Xie X et al 2014

BASIC RESEARCH www.jasn.org

The Basic Domain of HIV-Tat Transactivating Protein IsEssential for Its Targeting to Lipid Rafts andRegulating Fibroblast Growth Factor-2 Signalingin Podocytes Isolated from Children withHIV-1–Associated Nephropathy

Xuefang Xie,* Anamaris M. Colberg-Poley,*† Jharna R. Das,* Jinliang Li,* Aiping Zhang,*Pingtao Tang,*† Marina Jerebtsova,*† J. Silvio Gutkind,‡ and Patricio E. Ray*†§

*Center for Genetic Medicine Research and §Division of Nephrology, Children’s National Medical Center,Washington, DC; †Department of Pediatrics, George Washington University, Washington, DC; and ‡Oral andPharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health,Bethesda, Maryland

ABSTRACTPodocyte injury has a critical role in the pathogenesis of HIV-associated nephropathy (HIVAN). The HIV-1transactivator of transcription (Tat), combined with fibroblast growth factor-2 (FGF-2), can induce thededifferentiation and proliferation of cultured human podocytes. Cellular internalization of Tat requiresinteractions with heparan sulfate proteoglycans and cholesterol-enriched lipid rafts (LRs). However, thespecific distribution of Tat in human podocytes and its ability to associate with LRs have not beendocumented. Here, we found that Tat is preferentially recruited to LRs in podocytes isolated from childrenwithHIVAN. Furthermore, we identified arginines in the basic domain (RKKRRQRRR) of Tat as essential for (1)targeting Tat to LRs, (2) Tat-mediated increases in the expression of Rho-A andmatrix metalloproteinase-9 inLRs, and (3) Tat-mediated enhancement of FGF-2 signaling in human podocytes and HIV-transgenic mousekidneys and the exacerbation of renal lesions in these mice. Tat carrying alanine substitutions in the basicdomain (AKKAAQAAA) remained localized in the cytosol and did not associate with LRs or enhance FGF-2signaling in cultured podocytes. These results show the specific association of Tat with LRs in podocytesisolated from children with HIVAN, confirm Tat as a regulator of FGF-2 signaling in LRs, and identify the keydomain of Tat responsible for promoting these effects and aggravating renal injury in HIV-transgenic mice.Moreover, these results provide amolecular framework for developing novel therapies to improve the clinicaloutcome of children with HIVAN.

J Am Soc Nephrol 25: 1800–1813, 2014. doi: 10.1681/ASN.2013070710

HIV-associated nephropathy (HIVAN) is a progres-sive renal disease seen in HIV-infected patients fromAfricanancestry.One feature characteristicofHIVANis thecollapseofglomerularcapillaries associatedwiththe dedifferentiation and proliferation of podocytes.1

These changes affect the glomerular filtration bar-rier2 and cause heavy proteinuria and renal failure.Previous studies suggest that podocytes can be pro-ductively infected in vivo3 and that cells derived fromthe parietal epithelium4,5 may also be affected. Inaddition, circulating viral proteins and cytokines re-leased byHIV-infected cells can induce renal injury as

well.1 In this regard, theHIV-1 transactivator of tran-scription (Tat) protein has received significant

Received July 10, 2013. Accepted December 19, 2013.

Published online ahead of print. Publication date available atwww.jasn.org.

Correspondence: Dr. Patricio E. Ray, Centers for Genetic Med-icine Research and Division of Nephrology, Children’s NationalMedical Center, 111 Michigan Avenue NW, Washington, DC20010. Email: [email protected]

Copyright © 2014 by the American Society of Nephrology

1800 ISSN : 1046-6673/2508-1800 J Am Soc Nephrol 25: 1800–1813, 2014

http://www.jasn.org

mailto:[email protected]

attention, because it is a transcription factor that enhances viralreplication; it can also be released and taken up by noninfectedcells. In this manner, Tat can affect the function of podocytesacting through at least two different mechanisms.6–8 A concen-tration of Tat within the range detected in sera of HIV-infectedpatients9,10 can cause glomerular permeability changes in vivo11

and induce the proliferation of cultured podocytes by stimulat-ing the release of fibroblast growth factor-2 (FGF-2).12 Indeed,high plasma, kidney, and urinary levels of FGF-2 are detected inchildren with HIVAN,13,14 and FGF-2 is accumulated in thekidney of HIV-Tg26 mice with renal disease.15–17 Overall, thesestudies suggest that both Tat and FGF-2 may play a role in thepathogenesis of childhood HIVAN.

Extracellular Tat and FGF-2 specifically bind and interactwith negatively charged cell-surface heparan sulfate proteo-glycans (HSPGs).6,18–20 Tat entry into cells is facilitated by anendocytic pathway that originates in lipid rafts (LRs) and in-volves caveolar endocytosis21 or LR-dependent macropinocy-tosis.22 LRs are specialized membrane domains enriched in

certain lipids, cholesterol, and proteins that serve as dockingsites for signaling proteins, including G protein–coupled re-ceptors.23–25 They are resistant to low-temperature solubiliza-tion by nonionic detergents, and this property allows for theirseparation by differential flotation after density-gradient cen-trifugation in low-density fractions that are called detergent-resistant membranes (DRMs).23 Actin binding proteins bindto polyphosphoinositides located in LRs, and these proteinslink the actin cytoskeleton with signaling molecules that areenriched in the LRs.23 In fact, activation of G protein–coupledreceptors by HIV-Tat in brain endothelial cells results in thestimulation of small guanosine 59‑triphosphatase of the Rho-family, which in turn, activate Rho-kinase and the myosinbinding subunit of the myosin light chain (MLC).26,27 More-over, activation of the Rho-A pathway in podocytes can causechronic renal failure in transgenic mice.28 Therefore, we car-ried out this study to determine whether Tat, alone or com-bined with FGF-2, can induce cytoskeletal changes in culturedpodocytes acting through an LR-mediated Rho-signaling

Figure 1. Podocytes cultured from the urine of children with HIVAN express WT-1, synaptopodin, and nestin. A–D show light mi-croscopy images of (A and B) primary podocytes cultured from the urine of two children with HIVAN and (C and D) two cell linesderived from the primary podocytes. (E and G) Immunohistochemistry staining identified the nuclear localization of the WT-1 antigen incultured podocytes (red). (F and H) No specific WT-1 staining was detected in cells incubated with nonimmune IgG. (I and K) Byimmunofluorescence microsocopy, synaptopodin was detected in red in the cytoplasm of cultured podocytes, whereas cell nuclei werecounterstained in blue with diamino-2 phenylindol. (J and L) No specific synaptopodin staining was detected in podocytes incubatedwith irrelevant isotypic Igs. (M and O) Nestin was detected in red in the cytoplasm of podocytes, showing both a partial filamentous andhomogenous pattern. Cell nuclei were counterstained in blue with diamino-2 phenylindol. (N and P) Nestin was not detected inpodocytes incubated with irrelevant isotypic Igs. Original magnification, 3200 in A and E–P; 3400, B.

J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1801

www.jasn.org BASIC RESEARCH

mechanism and to define the Tat binding motif regulating thisprocess in podocytes harvested from children with HIVAN.

RESULTS

Extracellular Tat Increases the Ability of FGF-2 toInduce Rho-A/Phospho–Extracellular Signal-RegulatedKinase Signaling in Cultured Primary PodocytesHarvested from Children with HIVANTo determine how extracellular Tat and FGF-2 modulate Rho-Asignaling in childrenwithHIVAN,we culturedprimary podocytesfrom the urine of these patients (Figure 1, SupplementalFigure 1). We found that Tat, alone or combined with FGF-2,induced the expression of Rho-A, phospho–extracellular signal-regulated kinase (pERK), and phospho-MLC2 (pMLC2) in these

cells (Figure 2). These changes were partially inhibited by theexoenzyme C3-transferase from Clostridium botulinum, whichinhibits Rho-proteins by ADP-ribosylation in the effector bind-ing domain of the guanosine 59‑triphosphatase (Figure 2), anddid not involve other HIV-1 genes, because the cells were notinfected. Similar results were reproduced in the cell lines gener-ated from the primary podocytes (Figure 3A), validating theirclinical relevance for the purpose of this study.

