View
2
Download
0
Category
Preview:
Citation preview
UNIVERSITÉ DU QUÉBEC À MONTRÉAL
L'EFFET NÉFASTE DE L'OBÉSITÉ MATERNELLE SUR LE TRANSPORT
MATERNO-FŒTAL DU CHOLESTÉROL, VIA LES TRANSPORTEURS ABC ET
LEURS RÉGULATEURS POST-TRADUCTIONNELS, DANS LE PLACENTA
HUMAIN À TERME
MÉMOIRE
PRÉSENTÉ
COMME EXIGENCE PARTIELLE
DU PROGRAMME DE MAÎTRISE EN BIOLOGIE
PAR
GUILLAUME DESPAROIS
OCTOBRE 2014
UNIVERSITÉ DU QUÉBEC À MONTRÉAL Service des bibliothèques
Avertissement
La diffusion de ce mémoire se fait dans le respect des droits de son auteur, qui a signé le formulaire Autorisation de reproduire et de diffuser un travail de recherche de cycles supérieurs (SDU-522- Rév.01-2006). Cette autorisation stipule que «conformément à l'article 11 du Règlement no 8 des études de cycles supérieurs, [l'auteur] concède à l'Université du Québec à Montréal une licence non exclusive d'utilisation et de publication de la totalité ou d'une partie importante de [son] travail de recherche pour des fins pédagogiques et non commerciales. Plus précisément, [l'auteur) autorise l'Université du Québec à Montréal à reproduire, diffuser, prêter, distribuer ou vendre des copies de [son] travail de recherche à des fins non commerciales sur quelque support que ce soit, y compris l'Internet. Cette licence et cette autorisation n'entraînent pas une renonciation de [la] part [de l'auteur] à [ses] droits moraux ni à [ses] droits de propriété intellectuelle. Sauf entente contraire, [l'auteur] conserve la liberté de diffuser et de commercialiser ou non ce travail dont [il] possède un exemplaire.»
REMERCIEMENTS
Merci tout d'abord aux évaluateurs de ce mémoire, pour avoir accepté d'être sur mon comité de thèse et de prendre le temps d'évaluer et de corriger ce projet de maîtrise.
Le Dr. Julie Lafond, ma directrice, mille mercis de ne jamais m'avoir lâché et de t'être battue pour moi malgré les difficultés rencontrées. S.ans ton support, ce projet n'aurait jamais pu se concrétiser. Merci de m'avoir donné ma chance et d'avoir cru en mm.
Le Dr. Cathy Vaillancourt, ma co-directrice, sans qui je n'aurais jamais pu faire de maîtrise. Merci beaucoup de m'avoir accueilli parmi ton équipe et de m'avoir donné ma chance. Ton soutien fut grandement apprécié.
Le Dr. Evemie Dubé, mon mentor au laboratoire, qui a su faire preuve d'altruisme, de patience et d'acharnement à mon égard, afin que je puisse réaliser pleinement mon projet de maîtrise. Tu as partagé avec moi tout ton savoir et ta grande expérience acquise en milieu de recherche et ce fut infiniment apprécié. Ce projet n'auraitjamais été aussi complet sans tous tes bons conseils.
Stéphanie Bergeron, ma conjointe, pour tout le soutien moral que tu m'as apporté durant les durs moments de ma maîtrise. Tu m'as donné la force de continuer ce projet jusqu'à la toute fm.
Yves Desparois, mon père, qui malgré un horaire chargé, a toujours fait d'énormes sacrifices pour m'aider et me soutenir durant mes études. Ton dévouement sera toujours une source d'inspiration pour moi.
Carole Deshaies, ma mère, qui malgré les hauts et les bas, a su me donner toute la motivation et les encouragements nécessaires pour persévérer dans mes études.
Gilles Desparois et Francine Deshaies, parrain et marraine, qui, à leur manière, m'ont soutenu fmancièrement. Merci pour vos encouragements.
Patrick Bergeron, mon cousin, qui a toujours su me remonter le moral avec une touche d'humour typique de sa personne dans les moments difficiles. Merci pour ses bons moments et tes encouragements qui m'ont aidé à persévérer.
Je dédie ce mémoire à mes grands-parents, Marcel et Lucile Desparois, qui m'ont tous deux fait comprendre
qu'ils seraient toujours fiers de moi, qu'importe le chemin que j'emprunterais dans la vie ...
TABLE DES MATIÈRES
LISTE DES FIGURES ................................................................................................. vi LISTE DES TABLEAUX ........................................................................................... vii LISTE DES ABRÉVIATIONS, SIGLES ET ACRONYMES .................................... .ix LISTE DES SYMBOLES .............................................................................................. x RÉSUMÉ ...................................................................................................................... xi INTRODUCTION ....................................................................................................... 12 CHAPITRE I Revue de la littérature .................................................................................................. 15
1.1 Adaptation du métabolisme maternel à la grossesse ........................................ 15 1.2 Le placenta humain ........................................................................................... 16 1.3 Les échanges matemo-fœtaux ........................................................................... 18 1.4 Le transport des lipides ...................................................................................... 21 1.5 Les transporteurs A TP-binding cassette (ABC) ................................................ 22 1.6 Régulation des transporteurs ABC .................................................................... 26 1.8 Hypothèses de travail. ........................................................................................ 34 1.9 Objectifs de recherche ....................................................................................... 34
CHAPITRE II L'article scientifique .................................................................................................... 35
2.1 Résumé ............................................................................................................... 36 2.2 Contributions de l'étudiant à l'article ............................................................... 37 2.3 Front page ......................................................................................................... 38 2.4 Abstract. ............................................................................................................. 39 2.5 Introduction ........................................................................................................ 41 2.6 Materials and Methods., .................................................................................... 46 2. 7 Results ............................................................................................................... 51 2.8 Discussion .......................................................................................................... 54 2.10 Figure Legends ................................................................................................ 66 2.11 Tables ............................................................................................................... 68 2.12 Figures ............................................................................................................ 69
Chapitre III Discussion et conclusions ............................................................................................ 77
3.1 Discussion ......................................................................................................... 77 3.2 Conclusions ........................................................................................................ 81
APPENDICE A: Contributions de l'étudiant au projet ............................................. 83 Annexe 1 Projet sur les lipoprotéines ........................................................................................... 85
1.1 Contributions de l'étudiant au projet.. ............................................................... 85 1.2 Résumé de l'article des lipoprotéines ................................................................ 86 1.3 L'article scientifique en préparation ................................................................. 87
Annexe 2 .................................................................................................................... 119 Bibliographie ............................................................................................................. 122
VI
LISTE DES FIGURES Figure Page
1.1 : Modèle théorique du transport des acides gras via le placenta ........................ 19
1.2: Transport materno-foetal du cholestérol maternel.. ........................................ 20
2.1: Quantification du cholestérol dans les placentas de femmes de poids normal et obèse ................................................................................................ 69
2.2: ABC genes and proteins expression quantification in normal weight and obese women placentas .................................................................................... 70
2.3: Influence ofnewborn's sex on ABCA1 protein expression in normal weight and obese women placentas ................................................................. 71
2.4: CAPN1, CAPN2 and DERL1 genes and proteins expression quantification in normal weight and obese women placentas ......................... 72
2.5: Influence ofnewborn's sex on CAPN1 protein expression in normal weight and obese women placentas ................................................................. 73
2.6: Model ofmaternal-fetal cholesterol transfer in maternai obesity .................... 74
A 1.1: Maternai plasma hormonal and lipid profiles of normal weight and overweight/obese women ........................................................................ 113
A1.2: Expression of APOs, MTP, BMPl and PCEP2 in human full-term placentas of normal weight and overweight/obese women ........................... 114
A 1.3: Maternai plasma hormonal and lipid profiles of normo and hypercholesterolemic women ................................................................. 115
A1.4: Expression of APOs, MTP and DERL1 in human full-term placentas of normo and hypercholesterolemic wom ..................................... 116
A2.1: Expression des transporteurs ABC et derlin-1 de cultures primaires de cytotrophoblastes selon la différenciation en syncytiotrophoblaste ......... 118
A2.2: Expression des transporteurs ABC et de derlin-1 dans la lignée cellulaire Be Wo différenciée à la forskoline ................................................. 119
VU
LISTE DES TABLEAUX Tableau Page
1.1 : Sites principaux de localisation et substrats des protéines ABC ...................... 22
2.1 : Tableau d'amorces utilisées pour les analyses de RT-PCR en temps réel.. ..... 67
2.2 : Tableau des caractéristiques maternelles, néonatales et placentaires ............... 68
A1.1: Primers used for real-time RT-PCR ............................................................... 108
A 1.2: Maternai, placenta! and neonatal general characteristics of normal weight and overweight/obese pregnancies ..................................................... 109
A 1.3: Maternai, placenta! and neonatal general characteristics of normo and hypercholesterolemic pregnancies ............................................... 110
ABC
A po
CTB
Derlin-1
CE
Cebpa
CFTR
CL
Cox-2
CT
Dfm-1
DMSO
ERAD
FATP4
FAT/CD36
FSK
GAP OH
H-FABP
hCG
HDL
HEK293
HPRT1
Hsp90
IMC
L-FABP
LDL
LISTE DES ABRÉVIATIONS, SIGLES ET ACRONYMES
A TP-binding cassette
Apolipoprotéine
Cytotrophoblaste
Protéine de dégradation du réticulum endoplasmique 1
Ester de cholestérol ou cholestérol estérifié
Protéine liant l'inducteur de CCAA T membre a
V Ill
Régulateur de la perméabilité transmembranaire de la fibrose kystique
Cholestérol libre
Cyclo-oxygénase 2
Cholestérol total
Protéine de la famille DER1-like membre 1
Diméthylsulfoxyde
Voie de dégradation des protéines du réticulum endoplasrnique
Protéine de transport des acides gras 4
Translocase des acides gras
Forskoline
Glycéraldéhyde-3-phosphate déshydrogénase
Protéine liant les acides gras de type cardiaque
Hormone chorio-gonadotropique humaine
Lipoprotéine de haute densité
Cellule rénale embryonnaire humaine 293
Hypoxanthine Phosphoribosyltransférase 1
Protéine de choc thermique 90
Indice de Masse Corporelle
Protéine liant les acides gras de type hépatique
Lipoprotéine de faible densité
LDLr
NPC
PCR
PPIA
RACK1
RIPA
RT
SEM
SR-B1
STB
TOP-1
VLDL
VLDLr
Récepteur de lipoprotéines de faible densité
Transporteur Niemann-Pick
Réaction de polymérase en chaîne
Peptidylprolyl Isomérase A
Récepteur pour Kinases C Activées 1
Radioimmunoprecipitation assay
Transcriptase inverse
Erreur moyenne standard
Récepteur Scavenger-B1
Syncytiotrophoblaste
Topoisomérase 1
Lipoprotéine de très faible densité
Récepteur de lipoprotéines de très faible densité
IX
x
LISTE DES SYMBOLES
°C Degrés Celsius
cm Centimètres
g · Accélération causée par la pesanteur
g Gramme
h lieure
kg Kilogramme
1 Litre
rn Mètre
m2 Mètre carré
m3 Mètre cube
mg Milligramme
mm Minute
ml Millilitre
mM Millimolaire
Jlg Microgramme
111 Microlitre
11M Micromolaire
Xl
RÉSUMÉ
L'obésité est reconnue comme un problème de santé majeur en Amérique du Nord. Les femmes enceintes en souffrant sont plus à risque de subir des complications lors de la grossesse ou de 1' accouchement, ce qui peut affecter le développement normal du nouveau-né et sa santé à court, moyen et long terme. Notre étude porte sur les transporteurs ABC qui ont pour rôle d'excréter le cholestérol hors de la cellule afin d'éviter son accumulation dans les tissus de l'organisme. Dans le placenta, le transfert du cholestérol de la mère au fœtus exige une régulation adéquate de ces transporteurs, afin d'assurer un bon développement fœtal. Notre hypothèse stipule que l'obésité maternelle module le transport du cholestérol de la mère au fœtus via l'expression des transporteurs ABC dans le placenta humain à terme. Ainsi, des mères contrôles (Indice de Masse Corporelle (IMC) entre 18,5 et 24,9 kg/m2
) et obèses (IMC de 30 kg/m2 et plus) ont été recrutées (contrôles n = 22 et obèses n = 11). Du sang et du tissu placentaire (conservé à -80°C) ont été prélevés chez la mère à 1' accouchement, ainsi que du sang dans le cordon ombilical. Dans le plasma sanguin, des dosages lipidiques ont été effectués. Le taux placentaire de cholestérol total fut d'abord testé avec la technique d'extraction des lipides selon Folch et quantifié à l'aide d'une trousse commerciale, ainsi que les taux placentaires de cholestérol libre et d'esters de cholestérol. L'expression au niveau des transporteurs ABC (ARNm et protéines) (Al, BI, B4, Gl et G2) a été quantifiée par RT-PCR en temps réel et par immunobuvardage de type Western, respectivement, ainsi que celle des régulateurs calpaïne-1 et 2 et derlin-1 grâce aux mêmes techniques. Avec les dosages lipidiques, on observe une diminution, par rapport au groupe témoin, du cholestérol, des HDL et LDL chez les mères obèses, alors qu'une augmentation du cholestérol et des HDL est observable chez leurs nouveau-nés. On observe chez les femmes obèses une baisse des taux placentaires de cholestérollibre·et une hausse des taux d'ester de cholestérol, alors que le cholestérol total reste inchangé. Chez les femmes obèses, on remarque une baisse d' ABCAl, ABCG2 et calpaïne-2, ainsi qu'une augmentation pour ABCB4, calpaïne-1 et derlin-1. Ces résultats suggèrent que 1 'obésité maternelle affecte le transport du cholestérol dans le placenta humain à terme, par la modulation de l'expression des transporteurs ABCAI, ABCG2 et ABCB4 via leurs régulateurs, calpaïne-1 et derlin-1. Le lien entre derlin-1 et ABCG2 reste toutefois à démontrer dans le placenta humain.
