIzol! (Invitrogen) and standard pro-

cedures. Real-time quantitative PCR was performed as previously

described (Braunstein et al., 2010) using BIO-RAD iScriptTM cDNA

Synthesis Kit, iQTM qPCR mix and a CFX95 thermocycler (BioRad).

Data were normalized with the GeNorm software (Vandesompele

et al., 2002) using geometric averaging of three internal standards

(18S ribosomal RNA, Tata-box binding protein and RNA polymerase

II subunit).

5-Hydroxytryptamine-2c receptormRNA editingWe used the quantitative PCR method developed by Lanfranco et al.

(2009, 2010) to measure 5-Ht2c messenger RNA editing. This method

is based on the use of TaqMan! probes selective for the various edited

isoforms. We used the DNA templates provided by Lanfranco et al.

(2009, 2010) to check for selectivity and specificity of the measure-

ments, and obtained quantitative PCR cycling conditions that discrim-

inate fully between the different templates using the published

TaqMan! probes.

High-performance liquid chromatographySerotonin and 5-hydroxyindoleacetic acid (5-HIAA) were measured on

tissue extracts using high-performance liquid chromatography with

coulometric detection using a technique similar to Alvarez et al.

(1999). Results were standardized to initial wet weight of tissue.

Electromyographical evaluationof spasticitySpasticity in tail muscles was measured with percutaneous EMG wires

inserted in segmental tail muscles at the midpoint of the tail, as

described by Bennett et al. (2004) and adapted to mouse. During

EMG recording, muscle spasms were evoked with mechanical stimu-

lation of the tail skin, and the tail was free to move. EMG was sampled

at 5 kHz, rectified and averaged for a 4-s interval starting 1 s after

stimulation. EMG over 1 s before stimulation was averaged for meas-

ure of background signal.

Statistical analysisStatistical analysis was performed using GraphPad Prism software. For

comparison between two groups, Student’s t-test was used. For com-

parison between three or more groups, ANOVA followed by

Newman–Keuls post hoc test was applied. Significance level was set

at P5 0.05.

Results

Degeneration of serotonergic neurons inamyotrophic lateral sclerosis

We analysed autoptic brains from seven patients with ALS and six

control subjects (Supplementary Tables 1 and 2). Three patients

with ALS had a bulbar onset of symptoms, and four had spinal

onset. We focused our studies on major serotonergic nuclei of the

brainstem presented in Supplementary Fig. 1. Ubiquitin and

TDP43 cytoplasmic aggregates, two pathological hallmarks of

ALS (Neumann et al., 2006; Kiernan et al., 2011), were observed

almost systematically in the raphe magnus and gigantocellular

nuclei but more rarely in other nuclei studied (Supplementary

Figs 2 and 3). One patient (Patient 5) showed extensive ubiquitin

Degeneration of serotonergic neurons in ALS Brain 2013: 136; 483–493 | 485

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

and TDP43 pathology in all serotonergic nuclei studied.

Serotonergic neurons were easily detected in the pons and rostral

medulla nuclei of control patients using an antibody directed

against TPH2, the rate limiting enzyme in central serotonin syn-

thesis. Patients with ALS showed loss of TPH2-positive cell bodies

in serotonergic nuclei (Fig. 1A), although these nuclei were not

uniformly affected in patients with ALS. In many cases, cell bodies

were still present, but loss of TPH2-positive neurites was obvious

(Fig. 1B). Semi-quantitative analysis of TPH2-positive cell bodies

showed a heterogenous decrease in cell density in the studied

serotonergic nuclei, irrespective of the site of onset of disease,

gender or age (Table 1). Patients 3 and 6 showed widespread

serotonergic degeneration, whereas degeneration of serotonin

cell bodies was more localized in Patients 1, 2 and 4. Patient 5,

although displaying prominent ubiquitin and TDP43 pathology in

these nuclei, and Patient 7 appeared to show preserved neuronal

counts. Analysis of serial sections revealed that the cells displaying

TDP-43 or ubiquitin-positive inclusions were not serotonergic neu-

rons (not shown). Thus, serotonergic neurons suffer from a

degenerative process with prominent neuritic degeneration, and

sometimes cell body loss in patients with ALS, but do not show

typical ALS pathology.

Figure 1 Serotonergic neurons degenerate in patients with ALS. (A) Representative TPH2 immunohistochemistry in the raphe superior

central nucleus of one control subject (control subject 3, left panels) and one ALS (Patient 3, right panel). Upper pictures show low

magnification. Lower pictures show a magnification of the rectangle in upper picture. This ALS case exhibits extensive degeneration of

TPH2-specific cell bodies in this serotonergic nucleus. (B) Representative TPH2 immunohistochemistry in the raphe magnus nucleus

(rostral medulla) of one control subject (control subject 6, left panels) and one ALS (Patient 7, right panels). Upper pictures show low

magnification. Lower pictures show a magnification of the rectangle in upper picture. Neuronal density of TPH2-positive cell bodies are

similar in ALS and control subject, but that intense degeneration of TPH2-positive neurites is visible in the ALS patient.

Table 1 Semi-quantitative analysis of Tph2-positive cell bodies in regions of interest in patients with ALS

Rostral pons Caudal pons Rostral medulla Medulla(Inf. olive)

Case Site of onset RPF RSCN GCN RM RLN RO

ALS 1 Bulbar + + + + + + Neg + + + +2 Spinal + + + + + + Neg + + + + +

3 Spinal + + + Neg + Neg +

4 Spinal + + + + + + + + + Neg Neg

5 Bulbar + + + + + + + + + + + + +

6 Bulbar + + + + + + + Neg

7 Spinal + + + + + + + + + + + +

Control 1 +2 + + + + + + + + + + + +

3 + + + + + + + + + +

4 + +

5 + + + + +

6 + + + + + +

Number of neurons per section: Negative (Neg) = 0–10, + = 11–20, + + = 21–30, + + + =430.

Empty cells = tissue not available; Inf = inferior; RPF = reticular pontine formation; RSCN = raphe superior central nucleus; GCN = gigantocellular

nucleus; RM = raphe magnus; RLN = reticular lateral nucleus. Inf. olive: inferior olive.

486 | Brain 2013: 136; 483–493 C. Dentel et al.

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

Systematic degeneration of serotonergicprojections in amyotrophic lateralsclerosis

We next sought to determine whether projections of serotonergic

neurons degenerated in ALS. TPH2-labelled projections of seroto-

nergic neurons were readily detectable in the hippocampus of

control patients (Fig. 2A, left panel) but were almost absent in

patients with ALS (Fig. 2A, right panel). In the spinal cord of

Control 6, we observed spinal motor neurons densely innervated

with TPH2-positive projections, as expected from the distribution

of serotonin immunoreactivity in humans (Fig. 2B) (Perrin et al.,

2011). Contrasting with this, we occasionally observed isolated

motor neurons with preserved serotonergic innervation, but neigh-

bouring motor neurons were fully denervated (Fig. 2B). Even in

Patients 5 and 7 with seemingly normal neuronal density, we

barely observed motor neurons innervated by serotonergic

axons. In all, we observed a massive and generalized reduction

of TPH2-positive projections to spinal cord and hippocampus in

patients with ALS.

Degeneration of serotonergic neuronsand early serotonin depletion in SOD1(G86R) mice

Studies in patients are hampered by the inaccessibility to presymp-

tomatic period. To determine whether serotonergic neuron degen-

eration precedes motor symptoms, we studied SOD1 (G86R) mice,

a mutant mouse strain that over-expresses an ALS-linked mutant

form of SOD1. This mouse strain and other similar models have

been shown to demonstrate ALS-like disease, with both lower and

upper motor neuron degeneration (Gurney et al., 1994; Ripps

et al., 1995; Ozdinler et al., 2011). At disease onset (score of

3), messenger RNA levels of cell-specific markers of serotonergic

neurons (Tph2, serotonin transporter, 5-Ht1a receptor) were lower

in the brainstem of SOD1 (G86R) mice, indirectly suggesting

degeneration of these neurons (Fig. 3A). Direct visualization of

serotonergic neurons in the dorsalis raphe nucleus using Tph2

immunohistochemistry revealed similar features in SOD1 (G86R)

mice at symptom onset (score 3) to patients with ALS.

Semi-quantitative analysis revealed that the area of the cell body

of Tph2-positive neurons was decreased of about one-third in this

nucleus (Fig. 3B and C). We further observed fragmentation of

Tph2-positive neurites of SOD1 (G86R) mice (Fig. 3B). Most im-

portantly, levels of serotonin itself were decreased when compared

with wild-type mice, not only in symptomatic (score 3) but also in

non-symptomatic (score 4) SOD1 (G86R) brainstem (Fig. 4A),

spinal cord (Fig. 4B) and cortex (Fig. 4C). The ratio between

5-HIAA, the major serotonin metabolite depending of

mono-amine oxidase A activity, and serotonin represents an indir-

ect measurement of local serotonin turnover (Shannon et al.,

1986). In SOD1 (G86R) mice, the 5-HIAA/serotonin ratio was

unchanged before symptoms in all three tissues tested

(Fig. 4D–F) and increased at disease onset in brainstem and

cortex. This shows that serotonin depletion precedes increase in

serotonin turnover, suggesting that early loss of serotonin is due to

decreased supply rather than to increased turnover. Thus, the de-

velopment of ALS is associated with an early and general impair-

ment of central serotonin function in an animal model of the

disease.

Figure 2 Serotonergic projections degenerate in spinal cord and hippocampus of patients with ALS. (A) Representative TPH2 immu-

nohistochemistry in the dentate gyrus of one control subject (Control 3, left panels) and one ALS (Patient 4, right panels). Upper pictures

show low magnification. Lower pictures show a magnification of upper pictures. Note the almost complete absence of TPH2 immunor-

eactivity in the dentate gyrus of the patient with ALS. (B) Representative TPH2 immunohistochemistry in cervical spinal cord of one control

subject (Control 6, upper left panel) and three patients with ALS (Patients 1, 3 and 7). Note the punctate TPH2 immunoreactivity

surrounding motor neurons (arrows) in the control subject, but not in patients with ALS. A single motor neuron innervated by

TPH2-positive serotonin neuron terminals is shown in a patient with ALS (Patient 7, lower left panel).

Degeneration of serotonergic neurons in ALS Brain 2013: 136; 483–493 | 487

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

Spasticity develops in SOD1(G86R) mice, and is alleviated by5-hydroxytryptamine 2 b/c receptorsinverse agonists

We sought then to characterize whether serotonin depletion

occurring early in SOD1 (G86R) had pathogenic consequences

on motor neurons. Serotonin modulates excitability of motor neu-

rons by allowing sustained entry of calcium (Heckman et al.,

2009). In animal models of spinal cord injury, it was recently

shown that serotonin depletion due to transection of serotonergic

axons was over-compensated by motor neurons. More specifically,

motor neurons produce constitutively active 5-Ht2b and 5-Ht2c

receptors through still poorly defined mechanisms, decreased edit-

ing of the 5Ht2c messenger RNA being one of these (Murray

et al., 2010). This constitutive activity of 5-Ht2b/c receptors is

responsible for the occurrence of spasticity on spinal cord injury

(Murray et al., 2010). Other serotonin receptors, including

5-HT1A, 2A, 3, 4, 5, 6 and 7 appear to not be involved in this

event (Murray et al., 2011). By analogy, we reasoned that the

chronic loss of serotonergic innervation of lower motor neurons in

patients with ALS and SOD1 (G86R) mice could lead to spasticity.

To explore this hypothesis, we used an electromyographical

Figure 3 Serotonergic neurons degenerate in SOD1 (G86R) mice. (A) Messenger RNA levels of 5-Ht1a receptor (5-Ht1a), serotonin

transporter (Sert) and Tph2 in SOD1 (G86R) mice at 75 days of age (asymptomatic, NS) or at symptom onset (!100 days of age, OS) and

wild-type litter mates (Wt). Note that serotonin transporter and Tph2 gene expression levels are downregulated at symptom onset.

n = 7–10 per group. *P5 0.05 versus wild type, ANOVA followed by Newman–Keuls post hoc test. (B) Representative Tph2 immuno-

histochemistry in SOD1 (G86R) mice at disease onset (SOD1; OS) and wild-type littermates. Note the shrunken Tph2-positive cell bodies

in SOD1 (G86R) mice (upper right) and neuritic degeneration (lower right). n = 3 per group. (C) Mean area of Tph2-positive neurons in

SOD1 (G86R) mice at disease onset (OS) and wild-type (Wt) littermates. The area of 200–800 neurons was measured per animal, with

n = 3 per group. ***P50.0005 versus wild type, Student’s t-test.

488 | Brain 2013: 136; 483–493 C. Dentel et al.

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

protocol adapted from Bennett et al. (2004). This objective and

quantitative electromyographical method appears correlated with

clinical evaluation of spasticity (Bennett et al., 2004) and facilitates

the study of the effect of classical anti-spastic drugs such as baclo-

fen or clonidine (Li et al., 2004; Rank et al., 2011). We visually

observed spasticity in the tail of some animals at disease onset

(score 3), but this was difficult to distinguish from voluntary con-

tractions in these mice that are not yet paralysed. When disease

progresses, however, spasticity of the tail was systematically

observed and strong in end-stage (stage 1) mice. Thus, the mech-

anisms for spasticity are already present at disease onset, and

might help with maintaining motor function, but are blurred by

voluntary movements. For this reason, we used end-stage SOD1

(G86R) mice to adapt the EMG protocol initially developed for rats

with spinal cord injury. Under this experimental set-up, spastic-like

contractions of tail muscles were easily recorded (Fig. 5A), provid-

ing objective evidence of spasticity as a component of ALS disease

in this mouse model. We further studied involvement of constitu-

tive activity of 5-Ht2b/c receptors in this measure of spasticity and

found that spasticity was strongly alleviated by injection of

5-Ht2b/c inverse agonists SB206553 (Fig. 5B and D) and cypro-

heptadine (Fig. 5C and D). In rats with chronic spinal cord injury,

spasticity is associated with increased production of the unedited

isoform of the 5-Ht2c messenger RNA leading to increased

expression of the constitutively active INI-5-Ht2c receptor. In

SOD1 (G86R) mice, we observed, however, decreased production

of this specific isoform and normal levels of total messenger RNA

and of other various edited isoforms (Fig. 5E and F) in the lumbar

and sacral spinal cords at disease onset (score 3), i.e. the disease

stage at which spasticity arises. Contrasting with this, we observed

a 10-fold increased expression of the 5-Ht2b receptor in the same

animals (Fig. 5E). In all, our results suggest that serotonin deple-

tion leads to over-expression of 5Ht2b receptors and subsequent

constitutive activity of this receptor during development of spas-

ticity. In turn, this constitutive activity likely leads to spasticity.

DiscussionHere, we show that ALS is associated with degeneration of central

serotonergic neurons, both in patients and animal model, and

identify spasticity as a possible consequence of ALS-related sero-

tonergic dysfunction.

The first major result of this study is that central serotonergic

neurons degenerate in patients with ALS and in an animal model.