C3-Transferase Inhibits Tat+FGF-2–Induced StressFiber Formation and Rho-Activation in CulturedPodocytesFollow-up experimentsweredone todeterminehowTat+FGF-2 modulate the formation of stress fibers in the presence andabsence of C3-transferase. As shown in Figure 3B, incubationof podocytes with Tat+FGF-2 resulted in a remarkable increase

Figure 2. Extracellular Tat increases the ability of FGF-2 to induce Rho-A/pERK signaling in primary cultured podocytes isolated fromthe urine of children with HIVAN. Primary podocytes were starved overnight in serum-free media and treated with Tat (100 ng/ml) aloneor combined with FGF-2 (50 ng/ml). The Rho-A inhibitor C3-transferase (20 ng/ml) was added 4 hours before stimulation. The cells weretreated for 5 minutes as described above and then harvested to assess the phosphorylation of Rho-A, pERK, and pMLC as described inConcise Methods. The graph shows mean6SEM corresponding to three different experiments. Results were expressed in OD unitsexpressed as a ratio of the total activity. Values significantly different from the corresponding control group are marked: *P,0.05;**P,0.01.

1802 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014


http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2013070710/-/DCSupplemental


Figure 3. Extracellular Tat increases the ability of FGF-2 to induce Rho-A/pERK signaling in a podocyte cell line generated from a childwith HIVAN. (A) Cultured podocytes were starved overnight in serum-free media and treated with Tat (100 ng/ml) alone or combinedwith FGF-2 (50 ng/ml). The Rho-A inhibitor C3-transferase (20 ng/ml) was added 4 hours before stimulation. The cells were treated for 5minutes as described above and then harvested to assess the phosphorylation of Rho-A, pERK, and pMLC as described in Concise



in stress fibers. These structures appeared as thick actin cablesrunning along the length of the cell. In contrast, control cells orTat+FGF-2–treated cells incubated with C3-transferaseshowed amore rounded shape, exhibited F-actin in the periph-ery of the cells, and formed fewer stress fibers on Tat+FGF-2stimulation. The activation of pMLC2 was also inhibited by theC3-transferase (Figure 3A). These results suggest that Rho-Aactivation mediates the cytoskeletal changes induced by Tat+FGF-2 in cultured podocytes.

Tat Preferentially Associates with LRs in CulturedHuman PodocytesTo investigate the intracellular distribution of Tat in culturedpodocytes, we generated recombinant adenoviral vectors(rAds) carrying a cDNA fragment encoding the full-lengthTat protein and the FLAG peptide sequence. As discussed inConcise Methods and Supplemental Figure 2, the cDNA frag-ment encoding Tat was derived from cultured renal tubularepithelial cells infected with HIV-1.29 This Tat variant, namedTat-HIVAN, was conserved in the N terminus but not thepolymorphic C-terminal region downstream of the basic do-main, and it was missing the RGD motif in the C-terminalregion because of a frameshift deletion (Supplemental Figure2). To validate the proper function of the Tat-HIVAN, we con-firmed its ability to translocate to the nucleus in cultured podo-cytes and transactivate the HIV long terminal repeat in GHOST(GFP–human osteosarcoma) cells carrying a green fluorescentprotein (GFP) reporter system30 (Supplemental Figures 3 and4). Subsequently, using flotation sucrose gradients, we isolatedLRs from cultured podocytes transduced with either rAd-Tat-FLAG or rAd-GFP control vectors. Using both FLAG and Tatantibodies, we found that a significant proportion of Tat was pref-erentially localized in fraction 4 of the DRMs, whereas additionalTat was detected in detergent-soluble fractions (non-DRMs) (Fig-ure 4A). Caveolin-1, a protein known to associate with LRs, wasalmost exclusively detected in DRMs fraction 4, confirming thatan efficient isolation of LRs was achieved (Figure 4). In contrast,GFP was not detected in DRMs (Figure 4B), but it was located inthe bottomof the gradient, which is composed of non-DRMs thatcontain detergent-soluble cytoplasmic and nuclear components.Similar results were also found in cultured primary podocytesharvested from children with HIVAN (Figure 4C).

Arginines in the Tat Basic Domain Sequences MediateLR Association in PodocytesThe basic domain of Tat, (RKKRRQRRR)49–57 (also calledprotein transduction domain), is known to mediate mem-brane crossing for protein transduction. In addition, arginines

of the basic domain have been reported to specifically interactwith negatively charged lipids in the plasma membrane.31

Therefore, we explored whether this domain is necessaryand sufficient to mediate Tat association with LR in culturedpodocytes. As shown in Figure 4A, we observed that two dif-ferent wild-type (WT) –Tat variants, carrying or missing theRGD motifs, were localized in the LR domains and that thepresence or absence of the RGD motif did not affect this lo-calization. In contrast, we found that six alanine substitutions(AKKAAQAAA)49–57 carried by a mutant Tat, called Tat–basicdomain mutant 1 (Tat-BDM1-HIVAN), almost completelyabolished Tat association with LRs in cultured podocytes (Fig-ure 5). Interestingly, partial substitutions of three arginines(55–57) did not affect the recruitment of Tat (Tat-BDM2-HI-VAN) to the LRs (Figure 5B). Alternatively, another Tat mu-tant (Tat-BDM3-HIVAN) carrying partial substitutions of theother three arginines (49,52,53) showed a poor association withLRs (Figure 5B). Indeed, the OD ratio of DRM bands overnon-DRM bands for Tat-BDM3-HIVAN was 5-fold lowerthan the ratio of Tat-BDM2-HIVAN or Tat-WT-HIVAN(data not shown). These data suggest that positions of argi-nines present in the Tat basic domain are important for itsassociation with LRs.

Because cholesterol is a major component of LRs, we alsoexplored the potential role of the consensus cholesterolrecognition/interaction amino acid consensus sequence(CRAC). The CRAC sequence is defined as (L/V–(X)1–5–Y–(X)1–5–R/K) and used by several proteins for binding choles-terol in the LRs, including Caveolin-1, HIV gp41, and humancytomegalovirus UL37 exon 1 protein.32,33 We found that ar-ginines49,52,53 in the basic domain could form part of a poten-tial CRAC motif (LGISYGRKKRR). Thus, because tyrosine inthe CRAC motif is an essential residue for cholesterol bind-ing,32,33 we generated amutant Tat with Y47A (Tat-Y47A) andtested its association with LRs. We found that the Y47A mu-tation did not affect the association of Tat with the LRs (Figure5B). These findings indicate that the CRAC sequence alone isnot sufficient to warrant cholesterol binding and that otherstructural factors are needed for this process.32

Tat Basic Binding Domain Modulates Rho-A Signalingand the Expression of Matrix Metalloproteinase-9 inLRsRho-A signaling and matrix metalloproteinases (MMPs)modulate the migration of HIV-infected cells26 and facilitatethe release of FGF-2 in patients with Kaposi’s sarcoma.34,35

Children with HIVAN excrete high urinary levels of MMPsand FGF-2, which is in correlation with the progression of

Methods. The graph shows mean6SEM corresponding to three different experiments. Results were expressed in arbitrary OD units asa ratio of the total activity. Values significantly different from the corresponding control group are marked: *P,0.05; **P,0.01. (B) Cul-tured podocytes were treated as in A, and 20minutes after treatment, F-actin fibers were visualized in cells by staining with 2 mg/ml AlexaFluor 488–labeled phalloidin. Cell nuclei were stained with Hoechst 33342. Scale bar, 10 mm.








their renal disease.14,15 Therefore, we explored the effect ofTat-HIVAN on Rho-A signaling and MMP-9 expression. Wefound that Rho-A andMMP-9 were localized in the LRs of thepodocytes and that the basic domain of Tat increased Rho-Aphosphorylation and MMP-9 expression in LRs (Figure 5C).