12
INTRODUCTION
L'obésité est un problème sans cesse grandissant au sein de la population mondiale
actuelle [1]. Maintenant considérée comme une pandémie [2], l'obésité se caractérise
par une accumulation des lipides dans les tissus adipeux de l'organisme [3]. Il fut déjà
démontré que l'obésité entraîne des problèmes de santé divers, surtout au niveau
cardiaque, tels que les accidents cardia-vasculaires (ACV) [4] ou des problèmes
d'hypertension [5]. L'obésité affecte grandement la population canadienne. En effet,
des recensements datant de 2011 ont permis d'estimer que 25,3 % de la population
canadienne souffre d'obésité [6]. L'obésité, qui ne cesse d'augmenter en proportion
au Canada, peut affecter les femmes enceintes, causant chez elles des complications
durant la grossesse, sous forme de fausses-couches, d'infections morbides et de
diabète gestationnel [7], et durant l'accouchement, comme un risque accru
d'hémorragies post-partum, d'accouchement vaginal laborieux ou encore par
césarienne [8]. De plus, 1 'obésité maternelle affecte également le développement
fœtal, en amenant, par exemple, des anomalies du développement du tube neural ou
encore des anomalies cardiaques [9;10]. Afin de pouvoir contrer les effets de l'obésité
maternelle sur le développement fœtal, il faut avant tout comprendre comment elle
affecte le transport placentaire des nutriments nécessaires au développement fœtal,
notamment des lipides.
Ce projet vise d'abord et avant tout à déterminer si la voie des transporteurs ATP
binding-cassette (ABC) est modulée par l'obésité dans le placenta humain à terme, ce
qui ouvrirait de nouvelles pistes concernant le transfert materno-fœtal du cholestérol
et pourrait expliquer, en partie, comment l'obésité maternelle affecte le
développement du fœtus. Dans un second temps, 1' expression de certains régulateurs
post-traductionnels des transporteurs ABC sera évaluée. Les calpaïnes-1 et 2, ainsi
que derlin-1 sont de bonnes pistes à envisager, car elles ont été reconnues comme
13
régulant des protéines ABC dans d'autres organes chez l'être humain. Ce projet met
donc l'emphase à démontrer l'implication majeure des transporteurs ABC, ainsi que
de certains de leurs régulateurs post-traductionnels connus, dans la modulation du
transfert matemo-fœtal du cholestérol.
Pour ce faire, les taux d'expression des ARNm et des protéines de cinq transporteurs
ABC (Al, Bl, B4, Gl et G2) furent quantifiés dans le placenta humain à terme, ainsi
que les taux de 3 régulateurs post -traductionnels, soit calpaïne-1, calpaïne-2 et derlin-
1. De plus, les taux placentaires de cholestérol total, libre et estérifié ont été
quantifiés, pour évaluer l'effet de la modulation des transporteurs sur le transfert
placentaire du cholestérol. Cette étude a été réalisée sur 33 femmes (22 de poids
normal et 11 souffrant d'obésité) ayant accouché par délivrance vaginale, ne souffrant
ni de diabète gestationnel ni de problèmes de la glande thyroïde, exemptes de
traitements médicamenteux et ne consommant ni alcool ni cigarettes.
Aussi, sur des extraits protéiques de cultures primaires de cytotrophoblastes isolés de
placentas humains, le taux d'expression protéique des 5 transporteurs ABC et de
derlin-1 fut quantifié. Il en fut de même pour la lignée cellulaire Be Wo, afm de
démontrer que 1' expression protéique de cette lignée est semblable à celle des
cytotrophoblastes isolés de placentas. Ainsi, il sera démontré que la lignée cellulaire
Be Wo peut être un bon modèle pour étudier les protéines placentaires impliquées
dans le transport du cholestérol.
Tout d'abord, il y aura une revue détaillée de la littérature pertinente au sujet, suivi de
1' article scientifique soumis pour publication, terminé par une discussion et une
conclusion complémentaire ·résumant le projet de maîtrise en question. Il y sera
également joint au document des annexes montrant un second article scientifique en
préparation et des résultats préliminaires obtenus sur les cultures cellulaires.
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
----
-
15
CHAPITRE 1 : Revue de la littérature
1. 1 Adaptation du métabolisme maternel à la grossesse
Durant les neuf mois de grossesse, le métabolisme maternel subit des modifications
afin de subvenir aux besoins du fœtus en développement. Plus particulièrement, le
métabolisme maternel des lipides, glucides et protéines est modifié, les tissus
maternels subissant une augmentation de la lipolyse [11 ], qui elle est associée
directement à une hyperlipidémie. Cette dernière se caractérise par une augmentation
plasmatique de cholestérol, triglycérides et apolipoprotéines [12]. Cette augmentation
plasmatique de triglycérides est particulièrement importante, car étant une grande
source d'énergie, ils deviennent indispensables dans le contexte où les besoins du
fœtus en énergie augmentent tout au long de la grossesse. L 'hypertriglycéridémie est
particulièrement nécessaire, car les besoins du fœtus en énergie augmentent de façon
exponentielle, surtout au troisième trimestre [13]. Également, les tissus maternels
subissent une glycogénolyse et une glycolyse, afm d'augmenter les taux plasmatiques
des métabolites lactate (musculaire) et glucose (hépatique), éléments essentiels pour
le fœtus [14]. En effet, le l~ctate est nécessaire à la synthèse du lait maternel et le
glucose se trouve à être la source d'énergie principale pour assurer les activités
métaboliques dans les tissus fœtaux et placentaires [ 14]. Les protéines accumulées
dans les tissus maternels, étant de grosses molécules, doivent être dégradées en acides
aminés afm de pouvoir être transférées au fœtus [15]. Ces derniers sont nécessaires à
la croissance du fœtus, ainsi qu'à la biosynthèse de protéines, nucléotides et
neurotransmetteurs [15]. Évidemment, le transfert de tous ces nutriments doit être
bien régulé, travail accompli chez 1 'humain par le placenta.
16
1.2 Le placenta humain
1.2.1 Physiologie du placenta
Le placenta est un organe qui se développe à partir des cellules embryonnaires
envahissant l'endomètre maternel. En effet, quelques jours après la fécondation, on
voit apparaître sur le trophectoderme du blastocyste une première couche cellulaire
externe, appelées cytotrophoblastes [16]. Les cellules trophoblastiques de l'embryon
vont se différencier en trophoblastes villeux (VT) et extravilleux (EVT). Ces derniers
acquièrent la capacité d'envahir la paroi utérine (décidua) de la mère [17]. Cette
invasion cause des modifications au niveau des artères utérines spiralées de la mère,
c'est-à-dire que leur diamètre s'élargit pour permettre un plus grand débit sanguin
dans cette région et moins de résistance des parois artérielles [18]. Cette importante
modification artérielle permet un échange plus efficace des gaz, nutriments, vitamines
et eau entre la mère et le fœtus. Ces étapes sont primordiales pour la fixation du
blastocyste et la formation du placenta hémochorial humain. Ensuite, les VT vont se
différencier, processus durant lequel les membranes cytotrophoblastiques fusionnent
entre elles pour former une seule cellule multinucléée, le syncytiotrophoblaste (STB)
[19]. Cette cellule, qui est la principale impliquée dans le transport placentaire et les
échanges mère-fœtus, recouvre la surface placentaire et fait en sorte que la circulation
sanguine maternelle n'est jamais en contact direct avec la circulation sanguine fœtale
[20].
1.2.2 Fonctions du placenta
Le placenta est l'organe qui est responsable du maintien de la grossesse, et ce, jusqu'à
l'accouchement, rôle qui est rendu possible grâce aux fonctions endocriniennes du
placenta [21 ]. Ce rôle est primordial pour initier et maintenir la grossesse, certes,
mais certaines hormones sont également nécessaires à la croissance et au
développement du fœtus [22]. En début de grossesse, le placenta nouvellement
17
développé sécrète l'hormone chorionique gonadotropique humaine (hCG). Cette
hormone a comme rôle de maintenir 1' endomètre gestationnel induisant la
prolifération et la différenciation cellulaire [23]. Elle stimule aussi la sécrétion de
1' œstrogène et la progestérone, des hormones stéroïdiennes qui ont comme effet de
moduler le métabolisme et le système immunitaire de la mère afin de combler les
besoins du fœtus et assurer une grossesse sans complications. Ces hormones
permettent aussi d'empêcher le déclenchement du travail durant les neuf mois de la
grossesse, en relaxant les cellules du myomètre [24].
Le placenta joue également le rôle de barrière entre la circulation sanguine maternelle
et fœtale, empêchant ainsi la transmission, de la mère au fœtus, d'un pathogène
potentiellement dangereux pour sa santé (bactéries, virus, mycètes et parasites) [25].