We observed a major decrease in serotonergic innervation in

target regions, such as the spinal cord and the hippocampus,

along with obvious decreased density of serotonergic neurites in

the serotonergic nuclei. In some nuclei, this was also accompanied

by shrinkage and loss of cell bodies. We found limited ubiquitin

and TDP-43 pathology in most serotonergic nuclei studied, but

these inclusions were not in remaining cell bodies of serotonergic

neurons. This might reflect either high intrinsic capacity in clearing

protein aggregates in serotonergic neurons, or low production of

aggregate-prone proteins in this neuronal type or, on the contrary,

extreme sensitivity leading to degeneration of neurites, despite low

levels of aggregates. Degeneration of serotonergic neurons could

be either independent of lower motor neuron degeneration or be

a secondary consequence of motor neuronal loss. However,

we observed loss of serotonin in asymptomatic mice, as early as

Figure 4 Decreased levels of serotonin in SOD1 (G86R) mice. Serotonin (ng/mg tissue, A–C) and 5-HIAA/serotonin (D–F) in the

brainstem (A and D), the spinal cord (B and E) and the cerebral cortex (C and F) of SOD1 (G86R) mice at 75 days of age (asymptomatic,

NS) or at symptom onset (!100 days of age, OS) and wild-type littermates (Wt) as measured using high-performance liquid chroma-

tography. *P50.05 versus wild type, **P50.01 versus wild type, ***P5 0.001 versus wild type, #P50.05 versus asymptomatic,##P5 0.01 versus asymptomatic. ANOVA followed by Newman–Keuls post hoc test. n = 5–10 per group.

Degeneration of serotonergic neurons in ALS Brain 2013: 136; 483–493 | 489

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

75 days of age, an age that precedes from several weeks the

onset of motor neuron degeneration. This suggests that degener-

ation of serotonergic neurons occurs independently of motor

neuron death, at least in animal models.

The loss of serotonergic neurons causes loss of serotonin itself in

regions of projections. In our animal model, serotonin levels are

decreased in the brainstem and the spinal cord long before motor

symptoms arise. Previous studies on serotonin and 5-HIAA in

patients with ALS yielded conflicting results. Bertel et al. (1991)

observed normal levels of serotonin and decreased levels of

5-HIAA in autopsy samples, whereas Forrest et al. (1996)

observed normal serotonin levels but increased 5-HIAA levels.

However, serotonin is a labile molecule that might be significantly

altered in post-mortem human samples with hours of delay before

autopsy (Yoshimoto et al., 1993). Our study overcomes this prob-

lem by studying serotonergic neurons using TPH2 immunostaining

in fixed tissues. In asymptomatic animals, the loss of serotonin

was associated with normal serotonin turnover (unchanged

5-HIAA/serotonin ratio), strengthening the idea that decreased

serotonin was owing to decreased supply in serotonin rather

than to increased degradation. Contrastingly, in end-stage mice,

we observed an increased serotonin turnover (increased 5-HIAA/

Figure 5 Spasticity in SOD1 (G86R) mice is alleviated by 5-Ht2b/c inverse agonists. (A–C) Representative recording of long-lasting

reflexes using tail EMG in one diseased SOD1 (G86R) mouse before (left) and after injections of vehicle (Vh, A), SB206553 (SB206, B) or

cyproheptadine (Cypro, C). Spasticity was considered to be electrical activity above the baseline recorded 1 s after mechanical stimulation

(arrowhead). (D) Quantitative analysis. n = 5–6 mice per group and two to three EMGs were obtained before and after injection. We

calculated a ratio between spasticity before and after injection and present the result as a percentage. *P5 0.05 versus before injection,

ANOVA followed by Newman–Keuls post hoc test. (E) Messenger RNA levels of 5-Ht2b (5-Ht2b), and 5-Ht2c (5-Ht2c) receptors in SOD1

(G86R) mice at 75 days of age (asymptomatic, NS) or at symptom onset (!100 days of age, OS) and wild-type littermates (Wt). 5-Ht2b

gene expression levels are heavily upregulated at symptom onset. n = 12 per group. ***P50.001 versus wild type, ANOVA followed by

Newman–Keuls post hoc test. (F) Levels of editing variants of the 5-Ht2c messenger RNA in the spinal cord of SOD1 (G86R) mice at onset

(OS) and wild-type littermates (Wt). ABECD (messenger RNA variant with full editing of A, B, E, C and D sites), ABD (messenger RNA

variant edited at A, B and D sites) and the non-edited messenger RNA, which leads to the production of the constitutively active INI

receptor, were measured by TaqMan! assays. Levels of the non-edited messenger RNA are decreased. n = 12 per group. *P50.05 versus

wild type, Student’s t-test.

490 | Brain 2013: 136; 483–493 C. Dentel et al.

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

serotonin ratio). This late increased serotonin turnover is likely to

be due to increased release of serotonin by remaining nerve ter-

minals. Indeed, this increased mobilization of residual serotonin in

end-stage mice coincides with the loss of serotonin transporter

expression, an event expected to limit serotonin reuptake and in-

crease its turnover. Our studies are consistent with imaging studies

using the PET scan ligand WAY100635 (Turner et al., 2005,

2007). This compound binds to the 5-HT1A receptor, which is

broadly expressed in serotonergic neurons, notably in brainstem

and acts as an inhibitory somatodendritic autoreceptor in these

neurons. The decreased binding potential of WAY100635 in the

raphe of patients with ALS was hypothesized to be either owing to

decreased sensitivity of 5-HT1A receptors to WAY100635 or to

loss of neurons that express this receptor. As 5-HT1A receptor is

strongly expressed in serotonergic neurons in the raphe, our cur-

rent results argue for the latter view.

We next sought to delineate whether serotonin depletion had

pathogenic consequences and focused on one of the potential

consequences, the occurrence of spasticity. Spasticity had been

previously shown to occur in spinal cord injury as a late conse-

quence of transection of serotonergic axons (Murray et al., 2010,

2011). Spasticity represents a symptom that is difficult to object-

ively measure in animals. We adapted an EMG technique measur-

ing spastic-like contractions of tail muscles in response to a

mechanical stimulation. Others had previously shown that this

EMG method is clinically correlated with onset of spasticity in

rats with spinal cord injury and sensitive to classical anti-spastic

drugs (Bennett et al., 2004; Li et al., 2004; Rank et al., 2011).

This method thus represents a quantitative, observer-independent

measurement of spasticity. In our model, we were able to almost

abolish spasticity by the use of cyproheptadine, a broad 5-HT2

inverse agonist, and SB206553, a much more selective compound

known to target 5-HT2B and C (Kennett et al., 1996), arguing for

the involvement of one of these two receptors in ALS spasticity.

Murray et al. (2010) observed increased production of the un-

edited 5-Ht2c messenger RNA in rats with chronic spinal cord

injury, whereas our result in mSOD1 mice was opposite. Recent

work in another paradigm of spinal cord injury found unchanged

levels of editing of the 5-ht2c messenger RNA in rats (Navarrett

et al., 2012). This discrepancy might be due to species differences

(rats versus mice), to the different kinetics of serotonin loss [abrupt

in spinal cord injury but much slower in SOD1 (G86R) mice]. We

found a strong increase in spinal 5-Ht2b receptor expression when

spasticity was obvious, which could underlie the constitutive

activity observed. Indeed, 5-Ht2b receptor has intrinsic constitutive

activity, and the increase of concentration of a G-protein coupled

receptor is on its own sufficient to further increase any constitutive

activity (Seifert and Wenzel-Seifert, 2002). For instance, a 7-fold

over-expression of the 5-Ht2b receptor in cardiomyocytes leads to

a dramatic cardiac phenotype, suggesting that the over-expression

of this receptor in the range we observed in SOD1 (G86R) mice is

sufficient to induce strong constitutive activity (Nebigil et al.,

2003). Our mouse model of ALS is based on transgenic over-

expression of mutant SOD1. Although these mouse models rep-

resent the only currently available model that display selective loss

of both lower and upper motor neurons (Halter et al., 2010;

Ozdinler et al., 2011), they only mimic the 20% of familial

cases that display mutations in the SOD1 gene. Whether spasticity

might also be alleviated by 5-HT2 inverse agonists in other,

non-SOD1 ALS cases represents an open question. In all, our

animal study suggests that spasticity, at least in SOD1-linked

ALS, is due to constitutive activity of the 5-Ht2b receptor rather

than 5-Ht2c.

How far can these mechanistic results be compared with our

pathology study in patients with ALS? Among the patients

included in our study, only Patient 5 showed the complete picture

of upper motor neuron signs, in particular spasticity, whereas the

other patients exhibited either increased reflexes and/or Babinski

signs, but not obvious spasticity (Supplementary Table 1). Patient

5, who displayed spasticity, showed strong loss of serotonergic

terminals on motor neurons and thus appeared indistinguishable

from the other patients with ALS in terms of loss of TPH2 projec-

tions. Interestingly, however, Patient 5 was the single case with

ALS with widespread TDP43 pathology in serotonergic nuclei.

Further work comparing autoptic material from patients with or

without spasticity should be done to highlight potential correl-

ations between serotonin loss and spasticity. Importantly, such a

study could also investigate other phenotypes potentially related

with serotonin such as weight loss, depression or dementia.

Our work has potential clinical implications for the management

of spasticity in those patients presenting such a phenotype. This is

especially true for patients with primary lateral sclerosis, a subtype

of ALS with primary upper motor neuron involvement (Singer

et al., 2007; Gordon et al., 2009). These patients develop prom-

inent spasticity (Kuipers-Upmeijer et al., 2001; Le Forestier et al.,

2001a, b) that is likely to be due to motor neuron hyperexcitability

(Floeter et al., 2005). Spasticity is also sometimes associated with

ALS but difficult to detect clinically, as the tests used to assess

spasticity rely on the integrity of alpha and gamma motor neurons,

both degenerating during ALS (Swash, 2012). Spasticity in ALS

and primary lateral sclerosis has been poorly studied, and few

clinical trials have been performed to treat this symptom

(Ashworth et al., 2012). Only physical therapy was proven to

be effective in a small trial (Drory et al., 2001), and current guide-

lines of the European Federation of Neurological Societies state

that other anti-spastic medications display class IV level of evi-

dence of efficacy and ‘may be tried’ (Ashworth et al., 2006).

A rigorous clinical trial assessing cyproheptadine in ALS spasticity

is thus needed, although treatment of spasticity might also lead to

worsening of motor function as observed in spinal cord injury.

In conclusion, loss of serotonergic neurons is part of the degen-

erative process in ALS and may be involved in spasticity. Further

research is needed to determine whether serotonergic degener-

ation has broader consequences on ALS pathophysiology.

AcknowledgementsAnnie PICCHINENNA (INSERM U692), Marie-Jo RUIVO (INSERM

U692), Isabelle DROUET (Centre hospitalier de Versailles), Eliane

SUPPER (Hopitaux Universitaires de Strasbourg) and Martine

MUCKENSTURM (Hopitaux Universitaires de Strasbourg) provided

technical support for this study.

Degeneration of serotonergic neurons in ALS Brain 2013: 136; 483–493 | 491

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

FundingThis work was funded in part by the Agence Nationale de la

Recherche (ANR Jeune Chercheur Dynemit, to L.D.), Association

pour la recherche sur la SLA et les autres maladies du motoneuron

(ARSla, to F.R. and J.P.L.), Thierry Latran Foundation (L.D., J.P.L.),

Association pour la recherche et le developpement de moyens de

lutte contre les maladies neurodegeneratives (AREMANE),

the European Community’s Health Seventh Framework

Programme (FP7/2007-2013) under grant agreement No

259867 (J.P.L.), and Association francaise de lutte contre les myo-

pathies (AFM, to J.P.L.). The generation of the Tph2 antibody was

supported by the German Research Foundation (DFG) (SFB 581

and SFB TRR 58, to K.P.L.) and the European Community

(NEWMOOD LSHM-CT-2003-503474, to K.P.L.). Collaboration

between L.D. and V.M. is supported by a contrat d’interface

INSERM/AP-HP. L.D. is supported by a Mercator Professorship

(DFG, 2011-2012). A.H. is a research fellow receiving funding

from FP7/2007-2013. J.L.G.D.A. is recipient of a Chaire d’excel-

lence INSERM/Universite de Strasbourg.

Supplementary materialSupplementary material is available at Brain online.

ReferencesAlvarez JC, Bothua D, Collignon I, Advenier C, Spreux-Varoquaux O.

Simultaneous measurement of dopamine, serotonin, their metabolites

and tryptophan in mouse brain homogenates by high-performance

liquid chromatography with dual coulometric detection. Biomed

Chromatogr 1999; 13: 293–8.

Ashworth NL, Satkunam LE, Deforge D. Treatment for spasticity in

amyotrophic lateral sclerosis/motor neuron disease. Cochrane

Database Syst Rev 2006; 1: CD004156.

Ashworth NL, Satkunam LE, Deforge D. Treatment for spasticity in

amyotrophic lateral sclerosis/motor neuron disease. Cochrane

Database Syst Rev 2012; 2: CD004156.

Bennett DJ, Sanelli L, Cooke CL, Harvey PJ, Gorassini MA. Spastic

long-lasting reflexes in the awake rat after sacral spinal cord injury.

J Neurophysiol 2004; 91: 2247–58.

Bertel O, Malessa S, Sluga E, Hornykiewicz O. Amyotrophic lateral scler-

osis: changes of noradrenergic and serotonergic transmitter systems in

the spinal cord. Brain Res 1991; 566: 54–60.

Braunstein KE, Eschbach J, Rona-Voros K, Soylu R, Mikrouli E, Larmet Y,

et al. A point mutation in the dynein heavy chain gene leads to striatal

atrophy and compromises neurite outgrowth of striatal neurons. Hum

Mol Genet 2010; 19: 4385–98.

Brooks BR, Miller RG, Swash M, Munsat TL. El Escorial revisited: revised

criteria for the diagnosis of amyotrophic lateral sclerosis. Amyotroph

Lateral Scler Other Motor Neuron Disord 2000; 1: 293–9.

Drory VE, Goltsman E, Reznik JG, Mosek A, Korczyn AD. The value of

muscle exercise in patients with amyotrophic lateral sclerosis. J Neurol

Sci 2001; 191: 133–7.

Dupuis L, de Tapia M, Rene F, Lutz-Bucher B, Gordon JW, Mercken L,

et al. Differential screening of mutated SOD1 transgenic mice reveals

early up-regulation of a fast axonal transport component in spinal cord

motor neurons. Neurobiol Dis 2000; 7: 274–85.

Dupuis L, Spreux-Varoquaux O, Bensimon G, Jullien P, Lacomblez L,

Salachas F, et al. Platelet serotonin level predicts survival in amyo-

trophic lateral sclerosis. PLoS One 2010; 5: e13346.

Floeter MK, Zhai P, Saigal R, Kim Y, Statland J. Motor neuron firing

dysfunction in spastic patients with primary lateral sclerosis.

J Neurophysiol 2005; 94: 919–27.

Forrest V, Ince P, Leitch M, Marshall EF, Shaw PJ. Serotonergic neuro-

transmission in the spinal cord and motor cortex of patients with

motor neuron disease and controls: quantitative autoradiography for

5-HT1a and 5-HT2 receptors. J Neurol Sci 1996; 139 (Suppl): 83–90.

Franklin K, Paxinos G. The mouse brain in stereotaxic coordinates. San

Diego: Academic Press; 1997.

Gordon PH, Cheng B, Katz IB, Mitsumoto H, Rowland LP. Clinical fea-

tures that distinguish PLS, upper motor neuron-dominant ALS, and

typical ALS. Neurology 2009; 72: 1948–52.

Gurney ME, Pu H, Chiu AY, Dal Canto MC, Polchow CY, Alexander DD,

et al. Motor neuron degeneration in mice that express a human Cu,Zn

superoxide dismutase mutation. Science 1994; 264: 1772–5.

Gutknecht L, Kriegebaum C, Waider J, Schmitt A, Lesch KP.

Spatio-temporal expression of tryptophan hydroxylase isoforms in

murine and human brain: convergent data from Tph2 knockout

mice. Eur Neuropsychopharmacol 2009; 19: 266–82.