Tat Basic Domain Modulates FGF-2–Induced pERK,Rho-A, and pMLC2 in Cultured PodocytesBecause FGF-2 is accumulated in the kidney of children withHIVAN,13,14,16,17,36 we explored how the Tat basic domainmodulated FGF-2 signaling in podocytes transfected withTat-WT-HIVAN or Tat-BDM1-HIVAN. As shown in Figure6, we found that Tat-WT-HIVAN, alone or combinedwith FGF-2, induced a more significant activation of pERK,Rho-A, and pMLC2 compared with Tat-BDM1-HIVAN. Thesechanges are consistent with the results obtained in culturedprimary podocytes using an extracellular Tat variant that

carries the RGD motif (Figure 2). In contrast, Tat-BDM1-HI-VAN was unable to increase the activity of FGF-2 (Figure 6).Overall, these findings confirm that the Tat basic domainplays a critical role modulating FGF-2 signaling in culturedpodocytes and that the RGD motif is not essential for thisprocess.

Tat Basic Domain Modulates the Expression of pERK,Rho-A, pMLC2, and MMP-9 in the Kidneys of YoungHIV-Tg26 MiceTo determine the role of the Tat basic domain in vivo, we usedan adenoviral gene transferring technique developed in ourlaboratory37 to express Tat in the kidney of young mice (Sup-plemental Figures 5 and 6). As shown in Figure 7, bothWTandHIV-Tg26 mice infected with Ad-Tat-WT-HIVAN showed asignificant upregulation of renal pERK, Rho-A, pMLC, andMMP-9 compared with mice infected with Ad-Tat-BDM1-HIVAN. These changes were more remarkable in HIV-Tg26mice (Figure 7) and also associated with an upregulated ex-pression of HIV-1 genes and the development of more severerenal lesions compared withHIV-Tg26mice injectedwith rAd-Tat BDM1-HIVAN or rAd-LacZ vectors (Supplemental Fig-ures 5 and 6).

Circulating FGF-2 Induces the Expression of pERK,Rho-A, pMLC, and MMP-9 in the Kidney of AdultHIV-Tg26 MiceBecause children with HIVAN show high plasma and urinarylevels of FGF-2,13,14 we used Ad-FGF-2 vectors carrying a se-creted form of FGF-2 to determine whether circulating FGF-2can induce similar renal signaling changes in adult WT andHIV-Tg26 mice. In this experimental adult mouse model,38,39

only the hepatocytes are infected with the adenoviral vectors,and FGF-2 released into the circulation is trapped in the kid-ney bound to HSPGs.13,15,16,36,40 As shown in Figure 8, FGF-2increased the renal expression of pERK, Rho-A, pMLC2, andMMP-9 in both WTand HIV-Tg26 mice. These changes, how-ever, were more remarkable in HIV-Tg26 mice (Figure 8) andassociated with the development of more severe renal lesionsand albuminuria compared with all other groups (Figure 9,Supplemental Figure 7), Moreover, FGF-2, alone or combinedwith Tat, induced the proliferation and survival of culturedpodocytes harvested from children with HIVAN actingthrough similar signaling pathways (Figure 10).

DISCUSSION

This study shows that Tat is preferentially recruited to LRs inpodocytes harvested from children with HIVAN and inducescytoskeletal changes through the stimulation of the Rho-A/pMLC pathways. In addition, we found that alanine sub-stitution of the six arginines in the Tat basic binding domainprevented the association ofTatwith LRs, impaired its ability toenhance FGF-2 signaling or MMP-9 expression in cultured

Figure 4. HIV-1 Tat protein is associated with LRs in humanpodocytes isolated from the urine of children with HIVAN. LRswere isolated from a cultured podocyte cell line (P2) infected withadenovirus carrying (A) FLAG-tagged Tat (Ad-Tat-FLAG) or (B)GFP (Ad-GFP) or (C) primary podocytes infected with Ad-Tat-FLAG by sucrose gradient–based flotation assay. Twelve fractionsof the gradient were run by SDS-PAGE to show the distribution ofDRM and non-DRM fractions. FLAG-tagged Tat, GFP, and the LRmarker Caveolin-1 (Cav-1) were analyzed by Western blotting.








podocytes, and failed to induce severe renal disease in HIV-Tg26mice. Taken together, these findings provide compelling evi-dence to support the notion that the Tat basic domain is essentialfor the recruitment of Tat to LRs and the regulation of FGF-2signaling in podocytes isolated from children with HIVAN.

The Tat protein is a powerful transcriptional factor encodedby two exons. The first exon encodes the activation domain,which interacts with cyclin T1, and the basic domain (aminoacids 49–57), which is required for the nuclear localization ofTat,41,42 HIV-1 transcription,7 andmany other functions.7,41,42

The second exon encodes the RGD motif (C-terminal aminoacids 73–86), which enhances the angiogenic activity of Tatacting through integrin receptors.43,44 However, the Tat proteinderived from a child with HIVAN used in this study had anincomplete RGD sequence, and our results show that this se-quence is not essential for the association of Tat with LRs or theregulation of FGF-2 signaling. Indeed, we found that Tat

variants carrying the RGD motif were alsorecruited to LRs and induced FGF-2 signal-ing. Thus, our findings should be relevantfor children infected with viruses carryingdifferent Tat variants.

In contrast to theRGDmotif, theTat basicbinding domain contains a cluster of basicresidues (RKKRRQRRR) that are known tocarry proteins andDNAmolecules across thecell membranes and affect the activityof extracellular Tat peptides in humanpodocytes.11,12 LRs were also reported toplay a critical role modulating Tat activityin other cell types26,45; however, these stud-ies did not explore the specific localizationof Tat in LRs. Moreover, to date, the inter-actions between Tat and LRs in podocytesare unclear, and the residues responsible forthe association of Tat with LRs remain un-defined. Here, we used purified LRs to showthat three arginine residues in the basic do-main are essential for the stable associationof Tat with LRs and the regulation of FGF-2signaling in cultured podocytes harvestedfrom children with HIVAN. It is possiblethat Tat may be recruited to LRs microdo-mains by binding to anionic lipids that areenriched in the LRs.31 However, the basicresidues are not equally important in mem-brane insertion or binding to polyphos-phoinositides, because basic residues 49–51but not arginines55–57 are critical for thisprocess.31 Similarly, we found that threealanine substitutions in arginines49,52,53but not arginines55–57 diminished Tat asso-ciation with LRs by over 80%. These resultsindicate that lack of positive charges in theTat-BDM1-HIVANper se cannot fully explain

its defective association with LRs. In that regard, there may beconformation-specific interactions between the basic domain andthe LRs proteins to allow this stable association to occur.

Interesting findings of this study are the localization ofMMP-9within LRs in cultured podocytes and the ability of Tat-WT-HIVANto induce theexpressionofMMP-9 in this location.MMP-9 belongs to a family of zinc binding endopeptidases that degradeextracellularmatrix proteins, includingHSPGandcollagen.46Pre-vious studies have shown that MMP-9 was associated with LRs inseveral cancer cell lines,where theymodulate angiogenesis and cellmigration.47–49 In children with HIVAN, the urinary levels ofMMP-9 are increased in correlation with the progression of theirrenal disease.14,16 Therefore, becauseMMP-9 facilitates the releaseof FGF-2,34 our findings may provide an alternative mechanismby which Tat can regulate the activity of FGF-2 in podocytes.