Cet effet de barrière est possible grâce au syncytiotrophoblaste [26]. En effet,
plusieurs facteurs déciduaux solubles peuvent contrôler l'infection au virus de
1' immunodéficience humaine (VIH) de la mère, tels que certaines interleukines,
chemokines et interférons [27]. De plus, le placenta possède des protections contre les
parasites, comme 1' expression à la surface membranaire d'antigènes spécifiques aux
érythrocytes placentaires parasités, qui empêchera la propagation du parasite jusqu'au
fœtus [28]. Les cellules placentaires possèdent aussi des récepteurs qui permettent de
déclencher la réponse immunitaire innée en cas d'inflammation causée par une
infection bactérienne contractée par la mère [29]. Également, les anticorps maternels
qui traversent la barrière placentaire jouent un grand rôle dans la protection du fœtus
contre une large gamme de bactéries infectieuses [30]. Finalement, certains peptides
comme LL-37 aussi appelé hCAP-18 (protéine cathélicidine humaine 18) ou la
défensine beta humaine 3 (HBD3) (tous deux dérivés de la protéine glycéraldéhyde 3-
phosphate déhydrogénase (GAPDH) fortement exprimée au niveau du placenta)
possèdent une activité antifongique efficace qui protège le fœtus [31 ]. Cet effet de
barrière petmet du même coup au placenta d'exercer son autre rôle, celui consistant à
gérer les échanges entre la mère et le fœtus [32].
18
1. 3 Les échanges matemo-fœtaux
Les échanges mère-fœtus se font via la barrière placentaire, le syncytium. Il est
reconnu que lors du transfert materno-fœtal, il y a un apport en nutriments (glucides,
protéines et lipides) [33]. Il y aura également un apport au fœtus en eau, en oxygène
et en vitamines, alors qu'il y a rejet de ses déchets métaboliques, retrouvés sous
forme d'urée et de dioxyde de carbone (C02) [34]. Durant la grossesse, les besoins du
fœtus vont varier, c'est pourquoi une constante régulation du transport des nutriments
doit avoir lieu.
Le glucose, représentant la source principale d'énergie pour le fœtus, est transféré par
diffusion facilitée de la mère au fœtus via les transporteurs de glucose GLUT -1 et
GLUT-3 [35]. Il fut démontré que GLUT 1 était présent à la face apicale et
basolatérale du STB, et qu'il était le principal transporteur impliqué dans le transfert
materno-fœtal du glucose [36]. Quant à GLUT3, il fut démontré comme étant
principalement exprimé dans les cellules vasculaires endothéliales [37]. GLUT4 est
aussi présent, mais seulement dans les fibroblastes de l'arnnion et du chorion,
suggérant que ce transporteur n'est pas ou peu impliqué dans le transfert materno
fœtal du glucose [38]. Il est à noter que les transporteurs sont quatre fois plus
exprimés du côté maternel que fœtal du STB, cette asymétrie suggérant que la
quantité de glucose transférée au fœtus est régulée de par son accumulation dans le
placenta [39]. Il faut noter que le placenta est également apte à synthétiser son propre
glucose par néoglucogénèse afin de subvenir à ses propres besoins en énergie [40], le
glucose maternel n'étant alors pas la seule source disponible pour le foetus.
Les acides aminés sont des produits résultant de la dégradation de protéines et
s'avèrent très importants pour le fœtus. Ils sont nécessaires pour sa croissance,
synthèse protéique et synthèse de produits biosynthétiques, comme les nucléotides et
I9
l'hème. Les acides aminés de la mère sont intégrés dans le placenta par transport actif
par des co-transporteurs d'aminoacides neutres couplés au sodium-I, 2 et 4 (SNATI,
SNAT2 et SNAT 4), les transporteurs d'aminoacides cationiques (CATI, CAT2.
CAT3, CAT4) et les co-transporteurs d'aminoacides neuronaux excitatoires (EAATI,
EAA T2 et EAA T3) [ 4I]. Ils sont transportés de la face basolatérale (fœtale) du
placenta au fœtus par transport facilité via une large gamme de transporteurs, dont les
principaux sont le transporteur d'aminoacides de type T-I (TATI) et les transporteurs
d'aminoacides de type L-3 et 4 (LAT3 et LAT4) [42].
Les lipides transférés de la mère au fœtus se retrouvent sous forme d'acides gras et de
cholestérol. Les acides gras sont essentiels pour combler les besoins fœtaux en acides
linoléique et a-linoléique et en acides gras polyinsaturés à longues chaînes, surtout
durant le développement du cerveau [43]. Ils sont transportés dans le placenta via les
transporteurs FAT/CD36, FATP4, H-FABP et L-FABP [44]. Le cholestérol est un
lipide particulièrement important, car il est grandement utilisé comme source
d • énergie en fin de grossesse, mais aussi pour le développement du fœtus, surtout de
son cerveau, la synthèse des membranes cellulaires et la synthèse hormonale [45].
Son transport via la barrière placentaire doit donc être bien régulé. Il se fait via
certains transporteurs ABC et des récepteurs spécifiques, soit les récepteurs de
lipoprotéines de très faible et faible densité (VLDLr) et LDLr) et le scavenger
receptor-BI (SR-BI) [46;47]. Également, il faut mentionner l'implication d'autres
protéines, soit les porteurs de stérols de la famille Niemann-Pick (NPC) [48] (voir
Figure 1 et Figure 2).
20
, MATERNAL protcm mcd1atcd pa IVC transpon diff s!On
~----~ ,---~
Figure 1: Figure tirée de Hanebutt et al. (2008) [49] . Modèle théorique du transfert des acides gras via le tissu placentaire. LP, lipoprotéine; LPL, lipoprotéine lipase; NEF A, acide gras non-estérifié; F ATP, protéine de transport des acides gras; FAT, translocase des acides gras; P-FABPpm, protéine de membrane plasmique placentaire liant les acides gras; L-F ABP, protéine liant les acides gras du foie ; H-FABP, protéine liant les acides gras du coeur; PPAR, récepteur activé par la prolifération des peroxisomes ; RXR, récepteur rétinoïde X.
21
Maternai circulation
nLDL oxLDL HDL
Trop/Job/ose
ECM
Endorhe/ial ce/1
Fetal circulation
Figure 2: Figure tirée de Leiva et al. (2013) [50) Transport du cholestérol maternel de la mère au fœtus. Dans la circulation maternelle (taux élevés de cholestérol plasmatique) le cholestérol (Ch) est principalement transporté dans les lipoprotéines de faible densité (LDL) (natives, nLDL et oxydées, oxLDL) et les lipoprotéines de haute densité (HDL) et lié aux trophoblastes via les récepteurs à LDL (LDL-r) et le récepteur scavenger de classe B type I (SR-BI). Le cholestérol voyage à la matrice extracellulaire (ECM) et est intégrée par les cellules endothéliales à l ' aide de mécanismes inconnus pour fmalement être intégré dans la circulation foetale par des transporteurs de cholestérol de type ATP binding cassette transporter sub-family A member 1 (ABCAl) et sub-family G member 1 (ABCGl), lesquels, ensemble, avec la protéine de transfert des phospholipides (PLPT) contribue à l' assemblage des lipoprotéines. Dans la circulation foetale (taux faibles de cholestérol plasmatique), le cholestérol est transporté par des accepteurs tels qu ' ApoAI et les HDL fœtaux (fHDL).
1. 4 Le transport des lipides
Les acides gras maternels, circulant sous forme d'acides gras libres (liés à l' albumine)
ou encapsulés dans des lipoprotéines, peuvent être transférés de la mère au fœtus de
deux façons, soit par diffusion simple ou via des protéines de transport [51]. Dans
22
l'organisme, le cholestérol est véhiculé par des lipoprotéines de très-faible, faible et
haute densité (VLDL, LDL et HDL) [52;53]. Étant liées à des apolipoprotéines
(Apos), la liaison de ces dernières avec SR-Bl, LDLr et VLDLr (VLDLr) et LDLr)
déclenchera l'endocytose du cholestérol [54;55]. Dans la barrière placentaire, le
cholestérol peut être utilisé par la cellule pour sa propre synthèse membranaire ou
encore pour la synthèse d'hormones [47]. Par contre, il peut, lorsqu'en excès dans la
cellule, être excrété vers la circulation maternelle ou bien fœtale via des pompes
membranaires à efflux de cholestérol, comme les transporteurs ABC [56].
Un facteur à prendre en compte ici est le sexe du nouveau-né. En effet, Brass et al.
(2013) ont démontré que chez l'humain, l'obésité maternelle affectait le transport des
acides gras, mais seulement chez les nouveau-nés mâles. Plus précisément, l'apport
d'acide oléique placentaire était plus faible chez les nouveau-nés mâles de mères
obèses comparativement à ceux de mères de poids normal [57]. Il est possible alors
que le sexe du nouveau-né soit un facteur qui influence également le transport du
cholestérol dans le placenta humain à terme en présence d'obésité maternelle.
1. 5 Les transporteurs A TP-binding cassette (ABC)
1.5.1 Les familles et membres des transporteurs ABC
Il existe de nombreux transporteurs ABC. Ceux-ci sont résumés dans le Tableau 1. Il
y a plusieurs sous-familles et chaque famille possède plusieurs membres. La famille
ABCA est impliquée majoritairement dans le transport des lipides, en particulier le
cholestérol, tout comme la famille ABCG, alors que les ABCB sont impliqués dans le
transport de plusieurs substances, à la fois endogènes et exogènes. ABCC est une
famille transportant surtout les ions, ABCD les acides gras, ABCE (un seul membre)
les agents antiviraux et anti-cancers. ABCF est moins connue, jouant possiblement un
rôle dans le transport des ARN viraux.
_3
1
Familles 1 Membres 1 Principales substances 1 Sites principaux ABC ABC excrétées d'expression B
ABCB B Bl
BS Placenta [ 3]
B 86
Fer [97]
[99]
BIO 811
24
2~
a o iati [150;151]
e ont le tran p rteur AB 1 [5 ;61]. B 1 [ 1; 2] B B4 [89;90]. B
[~8;141;142] _ [144;145] qui ont prim ' dan 1 pla enta humain t qui
tran port nt 1 ho!
1.5.2 Local isation placentaire des protéines ABC
Dan le placenta humain, il fut d ' montr · qu' B I B G2 nt primé à la
face apical du TB et e, crètent 1 ur ub trat r la irculation mat rn Ile
[1~4 ; 1-~].D plu , AB B4 t B 1 ont . prim ' àlafa baolat ' ral du TB
te uantà l , lalitt ' ratur
r t mitig ' quant à n. et al. (-0 10 ont démontr ' on
e pre ion api al 1) dan le TB [ 141 ], a lor que Bhatta harj 1 al.
2010 ont démontr ' on e pre ion apical t ba olat ' rale principal m nt dan le
TB a c un tr ' faibl pr ion dan le TB [1 7] . D 1 t
fur ntd ' montr ' omm ' tant 'prim ' àlafa api al d llule endoth ' lial du
plac nta humain ellule pr nt du ôt ' fi tai du T [14 ].
26
1.5.3 Fonction des protéines ABC dans le placenta humain
Les protéines ABCA 1 et ABCG 1 sont les principaux transporteurs de cholestérol
dans le placenta humain [141]. De plus, ABCA1 nécessite une liaison avec l'apo-A1
afin de pouvoir excréter le cholestérol hors de la cellule [ 158], action qui aura comme
effet de générer un HDL [159] qui, une fois mature, pourra véhiculer le cholestérol
vers le foie et les reins de la mère pour y être excrété hors de l'organisme [160].
ABCB4 est impliqué dans le transport du cholestérol au niveau du foie humain [ 161 ],
suggérant qu'il pourrait avoir le même rôle dans le placenta. ABCB1 étant
majoritairement impliqué dans l'efflux de xénobiotiques, son rôle secondaire dans
l'efflux du cholestérol a été suggéré dans des cellules d'insecte Sf9, où le gène
humain d'ABCB1 fut transfecté [81]. Il en va de même pour la protéine ABCG2
humaine, dont le rôle primaire vise l'efflux d'un large spectre de xénobiotiques, mais
à laquelle on suggère également une importance dans le transport des stérols [162].