Halter B, Gonzalez de Aguilar JL, Rene F, Petri S, Fricker B, Echaniz-

Laguna A, et al. Oxidative stress in skeletal muscle stimulates early

expression of Rad in a mouse model of amyotrophic lateral sclerosis.

Free Radic Biol Med 2010; 48: 915–23.

Heckman CJ, Mottram C, Quinlan K, Theiss R, Schuster J. Motoneuron

excitability: the importance of neuromodulatory inputs. Clin

Neurophysiol 2009; 120: 2040–54.

Ivanhoe CB, Reistetter TA. Spasticity: the misunderstood part of the

upper motor neuron syndrome. Am J Phys Med Rehabil 2004; 83

(10 Suppl): S3–9.

Kennett GA, Wood MD, Bright F, Cilia J, Piper DC, Gager T, et al.

In vitro and in vivo profile of SB 206553, a potent 5-HT2C/5-HT2B

receptor antagonist with anxiolytic-like properties. Br J Pharmacol

1996; 117: 427–34.

Kiernan MC, Vucic S, Cheah BC, Turner MR, Eisen A, Hardiman O, et al.

Amyotrophic lateral sclerosis. Lancet 2011; 377: 942–55.

Kuipers-Upmeijer J, de Jager AE, Hew JM, Snoek JW, van Weerden TW.

Primary lateral sclerosis: clinical, neurophysiological, and magnetic

resonance findings. J Neurol Neurosurg Psychiatry 2001; 71: 615–20.

Lanfranco MF, Anastasio NC, Seitz PK, Cunningham KA. Quantification

of RNA editing of the serotonin 2C receptor (5-HT(C)R) ex vivo.

Methods Enzymol 2010; 485: 311–28.

Lanfranco MF, Seitz PK, Morabito MV, Emeson RB, Sanders-Bush E,

Cunningham KA. An innovative real-time PCR method to measure

changes in RNA editing of the serotonin 2C receptor (5-HT(2C)R) in

brain. J Neurosci Methods 2009; 179: 247–57.

Le Forestier N, Maisonobe T, Spelle L, Lesort A, Salachas F, Lacomblez L,

et al. Primary lateral sclerosis: further clarification. J Neurol Sci 2001a;

185: 95–100.

Le Forestier N, Maisonobe T, Piquard A, Rivaud S, Crevier-Buchman L,

Salachas F, et al. Does primary lateral sclerosis exist? A study of 20

patients and a review of the literature. Brain 2001b; 124 (Pt 10):

1989–99.

Li Y, Li X, Harvey PJ, Bennett DJ. Effects of baclofen on spinal reflexes

and persistent inward currents in motoneurons of chronic spinal rats

with spasticity. J Neurophysiol 2004; 92: 2694–703.

Murray KC, Stephens MJ, Ballou EW, Heckman CJ, Bennett DJ.

Motoneuron excitability and muscle spasms are regulated by

5-HT2B and 5-HT2C receptor activity. J Neurophysiol 2011; 105:

731–48.

Murray KC, Nakae A, Stephens MJ, Rank M, D’Amico J, Harvey PJ, et al.

Recovery of motoneuron and locomotor function after spinal cord

injury depends on constitutive activity in 5-HT2C receptors. Nat

Med 2010; 16: 694–700.

Navarrett S, Collier L, Cardozo C, Dracheva S. Alterations of serotonin

2C and 2A receptors in response to T10 spinal cord transection in rats.

Neurosci Lett 2012; 506: 74–8.

Nebigil CG, Jaffre F, Messaddeq N, Hickel P, Monassier L, Launay JM,

et al. Overexpression of the serotonin 5-HT2B receptor in heart leads

492 | Brain 2013: 136; 483–493 C. Dentel et al.

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

to abnormal mitochondrial function and cardiac hypertrophy.

Circulation 2003; 107: 3223–9.

Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC,

Chou TT, et al. Ubiquitinated TDP-43 in frontotemporal lobar degen-

eration and amyotrophic lateral sclerosis. Science 2006; 314: 130–3.

Ozdinler PH, Benn S, Yamamoto TH, Guzel M, Brown RH Jr, Macklis JD.

Corticospinal motor neurons and related subcerebral projection neu-

rons undergo early and specific neurodegeneration in hSOD1G(9)(3)A

transgenic ALS mice. J Neurosci 2011; 31: 4166–77.

Perrin FE, Gerber YN, Teigell M, Lonjon N, Boniface G, Bauchet L, et al.

Anatomical study of serotonergic innervation and 5-HT(1A) receptor in

the human spinal cord. Cell Death Dis 2011; 2: e218.

Rank MM, Murray KC, Stephens MJ, D’Amico J, Gorassini MA,

Bennett DJ. Adrenergic receptors modulate motoneuron excitability,

sensory synaptic transmission and muscle spasms after chronic spinal

cord injury. J Neurophysiol 2011; 105: 410–22.

Ripps ME, Huntley GW, Hof PR, Morrison JH, Gordon JW. Transgenic

mice expressing an altered murine superoxide dismutase gene provide

an animal model of amyotrophic lateral sclerosis. Proc Natl Acad Sci

USA 1995; 92: 689–93.

Seifert R, Wenzel-Seifert K. Constitutive activity of G-protein-coupled

receptors: cause of disease and common property of wild-type recep-

tors. Naunyn Schmiedebergs Arch Pharmacol 2002; 366: 381–416.

Shannon NJ, Gunnet JW, Moore KE. A comparison of biochemical indices

of 5-hydroxytryptaminergic neuronal activity following electrical

stimulation of the dorsal raphe nucleus. J Neurochem 1986; 47:

958–65.

Singer MA, Statland JM, Wolfe GI, Barohn RJ. Primary lateral sclerosis.

Muscle Nerve 2007; 35: 291–302.

Sofic E, Riederer P, Gsell W, Gavranovic M, Schmidtke A, Jellinger K.

Biogenic amines and metabolites in spinal cord of patients with

Parkinson’s disease and amyotrophic lateral sclerosis. J Neural

Transm Park Dis Dement Sect 1991; 3: 133–42.

Swash M. Why are upper motor neuron signs difficult to elicit in amyo-

trophic lateral sclerosis? J Neurol Neurosurg Psychiatry 2012; 83:

659–62.

Turner MR, Rabiner EA, Al-Chalabi A, Shaw CE, Brooks DJ, Leigh PN,

et al. Cortical 5-HT1A receptor binding in patients with homozygous

D90A SOD1 vs sporadic ALS. Neurology 2007; 68: 1233–5.

Turner MR, Rabiner EA, Hammers A, Al-Chalabi A, Grasby PM,

Shaw CE, et al. [11C]-WAY100635 PET demonstrates marked

5-HT1A receptor changes in sporadic ALS. Brain 2005; 128 (Pt 4):

896–905.

Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De

Paepe A, et al. Accurate normalization of real-time quantitative

RT-PCR data by geometric averaging of multiple internal control

genes. Genome Biology 2002; 3.

Yoshimoto K, Irizawa Y, Komura S. Rapid postmortem changes of rat

striatum dopamine, serotonin, and their metabolites as monitored by

brain microdialysis. Forensic Sci Int 1993; 60: 183–8.

Degeneration of serotonergic neurons in ALS Brain 2013: 136; 483–493 | 493

by g

uest o

n Ju

ly 1

5, 2

014

http

://brain

.oxfo

rdjo

urn

als.org

/D

ow

nlo

aded

from

CONCLUSIONS AND PERSPECTIVES

64

As it is understood today ALS-related pathology is considerably more

complex than originally envisaged. New pathologic events associated with

mSOD1 in cellular populations other than motor neurons are coming into the

spotlight (Boillée et al., 2006a). Throughout the works presented here, we

bring new evidence that highlights the importance of two different cellular

populations (muscle and serotonergic neurons) for disease progression and

for development of future therapeutic approaches.

Muscle dysfunctions in ALS have received little attention so far, as its

pathology was mostly considered a side effect of denervation. However

several lines of evidence support the idea that the muscle is also a target of

mSOD1 toxicity. Muscle is a tissue of great importance for whole body

homeostasis. At the same time ALS has been associated with metabolic

dysfunctions with undeniable clinical importance. Metabolic changes in ALS

have a negative impact on disease progression and correlate with a bad

prognosis (Dupuis et al., 2011). From this perspective we investigated the

metabolic profile of muscle tissue in our mouse model for ALS, in order to

establish whether there is a connection between muscle pathology and

metabolic disequilibrium.

One exciting finding of our study showed that asymptomatic SOD1G86R

mice have an increased resistance to moderate/aerobic exercise. This might

provide an interesting explanation to the high prevalence of ALS amongst

athletes, which has been a matter of debate for decades. In the same time

these animals showed a lower performance during anaerobic/glycolytic

exercise when compared to WT littermates. This indicated an alteration of the

adaptability capacity in mSOD1G86R mice.

Indeed, the metabolic profile of glycolytic muscle fibers, that were the

most affected by denervation and atrophy, presented deeper metabolic

alteration that were evident at an early asymptomatic stage. We demonstrated

that the increase in endurance capacity associated with the inability to support

intense exercise mirrored a profound alteration of fuel preference in muscle

65

fibers consisting in an inhibition of glycolysis and an up-regulation of the lipid

oxidation pathway. These alterations were identified in young asymptomatic

animals, and they were specific to glycolytic muscle fibers. This is in

agreement with previous findings indicating a switch in muscle fiber type,

pinpointing muscle tissue as site of lipid usage and hypermetabolism. We

identified PDK4 as the master regulator of this change in metabolic phenotype.

In skeletal muscle, PDK4 is the major isoform of this kinase family expressed,

and is considered as a critical regulator of pyruvate dehydrogenase (PDH)

activity (Harris et al., 2002). By phosphorylating PDH, PDK4 inhibits the entry

of pyruvate into the Krebs cycle and inhibits glucose oxidation (Sugden et al.,

2000). This mechanism is activated mainly during periods of energetic crisis

(e.g. starvation), and participates to a change in fiber type form glycolytic to

oxidative. PDK4 was upregulated in glycolytic muscle fibers of young

asymptomatic animals. The effect of PDK4 activation on glucose metabolism

was evidenced by decreased enzymatic activity of phosphofructokinase, the

rate-limiting enzyme of glycolysis. At this stage, glucose entry was not altered,

as we observed an increase in glycogen that suggested that glucose is

rerouted towards glycogen stores.

This switch towards increased lipid usage was independent of PGC-1α,

the main regulator of muscle metabolism. Moreover, PGC-1α was inhibited

with disease progression, and this correlates with a decreased expression of

genes involved in mitochondrial biogenesis. This was reflected by a decreased

expression of mtDNA especially evident at end stage. In this context, it is

expected that the increased ROS production issued from lipid metabolism will

add more pressure to an already fragile mitochondrial system.

Using dichloroacetate (DCA), a specific inhibitor of PDK4 we aimed at

restoring the glycolytic pathway and metabolic equilibrium in muscle fibers.

The attractiveness of this approach lies within the fact that PDK4 is not

expressed in motor neurons, which helped us to relatively isolate the effects of

our pharmacological treatment. Our results show clear benefits of DCA

administration on disease progression, delaying symptom onset and

denervation. Moreover this treatment had beneficial effects on mitochondrial

66

metabolism, restoring the expression of genes involved in glucose oxidation

(citrate synthase), mitochondrial biogenesis (Pgc-1α, mfn1), and reducing the

expression of genes involved in ROS scavenging (Gpx).

Our findings helped us isolate an interesting pathologic mechanism that

participates to the hypermetabolic states of SOD1G86R mice. This brings new

evidence supporting the involvement of muscle tissue in the progression of this

disease, and supports the interest in further investigating metabolic targets for

the development of future therapies.

In parallel we investigated the therapeutic significance of another

important metabolic regulator, Sirt1. In muscle tissues Sirt1 has an important

function regulating muscle adaptation to exercise, mainly by de-acetylating and

activating PGC-1α. Sirt1 was found upregulated in muscle tissues of two

different mouse models mainly at end stage. This correlates with an altered

NAD+/NADH ratio that we have shown in the previous section and is probably

the reflection an acute energetic distress. Targeting muscular Sirt1 in the early

states of the disease could have beneficial effects, protecting mitochondria

and protecting from energetic distress. However, in this work we showed a

different expression of Sirt1 between muscle and spinal cord, where Sirt1 was

inhibited. Activating Sirt1 (pharmacologically or genetically) in neuronal cells

expressing mSOD1 did not have beneficial effects. Taken all these aspects

into consideration, the therapeutic potential of Sirt1 remains elusive.

Another important aspect of muscle pathology that we explored was

muscle spasticity, a debilitating condition that has a negative impact on

patient’s quality of life. We show for the first time pathological alterations of

serotonergic system in ALS patients and an ALS mouse model. Further we

bring evidence supporting a direct relationship between the degeneration of

serotonergic projections and the development of spasticity in SOD1G86R mice.

Activation of constitutively active serotonin receptors 5HT2B is the direct

consequence of the loss of serotonergic projections to the motor neurons in

the spinal cord. This is extremely relevant for management of spasticity in PLS

and ALS patients presenting with such symptoms.

67

We show for the first time that muscle tissue suffers metabolic

alterations early in the course of disease development, alterations that

influence the course of the pathology. These alterations are specific to

glycolytic muscle fibers and therefore can explain the sensitivity of glycolytic

fibers to atrophy and denervation. Moreover, the mechanism described offers

further understanding of the systemic metabolic alterations that accompany

ALS. By exploring this mechanism we pinpointed the molecular actors

involved in these modifications and we identified a potential therapeutic target

on this pathway. Further we investigated the potential of specific therapeutic

targets in the central nervous system that could improve muscle function and

have beneficial effects on patient’s quality of life. Altogether the work

presented here brings new evidence supporting the importance of muscle

pathology in ALS and its relevance for the design of new therapeutic

approaches.

68

SUMMARY IN FRENCH

69

INTRODUCTION

La sclérose latérale amyotrophique (SLA) est une maladie

neurodégénérative fatale caractérisée par une perte progressive et

sélective des motoneurones. La dénervation musculaire associée à

cette perte provoque une paralysie progressive des muscles

squelettiques et une baisse de l’efficacité de la ventilation pulmonaire

conduisant au décès du patient de 3 à 5 ans après la pose du

diagnostic. La majorité des cas de SLA sont des cas sporadiques, et 5

à 10% d'entre eux sont d'origine familiale. A ce jour, une dizaine de

gènes a été associée à cette pathologie. Parmi eux, le gène sod1

codant pour la superoxyde dismutase 1 a été le premier identifié dans

des formes familiales. Des mutations de ce gène sont retrouvées dans

20% des formes familiales et 2% des formes sporadiques.

L'identification de ces mutations a permis de générer des souris

transgéniques modèles de cette pathologie grâce auxquelles il est

possible d'étudier les mécanismes cellulaires et moléculaires qui sous-

tendent cette pathologie.

Jusque très récemment, la SLA était considérée comme une

maladie intrinsèque du motoneurone, le premier événement visible

dans la progression de la maladie étant une déstabilisation des

jonctions neuromusculaires (JNM), points de contact fonctionnels entre

les motoneurones et les muscles qu’ils innervent. Cependant depuis

une quinzaine d’années, des travaux réalisés tant chez l’homme que

dans des modèles murins montrent que la SLA est une maladie

systémique qui affecte l’ensemble de l’organisme et s’accompagne

d’importantes altérations de l’homéostasie énergétique. En effet, des

altérations métaboliques (hypermétabolisme et dyslipidémie) et

mitochondriales sont associées au développement de la pathologie et

conduisent à un déficit énergétique chronique. Ces altérations

métaboliques apparaissent précocement au cours de la maladie, bien

avant que les motoneurones ne meurent et des arguments

70

expérimentaux suggèrent que des modifications métaboliques au

niveau musculaire pourraient participer au développement de la

pathologie. En effet, l’induction expérimentale d’un hypermétabolisme

musculaire est suffisante à elle seule pour induire une dénervation

musculaire et une perte de motoneurones. Ces travaux ont permis

d’émettre de nouvelles hypothèses quant au point de départ de la

pathologie et aux acteurs conduisant au démantèlement de la JNM et à

la mort des motoneurones, mettant en avant le rôle actif potentiel du

muscle dans cette pathologie.