Also, Rho is a small guanosine triphosphate binding proteinthat plays a central role regulating the dynamic organization of

Figure 5. Arginines located in the basic domain are essential for targeting Tat to theLRs in cultured podocytes. (A) Several mutations were introduced in the basic domainof the WT Tat isolated from a child with HIVAN (Tat-HIVAN) to generate different TatBDMs named for the purpose of this study: Tat-BDM1, Tat-BDM2, Tat-BDM3, and Tat-Y47A(mutation introduced in the putative cholesterol recognition consensus sequence). TheTat-101 control gene derived from the HIV-1 cDNA clone pCV1 (Supplemental Figure2) carries the RDG motif, which is missing in Tat-HIVAN and all the other Tat BDMs. Allthese sequences were aligned using the Clustal Omega multiple sequence alignmentprogram. Residues aligned identical are marked with an asterisk. Mutated residues areunderlined. (B) Podocytes were transiently transfected with Tat-101/pCV1, Tat-HIVAN,Tat-HIVAN BDMs, or Tat-HIVAN-Y47A mutant. Cells were lysed with Triton X-100and fractionated using a sucrose gradient flotation assay. FLAG-tagged Tat wasdetected by Western blot using the anti-FLAG antibody. (C) Western blot analysesshowing changes in pERK, Rho-A, pMLC, and MMP-9 expression in isolated LRs andwhole-cell lysates (WCLs) extracted from cultured podocytes transfected with WT Tatand Tat-mutated in BDM1 and the empty vector. GTP, guanosine triphosphate.





contractile actin–myosin filaments and the formation of stressfibers in mammalian cells.50 When bound to guanosine tri-phosphate, Rho-proteins activate the Rho-kinase and otherdownstream effector proteins, including the phosphorylationof the myosin binding subunit of MLC.50 All these factors areimportant to maintain the cytoskeletal structure of podocytesand the integrity of the glomerular basement membrane.2 In

line with this notion, our data suggest thatTat, combined with FGF-2, can induce thecrosslinking of F-actin and the formationof stress fibers in human podocytesthrough activation of Rho-A and pMLCsignaling pathways. In addition, we foundthat Tat increased the FGF-2–inducedphosphorylation of pERK, a pathway leadingto cell proliferation. Podocytes are termi-nally differentiated cells and have limitedin vivo ability to undergo nuclear divisionin response to FGF-2.51 Thus, differentiatedpodocytes that are forced to re-enter the cellcycle under the influence of Tat and FGF-2may be unable to divide and could detach orundergo apoptosis. Considering that FGF-2is accumulated in the circulation, glo-meruli , and urine of children withHIVAN,13,14,16,17,36 it is tempting to specu-late that the podocytes carrying the geneticrisk variants that predispose to HIVAN52,53

may be more sensitive to this pathogenicmechanism. In support of this notion, wefound that both Tat and FGF-2 can precip-itate the development of HIVAN in HIV-Tg26 mice. However, HIVAN is a complexrenal disease, and other viral proteins likeNef, which inhibits Rho-A activation inconditionally immortalized cultured mu-rine podocytes,54 also play a key role inthis disease. Nonetheless, children may bemore sensitive to the renal accumulation ofFGF-2, because their kidneys are growing,and they have high expressions of HSPG,MMPs, FGF receptors, and binding pro-teins and higher plasma and tissue levelsof FGF-2 relative to all other HIV-1 pro-teins.13,14,16,17,36 They also developmore se-vere immunosuppression and higher viralloads, leading to additional secretion of Tatand inflammatory cytokines that releasemore FGF-2.6,34 Moreover, our data didnot rule out the possibility that Tat, actingthrough the release of systemic cytokinesthat upregulate the expression of HIV-1genes through NF-kB activation, may playan additional role in HIVAN as well. BothTat and FGF-2 are cleared from the circula-

tion and stored bound to HSPG,6,18 and they can reach hightissue concentrations in organs with a high blood flow andHSPG content.15,17,40

In conclusion, we found that Tat is preferentially recruitedto LRs in cultured podocytes from children with HIVAN. Thisevent is mediated by the Tat basic domain, because mutationsof six arginines in this regionabolishedTat associationwithLRs

Figure 6. The basic domain of Tat is essential for enhancing the FGF-2–inducedactivation of pERK, Rho-A, and pMLC2 and increasing the expression of MMP-9 incultured podocytes. (A) Western blot analyses showing representative results inpodocytes transiently transfected Tat-WT (WT) or Tat-BDM1 (BDM1) for 44 hours.Transfected cells were subsequently treated with FGF-2 (50 ng/ml) for 5 minutes andprocessed for the signaling studies. (B) The graph shows mean6SEM correspondingto five samples per group. Results are expressed in arbitrary OD units as a ratio of thetotal activity or normalized for b-actin for the MMP-9 expression. Values significantlydifferent from the corresponding control group are marked: *P,0.05; **P,0.01.



and impaired its ability to induce Rho-A activation, MMP-9expression, and FGF-2 signaling both in vitro and in vivo.These findings may provide a molecular framework to definethe role of LRs in the pathogenesis of childhood HIVAN and/

or identify new therapeutic targets to im-prove the outcome of children with otherHIV renal diseases.

CONCISE METHODS

Collection of Human SamplesThe collectionof human sampleswas carried out

in accordancewith theprinciples of theDeclaration

of Helsinki. This study was approved by the In-

stitutional Review Board of Children’s National

Medical Center, and a waiver of Documentation

of Informed Consent and Health Insurance Porta-

bility andAccountabilityActAuthorizationwasob-

tained to allow for anonymous data and specimen

collection after a verbal agreement was obtained

from the patients or their parents.

Construction of Tat ExpressionVectors and AdenovirusesThe cDNA fragment encoding Tat was derived

from renal epithelial cells harvested from the

urine of a child with HIVAN and infected with

PBMCs isolated from the same child as pre-

viously described.29 Infected renal epithelial

cells were then lysed using TRIzol (Invitrogen)

to isolate total mRNA. The Tat gene was ampli-

fied from the subsequently synthesized cDNA

with the high-fidelity DNA polymerase Pfu (In-

vitrogen) using PCR primers flanking the open

reading frame of the full-length Tat.55 A cDNA

fragment encoding the full-length Tat protein

was cloned into the pCXN2-FLAG vector

and used to generate E1-deleted recombinant

adenoviruses as previously described.56 Both

Tat-FLAG and GFP adenoviruses were purified,

desalted, and titrated as described before.57 To

generate adenoviruses that express secreted

Tat protein, the signal peptide for secretion

was amplified by PCR from the sp-FGF4:

FGF-11–154–pMEXneo vector58 using forward

59-ATACTCGAGATGGCGGGGCCCGGGACGGC-

39 and reverse 59- GCGAAGCTTGGGCGCCAG-

CAAGGCCAGCAG-39 primers. The PCR

product of this 78-bp signal peptide was then

ligated with the PCR product of the full-length

Tat-FLAG (WT or BDM1) from the pCXN2

vector using forward 59-ACTAAGCTTGAC-

TACAAGGACGACGATGA-39 and reverse 59-

TACGGATCCCTAACTAGCTAATCGAATCG -39

primers. The resulting recombinant Tat-WT-FLAG or Tat-

BDM1-FLAG gene with the FGF4 signal peptide sequence was

cloned into the pVQAd CMV K-NpA shuttle plasmid (provided

by ViraQuest , Inc. , North Liberty, IA) to generate Tat

Figure 7. The basic domain of Tat is important for inducing the activation of pERK,Rho-A, and pMLC2 and increasing the expression of MMP-9 in the kidney of WT andHIV-Tg26 young mice. Newborn FVB/N WT and HIV-Tg26 mice (n=3 per group) wereinfected with adenoviral vectors carrying Tat-WT (Ad-Tat-WT) or Tat-BDM1 (Ad-Tat-BDM1). Mice were euthanized after 7 days, and their kidneys were processed for thesignaling studies as described in Concise Methods. (A) The Western blots show rep-resentative results corresponding to three mice in each group. (B) The graphs sum-marize the results corresponding to all the kidney samples per group. Results wereexpressed in arbitrary OD units as a ratio of the total activity or normalized for b-actinfor the MMP-9 expression. Values significantly different from the correspondingcontrol group are marked: *P,0.05; **P,0.01.



adenoviruses (rAd-Tat-WT* and rAd-Tat-BDM1*) as described

previously.59

Podocyte CulturesPrimary podocytes were isolated from clean-catch urine as previously

described.29,60 Proliferating podocytes were obtained consistently

from the urine of two children with HIVAN. Primary colonies that

showed typical podocyte morphology (Figure 1, A–E), were further

characterized by immunohistochemistry or immunofluorescence

with the podocyte markers Wilms’ tumor 1 (WT-1), synaptopodin,

and nestin (Figure 1, F–P). Cells were fixed in 4% paraformaldehyde

permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) and stained

using well established methods with specific antibodies against WT-1

(Dako), synaptopodin (Maine Biotechnology, Inc.), and nestin

(Chemicon Int., Inc.). Subsequently, selected colonies were trans-

duced with adenoviral vectors carrying DNA sequences encoding

the SV-40 large T antigen (provided by Janice Chou, National Insti-

tutes of Health, Bethesda, MD)61 and human telomerase (rAd-TERT;