1. 6 Régulation des transporteurs ABC
La régulation des transporteurs ABC est multifactorielle. Certains de leurs régulateurs
agissent au niveau transcriptionnel, alors que d'autres vont affecter leur expression
post-traductionnelle.
1.6.1 Les facteurs nucléaires PPAR
La famille des facteurs nucléaires Peroxysome-Proliferator-Activated-Receptor
(PPAR) est composée de trois membres, soit PP ARa, PPARP/8 et PPARy.
PPARa, quoiqu'étant faiblement exprimé dans les tissus adipeux comparativement
aux autres PP AR, est reconnu comme jouant un rôle fonctionnel dans le contrôle de la
réponse inflammatoire hépatique chronique induite par l'obésité [163;164]. Dans le
27
placenta de rat, PPARa régule le métabolisme lipidique [165], en régulant son
transport via la modulation de l'apo-A1, principal ligand des HDL. De plus, la
diminution de son expression est associée à une modulation du transport lipidique
chez la souris, amenant chez elles des complications majeures durant la grossesse
[166]. ABCG2 est reconnue comme étant régulée par PPARa dans les cellules
endothéliales des microvaisseaux du cerveau humain [167]. De plus, ABCA1 semble
également être régulé par PP ARa chez la souris, suggérant donc que ce régulateur est
grandement impliqué dans le transport du cholestérol [168].
PPARP, étant fortement exprimé dans les tissus adipeux de l'organisme est, de cette
famille de facteurs nucléaires, le moins compris au niveau de sa fonction. Il joue un
rôle dans les propriétés anti-inflamrnatoires des adipocytes et cellules endothéliales
du tissu adipeux [169;170]. Des études suggèrent également un rôle plus modéré dans
l'adipogenèse et un rôle indirect dans le contrôle de la masse adipeuse [171-173].
Dans le placenta, PP ARP est essentiel au succès de la grossesse, car nécessaire à
l'implantation, la décidualisation et la placentation [174]. La régulation des protéines
ABC par PPARP n'a toujours pas été démontrée. Cependant un article a démontré
que les PPAR en général régulent ABCA12 dans les kératinocytes humains [175].
PPARy est reconnu comme régulant la différenciation des adipocytes [176]. En
présence d'obésité induite par une diète riche en gras, il induit l'accumulation des
lipides dans ses adipocytes, causant alors leur hypertrophie, laquelle amène chez le
sujet une résistance à l'insuline [177]. Dans le placenta humain, PP AR y est
faiblement exprimé lorsque le nouveau-né est né prématurément, suggérant que son
expression est nécessaire pour une bonne régulation du métabolisme lipidique
placentaire [178]. De plus, tel que démontré chez le rat, lorsque la mère souffre de
diabète gestationnel, l'expression de PPARy diminue dans le placenta, amenant une
baisse de la synthèse lipidique. PP AR y semble donc être impliqué dans la régulation
métabolique des lipides placentaires [179]. Le transporteur de cholestérol ABCA1 et
28
ABCGI sont régulés par PPARy, démontrant leur implication majeure dans la
régulation du transport lipidique de la prostate [180] et des adipocytes [181]. ABCG2
serait aussi une protéine régulée par PP AR y dans le cellules dendritiques, montrant
l'implication de PPARy dans la régulation des protéines ABC et le transport du
cholestérol [182].
1.6.2 Les facteurs nucléaires LXR
La famille des facteurs nucléaires liver X receptor (LXR) est composée de deux
isoformes, soit LXRa et LXR~.
LXRa est reconnu comme un régulateur des PPAR. En effet, il interagit avec ceux-ci
et réprime leurs voies de signalisation dans les cellules des mammifères [183]. Il
régule donc de façon indirecte, via les PP AR, des protéines-cible des PP AR. Il régule
aussi de façon directe certaines protéines, car LXRa fut aussi démontré comme
régulant ABCA 1, un principal transporteur du cholestérol [ 184]. LXRa joue donc un
rôle majeur dans la régulation de l'efflux de cholestérol, comme démontré dans les
cellules mésangiales glomérulaires [ 185]. LXRa a aussi été démontré comme
régulant négativement l'expression d' ABCD2 dans le cadre d'une étude sur la
neurodégénérescence [186]. De plus, ce régulateur serait lui-même régulé par la
quantité d'acides gras présents dans l'organisme, lesquels diminuent grandement son
activité, tel que démontré dans les cellules HEK293 (cellules rénales embryonnaires
humaines) [187]. LXRa jouerait un rôle dans des pathologies reliées à la grossesse,
telles que la prééclampsie, où LXRa augmente drastiquement dans les tissus adipeux
de femmes en souffrant [188].
LXRP est également impliqué dans la régulation des stérols, tout comme l'isoforme
LXRa, tel qu'il fut démontré dans les macrophages [189]. Au niveau du placenta, il
29
est reconnu comme régulant l'invasion des trophoblastes chez l'humain. En effet,
celui-ci serait impliqué dans l'inhibition de leur invasion via les lipoprotéines de
faible-densité oxydées (oxLDL) [190]. Il serait donc impliqué dans l'invasion
cellulaire du placenta, en lien avec le transport lipidique.
Il ne faut pas oublier de mentionner que le facteur nucléaire LXR (isoforme non
précisé ou testé) régule ABCG 1 dans la lignée cellulaire MCF-7 provenant de cancers
du sein, jouant ainsi un rôle dans la prolifération et 1' apoptose cellulaire [ 191]. Ce fut
aussi démontré dans les macrophages humains [192].
1.6.3 Les protéines Calpaïne-1 et Calpaïne-2
Reconnues comme étant exprimées au niveau du placenta humain, les calpaïnes 1 et 2
sont les membres les plus exprimés de cette famille de protéines [193]. Elles régulent
ABCA1, au niveau post-traductionnel, de façon négative, c'est-à-dire qu'elles clivent
les transporteurs ABCA1, plus précisément ceux qui ne sont pas liés par une apo-A1,
liaison nécessaire à la conservation de 1' intégrité d' ABCA 1 [71]. Calpaïne-1 et
calpaïne-2 sont reconnues comme jouant les deux ce même rôle, à l'exception près
qu'elles diffèrent de par la sensibilité de leur activation. En effet, les calpaïnes sont
des protéines calcium-dépendantes, mais calpaïne-1 est sensible aux variations de
l'ordre du micromolaire (J.lM), alors que calpaïne-2 réagit plutôt aux variations de
concentrations de l'ordre du millimolaire (mM) [194]. Par contre, Prangsaengtong et
al. (2012) ont démontré que dans les macrophages, ces deux calpaïnes pouvaient
jouer un rôle non seulement différent, mais également opposé au niveau de leur effet
sur une protéine-cible [ 195]. Les calpaïnes régulent plus précisément ABCG 1 dans
les macrophages [ 196]. Il fut démontré que la régulation des transporteurs ABC de
chaque côté du STB se fait de façon indépendante l'une de l'autre [90], alors la
régulation par les calpaines d' ABCA1 (expression apicale ou basolatérale) et
30
d' ABCG 1 (expression basolatérale) pourrait se faire de façon indépendante l'une de
l'autre.
1.6.4 La protéine derlin-1
Bien que cette protéine n'ait jamais été démontrée comme exprimée au niveau du
placenta humain et que peu de renseignements soient connus quant aux voies de
signalisation impliquant derlin-1, il reste que cette protéine est nécessaire à la survie
de l'embryon, tel que démontré dans des souris KO pour la protéine derlin-1
suggérant que celle-ci possède une large gamme d'applications métaboliques au
niveau moléculaire [197]. Il faut également mentionner l'implication de derlin-1 dans
la régulation des protéines ABC, qui fut démontrée comme régulant négativement
l'expression du transporteur ABCG2 dans la lignée cellulaire HEK293 (cellule rénale
embryonnaire humaine) [198]. Derlin-1 est une protéine reconnue comme initiant la
voie de dégradation du réticulum endoplasmique [199]. Ce processus consiste en la
dégradation de protéines mal repliées, mécanisme pouvant être initié par derlin-1,
entre autres [200]. Concernant ABCG2, celle-ci est régulée par derlin-1 de deux
façons. Tout d'abord, derlin-1 initie la dégradation de la protéine ABCG2 non
glycosylée en 1 'ubiquitinant, ce qui initie la voie de dégradation des protéines
associées au réticulum endoplasmique (ERAD) [198]. Deuxièmement, elle empêche
la protéine ABCG2 mono-glycosylée de migrer jusqu'à l'appareil de Golgi et ainsi de
se faire multi-glycosyler, ce qui normalement la rendrait effective et donc apte à
migrer jusqu'à la membrane cellulaire et y effectuer son travail [198]. Dans ce cas,
cette action aura comme effet d'initier, encore une fois, la voie de dégradation du
réticulum endoplasmique (RE), qui est la voie de régulation nécessitant souvent
derlin-1 [20 1].
1. 7 Les transporteurs ABC et les pathologies influençant la grossesse
31
Plusieurs pathologies pouvant être présentes chez la mère durant la grossesse et
l'accouchement, sont susceptibles d'influencer le transport placentaire des nutriments
en altérant l'expression de certains transporteurs [202-204]. Certaines pathologies
induisent même des mutations chez certains de ses transporteurs de lipides [205;206],
mutations étant ainsi susceptibles d'affecter le placenta et de moduler le transfert,
entre autres, du cholestérol entre la mère et le fœtus.
1. 7.1 La pré-éclampsie
La pré-éclampsie est une pathologie spécifique à la grossesse qui se résume en une
mauvaise vascularisation placentaire (vasoconstriction) [207]. Ainsi, des problèmes
d'hypertension et de protéinurie surviennent à mi-chemin de la grossesse [208],
graves complications qui causent une dysfonction généralisée des organes maternels
(surtout le foie, les reins et le cerveau) pouvant mener à la mort des deux individus si
non traitée [209]. La seule solution possible consiste à provoquer l'accouchement afin
de sauver la mère. Les causes exactes de cette pathologie sont multifactorielles et des
recherches plus approfondies sur le sujet sont encore nécessaires à la compréhension
de la maladie et la recherche de traitements efficaces. Cependant, des recherches
offrent des pistes quant à la régulation de certains transporteurs ABC, tels
qu' ABCA 1, est surexprirné dans les placentas provenant de femmes pré
éclamptiques, ainsi que son régulateur LXRa [210]. Par la surexpression d'ABCA1
dans la pré-éclampsie, le placenta tente peut-être de compenser les effets néfastes de
la mauvaise vascularisation placentaire et donc compenser ainsi la diminution des
échanges entre la mère et le fœtus. ABCB 1 pourrait également être impliqué dans la
pré-éclampsie. En effet, une étude a démontré qu'un certain polymorphisme du gène
d'ABCB1 (MDRJ), avait tendance à prévaloir au sein de la population de femmes
souffrant de pré-éclampsie [211]. Ce polymorphisme, qui résulte en une protéine
ABCB 1 inefficace (soumettant ainsi le fœtus à une plus grande exposition à plusieurs
32
xénobiotiques), pourrait être une piste à envisager quant aux conséquences de la pré
éclampsie sur le développement du nouveau-né.