OBJECTIFS

Les modifications du métabolisme dans la SLA commencent à

être perçues comme un aspect pathologique important, même si elles

ne sont pas encore complètement définies. De nombreuses zones

d’ombres persistent, mais il est déjà bien établi que l’état

métabolique/énergétique dans la SLA a des effets directs sur la

progression de la maladie et la survie. Un fort indice de masse corporel

est notamment associé à un meilleur pronostique clinique chez les

patients SLA et une diète enrichie en lipides préserve les fonctions

motrices des souris SOD1 et augmente leurs survies.

L’homéostasie générale d’un organisme a un effet direct sur l‘activité

métabolique musculaire. Certaines études montrent que l’exercice

musculaire modéré est bénéfique dans les modèles animaux et pour

les patients SLA. Il a également été démontré par diverses approches

expérimentales que l’interaction nerf-muscle joue un rôle important

dans la stabilité de la jonction neuromusculaire (JMN).

Le laboratoire a démontré que le métabolisme musculaire est altéré

dans la SLA, et que ces altérations peuvent participer à la dénervation.

A partir de ces observations, nous pouvons imaginer que des

71

interventions thérapeutiques ciblant le muscle seraient bénéfiques en

préservant la fonctionnalité musculaire, l’intégrité de la JMN et en

améliorant significativement la qualité de vie des patients.

L’hypothèse de ma thèse est qu’en disséquant la pathologie

musculaire dans la SLA, nous gagnerons en compréhension dans cette

maladie et que de nouvelles stratégies thérapeutiques pourront être

proposées.

C’est dans ce contexte que se situe mon travail de thèse intitulé

« Etudes des altérations métaboliques musculaires au cours de la

sclérose latérale amyotrophique : rôle dans le développement de la

pathologie. ».

Les objectifs de ce travail ont été doubles :

I- Caractériser précisément les modifications métaboliques

précoces au niveau musculaire et comparer le décours de ces

altérations dans deux types de muscles : les muscles

glycolytiques, qui sont les muscles les plus touchés au cours de

la SLA, et les muscles oxydatifs qui eux semblent plus résistants

à la dénervation.

II- Evaluer les conséquences fonctionnelles de ces

modifications par des approches pharmacologiques afin de

comprendre si et comment ces altérations peuvent influencer la

mise en place de la pathologie.

METHODES

Ce travail a été réalisé dans le modèle de souris transgéniques

SOD1G86R qui surexprime une mutation du gène codant pour la SOD1

et développent une maladie du motoneurone présentant le même

tableau clinique que celui observé chez les patients. Dans ce modèle

murin de SLA, le décours de la pathologie se décline en plusieurs

stades : 65j stade asymptomatique d’un point de vue des atteintes

72

motrices, 90j stade où les premiers déficits de motricité peuvent

apparaître et où l’électromyogramme met en évidence une activité

spontanée de dénervation des fibres musculaires chez certains

animaux, et 105j stade auquel l’animal présente une paralysie avérée.

Pour mener à bien ces études portant sur la caractérisation et le

rôle des altérations métaboliques musculaires précoces au cours de la

SLA, j’ai utilisé des techniques complémentaires permettant d’une part

une approche physiologique intégrée (exercice sur tapis roulant, test

d’agrippement, électromyographie, traitement pharmacologiques) et

d’autre part une approche à l’échelle cellulaire et moléculaire grâce à

des techniques de biochimie et de biologie moléculaire (Western blot,

mesures d’activités enzymatiques, dosages de métabolites, RT-qPCR),

d’histologie, et d’immunohistochimie.

RESULTATS

Dans un premier temps, j’ai réalisé une évaluation fonctionnelle

de l’aptitude à l’exercice des souris SOD1G86R afin de tester les

capacités physiques des souris SOD1G86R à 65j (âge où l’innervation

est normale) en l’absence de tout entrainement et de déterminer si ces

souris étaient capables de s’adapter à des conditions de stress

énergétique de façon comparable à des souris contrôles (WT). Dans ce

but, des souris ont été soumises à deux types d’exercice physique sur

tapis roulant: 1) un protocole aigue à vitesse croissante qui sollicite

principalement les fibres glycolytiques, 2) un protocole réalisé a une

vitesse constante modérée correspondant à 80% de la vitesse

maximale atteinte dans le protocole 1 et sollicitant les fibres oxydatives.

Cette approche intégrée m’a permis de mettre en évidence une

importante et surprenante différence entre les souris WT et les souris

mutées : les souris SOD1G86R présentent des performances réduites

lors d’un exercice intense alors qu’elles ont un endurance supérieure

73

aux souris WT lors d’une course à une vitesse modérée suggérant des

capacités oxydatives accrues.

Pour comprendre l’origine de cette modification d’aptitude à

l’exercice et de réponse à un stress énergétique, j’ai ensuite étudié en

détail le métabolisme des fibres glycolytiques dans le tibialis anterior

(TA) que j’ai comparé à celui de fibres oxydatives (soleus). Les

muscles glycolytiques sont les premiers muscles touchés par la

dénervation au cours de la maladie. Cela m’a permis de mettre en

évidence l’existence d’altérations dynamiques entre le métabolisme

glucidique et le métabolisme lipidique dans les muscles glycolytiques à

un stade asymptomatique du point de vue moteur.

Par des méthodes biochimiques et moléculaires j’ai mis en

évidence une inhibition de la glycolyse reflétée par la réduction de

l’activité de la phosphofructokinase 1 (PFK1). Cette inhibition est

détectée dès 65j et augmente avec la progression de la pathologie. A

cela s’ajoute une induction de l’expression de la pyruvate

déshydrogénase kinase 4 (PDK4), une enzyme qui inhibe l’activité du

complexe pyruvate déshydrogénase (PDH) empêchant ainsi

l’oxydation du pyruvate en acétyl-CoA et son entrée dans le cycle de

Krebs. Parallèlement à ce blocage de l’utilisation du glucose, il y a une

surexpression des gènes impliqués dans la mobilisation et l’utilisation

des lipides (LPL, FAT/CD36, CPT1) ainsi qu’une accumulation de

NADH et d’ATP qui reflètent une augmentation du métabolisme

lipidique. Ces molécules (NADH et ATP) peuvent à leur tour stimuler

l’activité de la PDK4. Cette augmentation de la PDK4, qui s’amplifie

avec l’âge, est indépendante du processus de dénervation et est

spécifique des muscles glycolytiques. De plus, ces changements

métaboliques s’accompagnent d’une répression de PGC1a et de ses

gènes cibles ainsi que d’une baisse de la quantité d’ADN

mitochondrial, suggérant une perte progressive des mitochondries. Il

est à noter qu’aucune des modifications mesurées dans le muscle

glycolytique n’est retrouvée dans le muscle oxydatif.

74

Le dialogue entre ces deux voies métaboliques est essentiel

pour la réponse adaptative du muscle. L’altération de celui-ci avec le

blocage de l’utilisation du glucose peut conduire à une crise

énergétique au sein de l’unité motrice et potentiellement induire la

déstabilisation de la JNM.

Pour comprendre l’importance de ce dysfonctionnement

métabolique précoce dans le développement de la SLA j’ai utilisée une

approche pharmacologique systémique dans le but de normaliser les

modifications observées. J’ai choisi de tester une molécules touchant

une cible précise : la PDK4 qui est induite de manière précoce chez la

souris SODG86R. Pour cela j’ai utilisé le dichloroacétate (DCA), un

inhibiteur de la PDK4. Le traitement à été initié à l’âge de 2 mois, âge

auquel les souris présentent les premiers signes de dénervation ainsi

qu’une perte de poids et une altération de la motricité, et pour une

durée de 5 semaines. Le traitement a eu des effets bénéfiques

ralentissant le processus de dénervation. Le traitement avec le DCA a

normalisé l’expression de PDK4, augmenté l’expression des gènes

impliqués dans le fonctionnement de la mitochondrie, prévenu la perte

de poids associée à la progression de la maladie et augmenté la force

musculaire. Ces expériences montrent que le dysfonctionnement

métabolique est une composante importante de la pathologie et qu'en

ciblant ces altérations métaboliques, il est possible de prévenir la

dénervation et d’améliorer le métabolisme global des souris SOD1G86R.

75

CONCLUSION

Telle qu’elle est comprise aujourd’hui, la SLA a un tableau

clinique considérablement plus complexe que prévue initialement. Des

nouvelles pathologies associées à la mSOD1 dans des populations

cellulaires autres que les neurones moteurs sont mis en évidence. Tout

au long des travaux présentés ici, nous apportons de nouveaux indices

qui soulignent l'importance d’un autre type cellulaire (le muscle) dans la

progression de la maladie.

Les dysfonctionnements musculaires dans la SLA ont reçu peu

d'attention jusqu'à présent, comme la pathologie était surtout

considérée comme un effet secondaire de la dénervation. Cependant

plusieurs sources de données soutiennent l'idée que le muscle est

également une cible de toxicité de la mSOD1. Le muscle est un tissu

d'une grande importance pour l’homéostasie métabolique de

l’organisme. En même temps, la SLA a été associée à des

dysfonctionnements métaboliques ayant une importance clinique

indéniable. La diminution de l’indice de masse corporel, et donc des

réserves lipidiques, a un impact négatif sur la progression de la

maladie et corréle avec un mauvais pronostic. Dans cette perspective,

nous avons étudié le profil métabolique du tissu musculaire dans notre

modèle de souris pour la SLA, afin d’établir s'il existe un lien entre la

pathologie musculaire et le déséquilibre métabolique.

La découverte majeure de notre étude est que les souris

SOD1G86R asymptomatiques ont une résistance accrue à un exercice

modéré / aérobic. Dans le même temps, ces animaux ont montré une

performance inférieure pour un exercise anaérobic / glycolytique par

rapport aux WT. Ceci indique une altération de la capacité d’adaptation

chez la souris mSOD1G86R. Ces résultats peuvent fournir des éléments

de réflexion pour l’étude des liens, actuellement débattus, entre

l’activité physique et le développement de la SLA chez les patients.

76

En effet, le profil métabolique des fibres musculaires

glycolytiques, qui sont en fait les plus touchés par la dénervation et

l’atrophie, présente des profondes modifications métaboliques,

évidentes à un stade asymptotique précoce. Nous avons démontré que

l'augmentation de l’endurance associée à une capacité réduite pour un

exercice intense reflète une altération profonde de l’utilisation de

carburant dans les fibres musculaires des souris de 65 jours. Ces

altérations consistent en une inhibition de la glycolyse et une hausse

de la voie d’utilisation des lipides. Ces modifications ont été identifiées

chez les animaux jeunes asymptomatiques, et sont spécifiquement

trouvés dans fibres musculaires glycolytiques. Ceci est en accord avec

les résultats antérieurs indiquant un changement de type de fibre

musculaire au cours de la maladie, et qui marque l’utilisation accrue

des lipides par le muscle et son hypermetabolisme. Nous avons

identifié PDK4 comme le régulateur de ce changement dans le

phénotype métabolique. Ce mécanisme est activé principalement

pendant les périodes de crise énergétique (par exemple, la restriction

calorique), et participe à un changement de type fibre de glycolytique

vers oxydatif. PDK4 est régulée à la hausse dans les fibres

musculaires glycolytiques des jeunes animaux asymptomatiques.

L'effet de l’activation de PDK4 sur le métabolisme du glucose diminue

de l'activité enzymatique de la phosphofructokinase, l’enzyme limitante

de la glycolyse. A ce stade, l'entrée du glucose n'a pas été modifiée,

comme nous avons observé une augmentation de glycogène qui

suggère que le glucose est redistribué vers les réserves de glycogène.

Ce changement vers une utilisation accrue des lipides était

indépendant de PGC-1α, le principal régulateur du métabolisme

musculaire. En outre, PGC-1α est inhibée avec la progression de la

maladie, ce qui est en corrélation avec une diminution de l'expression

des gènes impliqués dans la biogenèse mitochondriale. Cela s'est

traduit par une diminution de l’expression de l'ADNmt particulièrement

évident au stade final. Dans ce contexte, il est attendu à ce que

77

l’augmentation de la production des ROS émis par le métabolisme

lipidique ajoute plus de pression pour un système mitochondrial déjà

fragilisé.

En utilisant le dichloroacétate (DCA), un inhibiteur spécifique de

PDK4, nous avons cherché à restaurer la voie de la glycolyse et donc

l'équilibre métabolique dans les fibres musculaires. L'attrait de cette

approche réside dans le fait que PDK4 n'est pas exprimé dans les

neurones moteurs, ce qui nous a aidé à isoler les effets de notre

traitement pharmacologique. Nos résultats montrent des effets

bénéfiques évidents de l’administration DCA de la progression de la

maladie, ce qui retarde l'apparition des symptômes et la dénervation.

En outre, ce traitement a des effets bénéfiques sur le métabolisme

mitochondrial, la restauration de l'expression de gènes impliqués dans

l'oxydation du glucose (citrate synthase), la biogenèse mitochondriale

(PGC-1α, mfn1), et la réduction de l'expression de gènes impliqués

dans la neutralisation des ROS (GPX).

Nos résultats nous ont permis d'isoler un mécanisme

pathologique intéressant qui contribue à l’état hypermétabolique de la

souris SOD1G86R. Cela apporte une nouvelle preuve de la participation

du tissu musculaire dans la progression de cette maladie, et soutient

l’investigation des cibles métaboliques pour le développement de

thérapies futures.

Mon travail de thèse a permis de montrer que dans un modèle

murin de SLA il existe des altérations métaboliques précoces,

spécifiques aux muscles glycolytiques qui sont les premiers atteint lors

de la SLA, et d’identifier les mécanismes qui conduisent à l’inhibition de

l’oxydation du glucose dans ces muscles. De plus il a permis de

montrer que par des approches pharmacologiques, il est possible

d’intervenir en limitant ces altérations permettant ainsi un maintien des

unités motrices fonctionnelles.

78

BIBLIOGRAPHY

79

Aguer, C., Fiehn, O., Seifert, E.L., Bézaire, V., Meissen, J.K., Daniels, A., Scott, K., Renaud,

J.-M., Padilla, M., Bickel, D.R., et al. (2013). Muscle uncoupling protein 3 overexpression

mimics endurance training and reduces circulating biomarkers of incomplete β-oxidation.

FASEB J. 27, 4213–4225.

Alami, N.H., Smith, R.B., Carrasco, M.A., Williams, L.A., Winborn, C.S., Han, S.S.W., Kiskinis,

E., Winborn, B., Freibaum, B.D., Kanagaraj, A., et al. (2014). Axonal transport of TDP-43

mRNA granules is impaired by ALS-causing mutations. Neuron 81, 536–543.

Alexianu, M.E., Kozovska, M., and Appel, S.H. (2001). Immune reactivity in a mouse model of

familial ALS correlates with disease progression. Neurology 57, 1282–1289.

Allaman, I., Bélanger, M., and Magistretti, P.J. (2011). Astrocyte-neuron metabolic

relationships: for better and for worse. Trends Neurosci. 34, 76–87.