Applied Biologic Materials, Inc.). Colonies of transformed podocytes

were characterized again by RT-PCR using specific primers for the

podocyte markers WT-1, synaptopodin, podocalyxin, nestin, podocin,

and nephrin as described in previous studies60,62 and shown in Sup-

plemental Figure 1 and Supplemental Table 1. Podocyte colonies

expressing all these markers, with the exception of podocin (which

was not detected in any of these colonies), were selected and tested

again by immunohistochemistry with WT-1, synaptopodin, and

nestin antibodies (Figure 1, G, K, and O). Two podocyte colonies,

named for the purpose of this study as P-2 and P-3 (Supplemental

Figure 1), were expanded and cultured in DMEM supplemented

with 10% FBS and 1% antibiotic–antimycotic (Invitrogen), which

contains 100 units/ml penicillin, 100 mg/ml streptomycin, and 0.25

mg/ml Fungizone (amphotericin B). Western blots were done to

confirm the expression of WT-1, synaptopodin, and nestin using

antibodies from Dako (6F-H2), Santa Cruz Biotechnology (P-19),

and Chemicon (MAb5326), respectively. Control sections were

stained omitting the first antibody and using nonimmune IgG. All

podocytes clones were screened and tested for the presence of HIV-1

genes by PCR as previously described.29

MutagenesisSite-specific mutations were introduced to the Tat gene using the

QuikChange IIXL Site-DirectedMutagenesisKit (Agilent Technologies,

Santa Clara, CA) following the manufacturer’s manuals. To generate

mutations in the basic domain RKKRRQRRR, forward primer

59-GGCAGGAAGAAGCGGAGACAGGCAGCAGCAGCTCCTCAA-

GACAGTCAGAC-39 and reverse primer 59-GTCTGACTGTCTT-

GAGGAGCTGCTGCTGCCTGTCTCCGCTTCTTCCTGCC-39 were

first used to mutate arginines55–57 and generate a mutant Tat

Figure 8. Circulating FGF-2 induces the expression of pERK, Rho-A, pMLC2, and MMP-9 in the kidneys of WT and HIV-Tg26 adult mice.Adult FVB/N WT and HIV-Tg26 mice (n=3 per group) were infected with adenoviral vectors carrying the Lac-Z gene (rAd-Lac-Z ) ora secreted form of human FGF-2 (rAd-FGF-2). Mice were euthanized after 28 days, and their kidneys were processed for the signalingstudies as described in Concise Methods. (A) The Western blots show representative results corresponding to one experiment. (B) Thegraphs summarize the results corresponding to six kidney samples per group. Results were expressed in arbitrary OD units as a ratio ofthe total activity or normalized for b-actin for the MMP-9 expression. Values significantly different from the corresponding control groupare marked: *P,0.05; **P,0.01.








(RKKRRQAAA)49–57. Forward primer 59-TTAGGCATCTCCTATGGCGC-

GAAGAAGGCGGCACAGGCAGCAGCAGCTCC-39 and reverse primer

59-GGAGCTGCTGCTGCCTGTGCCGCCTTCTTCGCGCCATAGGA-

GATGCCTAA-39 were then used to produce mutant Tat with (AKKAA-

QAAA)49–57. Forward 59-CTTAGGCATCTCCTATGGCGCGA

AGAAGGCGGCACAGCGACGAAGAGCTCCT-39 and reverse 59-AG-

GAGCTCTTCGTCGCTGTGCCGCCTTCTTCGCGCCATAGGA-

GATGCCTAAG-39 were used to generate mutant Tat with

(AKKAAQRRR)49–57. Forward primer 59-AGGCTTAGGCATCT-

CCGCTGGCAGGAAGAAGCGG-39 and reverse primer 59-CCGCT-

TCTTCCTGCCAGCGGAGATGCCTAAGCCT-39wereused to introduce

the Y47A mutation in the potential CRAC sequence, LGISYGRKKRR.

Extracellular Treatments, Adenovirus Infections, andTransient TransfectionPodocytes were exposed for 5minutes to the control buffer, 100 ng/ml

HIV-1Tatprotein (catalog number2222;National Institutes ofHealth

AIDS Reagent Program),63 or 50 ng/ml recombinant human FGF-2

(R&D Systems) alone or combined with HIV-Tat

and harvested for the signaling or immunofluores-

cence studies. Both Tat and FGF-2 preparations

were screened for endotoxin contamination

(,0.1 ng/mg protein). As indicated, C3-transferase

toxin (20 ng/ml) was added 4 hours before

stimulation to block Rho-A activity. Alterna-

tively, podocytes were infected with 2–43109

particles/ml rAd-Tat or rAd-GFP vectors

(Quantum Biotechnologies, Inc.) for 24–30

hours and then harvested for LRs isolation.

For transfection, podocytes were transiently

transfected with pCXN2-Tat-FLAG, pcDNA3.1-

TAT-1–101-FLAG64 (Addgene), which was origi-

nally derived from the HIV-1 cDNA clone

pCV1,65 or the corresponding Tat mutant or

control vectors using Lipofectamine 2000 (In-

vitrogen) and harvested 36–48 hours later for

LR isolation as described before.33 Cell prolif-

eration and survival assays were done as pre-

viously described.36

LR IsolationLR fractions were isolated using the flotation

assay as described previously.33 In brief, podocytes

were lysed on ice, homogenized, and sonicated

using a Polytron tip sonicator. The cell lysate was

then mixed with an equal volume of 80% sucrose

dissolved in the isolation buffer and overlaid

with discontinuous layers of 35% and 5% su-

crose solutions at a volume ratio of 1:2:1 in a

4-ml ultracentrifuge tube (Beckman). The

tubes were loaded on a Beckman SW60i rotor,

and gradients were separated by centrifugation

at 187,8133g (39,000 rpm) for 16 hours at 4°C.

After centrifugation, 12 fractions (about 330 ml

each) were sequentially collected from top to

bottom, and 25 ml of each fraction were resolved by SDS-PAGE

and analyzed by Western blot.

Western Blot AnalysesCells were lysed using RIPA lysis buffer containing protease inhibitor

and phosphatase inhibitor cocktail 2 (Sigma-Aldrich) and processed

for Western blots as described before.66 The following primary anti-

bodies were used: phospo-p44/42 mitogen-activated protein kinase

(Thr202/Tyr204), p44/42 mitogen-activated protein kinase (ERK1/

2), phospho-MLC2 (Thr18/Ser 19), and total MLC2 from Cell Sig-

naling Technology, anti–MMP-9 (Calbiochem), b-actin (AC-15;

Sigma-Aldrich), a-tubulin (DM1A; Abcam), Caveolin 1 (BD Bio-

sciences), FLAG (M2; Sigma-Aldrich), GFP (Santa Cruz Biotechnol-

ogy), and Tat Rabbit pAb (catalog number 705; National Institutes of

Health AIDS Reagent Program).67 Protein bands were detected using

Supersignal West Pico Chemiluminescent Substrate (Thermo Scien-

tific) or an ECLWestern Blot DetectionKit (GEHealthcare) following

the manufacturer’s instructions.

Figure 9. Circulating FGF-2 precipitated the development of HIVAN in adult HIV-Tg26

mice. WT and HIV-Tg26 male adult mice without preexisting renal disease were in-fected with adenoviral viral vectors carrying a secreted form of human recombinantFGF-2 or the Lac-Z gene (n=5 per group) as described in Concise Methods. Renalsections were harvested 28 days after the adenoviral infection. (B and D) Both WT andHIV-Tg26 mice infected with rAd-FGF-2 showed a significant recruitment of glomerularand tubular epithelial cells expressing proliferating cell nuclear antigen (PCNA),a marker of DNA synthesis, replication, and intrinsic repair activity when compared tomice (A and C) injected with rAd-LacZ vectors. (H) HIV-Tg26 mice infected with rAd-FGF-2 showed a decreased number of WT-1+ cells compared with all other groups (E–G) (*P,0.01; ANOVA). (D and H) These changes were associated with the presence ofFSGS lesions, tubular casts, and microcysts. The bar graphs show the immunohisto-chemistry staining scores corresponding to each group. Results are expressed aspercent changes in PCNA or WT-1+ cells relative to the control group (WT mice in-fected with rAd-Lac-Z). Values significantly different from the corresponding controlgroup are marked: *P,0.05; **P,0.01. Original magnification, 3200 in A–D; 3400 inE–H.