1.7.2 Le diabète gestationnel
Le diabète gestationnel ou diabète de grossesse (GDM) est une pathologie qui se
caractérise par de l'intolérance au glucose qui débute ou qui a été diagnostiqué pour
la première fois durant la grossesse, état pathologique dont le développement est
fortement du à l'obésité [212]. Le GDM est associé à une augmentation des risques
de complications durant la grossesse et l'accouchement, lesquels peuvent affecter la
santé de la mère et du fœtus/nouveau-né [213]. Dans notre laboratoire, cette
pathologie fut démontrée comme modulant certains transporteurs ABC, c'est-à-dire
ABCA 1 et ABCG 1, les principales protéines ABC transportant le cholestérol dans le
placenta. En effet, ABCA1 diminue dans les placentas de femmes atteintes de GDM
et souffrant de GDM et d'obésité. ABCG1 diminue seulement chez les femmes
souffrant de GDM et d'obésité. La modulation de l'expression de ses deux
transporteurs ABC semble être due à certains de leurs régulateurs connus, soit
PP ARa qui augmente et PPARy qui diminue en présence de GDM et d'obésité [55].
Toutefois, il fut également démontré qu'une fois le GDM traité à l'insuline, les effets
de cette pathologie au niveau de l'expression placentaire des transporteurs ABC
semblaient s'estomper et revenir à la normale [214]. Aussi, dans 1' intestin, il fut
démontré que chez un sujet diabétique, la protéine ABCB 1 était altérée, affectant
ainsi la métabolisation et la réexcrétion de plusieurs drogues et polluants
environnementaux [215]. L'expression d'ABCB1 pourrait donc être influencée dans
les placentas de femmes souffrant du diabète. Étant donné que le GDM est un facteur
étroitement lié à l'obésité, il est fort probable que l'expression de certaines protéines
ABC transportant le cholestérol soient affectées dans le placenta humain en présence
de cette pathologie.
33
1.7.3 L'hypercholestérolémie
L 'hypercholestérolémie, qui se caractérise par un taux surélevé de cholestérol
sanguin, est un important facteur de risque dans le développement de 1 'obésité et du
GDM. Les recherches sur les effets de l'hypercholestérolémie sur les transporteurs
ABC placentaires n'a toujours pas été faite. Par contre, il fut démontré que, chez les
patients souffrant d'hypercholestérolémie familiale, une baisse significative
d'ABCA1 et ABCG1 était observable au niveau du plasma sanguin [216], suggérant
que cet état pathologique (l'hypercholestérolémie) pourrait être une source de
complications lors de la grossesse et l'accouchement et même susceptible d'affecter
le développement fœtal. De plus, il fut démontré que dans l'intestin, ABCG5/G8
étaient nécessaires à la prévention de l'hypercholestérolémie, car impliqués dans
l'excrétion du cholestérol absorbé en excès.
1.7.4 L'obésité
L'obésité est un état pathologique où les lipides s'accumulent dans les tissus adipeux
de l'organisme. Il est déjà connu que l'obésité maternelle est à la base de plusieurs
complications métaboliques et cardiovasculaires chez le fœtus en développement
[217], telles que la résistance à l'insuline, l'hypertrophie myocardiale, les maladies
congénitales affectant le cœur et les maladies cardiovasculaires [218-221]. Les
recherches sur l'obésité maternelle n'ont toujours pas révélé les effets que pouvait
avoir cette pathologie sur 1' expression placentaire des transporteurs ABC chez
l'humain. Toutefois, chez la souris, le microARN miR-128-2 altère l'expression
d'ABCAl et ABCG1, responsables de l'effiux du cholestérol en excès et induisant
ainsi l'obésité chez le rongeur [222]. Il se pourrait donc qu'ABCA1 et ABCG1 se
retrouvent également modulés dans le placenta humain en présence d'obésité
maternelle et que cette modulation soit à la base, du moins en partie, de complications
au niveau du développement foetal.
34
1. 8 Hypothèses de travail
L'obésité maternelle affecte le transport placentaire du cholestérol, de la mère au
fœtus, via les protéines ABC impliquées dans le transport du cholestérol dans le
placenta humain, c'est-à-dire via la baisse d'expression de la protéine ABCA1
présente à la face maternelle (apicale) du STB et via l'augmentation de l'expression
de la protéine ABCG 1 présente à la face fœtale (basolatérale) du STB.
Leur modulation est due à une variation de l'expression de leurs régulateurs post
traductionnels calpaïne-1 et calpaïne-2, reconnus comme régulant ABCA1 dans le
placenta humain et ABCG 1 chez les macrophages, tout cela en absence de 1' influence
du sexe du nouveau-né.
1. 9 Objectifs de recherche
L'objectif principal de ce projet consiste d'abord à caractériser l'expression de 5
protéines ABC dans le placenta humain à terme, en fonction de l'IMC maternel. Les
protéines sélectionnées sont ABCA 1, B 1, B4, G 1 et G2, car elles sont toutes
exprimées au niveau du placenta humain et toutes impliquées dans le transport du
cholestérol, donc hautement susceptibles d'être modulées par l'obésité maternelle.
Plus précisément, les objectifs sont de :
1) extraire les lipides placentaires et quantifier le taux de cholestérol placentaire
total, ainsi que de ses formes, soit le cholestérol libre et le cholestérol
estérifié, à l'aide d'une trousse commerciale.
2) quantifier l'expression de l' ARNm et des protéines des transporteurs ABC.
3) quantifier 1' expression de 1' ARN rn et des protéines de régulant les
transporteurs ABC, soit calpaïne-1, calpaïne-2 et derlin-1.
CHAPITRE Il : L'article scientifique
Dans ce chapitre, 1' article est présenté tel que soumis à la revue scientifique
BIOLOGY OF REPRODUCTION.
35
36
2.1 Résumé
L'obésité, caractérisée par un indice de masse corporelle (IMC) supérieure à 30
kg/m2, est un problème de santé majeur qui affecte plus de 30% des femmes en âge
de procréer. L'obésité maternelle peut causer des problèmes de santé pouvant affecter
sa santé jusqu'au stade adulte. Une altération du transfert placentaire des nutriments,
spécialement du cholestérol, de la mère au fœtus durant la grossesse pourrait être en
partie responsable de la programmation fœtale de ces problèmes de santé. Des
femmes de poids normal (18.5 kg/m2 < IMC < 24.9 kg/m2) et obèses (IMC > 30
kg/m2) ont été recrutées avant leur 1 oème semaine de grossesse. Les placentas furent
recueillis à l'accouchement et congelés à -80°C. Les tissus ont été utilisés pour
quantifier les taux de cholestérol total, libre et estérifiés, ainsi que pour 1' évaluation
de l'expression des transporteurs ABC, des calpaïnes 1 et 2 (CAPN1 et CAPN2
respectivement) et derlin-1 (DERL1) par RT-PCR et immunobuvardage de type
Western. Le poids du placenta et l'index pondéral (poids du bébé/taille du bébé) du
nouveau-né augmentent lorsque la mère est affectée par l'obésité durant sa grossesse,
comparativement aux nouveau-nés de femmes de poids normal, alors que 1' index
placentaire (poids du bébé/ poids du placenta) diminue. Aucune différence n'est
observée entre les deux groupes pour les niveaux de cholestérol placentaire total,
alors que le ratio de cholestérol libre/estérifié est modifié au profit de la forme
estérifiée par une obésité maternelle. L'expression placentaire des protéines ABCA1,
ABCG2 et CAPN2 diminuent chez les obèses comparativement aux poids normaux,
alors qu'ABCB4, CAPN1 et DERL1 augmentent. Aucune différence est observée
pour l'expression de tous les ARNm et pour les protéines ABCB1 et ABCGl. En
conclusion, nos résultats suggèrent que l'expression des protéines impliquées dans le
transfert du cholestérol placentaire entre la mère et le fœtus est affectée par l'obésité
maternelle.
37
2.2 Contributions de l'étudiant à l'article
Ce gu 'il a fait
» Extraction des lipides totaux à partir de tissus placentaires (mise au point du protocole)
» Dosage du cholestérol total, libre et estérifié » Extraction de 1' ARN total de tissu placentaire » RT-PCR en temps réel (et mise au point) » Extraction des protéines de tissu placentaire » Immunobuvardage de type Western (et mise au point) » Analyse des résultats » Rédaction de 1' article scientifique en collaboration avec les co-auteurs
Ce gu 'il n'a pas fait
#- Recrutement des mères avant leur 1 oème semaine de grossesse pour former la cohorte de placentas
#- Compilation des données des questionnaires socio-médicaux #- Prises. de sang chez la mère et dans la veine du cordon ombilical #- Dosage des lipides dans le plasma sanguin #- Collecte et disposition des placentas #- Compilation des données des dosages lipidiques plasmatiques
38
2. 3 Front page
THE EXPRESSION OF ABC PRO TEINS IS MODULA TED BY MATERNAL
OBESITY IN THE HUMAN FULL-TERM PLACENTA1
Guillaume Desparois3•4
•5·, Evemie Dubé3
•5·, Philippe St -Onge3
•5
, Cathy V aillancourt4•5
and Julie Lafond2•3
•5
3Département des Sciences Biologiques de l'Université du Québec à Montréal (UQÀM), 4lnstitut National de la Recherche Scientifique- (INRS) Institut ArmandFrappier, 5Centre de Recherche BioMed.
*The authors contributed equally to the work.
Running title: Obesity affects ABC proteins in the human placenta.
Surnmary sentence: Maternai obesity affects the maternal-fetal cholesterol transport in the human full-term placenta by modulating the expression of ABC transportees.
Key words: Obesity, placenta, cholesterol, fetus, ABC transportees, Calpains, Derlin-
1
1Grant support: This work was supported by a NSERC research grant to JL. ED is the recipient of a post-doctoral scholarship from the FRQ-S.
2T o whom correspondence should be addressed: Julie Lafond PhD
Laboratoire de Physiologie MaternoFœtale Centre de Recherche BioMed Université du Québec à Montréal C.P. 8888, Succursale Centre-ville Montréal, Canada, H3C 3P8 Fax: (514) 987 4647 Email: lafond.julie@uqam.ca
39
2.4 Abstract
Obesity, characterized as a body mass index (BMI) greater than 30 kg/m2, is an
important health problem affecting more than 30% of women of childbearing age.
Maternai obesity can cause complications during pregnancy, at delivery and later in
life for the offspring. Altered placenta} nutrient transfer, especially of cholesterol,
from the mother to the fetus during pregnancy could be partly responsible for the fetal
prograrnming of these health problems in the offspring, like altered neural tube
development or cardiac diseases. Normal weight (18.5 <BMI< 24.9 kg/m2) and obese
(BM1>30 kg/m2) women were recruited before their lOth week of pregnancy. Full
term placentas were collected, processed and frozen at -80°C. Tissues were used to
quantify total, free and esterified cholesterol levels and evaluate the expression of
ABC transporters, calpains 1 and 2 (CAPNI and CAPN2 respectively) and derlin-1
(DERLI) by real-time RT-PCR and Western blot. The placenta} weight and the
neonatal ponderal index (newbom's weight/newbom's height) were higher in obese
compared to normal weight pregnancies whereas the placental index (newbom's
weight/placental weight) was lower. No difference was observed between both
groups in placental total cholesterol levels, whereas the ratio of free/esterified
cholesterol was modified (esterified cholesterol is higher and free cholesterol lower)
by obesity. Interestingly, the placenta} protein expression of ABCAI, ABCG2 and
CAPN2 was lower in obese compared to normal weight pregnancies whereas the
protein expression of ABCB4, CAPNI and DERLI was higher. No difference was
40
observed for the expression of ali mRNAs and for the prote in expression of ABCB 1
and ABCG 1. Overall our results suggest that the expression of pro teins responsible of
placenta} cholesterol transfer between the maternai and fetal circulations is affected
by maternai obesity.