Almeida, S., Gascon, E., Tran, H., Chou, H.J., Gendron, T.F., Degroot, S., Tapper, A.R.,

Sellier, C., Charlet-Berguerand, N., Karydas, A., et al. (2013). Modeling key pathological

features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human

neurons. Acta Neuropathol. 126, 385–399.

Andersen, P.M., and Al-Chalabi, A. (2011). Clinical genetics of amyotrophic lateral sclerosis:

what do we really know? Nat. Rev. Neurol. 7, 603–615.

Armstrong, G.A.B., and Drapeau, P. (2013). Loss and gain of FUS function impair

neuromuscular synaptic transmission in a genetic model of ALS. Hum. Mol. Genet. 22, 4282–

4292.

Ashworth, N.L., Satkunam, L.E., and Deforge, D. (2012). Treatment for spasticity in

amyotrophic lateral sclerosis/motor neuron disease. Cochrane Database Syst. Rev. 2,

CD004156.

Bahadorani, S., Mukai, S.T., Rabie, J., Beckman, J.S., Phillips, J.P., and Hilliker, A.J. (2013).

Expression of zinc-deficient human superoxide dismutase in Drosophila neurons produces a

locomotor defect linked to mitochondrial dysfunction. Neurobiol. Aging 34, 2322–2330.

Beckman, J.S., Carson, M., Smith, C.D., and Koppenol, W.H. (1993). ALS, SOD and

peroxynitrite. Nature 364, 584.

Beckman, J.S., Estévez, A.G., Crow, J.P., and Barbeito, L. (2001). Superoxide dismutase and

the death of motoneurons in ALS. Trends Neurosci. 24, S15–S20.

Bélanger, M., and Magistretti, P.J. (2009). The role of astroglia in neuroprotection. Dialogues

Clin. Neurosci. 11, 281–295.

Bendotti, C., Calvaresi, N., Chiveri, L., Prelle, A., Moggio, M., Braga, M., Silani, V., and De

Biasi, S. (2001). Early vacuolization and mitochondrial damage in motor neurons of FALS

mice are not associated with apoptosis or with changes in cytochrome oxidase histochemical

reactivity. J. Neurol. Sci. 191, 25–33.

Bodine, S.C., Stitt, T.N., Gonzalez, M., Kline, W.O., Stover, G.L., Bauerlein, R., Zlotchenko,

E., Scrimgeour, A., Lawrence, J.C., Glass, D.J., et al. (2001a). Akt/mTOR pathway is a crucial

regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell

Biol. 3, 1014–1019.

Bodine, S.C., Latres, E., Baumhueter, S., Lai, V.K., Nunez, L., Clarke, B.A., Poueymirou,

W.T., Panaro, F.J., Na, E., Dharmarajan, K., et al. (2001b). Identification of ubiquitin ligases

required for skeletal muscle atrophy. Science 294, 1704–1708.

80

Boillée, S., Vande Velde, C., and Cleveland, D.W. (2006a). ALS: a disease of motor neurons

and their nonneuronal neighbors. Neuron 52, 39–59.

Boillée, S., Yamanaka, K., Lobsiger, C.S., Copeland, N.G., Jenkins, N.A., Kassiotis, G.,

Kollias, G., and Cleveland, D.W. (2006b). Onset and progression in inherited ALS determined

by motor neurons and microglia. Science 312, 1389–1392.

Bordone, L., and Guarente, L. (2005). Calorie restriction, SIRT1 and metabolism:

understanding longevity. Nat. Rev. Mol. Cell Biol. 6, 298–305.

Van Den Bosch, L., Tilkin, P., Lemmens, G., and Robberecht, W. (2002). Minocycline delays

disease onset and mortality in a transgenic model of ALS. Neuroreport 13, 1067–1070.

Bottinelli, R., Canepari, M., Reggiani, C., and Stienen, G.J. (1994). Myofibrillar ATPase

activity during isometric contraction and isomyosin composition in rat single skinned muscle

fibres. J. Physiol. 481, 663–675.

Bouteloup, C., Desport, J.-C., Clavelou, P., Guy, N., Derumeaux-Burel, H., Ferrier, A., and

Couratier, P. (2009). Hypermetabolism in ALS patients: an early and persistent phenomenon.

J. Neurol. 256, 1236–1242.

Brown, R.H. (1998). SOD1 aggregates in ALS: cause, correlate or consequence? Nat. Med.

4, 1362–1364.

Brown, G.C., and Neher, J.J. (2014). Microglial phagocytosis of live neurons. Nat. Rev.

Neurosci. 15, 209–216.

Bruijn, L.I., Beal, M.F., Becher, M.W., Schulz, J.B., Wong, P.C., Price, D.L., and Cleveland,

D.W. (1997). Elevated free nitrotyrosine levels, but not protein-bound nitrotyrosine or hydroxyl

radicals, throughout amyotrophic lateral sclerosis (ALS)-like disease implicate tyrosine

nitration as an aberrant in vivo property of one familial ALS-linked superoxide di. Proc. Natl.

Acad. Sci. U. S. A. 94, 7606–7611.

Bruijn, L.I., Houseweart, M.K., Kato, S., Anderson, K.L., Anderson, S.D., Ohama, E., Reaume,

A.G., Scott, R.W., and Cleveland, D.W. (1998). Aggregation and motor neuron toxicity of an

ALS-linked SOD1 mutant independent from wild-type SOD1. Science 281, 1851–1854.

Buratti, E., Dörk, T., Zuccato, E., Pagani, F., Romano, M., and Baralle, F.E. (2001). Nuclear

factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. EMBO J.

20, 1774–1784.

Burke, R.E., Levine, D.N., Zajac, F.E., Tsairis, P., and Engel, W.K. (1971). Mammalian Motor

Units: Physiological-Histochemical Correlation in Three Types in Cat Gastrocnemius. Science

(80-. ). 174, 709–712.

Cantó, C., Jiang, L.Q., Deshmukh, A.S., Mataki, C., Coste, A., Lagouge, M., Zierath, J.R., and

Auwerx, J. (2010). Interdependence of AMPK and SIRT1 for metabolic adaptation to fasting

and exercise in skeletal muscle. Cell Metab. 11, 213–219.

Carreras, I., Yuruker, S., Aytan, N., Hossain, L., Choi, J.-K., Jenkins, B.G., Kowall, N.W., and

Dedeoglu, A. (2010). Moderate exercise delays the motor performance decline in a transgenic

model of ALS. Brain Res. 1313, 192–201.

Carrì, M.T., and Cozzolino, M. (2011). SOD1 and mitochondria in ALS: a dangerous liaison. J.

Bioenerg. Biomembr. 43, 593–599.

Cassina, P., Pehar, M., Vargas, M.R., Castellanos, R., Barbeito, A.G., Estévez, A.G.,

Thompson, J.A., Beckman, J.S., and Barbeito, L. (2005). Astrocyte activation by fibroblast

growth factor-1 and motor neuron apoptosis: implications for amyotrophic lateral sclerosis. J.

Neurochem. 93, 38–46.

81

Catoire, M., Alex, S., Paraskevopulos, N., Mattijssen, F., Evers-van Gogh, I., Schaart, G.,

Jeppesen, J., Kneppers, A., Mensink, M., Voshol, P.J., et al. (2014). Fatty acid-inducible

ANGPTL4 governs lipid metabolic response to exercise. Proc. Natl. Acad. Sci. U. S. A. 111,

E1043–52.

Chiò, A., Benzi, G., Dossena, M., Mutani, R., and Mora, G. (2005). Severely increased risk of

amyotrophic lateral sclerosis among Italian professional football players. Brain 128, 472–476.

Chuang, D.-M., Leng, Y., Marinova, Z., Kim, H.-J., and Chiu, C.-T. (2009). Multiple roles of

HDAC inhibition in neurodegenerative conditions. Trends Neurosci. 32, 591–601.

Cleveland, D.W., and Rothstein, J.D. (2001). From Charcot to Lou Gehrig: deciphering

selective motor neuron death in ALS. Nat. Rev. Neurosci. 2, 806–819.

Conte, A., Lattante, S., Zollino, M., Marangi, G., Luigetti, M., Del Grande, A., Servidei, S.,

Trombetta, F., and Sabatelli, M. (2012). P525L FUS mutation is consistently associated with a

severe form of juvenile amyotrophic lateral sclerosis. Neuromuscul. Disord. 22, 73–75.

Couratier, P., Hugon, J., Sindou, P., Vallat, J.M., and Dumas, M. (1993). Cell culture evidence

for neuronal degeneration in amyotrophic lateral sclerosis being linked to glutamate

AMPA/kainate receptors. Lancet 341, 265–268.

Cozzolino, M., and Carrì, M.T. (2012). Mitochondrial dysfunction in ALS. Prog. Neurobiol. 97,

54–66.

Crippa, V., Boncoraglio, A., Galbiati, M., Aggarwal, T., Rusmini, P., Giorgetti, E., Cristofani,

R., Carra, S., Pennuto, M., and Poletti, A. (2013). Differential autophagy power in the spinal

cord and muscle of transgenic ALS mice. Front. Cell. Neurosci. 7, 234.

Crow, J.P., Sampson, J.B., Zhuang, Y., Thompson, J.A., and Beckman, J.S. (1997).

Decreased zinc affinity of amyotrophic lateral sclerosis-associated superoxide dismutase

mutants leads to enhanced catalysis of tyrosine nitration by peroxynitrite. J. Neurochem. 69,

1936–1944.

Da Cruz, S., Parone, P. a, Lopes, V.S., Lillo, C., McAlonis-Downes, M., Lee, S.K., Vetto, A.P.,

Petrosyan, S., Marsala, M., Murphy, A.N., et al. (2012). Elevated PGC-1α activity sustains

mitochondrial biogenesis and muscle function without extending survival in a mouse model of

inherited ALS. Cell Metab. 15, 778–786.

Daigle, J.G., Lanson, N.A., Smith, R.B., Casci, I., Maltare, A., Monaghan, J., Nichols, C.D.,

Kryndushkin, D., Shewmaker, F., and Pandey, U.B. (2013). RNA-binding ability of FUS

regulates neurodegeneration, cytoplasmic mislocalization and incorporation into stress

granules associated with FUS carrying ALS-linked mutations. Hum. Mol. Genet. 22, 1193–

1205.

Dal Bello-Haas, V., and Florence, J.M. (2013). Therapeutic exercise for people with

amyotrophic lateral sclerosis or motor neuron disease. Cochrane Database Syst. Rev. 5,

CD005229.

Van Damme, P., Braeken, D., Callewaert, G., Robberecht, W., and Van Den Bosch, L. (2005).

GluR2 deficiency accelerates motor neuron degeneration in a mouse model of amyotrophic

lateral sclerosis. J. Neuropathol. Exp. Neurol. 64, 605–612.

Deforges, S., Branchu, J., Biondi, O., Grondard, C., Pariset, C., Lécolle, S., Lopes, P., Vidal,

P.-P., Chanoine, C., and Charbonnier, F. (2009). Motoneuron survival is promoted by specific

exercise in a mouse model of amyotrophic lateral sclerosis. J. Physiol. 587, 3561–3572.

82

Deng, H., Hentati, A., Tainer, J., Iqbal, Z., Cayabyab, A., Hung, W., Getzoff, E., Hu, P.,

Herzfeldt, B., Roos, R., et al. (1993). Amyotrophic lateral sclerosis and structural defects in

Cu,Zn superoxide dismutase. Science (80-. ). 261, 1047–1051.

Deschenes, M.R., Covault, J., Kraemer, W.J., and Maresh, C.M. (1994). The neuromuscular

junction. Muscle fibre type differences, plasticity and adaptability to increased and decreased

activity. Sports Med. 17, 358–372.

Desport, J.C., Preux, P.M., Truong, T.C., Vallat, J.M., Sautereau, D., and Couratier, P. (1999).

Nutritional status is a prognostic factor for survival in ALS patients. Neurology 53, 1059–1059.

Desport, J.C., Preux, P.M., Magy, L., Boirie, Y., Vallat, J.M., Beaufrère, B., and Couratier, P.

(2001). Factors correlated with hypermetabolism in patients with amyotrophic lateral sclerosis.

Am. J. Clin. Nutr. 74, 328–334.

Dietz, K.C., and Casaccia, P. (2010). HDAC inhibitors and neurodegeneration: at the edge

between protection and damage. Pharmacol. Res. 62, 11–17.

Dobrowolny, G., Aucello, M., Rizzuto, E., Beccafico, S., Mammucari, C., Boncompagni, S.,

Bonconpagni, S., Belia, S., Wannenes, F., Nicoletti, C., et al. (2008). Skeletal muscle is a

primary target of SOD1G93A-mediated toxicity. Cell Metab. 8, 425–436.

Dum, R.P., and Kennedy, T.T. (1980). Physiological and histochemical characteristics of

motor units in cat tibialis anterior and extensor digitorum longus muscles. J. Neurophysiol. 43,

1615–1630.

Dupuis, Pradat, P., Meininger, V., and Loeffler, J. (2003). sclerosis.

Dupuis, L., Oudart, H., René, F., Gonzalez de Aguilar, J.-L., and Loeffler, J.-P. (2004).

Evidence for defective energy homeostasis in amyotrophic lateral sclerosis: benefit of a high-

energy diet in a transgenic mouse model. Proc. Natl. Acad. Sci. U. S. A. 101, 11159–11164.

Dupuis, L., Gonzalez de Aguilar, J.-L., Echaniz-Laguna, A., Eschbach, J., Rene, F., Oudart,

H., Halter, B., Huze, C., Schaeffer, L., Bouillaud, F., et al. (2009). Muscle mitochondrial

uncoupling dismantles neuromuscular junction and triggers distal degeneration of motor

neurons. PLoS One 4, e5390.

Dupuis, L., Pradat, P.-F., Ludolph, A.C., and Loeffler, J.-P. (2011). Energy metabolism in

amyotrophic lateral sclerosis. Lancet Neurol. 10, 75–82.

Echaniz-Laguna, A., Zoll, J., Ribera, F., Tranchant, C., Warter, J.-M., Lonsdorfer, J., and

Lampert, E. (2002). Mitochondrial respiratory chain function in skeletal muscle of ALS

patients. Ann. Neurol. 52, 623–627.

Echaniz-Laguna, A., Zoll, J., and Ponsot, E. (2006). Muscular mitochondrial function in

amyotrophic lateral sclerosis is progressively altered as the disease develops: a temporal

study in man. Exp. … 198, 25–30.

Edström, L., and Kugelberg, E. (1968). Histochemical composition, distribution of fibres and

fatiguability of single motor units. Anterior tibial muscle of the rat. J. Neurol. Neurosurg.

Psychiatry 31, 424–433.

Egan, B., and Zierath, J.R. (2013). Exercise metabolism and the molecular regulation of

skeletal muscle adaptation. Cell Metab. 17, 162–184.

Egan, B., Carson, B.P., Garcia-Roves, P.M., Chibalin, A. V, Sarsfield, F.M., Barron, N.,

McCaffrey, N., Moyna, N.M., Zierath, J.R., and O’Gorman, D.J. (2010). Exercise intensity-

dependent regulation of peroxisome proliferator-activated receptor coactivator-1 mRNA

abundance is associated with differential activation of upstream signalling kinases in human

skeletal muscle. J. Physiol. 588, 1779–1790.

83

Estévez, A.G., Crow, J.P., Sampson, J.B., Reiter, C., Zhuang, Y., Richardson, G.J., Tarpey,

M.M., Barbeito, L., and Beckman, J.S. (1999). Induction of nitric oxide-dependent apoptosis in

motor neurons by zinc-deficient superoxide dismutase. Science 286, 2498–2500.