Glutathione S-Transferase Pull-Down AssaysRho-A activation was monitored by glutathione S-transferase (GST)

pull-down using GST-Rhotekin recombinant protein bound to

glutathione slurry resin using the protocol described before.66 Total

and phosphorylated Rho-A were assessed by Western blotting using

Rho-A (67B9) rabbit mAb (Cell Signaling Technology). For total Rho-

A, we used an equal amount of protein corresponding to the cell lysates

obtained before they were mixed with the GST beads.

Immunofluorescence StainingPodocyteswere culturedoncell growth-promoting coverslips (Fisher)

or coverslips coatedwith type I collagen for 24hours. Cellswere treated

as indicated and thenfixedandpermeablizedasdescribedbefore.66After

blockingwith 1%BSA, cells were stainedwith 2mg/ml Phalloidin–Alexa

Fluor 488 (Invitrogen), and nuclei were stained with Hoechst 33342

(1:2000; Invitrogen) for 20minutes at room temperature. After mount-

ing, the confocal imaging was performed using an Olympus FV1000

confocalmicroscope, and amagnification of 603was used for imaging.

Studies in WT and HIV-Tg26 MiceThese experiments were approved by the Children’s Research Institute

Animal Care and Use Committee.WTandHIV-Tg26 FVB/Nmice were

housed in a pathogen-free environment on a 12:12-hour light/dark

cycle in the animal facility at Children’s National Medical Center. All

mice had free access to water and standard food and were treated in

accordancewith theNational Institutes ofHealth guidelines for care and

use of research animals. Both the generation of the HIV-Tg26 mouse

colony and the adenoviral gene-transferring technique to express for-

eign genes in newborn mouse kidneys have been described in de-

tail.37,68,69 Briefly, newborn FVB/N WT and HIV-Tg26 mice (n=3–8

per group) were injected through the retro-orbital plexus with adeno-

viruses carrying the Escherichia coli LacZ gene (rAd-LacZ), Tat-WT-

FLAG, or Tat-BDM1-FLAG (13108 pfu/pup). Tat mRNA expression

was assessed by RT-PCR using the following primers: forward 59-ATG-

GAGCCAGTAGATCCTAGAC-39 and reverse 59- CTAATCGAATC-

GATCTGTCTCTGC-39. In other experiments, WTor HIV-Tg26 adult

malemice without preexisting renal disease were divided in two groups

(n=3–5 mice per group) and injected through the retro-orbital vein

plexus with adenoviral vectors carrying LacZ or a 700-bp cDNA se-

quence encoding a secreted form of human FGF-2 (rAd-FGF-2;

53108 pfu/mouse) as previously described.38,69,70 Mice were eutha-

nized 7 or 28 days after the adenoviral infection, and their kidneys

were processed for signaling or renal histologic studies as described

above. Renal injury was assessed in sections stained with period

acid–Schiff by counting the percentage of glomeruli exhibiting seg-

mental/global sclerosis and the percentage of tubular casts and mi-

crocysts. In addition, we counted the number of cells that stained

positive for proliferating cell nuclear antigen andWT-1 and assessed

the magnitude of albuminuria as previously described.38

Statistical AnalysesIf not specified otherwise, the data are expressed as means6SEMs.

Multiple sets of data were compared by ANOVA with Newman–Keuls

post hoc comparisons. The significant differences between the means of

two groups were analyzed by unpaired t tests. Statistical analyses were

performed using GraphPad Prism software (version 5.00; GraphPad

Software, SanDiego,CA).Values ofP,0.05were considered statistically

significant.

Figure 10. FGF-2, alone or combined with Tat, increased the pro-liferation and survival of cultured podocytes. (A) Proliferation assay.Podocytes were seeded at a density of 53104 cells/well and cul-tured in DMEM media supplemented with 1% FBS and penicil-lin/streptomycin for 4 days. HIV-Tat, FGF-2, or both combined wereadded daily at a concentration of 50 ng/ml each. On day 4, all cellswere trypsinized and counted as described in Concise Methods.Values significantly different from controls are marked: *P,0.05. (B)The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-mide) survival assay. Podocytes were seeded at a density of 63104

cells per well and starved overnight on DMEM serum-free mediacontaining antibiotics. Subsequently, all cells were treated withFGF-2+Tat at a concentration of 10 ng/ml each (black bars) in thepresence or absence of the corresponding inhibitors. The kinaseinhibitor PD98059 (5 mM), the Rho-associated protein kinase in-hibitor Y27632 (10 mM), and the Rho-A inhibitor C3-transferase (20ng/ml) were added 2 hours before the FGF-2+Tat treatment. Onday 3, 10 ml MTT solution (5 mg/ml) was added to each well, in-cubated for 3 hours at 37°C, and then, treated with 100 ml MTTsolvent (4 mM HCl and 0.1% Triton X-100 in isopropronal) as de-scribed in Concise Methods. Results were recorded in MTT absor-bance units and expressed as a percent of control values (openbars) considering six independent readings. Values significantlydifferent from controls are marked: **P,0.01.



ACKNOWLEDGMENTS

The following reagents were obtained through theNational Institutes of

Health AIDS Research and Reference Reagent Program, Division of

AIDS, National Institute of Allergy and Infectious Diseases, National

Institutes ofHealth: Ghost(3)X4/R5 fromDrs. Vineet N. Kewal Ramani

and Dan R. Littman, HIV-1 Tat fromDr. John Brady, and HIV-1 BH10

Tat antiserum from Dr. Bryan Cullen. We thank Children’s Research

Institute Intellectual and Developmental Disabilities Research Center

lightmicroscopy and image analysis core at Children’s NationalMedical

Center for help with the immunofluorescence studies. We thank the

group of Dr. Valente for contributing the pcDNA3.1-TAT-1-101-FLAG

plasmid to Addgene as well as Lian Xu, Dr. Jyoti Jaiswal, and Dr. Luana

Scheffer for technical advice and helpful scientific discussions.

This study was supported, in part, by National Institutes of Health

Grants R01-HL55605, R01-HL102497, and R01-DK049419.

DISCLOSURESNone.

REFERENCES

1. Ray PE, Hu CA: Advances in our understanding of the pathogenesis ofHIV-1 associated nephropathy in children. Future Virol 6: 883–894, 2011

2. Oh J, Reiser J, Mundel P: Dynamic (re)organization of the podocyte actincytoskeleton in thenephrotic syndrome.PediatrNephrol19:130–137,2004

3. Bruggeman LA, Ross MD, Tanji N, Cara A, Dikman S, Gordon RE, BurnsGC, D’Agati VD, Winston JA, Klotman ME, Klotman PE: Renal epithe-lium is a previously unrecognized site of HIV-1 infection. J Am Soc

Nephrol 11: 2079–2087, 20004. Smeets B, Angelotti ML, Rizzo P, Dijkman H, Lazzeri E, Mooren F, Ballerini

L, Parente E, Sagrinati C,Mazzinghi B, Ronconi E, Becherucci F, Benigni A,Steenbergen E, Lasagni L, Remuzzi G, Wetzels J, Romagnani P: Renalprogenitor cells contribute to hyperplastic lesions of podocytopathies andcrescentic glomerulonephritis. J Am Soc Nephrol 20: 2593–2603, 2009

5. Ronconi E, Sagrinati C, Angelotti ML, Lazzeri E, Mazzinghi B, Ballerini L,Parente E, Becherucci F, Gacci M, Carini M, Maggi E, Serio M, Vannelli GB,Lasagni L, Romagnani S, Romagnani P: Regeneration of glomerular podo-cytes by human renal progenitors. J Am Soc Nephrol 20: 322–332, 2009