41
2. 5 Introduction
Obesity is recognized as a continually growing health problem in North-America [1].
Characterized as a lipid accumulation in adipose tissu~s, it can cause many
complications for pregnant women. For example, obesity has been directly associated
with an increased risk of post-partum haemorrhages, gestational diabetes mellitus,
infectious morbidity and stillbirth [2-5]. Maternai obesity constitutes also a risk factor
for fetal malformations affecting the neural tube, cardiac anomalies and macrosomia
which will ali affect the newbom's health during his entire life [6,7]. Furthermore,
maternai obesity can cause complications during delivery such as operative vaginal or
caesarean delivery [6,8,9]. Thus it is critical to understand how obesity impacts
pregnancy to lirnit the consequences on the health of the mother and fetus.
The placenta is a major organ involved in fetal development and, therefore, it is more
susceptible to be affected by obesity [1 0]. As the only semi-permeable barrier
between maternai and fetal blood circulation, it protects the fetus from infections
contracted by the mother (microbes, viruses, parasites and fungi) [11]. This organ is
also responsible for eliminating fetal wastes (urea and C02) [12,13] and possesses an
endocrine role by secreting essential hormones for fetal development and for maternai
adaptation [ 14]. lt is also essential for the transfer of nutrients (glucids, lipids,
proteins and vitamins), water and oxygen, through the placenta} barrier, from the
maternai to the fetal blood circulation [15].
42
Cholesterol is a nutrient which is particularly important for fetal development,
especially for the development of the brain [ 16]. In the cell, it is used as a steroid
hormone precursor and is an essential component of cell membranes [17]. Even if the
fetus is capable of de novo synthesis, fetal cholesterol mainly originates from the
maternai circulation [ 18]. Since a lack or an excess of maternai cholesterol could
impair fetal development, the cholesterol transfer from the mat~rnal to the fetal
circulation needs to be well-regulated and the cholesterol influx and efflux in the
placenta must be in balance [19]. The cholesterol is first driven in the maternai blood
by low, very low and high density lipoproteins (LDL, VLDL and HDL), which are
composed of apolipoproteins. Apolipoproteins (Apo) are able to recognize specifie
cell receptors, such as the scavenger-receptor-Bl (SR-BI), the low density
lipoprotein receptor (LDLr) and the very low density lipoprotein receptor (VLDLr)
[20]. Once these lipoproteins are fixed to their receptors, the cholesterol is endocyted
by the cell and can be used for placenta} functions. If cholesterol is present in excess
in the cell, it will be expulsed by effiux pumps in the blood circulation where it will
be bound to APO-Al to generate HDLs and drive the cholesterol in excess to the
maternai li ver or to the maternai kidneys for excretion [21]. Our laboratory has
demonstrated that the expression of placenta! proteins involved in lipid homeostasis is
affected by maternai metabolical problems, such as hypercholesterolemia and
gestational diabetes mellitus [22], suggesting that maternal-fetal cholesterol transport
could be affected.
43
In the placenta, different efflux pumps localized on the apical or basolateral
membrane of the syncytiotrophoblast allow excess cholesterol to be expulsed toward
the maternai or fetal blood circulation [23]. One of the most important families of
effiux pumps is the family of A TP-binding cassette (ABC) transporters. Their role
consists in extracting toxic products, xenobiotics, drugs, or endogenous products,
such as excess cholesterol, out of cells [24]. Several ABC transporters are expressed
in the human full-term placenta including ABCA1, ABCB1, ABCB4, ABCG1 and
ABCG2. ABCB1 and ABCG2 are present on the apical side (maternai face) of the
syncytiotrophoblast [25, 26]. ABCB4 and ABCG 1 are located on the basolateral side
(fetal face) of the syncytiotrophoblast [27]. The localization of ABCA1 in the
syncytiotrophoblast is still unclear. Aye et al. demonstrated that ABCA1 was
expressed primarily on the apical membrane of the syncytiotrophoblast [28] whereas
Bhattacharjee et al. showed that it was expressed almost in cytotrophoblasts with a
low detection in both sides ofthe syncytiotrophoblast [29]. In addition, ABCA1 and
ABCG 1 have been shown to be expressed on the apical membrane of endothelial
cells present on the fetal si de of the syncytium, excreting cholesterol toward the fetal
blood circulation [30]. In human trophoblasts, ABCA1 and ABCG1 have been shown
to be involved in cholesterol effiux [28]. ABCB 1 is also known to be implicated in
the cholesterol cell effiux in intestines of ABCB 1-deficient mice [31] and in Sf9
insect cells transfected with human ABCB1 (also known as MDR1) gene [32].
Moreover, ABCB4 was demonstrated to be mainly implicated in cholesterol secretion
44
in human liver cells [33]. ABCG2 was suggested to play a secondary role in sterol
transport in human gastric EPG85-257 carcinoma cell line overexpressing ABCG2
[34] in addition toits role in many xenobiotics efflux [35]. lt was demonstrated that it
can transport other lipids, such as sphingolipids [36].
The expression and function of ABC transporters are regulated by numerous
transcriptional and post-transcriptional mechanisms. In human cytotrophoblasts,
ABCA 1 and ABCG 1 transcription is mainly regulated by nuclear factors LXR (Li ver
X Receptor) [28]. In human embryonic kidney (HEK) cells, DERL1 negatively
regulates the expression of ABCG2 protein (the glycosylated and non-glycosylated
forms) by stopping its maturation and promoting its degradation via the Endoplasmic
Reticulum Associated Degradation (ERAD) pathway [37]. Calpains are also known
to be post-translational negative regulators of ABCA1 [38] and ABCG 1 [39] in
human macrophages. In humans, the calpains that are predorninantly and ubiquitously
expressed are CAPN1 and CAPN2 [40]. Both calpains are activated by calcium but
the ir sensibility to this element varies. Indeed, CAPN 1 needs concentrations in the
order of J.Ull, while CAPN2 needs concentrations in the order of mM [ 40]. Therefore,
an increasing levet of Ca2+ in blood could affect the activity or expression of cal pains.
Interestingly, obesity constitutes a risk factor for osteoporosis: an increase in BMI
and a lack ofphysical activity decreases bone mineral density [41]. In the hurnan full
term placenta, it has been demonstrated that both CAPN1 and 2 are expressed [42].
The direct role of cal pains as regulators of ABCA 1 was also demonstrated in the
45
human full-term placenta. In fact, cal pains are known to degrade ABCA 1 pro teins
that are not bound to APO-Al [38]. lndeed, the binding of ABCAl proteins to apo
Al is required to maintain ABCAl protein integrity and generate HDLs for
cholesterol transport [24]. Interestingly, a study has demonstrated that obesity and
sedentary lifestyle induce an increase in the expression of both calpains in rats [ 43].
Thus, we propose that maternai obesity could impact the transfer of cholesterol from
the maternai to the fetal blood circulation by modulating the expression of ABC
proteins, through the action of DERLl, CAPNl and CAPN2 in the human full-term
placenta.
2. 6 Materials and Methods
Subjects
46
Mothers were recruited between 2002 and 2006 at their first prenatal visit before their
1 Oth week of pregnancy at the Clinique Fidès (Montréal, QC, Canada) and at the
Centre Hospitalier de l'Université de Montréal (CHUM)-Hôpital Saint-Luc
(Montréal, QC, Canada). Each · mother signed an informed consent form and
completed an interview-administrated questionnaire on their socio-demographic
characteristics including their age, medical history, smoking and drinking habits,
weight and height. Only Caucasian healthy mothers (except for obesity) who
delivered their newborn vaginally were included in this study. Mothers with other
pathologies, such as gestational diabetes mellitus, or newborns suffering of
malformations, macrosomia and cardiac problems, or other delivery modes
(caesarean, medicated) were excluded. Finally, data on the babies' weight, height and
head circumference was taken at delivery. The study was approved by the Université
du Québec à Montréal (UQÀM) and the CHUM ethic committees for research on
human subjects. Women were classified into two groups based on their pre
pregnancy BMI: women with a BMI between 18.5 and 24.9 kg/m2 were considered as
normal weight women (n=22) and women with a BMI > 30 kg/m2 were considered
obese (n=11) according to the World Health Organization criteria [44].
47
Tissue samples
Placentas were immediately immersed in DMEM (Dulbecco modified Eagle
Medium; Sigma, Oakville, ON, Canada) supplemented with antibiotics (0.12 mg/ml
penicillin, 5 Jlg/ml amphotericin, 50 Jlg/ml gentamycin) (Invitrogen, Burlington, ON,
Canada) and NaHC03 (90 mg/ml) and processed within 1 h of delivery as previously
described [45]. The amnion, chorion and decidua layers were removed. Then, the
villous tissue was sampled in equal small pieces, frozen in liquid nitrogen and kept at
-80°C for further experiments.
Cholesterol Quantification
Placenta! tissue (100-140 mg) was homogenized with 2 ml of chloroform-methanol
(2: 1) using the Polytron PT 3000 (Brinkman, Canada). 400 Jll of 1 mM CaCh was
added and the homogenate was centrifuged for 1 0 minutes at 21 000 g. The bottom
layer was recovered and evaporated with gaseous nitrogen. The resulting dried
fraction was dissolved in 200 Jll of isopropanol containing 10% Triton X-100. Total
and free cholesterol (respectively TC and FC) were quantified using the
Cholesterol/Cholesteryl Ester Quantitation kit according to the manufacturer's
instructions (BioVision Incorporated, Milpitas, CA, USA). The quantity of
cholesteryl esters (CE) was determined with the following formula: CE = TC - FC.
Results were normalized with the quantity of tissue used. This protocol was adapted
48
from Folch et al, 1957; Hara and Radin, 1978 and Marseille-Tremblay et al, 2008
[22,46,4 7].
Real-time RT -PCR
Total RNA was extracted from placenta} tissue using the High Pure RNA Tissue Kit
(Roche Diagnostics, Laval, QC, Canada) according to the manufacturer's
instructions. 500 ng of total RNA was reverse transcribed with the MML V· Reverse
Transcriptase (Sigma-Aldrich, Oakville, ON, Canada) and Oligo-dT primers (Roche
Diagnostics, Laval, QC, Canada). eDNA was then submitted to real-time PCR
reactions using the Light Cycler 480 Instrument (Roche Diagnostics), 0.5 f.!M of
specifie primers and the 480 SYBR Green 1 Master (Roche Diagnostics). Primers
were either previously published or designed using PrimerBlast (Table 2.1 ). The
standard curve technique was used to evaluate the expression of genes. Melting
curves were included in each run as weil as negative controls. Each sample was done
in duplicate. Genes of interest were normalized on the geometrie mean of three
reference genes (HPRT1, PPIA and TOP-1), as described by Lanoix et al. [48].
Melting curves were included in each run as weil as negative controls (no template).
Each sample was done in duplicate.
49
Western blot
Placental tissue (700 mg) was homogenized with the Polytron PT 3000 (Brinkman,
Canada) in a hypertonie buffer (125 mM Tris-HCl, 2 mM CaCl2, 1.4% (v/v) Triton
X-100, pH 8.0) supplemented with the Complete-Mini EDTA-free anti-protease mix
(Roche Diagnostics). Homogenates were then centrifuged at 1 0 000 g during 25
minutes at 4°C. The supematants were recovered and frozen at -80°C until further
use. Protein concentrations were determined with the BCA protein assay kit (Pierce
Biotechnology Rockford, CA, USA). 50 ug of proteins were diluted in sample buffer
(0.3 M Tris pH 6.8-12% SDS- 50% glycerol- 0.4% bromophenol blue) and heated
at 95°C during 5 minutes. Proteins were then separated on a SOS-PAGE gel (6 to
15%) and electroblotted to a PVDF membrane (Millipore, Cambridge, ON, Canada).