Facchinetti, F., Sasaki, M., Cutting, F.B., Zhai, P., MacDonald, J.E., Reif, D., Beal, M.F.,

Huang, P.L., Dawson, T.M., Gurney, M.E., et al. (1999). Lack of involvement of neuronal nitric

oxide synthase in the pathogenesis of a transgenic mouse model of familial amyotrophic

lateral sclerosis. Neuroscience 90, 1483–1492.

Fidler, J.A., Treleaven, C.M., Frakes, A., Tamsett, T.J., McCrate, M., Cheng, S.H.,

Shihabuddin, L.S., Kaspar, B.K., and Dodge, J.C. (2011). Disease progression in a mouse

model of amyotrophic lateral sclerosis: the influence of chronic stress and corticosterone.

FASEB J. 25, 4369–4377.

Fischer, L.R., Culver, D.G., Tennant, P., Davis, A. a., Wang, M., Castellano-Sanchez, A.,

Khan, J., Polak, M. a., and Glass, J.D. (2004). Amyotrophic lateral sclerosis is a distal

axonopathy: evidence in mice and man. Exp. Neurol. 185, 232–240.

Frey, D., Schneider, C., Xu, L., Borg, J., Spooren, W., and Caroni, P. (2000). Early and

Selective Loss of Neuromuscular Synapse Subtypes with Low Sprouting Competence in

Motoneuron Diseases. J. Neurosci. 20, 2534–2542.

Fujita, K., Yamauchi, M., Shibayama, K., Ando, M., Honda, M., and Nagata, Y. (1996).

Decreased cytochrome c oxidase activity but unchanged superoxide dismutase and

glutathione peroxidase activities in the spinal cords of patients with amyotrophic lateral

sclerosis. J. Neurosci. Res. 45, 276–281.

Gollnick, P.D., and Saltin, B. (1982). Significance of skeletal muscle oxidative enzyme

enhancement with endurance training. Clin. Physiol. 2, 1–12.

Gong, Y.H., Parsadanian, A.S., Andreeva, A., Snider, W.D., and Elliott, J.L. (2000). Restricted

expression of G86R Cu/Zn superoxide dismutase in astrocytes results in astrocytosis but

does not cause motoneuron degeneration. J. Neurosci. 20, 660–665.

Goto, M., Terada, S., Kato, M., Katoh, M., Yokozeki, T., Tabata, I., and Shimokawa, T. (2000).

cDNA Cloning and mRNA analysis of PGC-1 in epitrochlearis muscle in swimming-exercised

rats. Biochem. Biophys. Res. Commun. 274, 350–354.

Gould, T.W., Buss, R.R., Vinsant, S., Prevette, D., Sun, W., Knudson, C.M., Milligan, C.E.,

and Oppenheim, R.W. (2006). Complete dissociation of motor neuron death from motor

dysfunction by Bax deletion in a mouse model of ALS. J. Neurosci. 26, 8774–8786.

Guarente, L., and Picard, F. (2005). Calorie restriction--the SIR2 connection. Cell 120, 473–

482.

Guo, H., Lai, L., Butchbach, M.E.R., Stockinger, M.P., Shan, X., Bishop, G.A., and Lin, C.G.

(2003). Increased expression of the glial glutamate transporter EAAT2 modulates

excitotoxicity and delays the onset but not the outcome of ALS in mice. Hum. Mol. Genet. 12,

2519–2532.

Gurney, M.E., Cutting, F.B., Zhai, P., Doble, A., Taylor, C.P., Andrus, P.K., and Hall, E.D.

(1996). Benefit of vitamin E, riluzole, and gabapentin in a transgenic model of familial

amyotrophic lateral sclerosis. Ann. Neurol. 39, 147–157.

Gurney, M.E., Fleck, T.J., Himes, C.S., and Hall, E.D. (1998). Riluzole preserves motor

function in a transgenic model of familial amyotrophic lateral sclerosis. Neurology 50, 62–66.

84

Haeusler, A.R., Donnelly, C.J., Periz, G., Simko, E.A.J., Shaw, P.G., Kim, M.-S., Maragakis,

N.J., Troncoso, J.C., Pandey, A., Sattler, R., et al. (2014). C9orf72 nucleotide repeat

structures initiate molecular cascades of disease. Nature 507, 195–200.

Haidet-Phillips, A.M., Hester, M.E., Miranda, C.J., Meyer, K., Braun, L., Frakes, A., Song, S.,

Likhite, S., Murtha, M.J., Foust, K.D., et al. (2011). Astrocytes from familial and sporadic ALS

patients are toxic to motor neurons. Nat. Biotechnol. 29, 824–828.

Halter, B., Gonzalez de Aguilar, J.-L., Rene, F., Petri, S., Fricker, B., Echaniz-Laguna, A.,

Dupuis, L., Larmet, Y., and Loeffler, J.-P. (2010). Oxidative stress in skeletal muscle

stimulates early expression of Rad in a mouse model of amyotrophic lateral sclerosis. Free

Radic. Biol. Med. 48, 915–923.

Ben Hamida, M., Hentati, F., and Ben Hamida, C. (1990). Hereditary motor system diseases

(chronic juvenile amyotrophic lateral sclerosis). Conditions combining a bilateral pyramidal

syndrome with limb and bulbar amyotrophy. Brain 113 ( Pt 2, 347–363.

Hardiman, O., van den Berg, L.H., and Kiernan, M.C. (2011). Clinical diagnosis and

management of amyotrophic lateral sclerosis. Nat. Rev. Neurol. 7, 639–649.

Harris, R.A., Bowker-Kinley, M.M., Huang, B., and Wu, P. (2002). Regulation of the activity of

the pyruvate dehydrogenase complex. Adv. Enzyme Regul. 42, 249–259.

Hassel, B., and Dingledine, R. (2012). Glutamate and Glutamate Receptors. In Basic

Neurochemistry, pp. 342–366.

Hegedus, J., Putman, C.T., and Gordon, T. (2007). Time course of preferential motor unit loss

in the SOD1 G93A mouse model of amyotrophic lateral sclerosis. Neurobiol. Dis. 28, 154–

164.

Henneman, E., Somjen, G., and Carpenter, D.O. (1965). FUNCTIONAL SIGNIFICANCE OF

CELL SIZE IN SPINAL MOTONEURONS. J Neurophysiol 28, 560–580.

Holloszy, J.O., Kohrt, W.M., and Hansen, P.A. (1998). The regulation of carbohydrate and fat

metabolism during and after exercise. Front. Biosci. 3, D1011–27.

Hood, D.A., Balaban, A., Connor, M.K., Craig, E.E., Nishio, M.L., Rezvani, M., and Takahashi,

M. (1994). Mitochondrial biogenesis in striated muscle. Can. J. Appl. Physiol. 19, 12–48.

Hughes, B.W., Kusner, L.L., and Kaminski, H.J. (2006). Molecular architecture of the

neuromuscular junction. Muscle Nerve 33, 445–461.

Huisman, M.H.B., Seelen, M., de Jong, S.W., Dorresteijn, K.R.I.S., van Doormaal, P.T.C., van

der Kooi, A.J., de Visser, M., Schelhaas, H.J., van den Berg, L.H., and Veldink, J.H. (2013).

Lifetime physical activity and the risk of amyotrophic lateral sclerosis. J. Neurol. Neurosurg.

Psychiatry 84, 976–981.

HUXLEY, A.F. (1957). Muscle structure and theories of contraction. Prog. Biophys. Biophys.

Chem. 7, 255–318.

Jaarsma, D., Haasdijk, E.D., Grashorn, J.A., Hawkins, R., van Duijn, W., Verspaget, H.W.,

London, J., and Holstege, J.C. (2000). Human Cu/Zn superoxide dismutase (SOD1)

overexpression in mice causes mitochondrial vacuolization, axonal degeneration, and

premature motoneuron death and accelerates motoneuron disease in mice expressing a

familial amyotrophic lateral sclerosis mutant SO. Neurobiol. Dis. 7, 623–643.

Jaarsma, D., Teuling, E., Haasdijk, E.D., De Zeeuw, C.I., and Hoogenraad, C.C. (2008).

Neuron-specific expression of mutant superoxide dismutase is sufficient to induce

amyotrophic lateral sclerosis in transgenic mice. J. Neurosci. 28, 2075–2088.

85

Jacobs, B.L., Martín-Cora, F.J., and Fornal, C.A. (2002). Activity of medullary serotonergic

neurons in freely moving animals. Brain Res. Brain Res. Rev. 40, 45–52.

Jäger, S., Handschin, C., St-Pierre, J., and Spiegelman, B.M. (2007). AMP-activated protein

kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl.

Acad. Sci. U. S. A. 104, 12017–12022.

Jeppesen, J., Albers, P.H., Rose, A.J., Birk, J.B., Schjerling, P., Dzamko, N., Steinberg, G.R.,

and Kiens, B. (2011). Contraction-induced skeletal muscle FAT/CD36 trafficking and FA

uptake is AMPK independent. J. Lipid Res. 52, 699–711.

Jia, Z., Agopyan, N., Miu, P., Xiong, Z., Henderson, J., Gerlai, R., Taverna, F.A., Velumian,

A., MacDonald, J., Carlen, P., et al. (1996). Enhanced LTP in mice deficient in the AMPA

receptor GluR2. Neuron 17, 945–956.

Johnson, M.L., Robinson, M.M., and Nair, K.S. (2013). Skeletal muscle aging and the

mitochondrion. Trends Endocrinol. Metab. 24, 247–256.

Jokic, N., Gonzalez de Aguilar, J.-L., Dimou, L., Lin, S., Fergani, A., Ruegg, M.A., Schwab,

M.E., Dupuis, L., and Loeffler, J.-P. (2006). The neurite outgrowth inhibitor Nogo-A promotes

denervation in an amyotrophic lateral sclerosis model. EMBO Rep. 7, 1162–1167.

Jørgensen, S.B., Richter, E.A., and Wojtaszewski, J.F.P. (2006). Role of AMPK in skeletal

muscle metabolic regulation and adaptation in relation to exercise. J. Physiol. 574, 17–31.

Jouaville, L.S., Pinton, P., Bastianutto, C., Rutter, G.A., and Rizzuto, R. (1999). Regulation of

mitochondrial ATP synthesis by calcium: evidence for a long-term metabolic priming. Proc.

Natl. Acad. Sci. U. S. A. 96, 13807–13812.

Kabashi, E., Valdmanis, P.N., Dion, P., and Rouleau, G.A. (2007). Oxidized/misfolded

superoxide dismutase-1: the cause of all amyotrophic lateral sclerosis? Ann. Neurol. 62, 553–

559.

Kasarskis, E., Berryman, S., Vanderleest, J., Schneider, A., and McClain, C. (1996).

Nutritional status of patients with amyotrophic lateral sclerosis: relation to the proximity of

death. Am J Clin Nutr 63, 130–137.

Kaspar, B.K., Frost, L.M., Christian, L., Umapathi, P., and Gage, F.H. (2005). Synergy of

insulin-like growth factor-1 and exercise in amyotrophic lateral sclerosis. Ann. Neurol. 57,

649–655.

Kawahara, Y., Kwak, S., Sun, H., Ito, K., Hashida, H., Aizawa, H., Jeong, S.-Y., and

Kanazawa, I. (2003). Human spinal motoneurons express low relative abundance of GluR2

mRNA: an implication for excitotoxicity in ALS. J. Neurochem. 85, 680–689.

Kawamata, H., and Manfredi, G. (2010). Mitochondrial dysfunction and intracellular calcium

dysregulation in ALS. Mech. Ageing Dev. 131, 517–526.

Kawamata, T., Akiyama, H., Yamada, T., and McGeer, P.L. (1992). Immunologic reactions in

amyotrophic lateral sclerosis brain and spinal cord tissue. Am. J. Pathol. 140, 691–707.

Kiernan, M.C., Vucic, S., Cheah, B.C., Turner, M.R., Eisen, A., Hardiman, O., Burrell, J.R.,

and Zoing, M.C. (2011). Amyotrophic lateral sclerosis. Lancet 377, 942–955.

Kim, D., Nguyen, M.D., Dobbin, M.M., Fischer, A., Sananbenesi, F., Rodgers, J.T., Delalle, I.,

Baur, J. a, Sui, G., Armour, S.M., et al. (2007). SIRT1 deacetylase protects against

neurodegeneration in models for Alzheimer’s disease and amyotrophic lateral sclerosis.

EMBO J. 26, 3169–3179.

86

Knowler, W.C., Barrett-Connor, E., Fowler, S.E., Hamman, R.F., Lachin, J.M., Walker, E.A.,

and Nathan, D.M. (2002). Reduction in the incidence of type 2 diabetes with lifestyle

intervention or metformin. N. Engl. J. Med. 346, 393–403.

Kong, J., and Xu, Z. (1998). Massive mitochondrial degeneration in motor neurons triggers

the onset of amyotrophic lateral sclerosis in mice expressing a mutant SOD1. J. Neurosci. 18,

3241–3250.

Kostic, V., Jackson-Lewis, V., de Bilbao, F., Dubois-Dauphin, M., and Przedborski, S. (1997).

Bcl-2: prolonging life in a transgenic mouse model of familial amyotrophic lateral sclerosis.

Science 277, 559–562.

Latres, E., Amini, A.R., Amini, A.A., Griffiths, J., Martin, F.J., Wei, Y., Lin, H.C., Yancopoulos,

G.D., and Glass, D.J. (2005). Insulin-like growth factor-1 (IGF-1) inversely regulates atrophy-

induced genes via the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin

(PI3K/Akt/mTOR) pathway. J. Biol. Chem. 280, 2737–2744.

Li, Q., Zhu, X., Ishikura, S., Zhang, D., Gao, J., Sun, Y., Contreras-Ferrat, A., Foley, K.P.,

Lavandero, S., Yao, Z., et al. (2014). Ca2+ signals promote GLUT4 exocytosis and reduce its

endocytosis in muscle cells. Am. J. Physiol. Endocrinol. Metab.

Lin, J., Wu, H., Tarr, P.T., Zhang, C.-Y., Wu, Z., Boss, O., Michael, L.F., Puigserver, P.,

Isotani, E., Olson, E.N., et al. (2002). Transcriptional co-activator PGC-1 alpha drives the

formation of slow-twitch muscle fibres. Nature 418, 797–801.

Lin, J., Handschin, C., and Spiegelman, B.M. (2005). Metabolic control through the PGC-1

family of transcription coactivators. Cell Metab. 1, 361–370.

Lindauer, E., Dupuis, L., Müller, H.-P., Neumann, H., Ludolph, A.C., and Kassubek, J. (2013).

Adipose Tissue Distribution Predicts Survival in Amyotrophic Lateral Sclerosis. PLoS One 8,

e67783.

Ling, S.-C., Polymenidou, M., and Cleveland, D.W. (2013). Converging mechanisms in ALS

and FTD: disrupted RNA and protein homeostasis. Neuron 79, 416–438.

Lino, M.M., Schneider, C., and Caroni, P. (2002). Accumulation of SOD1 mutants in postnatal

motoneurons does not cause motoneuron pathology or motoneuron disease. J. Neurosci. 22,

4825–4832.

Liu, W., Yamashita, T., Tian, F., Morimoto, N., Ikeda, Y., Deguchi, K., and Abe, K. (2013).

Mitochondrial fusion and fission proteins expression dynamically change in a murine model of

amyotrophic lateral sclerosis. Curr. Neurovasc. Res. 10, 222–230.

Logroscino, G., Traynor, B.J., Hardiman, O., Chiò, A., Mitchell, D., Swingler, R.J., Millul, A.,

Benn, E., and Beghi, E. (2010). Incidence of amyotrophic lateral sclerosis in Europe. J.