6. Barillari G, Ensoli B: Angiogenic effects of extracellular human immuno-deficiency virus type1Tat protein and its role in thepathogenesis ofAIDS-associated Kaposi’s sarcoma. Clin Microbiol Rev 15: 310–326, 2002

7. Berkhout B, Silverman RH, Jeang KT: Tat trans-activates the human immu-nodeficiency virus through a nascent RNA target. Cell 59: 273–282, 1989

8. Vivès E, Brodin P, Lebleu B: A truncated HIV-1 Tat protein basic domainrapidly translocates through the plasma membrane and accumulates inthe cell nucleus. J Biol Chem 272: 16010–16017, 1997

9. WestendorpMO, Frank R, Ochsenbauer C, Stricker K, Dhein J, WalczakH, Debatin KM, Krammer PH: Sensitization of T cells to CD95-mediatedapoptosis by HIV-1 Tat and gp120. Nature 375: 497–500, 1995

10. Xiao H, Neuveut C, Tiffany HL, Benkirane M, Rich EA, Murphy PM,Jeang KT: Selective CXCR4 antagonism by Tat: Implications for in vivoexpansion of coreceptor use by HIV-1. Proc Natl Acad Sci U S A 97:11466–11471, 2000

11. Doublier S, Zennaro C, Spatola T, Lupia E, Bottelli A, Deregibus MC,CarraroM,Conaldi PG,Camussi G: HIV-1 Tat reduces nephrin in humanpodocytes: A potential mechanism for enhanced glomerular perme-ability in HIV-associated nephropathy. AIDS 21: 423–432, 2007

12. Conaldi PG, Bottelli A, Baj A, Serra C, Fiore L, Federico G, Bussolati B,Camussi G: Human immunodeficiency virus-1 tat induces hyper-proliferation and dysregulation of renal glomerular epithelial cells. AmJ Pathol 161: 53–61, 2002

13. Ray PE, Liu XH, Xu L, Rakusan T: Basic fibroblast growth factor inHIV-associated hemolytic uremic syndrome. Pediatr Nephrol 13: 586–593,1999

14. Soler-García AA, Rakhmanina NY, Mattison PC, Ray PE: A urinary bio-marker profile for children with HIV-associated renal diseases. KidneyInt 76: 207–214, 2009

15. Ray PE, Bruggeman LA, Weeks BS, Kopp JB, Bryant JL, Owens JW,Notkins AL, Klotman PE: bFGF and its low affinity receptors in thepathogenesis of HIV-associated nephropathy in transgenic mice. Kid-ney Int 46: 759–772, 1994

16. Liu XH, Aigner A, Wellstein A, Ray PE: Up-regulation of a fibroblastgrowth factor binding protein in childrenwith renal diseases.Kidney Int59: 1717–1728, 2001

17. Ray PE, Xu L, Rakusan T, Liu XH: A 20-year history of childhood HIV-associated nephropathy. Pediatr Nephrol 19: 1075–1092, 2004

18. Albini A, Benelli R, Presta M, Rusnati M, Ziche M, Rubartelli A,Paglialunga G, Bussolino F, Noonan D: HIV-tat protein is a heparin-binding angiogenic growth factor. Oncogene 12: 289–297, 1996

19. Chu CL, Buczek-Thomas JA, Nugent MA: Heparan sulphate proteo-glycans modulate fibroblast growth factor-2 binding through a lipidraft-mediated mechanism. Biochem J 379: 331–341, 2004

20. Urbinati C, Nicoli S, Giacca M, David G, Fiorentini S, Caruso A, AlfanoM, Cassetta L, Presta M, Rusnati M: HIV-1 Tat and heparan sulfateproteoglycan interaction: A novel mechanism of lymphocyte adhesionand migration across the endothelium. Blood 114: 3335–3342, 2009

21. Fittipaldi A, Ferrari A, Zoppé M, Arcangeli C, Pellegrini V, Beltram F,Giacca M: Cell membrane lipid rafts mediate caveolar endocytosis ofHIV-1 Tat fusion proteins. J Biol Chem 278: 34141–34149, 2003

22. Wadia JS, Stan RV, Dowdy SF: Transducible TAT-HA fusogenic peptideenhances escape of TAT-fusion proteins after lipid raft macro-pinocytosis. Nat Med 10: 310–315, 2004

23. Chini B, Parenti M: G-protein coupled receptors in lipid rafts and caveolae:How,when andwhy do theygo there? JMol Endocrinol 32: 325–338, 2004

24. Pike LJ: The challenge of lipid rafts. J Lipid Res 50[Suppl]: S323–S328, 200925. Simons K, Ikonen E: Functional rafts in cell membranes. Nature 387:

569–572, 199726. Zhong Y, Hennig B, Toborek M: Intact lipid rafts regulate HIV-1 Tat

protein-induced activation of the Rho signaling and upregulation ofP-glycoprotein in brain endothelial cells. JCerebBloodFlowMetab 30:522–533, 2010

27. Zhong Y, Smart EJ, Weksler B, Couraud PO, Hennig B, Toborek M:Caveolin-1 regulates human immunodeficiency virus-1 Tat-inducedalterations of tight junction protein expression via modulation of theRas signaling. J Neurosci 28: 7788–7796, 2008

28. Zhu L, Jiang R, Aoudjit L, Jones N, Takano T: Activation of Rho-A inpodocytes induces focal segmental glomerulosclerosis. J Am Soc

Nephrol 22: 1621–1630, 201129. Ray PE, Liu XH, Henry D, Dye L 3rd, Xu L, Orenstein JM, Schuztbank TE:

Infection of human primary renal epithelial cells with HIV-1 from childrenwith HIV-associated nephropathy. Kidney Int 53: 1217–1229, 1998

30. Mörner A, Björndal A, Albert J, Kewalramani VN, Littman DR, Inoue R,Thorstensson R, Fenyö EM, Björling E: Primary human immunodeficiencyvirus type 2 (HIV-2) isolates, like HIV-1 isolates, frequently use CCR5 butshow promiscuity in coreceptor usage. J Virol 73: 2343–2349, 1999

31. Rayne F, Debaisieux S, Yezid H, Lin YL, Mettling C, Konate K, Chazal N,Arold ST, Pugnière M, Sanchez F, Bonhoure A, Briant L, Loret E, Roy C,Beaumelle B: Phosphatidylinositol-(4,5)-bisphosphate enables efficientsecretion of HIV-1 Tat by infected T-cells.EMBOJ 29: 1348–1362, 2010

32. Epand RM: Cholesterol and the interaction of proteins with membranedomains. Prog Lipid Res 45: 279–294, 2006



33. Williamson CD, Zhang A, Colberg-Poley AM: The human cytomega-lovirus protein UL37 exon 1 associates with internal lipid rafts. J Virol 85:2100–2111, 2011

34. Ensoli B, Gendelman R, Markham P, Fiorelli V, Colombini S, Raffeld M,Cafaro A, Chang HK, Brady JN, Gallo RC: Synergy between basic fi-broblast growth factor and HIV-1 Tat protein in induction of Kaposi’ssarcoma. Nature 371: 674–680, 1994

35. Barillari G, Gendelman R, Gallo RC, Ensoli B: The Tat protein of humanimmunodeficiency virus type 1, a growth factor for AIDS Kaposi sar-coma and cytokine-activated vascular cells, induces adhesion of thesame cell types by using integrin receptors recognizing the RGD aminoacid sequence. Proc Natl Acad Sci U S A 90: 7941–7945, 1993

36. Ray PE, Tassi E, Liu XH,Wellstein A: Role of fibroblast growth factor-bindingprotein in the pathogenesis of HIV-associated hemolytic uremic syndrome.Am J Physiol Regul Integr Comp Physiol 290: R105–R113, 2006

37. JerebtsovaM, LiuXH,YeX,RayPE:Adenovirus-mediatedgene transfer toglomerular cells in newborn mice. Pediatr Nephrol 20: 1395–1400, 2005

38. MattisonPC, Soler-GarcíaAA,Das JR, JerebtsovaM, Perazzo S, TangP, RayPE: Role of circulating fibroblast growth factor-2 in lipopolysaccharide-induced acute kidney injury in mice. Pediatr Nephrol 27: 469–483, 2012