PVDF membranes were blocked for 90 minutes at room temperature with 5%
skimmed-milk diluted in Tris-Buffered-Saline-Tween (TBS-T; 20mM Tris Base, pH
7.6, 137mM NaCl, 0.10% Tween-20). Membranes were incubated ovemight at 4°C
with primary antibodies diluted in the blocking buffer. The primary antibodies used
were a mouse monoclonal anti-ABCA1 (1 :1000, Santa Cruz Biotechnology, CA,
USA), a rab bit polyclonal anti-ABCB 1 ( 1:1000, LifeSpan BioSciences, W A, USA), a
rabbit polyclonal anti-ABCB4 (1 :500, LifeSpan BioSciences), a goat polyclonal anti
ABCG1 (1:1000, Santa Cruz Biotechnology), a rabbit polyclonal anti-ABCG2
( 1: 1000, LifeSpan Bio Sciences), a rab bit polyclonal anti-CAPN 1 ( 1: 1000, Bio Vision,
CA, USA), a rabbit polyclonal anti-CAPN2 (1:1000, BioViosion) and a rabbit
50
polyclonal anti-DERL1 (1:1000 OriGene). Membranes were washed 3 times in TBS
T 0.1% for 5 minutes, except for CAPN1, which was washed with TBS-T 0.2%.
Blots were incubated with appropriate horseradish peroxidase-conjugated secondary
antibodies (1 :5000-1:10000, Cell Signaling, ON, Canada) for 90 minutes at room
temperature. Luminata Forte Western HRP Substrate (Millipore, MA, USA) was used
and bands were visualized with autoradiographie films (Hyperfilm ECL, GE
Healthcare, Baie d'Urfée, QC, Canada). Amidoblack staining (10% methanol, 0.1%
Naphtol-blue, 2% acetic acid) was used for normalization [49]. Quantification was
performed with the Quantity One software (Bio-Rad Laboratories, Mississauga, ON,
Canada).
Statistical analyses
Results were expressed as mean ± standard error mean (SEM). Statistical analyses
were performed with the PRISM 5.01 software (GraphPad Software, La JoUa, CA,
USA) and consisted of the unpaired Student's t test or the two-way ANOVA analysis
followed by the Bonferroni post-test. Significance was set at P < 0.05.
51
2.7 Resu/ts
Effect of maternai obesity on maternai, neonatal and placental characteristics
The group of recruited mothers, which were divided by their BMI (P < 0.00001)
showed significant differences in several parameters (Table 2.2). The ponderal index
were higher in the obese group compared to controls (P < 0.0001), but no significant
changes were observed for weight gain, maternai or gestational age. Placenta! weight
and placenta! ratio showed significant differences between the two groups
(respectively P = 0.0012 and P = 0.0360). Newborn data showed no significant
differences for the height, weight or head circumference whereas the ponderal index
(P = 0.0337) were higher in obese mother's newborns compared to controls. No
differences were observed according to the newborn's sex, except for the placenta!
weight, which were higher only in male newborns in presence of maternai obesity (P
< 0.05, data not shown).
Effect of maternai obesity on levels of cholesterol in human full-term placentas
TC, FC and CE levels were quantified in full-term placenta! tissues from normal
weight (n = 22) and obese (n = 11) women. No significant differences were observed
for TC levels (Fig.2.1A) between the two groups, whereas FC levels (Fig.2.1B, P =
0.0490) were lower and EC levels (Fig 2.1 C, P = 0.0322) were higher in obese
compared to control pregnancies. No differences were observed according to the
newborn's sex (data not shown).
52
Effect of maternai obesity on the expression of ABC transporters mRNA and
protein in human full-term placentas
The expression of ABC transporters was evaluated in full-term placentas from normal
weight (n = 22) and obese (n = 11) women. Real-time RT-PCR analyses showed no
significant differences for ali tested ABC genes (Fig.2.2A-E) between the normal
weight and obese groups. The Western blot analyses revealed that ABCAl (P =
0.0018) and ABCG2 (P = 0.0410) (Fig.2.2F-G) expression levels were lower in obese
women's full-term placentas compared with the control group, while ABCB4 protein
level were higher (P = 0.0377). No differences were noted for the other ABC
transporters (Fig.2.2H-J). Additional analyses revealed that, in presence of obesity,
placenta} ABCA 1 prote in expression level varied according to the new born' s sex,
with a significant decrease in females (P < 0.05) (Fig.2.3). No differences in the
mRNA and protein expression were observed for the other ABC transporters
according to the newborn's sex (data not shown).
Effect of maternai obesity on the expression of post-translational regulators
mRNA and protein in human fuU-term placentas
The expression of CAPN 1, CAPN2 and DERL 1 was evaluated in full-term placental
tissues from normal weight (n = 22) and obese (n = 11) women. Real-time RT-PCR
analyses showed no significant differences for CAPN1, CAPN2 and DERL1 in full
term placentas of normal weight and obese women (Fig.2.4A-C). In contrast, Western
53
blot analyses (Fig.2.4D-F), showed that the protein expres~ion of CAPNI and
DERL1 was higher significantly in the obese group compared to normal weight
(respectively P = 0.0096 and P = 0.0199), while the expression of CAPN2 was lower
in the obese group compared to controls (P = 0.0246). Additional analyses revealed
that placenta} CAPN 1 prote in expression varied according to the newbom' s sex, with
a significant decrease in placentas with female newboms (P < 0.01) (Fig.2.5).
CAPN2 and DERL 1 mRNA and protein expression did not differ according to the
newbom's sex (data not shown).
54
2. 8 Discussion
With the worldwide pandemie of obesity, it is important to clearly understand the
impact of maternai obesity on fetal growth and development, especially on the major
transporters involved in the placental transfer of nutrients from the maternai to the
fetal circulation. Placenta! efficiency is affected by maternai obesity during
pregnancy suggesting alterations in the trans fer of nutrients between the maternai and
fetal circulations [19]. This could explain the increase in the neonatal ponderal index.
In addition, our laboratory [ 45] has demonstrated a plasmatic cholesterol modulation
in the maternai and neonatal circulations by maternai obesity (a decrease in mothers
at the 3rd trimester and an increase in newborns). We also observed a higher level of
LDL in the neonatal blood that could be due to a greater transfer of placental CE to
the fetus. Indeed, in obese pregnancies, the placenta! FC/CE cholesterol ratio is
modified, with a higher level of CE and a lower level of FC. lt is known that CE are
present mainly in transport vesicles like LDLs and that CE can be transferred from
HDL to LDL in blood circulation [50]. Placental cholesterol excreted by ABCAI and
ABCG 1 from endothelial cells to the fetal circulation possibly generates HDLs, and,
because of maternai obesity, the excreted placental cholesterol (now enriched in CE)
is transferred to LDLs. Thus placental cholesterol could be directly transferred to the
fetus (instead of being accumulated in the placenta) via the modulation of ABC
proteins. The maternai cholesterol is not the only source for fetal needs that should be
taken in consideration [51 ,52]. In this case, it is possible that the human placenta, to
55
compensate for the excess of lipids, diminishes its own cholesterol synthesis, as it
was demonstrated for hypercholesterolemia during pregnancies [22].
The regulation of ABC proteins expression is critical for fetuses' protection [53]. Our
study clearly demonstrates that maternai obesity affects the expression of key players
of transplacental transport of cholesterol. Thus maternai obesity has a major impact
on fetal exposition to exogen and endogen products. On the maternai side of the
syncytium, ABCG2 is highly expressed [53], being the main transporter, with
ABCB 1, implicated in the fetal protection against environmental pollutants and drugs
[54]. In addition, ABCG2 hasan emerging role in cholesterol transport [34]. Thus its
modified placenta! expression in obese pregnancies could expose the fetus to
environmental pollutants and an excess of cholesterol. lt could also allow teratogen
molecules, such as glyburide, to cross the placenta} barrier and travel to the fetus.
lndeed, glyburide, which is used for the treatment of women with gestational diabetes
mellitus, is normally effiuxed from the placenta toward the maternai circulation by
ABCG2 [23]. lt was also demonstrated that ABCG2 protects the cell from tumor
necrosis factor (TNF)-induced apoptosis [55]. Thus maternai obesity could lead to an
increase of apoptosis in the placenta, leading to pregnancy or fetal development
complications. Interestingly, ABCG2 and ABCBI role in xenobiotics' effiux is
mostly important during the frrst trimester of pregnancy [54]. Thus, the role of
ABCG2 and ABCBl likely varies during pregnancy, switching from protection
against chemicals to metabolism, to respond to the growing fetal needs in energy
56
rather than in the protection against xenobiotics [56]. On the other band, the
expression of ABCB 1 is not affected by maternai obesity in the human full-term
placenta, suggesting that maternai obesity does not increase fetal exposure to ABCB 1
substrates [55]. However, ABCB 1 expression could be modulated by obesity in first
or second trimester. Even if its expression is not altered at term, ABCB 1
polymorphisms, such as the 26770 ~ Aff polymorphism of ABCB 1 associated with
the prevalence of obesity [57], could however influence fetal exposure to drugs and
xenobiotics [58].
In vitro studies in trophoblasts confirmed that ABCA 1 and ABCG 1 efflux cholesterol
in the human full-term placenta [28]. However, it is unclear if ABCA 1 efflux
cholesterol toward the maternai or fetal circulation. Indeed, studies from two research
groups reported divergent localizations. Aye et al. observed ABCA1 on the apical
side of the syncytiotrophoblast [28], whereas Bhattacharjee et al. showed that this
transporter was expressed mainly in cytotrophoblasts [29], thus suggesting that
maternai obesity could contribute to an accumulation of cholesterol in
syncytiotrophoblasts or cytotrophoblasts via the modulation of ABCA 1 expression.
Surprisingly, the expression of ABCG1, a major transporter of placenta! cholesterol
[30], is not altered in obese pregnancies suggesting that ABCG 1 is not involved in the
modulation of placenta} cholesterol homeostasis by maternai obesity. An increase in
ABCB4 expression level was however observed in obese pregnancies. The function
of ABCB4 in the placenta is unknown. lts overexpression in fibroblasts promotes the
57
translocation of phosphatidylcholine through the fetal blood circulation [59], a major
component of syncytiotrophoblast microvesicles [60]. lt has been shown that
injection to pregnant mice of artificial phosphatidylcholine-containing vesicles induce
preeclampsia-like changes in the placenta and reduce birth weight, suggesting a
possible role of these pro-inflammatory microvesicles in pregnancy complications
[61]. Thus an increase in ABCB4 could possibly affect the lipid composition ofthese
microvesicles and induce inflammatory responses in the placenta and in the fetus as it
has been described in the intestine of fetuses of obese mothers [62].