Neurol. Neurosurg. Psychiatry 81, 385–390.

Longstreth, W.T., McGuire, V., Koepsell, T.D., Wang, Y., and van Belle, G. (1998). Risk of

amyotrophic lateral sclerosis and history of physical activity: a population-based case-control

study. Arch. Neurol. 55, 201–206.

Luo, G., Yi, J., Ma, C., Xiao, Y., Yi, F., Yu, T., and Zhou, J. (2013). Defective mitochondrial

dynamics is an early event in skeletal muscle of an amyotrophic lateral sclerosis mouse

model. PLoS One 8, e82112.

Mahoney, D.J., Rodriguez, C., Devries, M., Yasuda, N., and Tarnopolsky, M.A. (2004). Effects

of high-intensity endurance exercise training in the G93A mouse model of amyotrophic lateral

sclerosis. Muscle Nerve 29, 656–662.

87

Marchetto, M.C.N., Muotri, A.R., Mu, Y., Smith, A.M., Cezar, G.G., and Gage, F.H. (2008).

Non-cell-autonomous effect of human SOD1 G37R astrocytes on motor neurons derived from

human embryonic stem cells. Cell Stem Cell 3, 649–657.

Mavalli, M.D., DiGirolamo, D.J., Fan, Y., Riddle, R.C., Campbell, K.S., van Groen, T., Frank,

S.J., Sperling, M.A., Esser, K.A., Bamman, M.M., et al. (2010). Distinct growth hormone

receptor signaling modes regulate skeletal muscle development and insulin sensitivity in

mice. J. Clin. Invest. 120, 4007–4020.

Mazzini, L., Corrà, T., Zaccala, M., Mora, G., Del Piano, M., and Galante, M. (1995).

Percutaneous endoscopic gastrostomy and enteral nutrition in amyotrophic lateral sclerosis.

J. Neurol. 242, 695–698.

McClelland, S., Bethoux, F.A., Boulis, N.M., Sutliff, M.H., Stough, D.K., Schwetz, K.M., Gogol,

D.M., Harrison, M., and Pioro, E.P. (2008). Intrathecal baclofen for spasticity-related pain in

amyotrophic lateral sclerosis: efficacy and factors associated with pain relief. Muscle Nerve

37, 396–398.

McGee, S.L., and Hargreaves, M. (2011). Histone modifications and exercise adaptations. J.

Appl. Physiol. 110, 258–263.

McGee, S.L., van Denderen, B.J.W., Howlett, K.F., Mollica, J., Schertzer, J.D., Kemp, B.E.,

and Hargreaves, M. (2008). AMP-activated protein kinase regulates GLUT4 transcription by

phosphorylating histone deacetylase 5. Diabetes 57, 860–867.

Mendell, L.M. (2005). The size principle: a rule describing the recruitment of motoneurons. J.

Neurophysiol. 93, 3024–3026.

Menzies, F.M. (2002). Mitochondrial dysfunction in a cell culture model of familial amyotrophic

lateral sclerosis. Brain 125, 1522–1533.

Merrill, G.F., Kurth, E.J., Hardie, D.G., and Winder, W.W. (1997). AICA riboside increases

AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am. J.

Physiol. 273, E1107–12.

Miller, R.G., Mitchell, J.D., and Moore, D.H. (2012). Riluzole for amyotrophic lateral sclerosis

(ALS)/motor neuron disease (MND). Cochrane Database Syst. Rev. 3, CD001447.

Milton, R.L., Lupa, M.T., and Caldwell, J.H. (1992). Fast and slow twitch skeletal muscle

fibres differ in their distribution of Na channels near the endplate. Neurosci. Lett. 135, 41–44.

Mitchell, J.C., McGoldrick, P., Vance, C., Hortobagyi, T., Sreedharan, J., Rogelj, B., Tudor,

E.L., Smith, B.N., Klasen, C., Miller, C.C.J., et al. (2013). Overexpression of human wild-type

FUS causes progressive motor neuron degeneration in an age- and dose-dependent fashion.

Acta Neuropathol. 125, 273–288.

Morrison, B.M., Janssen, W.G., Gordon, J.W., and Morrison, J.H. (1998). Time course of

neuropathology in the spinal cord of G86R superoxide dismutase transgenic mice. J. Comp.

Neurol. 391, 64–77.

Mosole, S., Carraro, U., Kern, H., Loefler, S., Fruhmann, H., Vogelauer, M., Burggraf, S.,

Mayr, W., Krenn, M., Paternostro-Sluga, T., et al. (2014). Long-term high-level exercise

promotes muscle reinnervation with age. J. Neuropathol. Exp. Neurol. 73, 284–294.

Mu, J., Brozinick, J.T., Valladares, O., Bucan, M., and Birnbaum, M.J. (2001). A Role for

AMP-Activated Protein Kinase in Contraction- and Hypoxia-Regulated Glucose Transport in

Skeletal Muscle. Mol. Cell 7, 1085–1094.

88

Murakami, T., Shimomura, Y., Fujitsuka, N., Nakai, N., Sugiyama, S., Ozawa, T., Sokabe, M.,

Horai, S., Tokuyama, K., and Suzuki, M. (1994). Enzymatic and genetic adaptation of soleus

muscle mitochondria to physical training in rats. Am. J. Physiol. 267, E388–95.

Murray, K.C., Stephens, M.J., Ballou, E.W., Heckman, C.J., and Bennett, D.J. (2011).

Motoneuron excitability and muscle spasms are regulated by 5-HT2B and 5-HT2C receptor

activity. J. Neurophysiol. 105, 731–748.

Musarò, A., McCullagh, K., Paul, A., Houghton, L., Dobrowolny, G., Molinaro, M., Barton,

E.R., Sweeney, H.L., and Rosenthal, N. (2001). Localized Igf-1 transgene expression sustains

hypertrophy and regeneration in senescent skeletal muscle. Nat. Genet. 27, 195–200.

Nabben, M., and Hoeks, J. (2008). Mitochondrial uncoupling protein 3 and its role in cardiac-

and skeletal muscle metabolism. Physiol. Behav. 94, 259–269.

Nagai, M., Re, D.B., Nagata, T., Chalazonitis, A., Jessell, T.M., Wichterle, H., and

Przedborski, S. (2007). Astrocytes expressing ALS-linked mutated SOD1 release factors

selectively toxic to motor neurons. Nat. Neurosci. 10, 615–622.

Nelson, L.M., Matkin, C., Longstreth, W.T., and McGuire, V. (2000). Population-based case-

control study of amyotrophic lateral sclerosis in western Washington State. II. Diet. Am. J.

Epidemiol. 151, 164–173.

Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi, M.C., Chou, T.T., Bruce,

J., Schuck, T., Grossman, M., Clark, C.M., et al. (2006). Ubiquitinated TDP-43 in

frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130–133.

Nguyen, K.T., García-Chacón, L.E., Barrett, J.N., Barrett, E.F., and David, G. (2009). The

Psi(m) depolarization that accompanies mitochondrial Ca2+ uptake is greater in mutant SOD1

than in wild-type mouse motor terminals. Proc. Natl. Acad. Sci. U. S. A. 106, 2007–2011.

Nichols, D.E., and Nichols, C.D. (2008). Serotonin receptors. Chem. Rev. 108, 1614–1641.

Okamoto, K., Kihira, T., Kondo, T., Kobashi, G., Washio, M., Sasaki, S., Yokoyama, T.,

Miyake, Y., Sakamoto, N., Inaba, Y., et al. (2007). Nutritional status and risk of amyotrophic

lateral sclerosis in Japan. Amyotroph. Lateral Scler. 8, 300–304.

Onesto, E., Rusmini, P., Crippa, V., Ferri, N., Zito, A., Galbiati, M., and Poletti, A. (2011).

Muscle cells and motoneurons differentially remove mutant SOD1 causing familial

amyotrophic lateral sclerosis. J. Neurochem. 118, 266–280.

Orrell, R.W., Lane, R.J.M., and Ross, M. (2007). Antioxidant treatment for amyotrophic lateral

sclerosis / motor neuron disease. Cochrane Database Syst. Rev. CD002829.

Panov, A., Kubalik, N., Zinchenko, N., Hemendinger, R., Dikalov, S., and Bonkovsky, H.L.

(2011). Respiration and ROS production in brain and spinal cord mitochondria of transgenic

rats with mutant G93a Cu/Zn-superoxide dismutase gene. Neurobiol. Dis. 44, 53–62.

Parone, P.A., Da Cruz, S., Han, J.S., McAlonis-Downes, M., Vetto, A.P., Lee, S.K., Tseng, E.,

and Cleveland, D.W. (2013). Enhancing mitochondrial calcium buffering capacity reduces

aggregation of misfolded SOD1 and motor neuron cell death without extending survival in

mouse models of inherited amyotrophic lateral sclerosis. J. Neurosci. 33, 4657–4671.

Pasinelli, P., Belford, M.E., Lennon, N., Bacskai, B.J., Hyman, B.T., Trotti, D., and Brown,

R.H. (2004). Amyotrophic lateral sclerosis-associated SOD1 mutant proteins bind and

aggregate with Bcl-2 in spinal cord mitochondria. Neuron 43, 19–30.

Patel, B.P., Safdar, A., Raha, S., Tarnopolsky, M.A., and Hamadeh, M.J. (2010). Caloric

restriction shortens lifespan through an increase in lipid peroxidation, inflammation and

apoptosis in the G93A mouse, an animal model of ALS. PLoS One 5, e9386.

89

Perrier, J.-F., and Delgado-Lezama, R. (2005). Synaptic release of serotonin induced by

stimulation of the raphe nucleus promotes plateau potentials in spinal motoneurons of the

adult turtle. J. Neurosci. 25, 7993–7999.

Petri, S., Kiaei, M., Kipiani, K., Chen, J., Calingasan, N.Y., Crow, J.P., and Beal, M.F. (2006).

Additive neuroprotective effects of a histone deacetylase inhibitor and a catalytic antioxidant

in a transgenic mouse model of amyotrophic lateral sclerosis. Neurobiol. Dis. 22, 40–49.

Potthoff, M.J., Wu, H., Arnold, M.A., Shelton, J.M., Backs, J., McAnally, J., Richardson, J.A.,

Bassel-Duby, R., and Olson, E.N. (2007). Histone deacetylase degradation and MEF2

activation promote the formation of slow-twitch myofibers. J. Clin. Invest. 117, 2459–2467.

Pradat, P.-F., Bruneteau, G., Gordon, P.H., Dupuis, L., Bonnefont-Rousselot, D., Simon, D.,

Salachas, F., Corcia, P., Frochot, V., Lacorte, J.-M., et al. (2010). Impaired glucose tolerance

in patients with amyotrophic lateral sclerosis. Amyotroph. Lateral Scler. 11, 166–171.

Pramatarova, a, Laganière, J., Roussel, J., Brisebois, K., and Rouleau, G. a (2001). Neuron-

specific expression of mutant superoxide dismutase 1 in transgenic mice does not lead to

motor impairment. J. Neurosci. 21, 3369–3374.

Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M. (1998). A

Cold-Inducible Coactivator of Nuclear Receptors Linked to Adaptive Thermogenesis. Cell 92,

829–839.

Pun, S., Santos, A.F., Saxena, S., Xu, L., and Caroni, P. (2006). Selective vulnerability and

pruning of phasic motoneuron axons in motoneuron disease alleviated by CNTF. Nat.

Neurosci. 9, 408–419.

Rabizadeh, S., Gralla, E.B., Borchelt, D.R., Gwinn, R., Valentine, J.S., Sisodia, S., Wong, P.,

Lee, M., Hahn, H., and Bredesen, D.E. (1995). Mutations associated with amyotrophic lateral

sclerosis convert superoxide dismutase from an antiapoptotic gene to a proapoptotic gene:

studies in yeast and neural cells. Proc. Natl. Acad. Sci. U. S. A. 92, 3024–3028.

Raney, M.A., and Turcotte, L.P. (2008). Evidence for the involvement of CaMKII and AMPK in

Ca2+-dependent signaling pathways regulating FA uptake and oxidation in contracting rodent

muscle. J. Appl. Physiol. 104, 1366–1373.

Raney, M.A., Yee, A.J., Todd, M.K., and Turcotte, L.P. (2005). AMPK activation is not critical

in the regulation of muscle FA uptake and oxidation during low-intensity muscle contraction.

Am. J. Physiol. Endocrinol. Metab. 288, E592–8.

Rayment, I., Rypniewski, W.R., Schmidt-Bäse, K., Smith, R., Tomchick, D.R., Benning, M.M.,

Winkelmann, D.A., Wesenberg, G., and Holden, H.M. (1993). Three-dimensional structure of

myosin subfragment-1: a molecular motor. Science 261, 50–58.

Reaume, A.G., Elliott, J.L., Hoffman, E.K., Kowall, N.W., Ferrante, R.J., Siwek, D.F., Wilcox,

H.M., Flood, D.G., Beal, M.F., Brown, R.H., et al. (1996). Motor neurons in Cu/Zn superoxide

dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury.

Nat. Genet. 13, 43–47.

Renton, A.E., Chiò, A., and Traynor, B.J. (2014). State of play in amyotrophic lateral sclerosis

genetics. Nat. Neurosci. 17, 17–23.

Reyes, E.T., Perurena, O.H., Festoff, B.W., Jorgensen, R., and Moore, W. V (1984). Insulin

resistance in amyotrophic lateral sclerosis. J. Neurol. Sci. 63, 317–324.

Romijn, J.A., Coyle, E.F., Sidossis, L.S., Gastaldelli, A., Horowitz, J.F., Endert, E., and Wolfe,

R.R. (1993). Regulation of endogenous fat and carbohydrate metabolism in relation to

exercise intensity and duration. Am. J. Physiol. 265, E380–91.

90

Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson,

D., Goto, J., O’Regan, J.P., and Deng, H.X. (1993). Mutations in Cu/Zn superoxide dismutase

gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59–62.

Rothstein, J.D., Van Kammen, M., Levey, A.I., Martin, L.J., and Kuncl, R.W. (1995). Selective

loss of glial glutamate transporter GLT-1 in amyotrophic lateral sclerosis. Ann. Neurol. 38, 73–

84.

Rothstein, J.D., Dykes-Hoberg, M., Pardo, C.A., Bristol, L.A., Jin, L., Kuncl, R.W., Kanai, Y.,

Hediger, M.A., Wang, Y., Schielke, J.P., et al. (1996). Knockout of glutamate transporters

reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate.

Neuron 16, 675–686.

Rotunno, M.S., and Bosco, D.A. (2013). An emerging role for misfolded wild-type SOD1 in

sporadic ALS pathogenesis. Front. Cell. Neurosci. 7, 253.

Rouaux, C., Panteleeva, I., René, F., Gonzalez de Aguilar, J.-L., Echaniz-Laguna, A., Dupuis,

L., Menger, Y., Boutillier, A.-L., and Loeffler, J.-P. (2007). Sodium valproate exerts

neuroprotective effects in vivo through CREB-binding protein-dependent mechanisms but

does not improve survival in an amyotrophic lateral sclerosis mouse model. J. Neurosci. 27,

5535–5545.

Ryu, H., Smith, K., Camelo, S.I., Carreras, I., Lee, J., Iglesias, A.H., Dangond, F., Cormier,

K.A., Cudkowicz, M.E., Brown, R.H., et al. (2005). Sodium phenylbutyrate prolongs survival

and regulates expression of anti-apoptotic genes in transgenic amyotrophic lateral sclerosis

mice. J. Neurochem. 93, 1087–1098.

Sabatelli, M., Conte, A., and Zollino, M. (2013). Clinical and genetic heterogeneity of

amyotrophic lateral sclerosis. Clin. Genet.