39. Jerebtsova M, Wong E, Przygodzki R, Tang P, Ray PE: A novel role of fi-broblast growth factor-2 and pentosan polysulfate in the pathogenesis ofintestinal bleeding in mice. Am J Physiol Heart Circ Physiol 292: H743–H750, 2007

40. Whalen GF, Shing Y, Folkman J: The fate of intravenously administeredbFGF and the effect of heparin. Growth Factors 1: 157–164, 1989

41. Hauber J, Malim MH, Cullen BR: Mutational analysis of the conservedbasic domain of human immunodeficiency virus tat protein. J Virol 63:1181–1187, 1989

42. Ruben S, Perkins A, Purcell R, Joung K, Sia R, Burghoff R, HaseltineWA,Rosen CA: Structural and functional characterization of human immu-nodeficiency virus tat protein. J Virol 63: 1–8, 1989

43. Boykins RA, Mahieux R, Shankavaram UT, Gho YS, Lee SF, Hewlett IK,Wahl LM, Kleinman HK, Brady JN, Yamada KM, Dhawan S: Cuttingedge: A short polypeptide domain of HIV-1-Tat protein mediatespathogenesis. J Immunol 163: 15–20, 1999

44. Mitola S, Soldi R, Zanon I, Barra L, Gutierrez MI, Berkhout B, Giacca M,Bussolino F: Identification of specific molecular structures of humanimmunodeficiency virus type 1 Tat relevant for its biological effects onvascular endothelial cells. J Virol 74: 344–353, 2000

45. Zhong Y, Zhang B, Eum SY, Toborek M: HIV-1 Tat triggers nuclear lo-calization of ZO-1 via Rho signaling and cAMP response element-binding protein activation. J Neurosci 32: 143–150, 2012

46. Page-McCaw A, Ewald AJ, Werb Z: Matrix metalloproteinases andthe regulation of tissue remodelling. Nat Rev Mol Cell Biol 8: 221–233, 2007

47. Chetty C, Lakka SS, Bhoopathi P, Gondi CS, Veeravalli KK, Fassett D,Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: Urokinase plasminogenactivator receptor and/ormatrixmetalloproteinase-9 inhibition inducesapoptosis signaling through lipid rafts in glioblastoma xenograft cells.Mol Cancer Ther 9: 2605–2617, 2010

48. RaghuH, Sodadasu PK,Malla RR, Gondi CS, EstesN, Rao JS: Localizationof uPAR and MMP-9 in lipid rafts is critical for migration, invasion andangiogenesis in human breast cancer cells. BMC Cancer 10: 647, 2010

49. ZhangQ, Chen X, Zhou J, Zhang L, ZhaoQ, Chen G, Xu J, Qian F, ChenZ: CD147, MMP-2, MMP-9 andMVD-CD34 are significant predictors ofrecurrence after liver transplantation in hepatocellular carcinoma pa-tients. Cancer Biol Ther 5: 808–814, 2006

50. Etienne-Manneville S, Hall A: Rho GTPases in cell biology.Nature 420:629–635, 2002

51. Sasaki T, Hatta H, Osawa G: Cytokines and podocyte injury: Themechanism of fibroblast growth factor 2-induced podocyte injury.Nephrol Dial Transplant 14[Suppl 1]: 33–34, 1999

52. GenoveseG, FriedmanDJ, RossMD, Lecordier L, Uzureau P, FreedmanBI, Bowden DW, Langefeld CD, Oleksyk TK, Uscinski Knob AL,

Bernhardy AJ, Hicks PJ, Nelson GW, Vanhollebeke B, Winkler CA, KoppJB, Pays E, Pollak MR: Association of trypanolytic ApoL1 variants withkidney disease in African Americans. Science 329: 841–845, 2010

53. PollakMR, GenoveseG, FriedmanDJ: APOL1 and kidney disease.CurrOpin Nephrol Hypertens 21: 179–182, 2012

54. Lu TC, He JC, Wang ZH, Feng X, Fukumi-Tominaga T, Chen N, Xu J,Iyengar R, Klotman PE: HIV-1 Nef disrupts the podocyte actin cyto-skeleton by interacting with diaphanous interacting protein. J BiolChem 283: 8173–8182, 2008

55. Emiliani S, Fischle W, Ott M, Van Lint C, Amella CA, Verdin E: Muta-tions in the tat gene are responsible for human immunodeficiency virustype 1 postintegration latency in theU1 cell line. J Virol 72: 1666–1670,1998

56. Kozarsky K, Grossman M, Wilson JM: Adenovirus-mediated correctionof the genetic defect in hepatocytes from patients with familial hy-percholesterolemia. Somat Cell Mol Genet 19: 449–458, 1993

57. JerebtsovaM, YeX, Ray PE: A simple technique to establish a long-termadenovirus mediated gene transfer to the heart of newborn mice.Cardiovasc Hematol Disord Drug Targets 9: 136–140, 2009

58. Forough R, Xi Z, MacPhee M, Friedman S, Engleka KA, Sayers T, WiltroutRH, Maciag T: Differential transforming abilities of non-secreted andsecreted forms of human fibroblast growth factor-1. J Biol Chem 268:2960–2968, 1993

59. Anderson RD, Haskell RE, Xia H, Roessler BJ, Davidson BL: A simplemethod for the rapid generation of recombinant adenovirus vectors.Gene Ther 7: 1034–1038, 2000

60. Vogelmann SU, Nelson WJ, Myers BD, Lemley KV: Urinary excretion ofviable podocytes in health and renal disease. Am J Physiol RenalPhysiol 285: F40–F48, 2003

61. Van Doren K, Gluzman Y: Efficient transformation of human fibroblasts byadenovirus-simian virus 40 recombinants.MolCell Biol 4: 1653–1656, 1984

62. Sakairi T, Abe Y, Kajiyama H, Bartlett LD, Howard LV, Jat PS, Kopp JB:Conditionally immortalized human podocyte cell lines established fromurine. Am J Physiol Renal Physiol 298: F557–F567, 2010

63. Bohan CA, Kashanchi F, Ensoli B, Buonaguro L, Boris-Lawrie KA, BradyJN: Analysis of Tat transactivation of human immunodeficiency virustranscription in vitro. Gene Expr 2: 391–407, 1992

64. MousseauG, ClementzMA, BakemanWN,Nagarsheth N, CameronM,Shi J, Baran P, Fromentin R, Chomont N, Valente ST: An analog of thenatural steroidal alkaloid cortistatin A potently suppresses Tat-dependent HIV transcription. Cell Host Microbe 12: 97–108, 2012

65. AryaSK,GuoC, JosephsSF,Wong-Staal F:Trans-activator geneofhumanT-lymphotropic virus type III (HTLV-III). Science 229: 69–73, 1985

66. Gavard J, Patel V, Gutkind JS: Angiopoietin-1 prevents VEGF-inducedendothelial permeability by sequestering Src through mDia. Dev Cell14: 25–36, 2008

67. Hauber J, Perkins A, Heimer EP, Cullen BR: Trans-activation of humanimmunodeficiency virus gene expression is mediated by nuclearevents. Proc Natl Acad Sci U S A 84: 6364–6368, 1987

68. Kopp JB, Klotman ME, Adler SH, Bruggeman LA, Dickie P, Marinos NJ,Eckhaus M, Bryant JL, Notkins AL, Klotman PE: Progressive glomerulo-sclerosis and enhanced renal accumulation of basement membranecomponents in mice transgenic for human immunodeficiency virus type 1genes. Proc Natl Acad Sci U S A 89: 1577–1581, 1992

69. Li Z, Jerebtsova M, Liu XH, Tang P, Ray PE: Novel cystogenic role ofbasic fibroblast growth factor in developing rodent kidneys. Am JPhysiol Renal Physiol 291: F289–F296, 2006

70. Gupta AR, Dejneka NS, D’Amato RJ, Yang Z, Syed N, Maguire AM,Bennett J: Strain-dependent anterior segment neovascularization fol-lowing intravitreal gene transfer of basic fibroblast growth factor(bFGF). J Gene Med 3: 252–259, 2001

This article contains supplemental material online at http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2013070710/-/DCSupplemental.





Documents

Xie X et al 2014