Sacheck, J.M., Ohtsuka, A., McLary, S.C., and Goldberg, A.L. (2004). IGF-I stimulates muscle

growth by suppressing protein breakdown and expression of atrophy-related ubiquitin ligases,

atrogin-1 and MuRF1. Am. J. Physiol. Endocrinol. Metab. 287, E591–601.

Sahlin, K., Tonkonogi, M., and Söderlund, K. (1998). Energy supply and muscle fatigue in

humans. Acta Physiol. Scand. 162, 261–266.

Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K., Schiaffino, S.,

Lecker, S.H., and Goldberg, A.L. (2004). Foxo Transcription Factors Induce the Atrophy-

Related Ubiquitin Ligase Atrogin-1 and Cause Skeletal Muscle Atrophy. Cell 117, 399–412.

Sareen, D., O’Rourke, J.G., Meera, P., Muhammad, A.K.M.G., Grant, S., Simpkinson, M.,

Bell, S., Carmona, S., Ornelas, L., Sahabian, A., et al. (2013). Targeting RNA foci in iPSC-

derived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci. Transl.

Med. 5, 208ra149.

Scarmeas, N., Shih, T., Stern, Y., Ottman, R., and Rowland, L.P. (2002). Premorbid weight,

body mass, and varsity athletics in ALS. Neurology 59, 773–775.

Schiaffino, S., and Reggiani, C. (2011). Fiber types in mammalian skeletal muscles. Physiol.

Rev. 91, 1447–1531.

Schiaffino, S., Hanzlíková, V., and Pierobon, S. (1970). Relations between structure and

function in rat skeletal muscle fibers. J. Cell Biol. 47, 107–119.

Schiaffino, S., Dyar, K.A., Ciciliot, S., Blaauw, B., and Sandri, M. (2013). Mechanisms

regulating skeletal muscle growth and atrophy. FEBS J. 280, 4294–4314.

Shelkovnikova, T.A., Peters, O.M., Deykin, A. V, Connor-Robson, N., Robinson, H., Ustyugov,

A.A., Bachurin, S.O., Ermolkevich, T.G., Goldman, I.L., Sadchikova, E.R., et al. (2013). Fused

91

in sarcoma (FUS) protein lacking nuclear localization signal (NLS) and major RNA binding

motifs triggers proteinopathy and severe motor phenotype in transgenic mice. J. Biol. Chem.

288, 25266–25274.

Shibata, N., Asayama, K., Hirano, A., and Kobayashi, M. (1996). Immunohistochemical study

on superoxide dismutases in spinal cords from autopsied patients with amyotrophic lateral

sclerosis. Dev. Neurosci. 18, 492–498.

Shibata, N., Hirano, A., Kobayashi, M., Dal Canto, M.C., Gurney, M.E., Komori, T., Umahara,

T., and Asayama, K. (1998). Presence of Cu/Zn superoxide dismutase (SOD)

immunoreactivity in neuronal hyaline inclusions in spinal cords from mice carrying a

transgene for Gly93Ala mutant human Cu/Zn SOD. Acta Neuropathol. 95, 136–142.

Shinder, G.A., Lacourse, M.C., Minotti, S., and Durham, H.D. (2001). Mutant Cu/Zn-

superoxide dismutase proteins have altered solubility and interact with heat shock/stress

proteins in models of amyotrophic lateral sclerosis. J. Biol. Chem. 276, 12791–12796.

Del Signore, S.J., Amante, D.J., Kim, J., Stack, E.C., Goodrich, S., Cormier, K., Smith, K.,

Cudkowicz, M.E., and Ferrante, R.J. (2009). Combined riluzole and sodium phenylbutyrate

therapy in transgenic amyotrophic lateral sclerosis mice. Amyotroph. Lateral Scler. 10, 85–94.

Smith, L.R., Meyer, G., and Lieber, R.L. Systems analysis of biological networks in skeletal

muscle function. Wiley Interdiscip. Rev. Syst. Biol. Med. 5, 55–71.

Song, W., Song, Y., Kincaid, B., Bossy, B., and Bossy-Wetzel, E. (2013). Mutant SOD1G93A

triggers mitochondrial fragmentation in spinal cord motor neurons: neuroprotection by SIRT3

and PGC-1α. Neurobiol. Dis. 51, 72–81.

Spina, R.J., Chi, M.M., Hopkins, M.G., Nemeth, P.M., Lowry, O.H., and Holloszy, J.O. (1996).

Mitochondrial enzymes increase in muscle in response to 7-10 days of cycle exercise. J.

Appl. Physiol. 80, 2250–2254.

Spriet, L.L., Tunstall, R.J., Watt, M.J., Mehan, K.A., Hargreaves, M., and Cameron-Smith, D.

(2004). Pyruvate dehydrogenase activation and kinase expression in human skeletal muscle

during fasting. J. Appl. Physiol. 96, 2082–2087.

Stallings, N.R., Puttaparthi, K., Luther, C.M., Burns, D.K., and Elliott, J.L. (2010). Progressive

motor weakness in transgenic mice expressing human TDP-43. Neurobiol. Dis. 40, 404–414.

Sterz, R., Pagala, M., and Peper, K. (1983). Postjunctional characteristics of the endplates in

mammalian fast and slow muscles. Pflugers Arch. 398, 48–54.

Stitt, T.N., Drujan, D., Clarke, B.A., Panaro, F., Timofeyva, Y., Kline, W.O., Gonzalez, M.,

Yancopoulos, G.D., and Glass, D.J. (2004). The IGF-1/PI3K/Akt Pathway Prevents

Expression of Muscle Atrophy-Induced Ubiquitin Ligases by Inhibiting FOXO Transcription

Factors. Mol. Cell 14, 395–403.

Sugden, M.C., Kraus, A., Harris, R.A., and Holness, M.J. (2000). Fibre-type specific

modification of the activity and regulation of skeletal muscle pyruvate dehydrogenase kinase

(PDK) by prolonged starvation and refeeding is associated with targeted regulation of PDK

isoenzyme 4 expression. Biochem. J. 346 Pt 3, 651–657.

Swerdlow, R.H., Parks, J.K., Cassarino, D.S., Trimmer, P.A., Miller, S.W., Maguire, D.J.,

Sheehan, J.P., Maguire, R.S., Pattee, G., Juel, V.C., et al. (1998). Mitochondria in sporadic

amyotrophic lateral sclerosis. Exp. Neurol. 153, 135–142.

Tsai, K.-J., Yang, C.-H., Fang, Y.-H., Cho, K.-H., Chien, W.-L., Wang, W.-T., Wu, T.-W., Lin,

C.-P., Fu, W.-M., and Shen, C.-K.J. (2010). Elevated expression of TDP-43 in the forebrain of

92

mice is sufficient to cause neurological and pathological phenotypes mimicking FTLD-U. J.

Exp. Med. 207, 1661–1673.

Turner, M.R. (2013). Increased premorbid physical activity and amyotrophic lateral sclerosis:

born to run rather than run to death, or a seductive myth? J. Neurol. Neurosurg. Psychiatry

84, 947.

Valenti, M., Pontieri, F.E., Conti, F., Altobelli, E., Manzoni, T., and Frati, L. (2005).

Amyotrophic lateral sclerosis and sports: a case-control study. Eur. J. Neurol. 12, 223–225.

Vielhaber, S. (2000). Mitochondrial DNA abnormalities in skeletal muscle of patients with

sporadic amyotrophic lateral sclerosis. Brain 123, 1339–1348.

Vinsant, S., Mansfield, C., Jimenez-Moreno, R., Del Gaizo Moore, V., Yoshikawa, M.,

Hampton, T.G., Prevette, D., Caress, J., Oppenheim, R.W., and Milligan, C. (2013).

Characterization of early pathogenesis in the SOD1(G93A) mouse model of ALS: part II,

results and discussion. Brain Behav. 3, 431–457.

Waerhaug, O., and Lømo, T. (1994). Factors causing different properties at neuromuscular

junctions in fast and slow rat skeletal muscles. Anat. Embryol. (Berl). 190, 113–125.

Wang, Y., and Pessin, J.E. (2013). Mechanisms for fiber-type specificity of skeletal muscle

atrophy. Curr. Opin. Clin. Nutr. Metab. Care 16, 243–250.

Wang, H.-Y., Wang, I.-F., Bose, J., and Shen, C.-K.J. (2004). Structural diversity and

functional implications of the eukaryotic TDP gene family. Genomics 83, 130–139.

Watanabe, M., Dykes-Hoberg, M., Culotta, V.C., Price, D.L., Wong, P.C., and Rothstein, J.D.

(2001). Histological evidence of protein aggregation in mutant SOD1 transgenic mice and in

amyotrophic lateral sclerosis neural tissues. Neurobiol. Dis. 8, 933–941.

Watt, M.J., Heigenhauser, G.J.F., LeBlanc, P.J., Inglis, J.G., Spriet, L.L., and Peters, S.J.

(2004). Rapid upregulation of pyruvate dehydrogenase kinase activity in human skeletal

muscle during prolonged exercise. J. Appl. Physiol. 97, 1261–1267.

Wenz, T., Rossi, S.G., Rotundo, R.L., Spiegelman, B.M., and Moraes, C.T. (2009). Increased

muscle PGC-1alpha expression protects from sarcopenia and metabolic disease during

aging. Proc. Natl. Acad. Sci. U. S. A. 106, 20405–20410.

Wiedau-Pazos, M., Goto, J.J., Rabizadeh, S., Gralla, E.B., Roe, J.A., Lee, M.K., Valentine,

J.S., and Bredesen, D.E. (1996). Altered reactivity of superoxide dismutase in familial

amyotrophic lateral sclerosis. Science 271, 515–518.

Williams, T.L., Day, N.C., Ince, P.G., Kamboj, R.K., and Shaw, P.J. (1997). Calcium-

permeable alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid receptors: a molecular

determinant of selective vulnerability in amyotrophic lateral sclerosis. Ann. Neurol. 42, 200–

207.

Wolfe, R.R. (1998). Fat metabolism in exercise. Adv. Exp. Med. Biol. 441, 147–156.

Wong, M., and Martin, L.J. (2010a). Skeletal muscle-restricted expression of human SOD1

causes motor neuron degeneration in transgenic mice. Hum. Mol. Genet. 19, 2284–2302.

Wong, M., and Martin, L.J. (2010b). Skeletal muscle-restricted expression of human SOD1

causes motor neuron degeneration in transgenic mice. Hum. Mol. Genet. 19, 2284–2302.

Wong, P.C., Pardo, C.A., Borchelt, D.R., Lee, M.K., Copeland, N.G., Jenkins, N.A., Sisodia,

S.S., Cleveland, D.W., and Price, D.L. (1995). An adverse property of a familial ALS-linked

SOD1 mutation causes motor neuron disease characterized by vacuolar degeneration of

mitochondria. Neuron 14, 1105–1116.

93

Wu, H., Kanatous, S.B., Thurmond, F.A., Gallardo, T., Isotani, E., Bassel-Duby, R., and

Williams, R.S. (2002). Regulation of mitochondrial biogenesis in skeletal muscle by CaMK.

Science 296, 349–352.

Yamanaka, K., Chun, S.J., Boillee, S., Fujimori-Tonou, N., Yamashita, H., Gutmann, D.H.,

Takahashi, R., Misawa, H., and Cleveland, D.W. (2008). Astrocytes as determinants of

disease progression in inherited amyotrophic lateral sclerosis. Nat. Neurosci. 11, 251–253.

Yamashita, H., Kawamata, J., Okawa, K., Kanki, R., Nakamizo, T., Hatayama, T., Yamanaka,

K., Takahashi, R., and Shimohama, S. (2007). Heat-shock protein 105 interacts with and

suppresses aggregation of mutant Cu/Zn superoxide dismutase: clues to a possible strategy

for treating ALS. J. Neurochem. 102, 1497–1505.

Yang, C., Wang, H., Qiao, T., Yang, B., Aliaga, L., Qiu, L., Tan, W., Salameh, J., McKenna-

Yasek, D.M., Smith, T., et al. (2014). Partial loss of TDP-43 function causes phenotypes of

amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. U. S. A. 111, E1121–9.

Yoo, Y.-E., and Ko, C.-P. (2011). Treatment with trichostatin A initiated after disease onset

delays disease progression and increases survival in a mouse model of amyotrophic lateral

sclerosis. Exp. Neurol. 231, 147–159.

Zhou, J., Yi, J., Fu, R., Liu, E., Siddique, T., Ríos, E., and Deng, H.-X. (2010). Hyperactive

intracellular calcium signaling associated with localized mitochondrial defects in skeletal

muscle of an animal model of amyotrophic lateral sclerosis. J. Biol. Chem. 285, 705–712.

Zhu, S., Stavrovskaya, I.G., Drozda, M., Kim, B.Y.S., Ona, V., Li, M., Sarang, S., Liu, A.S.,

Hartley, D.M., Wu, D.C., et al. (2002). Minocycline inhibits cytochrome c release and delays

progression of amyotrophic lateral sclerosis in mice. Nature 417, 74–78.

Zurlo, F., Larson, K., Bogardus, C., and Ravussin, E. (1990). Skeletal muscle metabolism is a

major determinant of resting energy expenditure. J. Clin. Invest. 86, 1423–1427.

94

Lavinia PALAMIUC

ETUDES DES ALTÉRATIONS MÉTABOLIQUES

MUSCULAIRES AU COURS DE LA SCLÉROSE

LATÉRALE AMYOTROPHIQUE

La sclérose latérale amyotrophique (SLA) est une maladie dégénérative neuromusculaire fatale. Elle

est accompagnée par des altérations métaboliques, se manifestant précocement dans des modèles

murins. L’objectif de cette thèse a été d’identifier les cibles moléculaires impliquées dans ces

changements. Pour ce faire, nous avons étudié le muscle glycolytique, le premier touché par la

dénervation au cours de la maladie dans un modèle de SLA, la souris SOD1G86R. Nous avons

montré un déséquilibre entre les voies métaboliques glucidiques et lipidiques à un stade

présymptômatique, avec une préférence pour la voie catabolique des lipides. Cette altération peut

expliquer notre observation sur le changement des capacités à l’exercice des souris SOD1G86R

présymptômatiques. Dans ce contexte, nous avons montré que l’inhibition pharmacologique de

PDK4, un des principaux inhibiteurs de la glycolyse, est bénéfique, retardant l’apparition des

symptômes. En prenant compte des spécificités métaboliques des différents éléments de l’axe

neuromusculaire, ce travail ouvre des nouvelles pistes thérapeutiques pour le traitement de la SLA.

Mots-clés : ALS, métabolisme, exercice, muscle

Amyotrophic lateral sclerosis (ALS) is a fatal degenerative disease characterized by loss of upper

and lower motor neurons, denervation and skeletal muscle atrophy. ALS is accompanied by

metabolic alterations that are early events in mouse models for ALS. The main objective was to

identify molecular targets responsible for these alterations. For this, we analyzed several metabolic

regulators localized in presymptomatic glycolytic muscle tissue of an ALS mouse model, the

SOD1G86R. We identified a pre-symptomatic alteration of metabolic equilibrium, showing an inhibition

of glycolysis accompanied by an upregulation of lipid catabolic pathway. This alteration has

functional significance, being reflected in a modified capacity of SOD1G86R mice to adapt to different

types of exercise. Pharmacological inhibition of PDK4, one of the main inhibitors of glycolysis,

delayed disease onset, underpinning the importance of metabolic equilibrium in disease progression.

Taking into consideration the metabolic specificity of the different elements on the neuromuscular

axis, this work opens towards new therapeutic approaches for ALS.

Key words : ALS, metabolism, exercise, muscle