The changes in the expression of ABC transporters could be due to a multifactorial
regulation involving cytokines, steroids, growth factors, RACK1 (Receptor for
Activated C-Kinase 1), KGF2 (Keratinocyte Growth Factor 2), calpains and DERL1
[27, 37, 38, 63, 64] (Fig.2.6). Both calpains, expressed in the human placenta [42],
are known to play similar roles in the organism [ 40], such as the regulation of the
ABC transporters ABCA1 and ABCG1 [38,39]. In the human full-term placenta, •
maternai obesity affects differently CAPN1 and CAPN2 expression, suggesting
different roles for these proteins in obese pregnancies as in macrophages [65]. lt is
also possible that a compensation mechanism exists between CAPN1 and CAPN2 to
decrease the effect of maternai obesity on the placental expression of ABCA 1 or
ABCG 1, which could parti y exp lain the unchanged expression of ABCG 1. seems to
be in placentas with female newborns only. Another study also demonstrated that the
gene expression of the fatty ac id transporter CD36 and the fatty ac id binding protein
58
FABP5 was differently modulated by maternai obesity according to the newborn's
sex [66]. This difference in the expression of cholesterol transporters according to the
newborn's sex could be due to the fact that male fetuses grow faster from the
implantation and during all the first trimester [67]. This could mean that male
newborns have a greater dependence on maternai diet, making them more susceptible
to suffer from the impact of metabolic disorders on maternai diet [68]. DERL 1 is
another potential protein that may regulate ABC transporters in the human full-term
placenta. In HEK cells, overexpression of DERL 1 inhibits the expression of
glycosylated and unglycosylated forms of ABCG2 and indirectly the glycosylation of
ABCG2 which is necessary for its transport to the plasma membrane [37]. Thus
overexpression of DERL 1 in the human full-term placenta of obese pregnancies could
be responsible for the decrease of the expression of ABCG2 and could also affect the
localization of ABC transporters to the apical or basolateral membrane of the
syncytiotrophoblast.
Overall our study support that maternai obesity could affect the transplacental
transport of cholesterol between the maternai and fetal circulation by modulating the
expression of various ABC transporters and possibly their localization to the plasma
membrane of trophoblasts. Our studies demonstrated the effect of obesity on the
placenta} efficiency. Maternai obesity could promote the matemal-fetal cholesterol
transfer via the decrease of ABCG2 and ABCA1 proteins and the increase of ABCB4
in the human full-term placenta. These changes are possibly regulated by CAPNl and
59
DERLl, which are both increased in obese women's placentas, and CAPN2, which is
decreased. Future studies would be important to assess the impact of these changes on
placenta! cholesterol transport through pregnancy as weil as on the health of the
newbom during its childhood and adulthood.
60
2. 9 References
1. Masters RK, Powers DA, Link BG. Obesity and US mortality risk over the adult life course. Am J Epidemiol 20 12; 177:431-442.
2. Cnattingius S, Bergstrom R, Lipworth L, Kramer MS. Prepregnancy weight and the risk of adverse pregnancy outcomes. N Engl J Med 1998; 338:147-152.
3. Sebire NJ, JoUy M, Harris JP, Wadsworth J, Joffe M, Beard RW, Regan L, Robinson S. Maternai obesity and pregnancy outcome: a study of 287,213 pregnancies in London. Int J Obes Re lat Metab Disord 2001; 25:1175-1182.
4. Perlow JH, Morgan MA, Montgomery D, Towers CV, Porto M. Perinatal outcome in pregnancy complicated by massive obesity. Am J Obstet Gynecol 1992; 167:958-962.
5. Robinson HE, O'Connell CM, Joseph KS, McLeod NL. Maternai outcomes in pregnancies complicated by obesity. Obstet Gynecol2005; 106:1357-1364.
6. Racusin D, Stevens B, Campbell G, Aagaard KM. Obesity and the risk and detection of fetal malformations. Sernin Perinatol 20 12; 36:213-221.
7. Weiss JL, Malone FD, Emig D, Ball RH, Nyberg DA, Comstock CH, Saade G, Eddleman K, Carter SM, Craigo SD, Carr SR, D'Aiton ME. Obesity, obstetric complications and cesarean delivery rate--a population-based screening study. Am J Obstet Gynecol2004; 190:1091-1097.
8. Perlow JH, Morgan MA. Massive maternai obesity and perioperative cesarean morbidity. Am J Obstet Gynecol 1994; 170:560-565.
9. Mancuso A, D'Anna R, Leonardi R. Pregriancy in the obese patient. Eur J Obstet Gynecol Reprod Biol 1991; 39:83-86.
10. Gauster M, Hiden U, van Poppel M, Frank S, Wadsack C, Hauguel-de Mouzon S, Desoye G. Dysregulation of placenta! endothelial lipase in obese women with gestational diabetes mellitus. Diabetes 2011; 60:2457-2464.
11. Renaud SJ, Graham CH. The role of macrophages in utero-placental interactions during normal and pathological pregnancy. Immunol Invest 2008; 37:535-564.
12. Gresham EL, Simons PS, Battaglia FC. Maternal-fetal urea concentration difference in man: metabolic significance. J Pediatr 1971; 79:809-811.
13. Hill EP, Power GG, Longo LD. A mathematical model of carbon dioxide transfer in the placenta and its interaction with oxygen. Am J Physiol 1973; 224:283-299.
14. Jameson JL, Hollenberg AN. Regulation of chorionic gonadotropin gene expression. Endocr Rev 1993; 14:203-221.
15. Larque E, Ruiz-Palacios M, Koletzko B. Placental regulation of fetal nutrient supply. Curr Opin Clin Nutr Metab Care 2013; 16:292-297.
16. Porter FD, Herman GE. Malformation syndromes caused by disorders of cholesterol synthesis. J Lipid Res 2011; 52:6-34.
61
17. Woollett LA. Maternai cholesterol in fetal development: transport of cholesterol from the maternai to the fetal circulation. Am J Clin Nutr 2005; 82:1155-1161.
18. Carr BR, Simpson ER. Cholesterol synthesis in human fetal tissues. J Clin Endocrinol Metab 1982; 55:447-452.
19. Bjorkhem I, Meaney S. Brain cholesterol: long secret life behind a barrier. Arterioscler Thromb Vase Biol2004; 24:806-815.
20. Fernandez ML, Jones JJ, Ackerman D, Barona J, Calle M, Comperatore MV, Kim JE, Andersen C, Leite JO, Volek JS, Mclntosh M, Kalynych C, et al. Low HDL cholesterol is associated with increased atherogenic lipoproteins and insulin resistance in women classified with metabolic syndrome. Nutr Res Pract 2010; 4:492-498.
21. Rinninger F, Brundert M, Jackie S, Galle PR, Busch C, Izbicki JR, Rogiers X, Henne-Bruns D, Kremer B, Broelsch CE, et al. Selective uptake of highdensity lipoprotein-associated cholesteryl esters by human hepatocytes in primary culture. Hepatology 1994; 19:1100-1114.
22. Marseille-Tremblay C, Ethier-Chiasson M, Forest JC, Giguere Y, Masse A, Mounier C, Lafond J. Impact of maternai circulating cholesterol and gestational diabetes mellitus on lipid metabolism in human term placenta. Mol Reprod Dev 2008; 75:1054-1062.
23. Iqbal M, Audette MC, Petropoulos S, Gibb W, Matthews SG. Placenta! drug transporters and their role in fetal protection. Placenta 2012; 33:137-142.
24. Yokoyama S. ABCAl and biogenesis of HDL. J Atheroscler Thromb 2006; 13:1-15.
25. Ni Z, Mao Q. ATP-binding cassette efflux transporters in human placenta. Curr Pharm Biotechnol2011; 12:674-685.
26. Mathias AA, Hitti J, Unadkat ID. P-glycoprotein and breast cancer resistance protein expression in human placentae of various gestational ages. Am J Physiol Regul Integr Comp Physiol2005; 289:R963-969.
27. Evseenko DA, Paxton JW, Keelan JA. Independent regulation of apical and basolateral drug transporter expression and function in placenta! trophoblasts by cytokines, steroids, and growth factors. Drug Metab Dispos 2007; 35:595-601.
28. Aye IL, Waddell BJ, Mark PJ, Keelan JA. Placenta! ABCAl and ABCGl transporters efflux cholesterol and protect trophoblasts from oxysterol induced toxicity. Biochim Biophys Acta 2010; 1801:1013-1024.
29. Bhattacharjee J, Ietta F, Giacomello E, Bechi N, Romagnoli R, Fava A, Paulesu L. Expression and localization of A TP binding cassette transporter Al (ABCAl) in frrst trimester and term human placenta. Placenta 2010; 31 :423-430.
30. Stefulj J, Panzenboeck U, Becker T, Hirschmugl B, Schweinzer C, Lang I, Marsche G, Sadjak A, Lang U, Desoye G, Wadsack C. Human endothelial
62
cells of the placenta} barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1. Circ Res 2009; 104:600-608.
31. Le May C, Berger JM, Lespine A, Pillot B, Prieur X, Letessier E, Hussain MM, Collet X, Cari ou B, Costet P. Trans intestinal cholesterol excretion is an active metabolic process modulated by PCSK9 and statin involving ABCB 1. Arterioscler Thromb Vase Biol2013; 33:1484-1493.
32. Garrigues A, Escargueil AE, Orlowski S. The multidrug transporter, Pglycoprotein, actively mediates cholesterol redistribution in the cell membrane. Proc Natl Acad Sei US A 2002; 99:10347-10352.
33. Rosmorduc 0, Hermelin B, Poupon R. MDR3 gene defect in adults with symptomatic intrahepatic and gallbladder cholesterol cholelithiasis. Gastroenterology 2001; 120:1459-1467.
34. Woehlecke H, Pohl A, Alder-Baerens N, Lage H, Herrmann A. Enhanced exposure of phosphatidylserine in human gastric carcinoma cells overexpressing the half-size ABC transporter BCRP (ABCG2). Biochem J 2003; 376:489-495.
35. Janvilisri T, Shahi S, Venter H, Balakrishnan L, van Veen HW. Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J 2005; 385:419-426.
36. Evseenko DA, Murthi P, Paxton JW, Reid G, Emerald BS, Mohankumar KM, Lobie PE, Brennecke SP, Kalionis B, Keelan JA. The ABC transporter BCRP/ ABCG2 is a placenta} survival factor, and its expression is reduced in idiopathie human fetal growth restriction. Faseb J 2007; 21 :3592-3605.
37. Sugiyama T, Shuto T, Suzuki S, Sato T, Koga T, Suico MA, Kusuhara H, Sugiyama Y, Cyr DM, Kai H. Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1. Biochem Biophys Res Commun 2011; 404:853-858.
38. Yokoyama S, Arakawa R, Wu CA, lwamoto N, Lu R, Tsujita M, AbeDohmae S. Calpain-mediated ABCA1 degradation: post-translational regulation of ABCA1 for HDL biogenesis. Biochim Biophys Acta 2012; 1821:547-551.
39. Hori N, Hayashi H, Sugiyama Y. Calpain-mediated cleavage negatively regulates the expression level of ABCGI. Atherosclerosis 2011; 215:383-391.
40. Takano J, Mihira N, Fujioka R, Hosoki E, Chishti AH, Saido TC. Vital role of the calpain-calpastatin system for placental-integrity-dependent embryonic survival. Mol Cell Biol 2011; 31 :4097-41 06.
41. Shapses SA, Sukumar D. Bone metabolism in obesity and weight loss. Annu Rev Nutr 2012; 32:287-309.
42. Thompson VF, Saldana S, Cong J, Luedke DM, Goll DE. The calpain system in human placenta. Life Sei 2002; 70:2493-2508.
63
43. Hsieh YY, Chang CC, Hsu KH, Tsai FJ, Chen CP, Tsai HD. Effect of exercise training on calpain systems in lean and obese Zucker rats. Int J Biol Sei 2008; 4:300-308.
44. Janssen 1. The public health burden of obesity in Canada. Can J Diabetes 2013; 37:90-96.
45. Dube E, Gravel A, Martin C, Desparois G, Moussa 1, Ethier-Chiasson M, Forest JC, Giguere Y, Masse A, Lafond J. Modulation of fatty acid transport and metabolism by maternai obesity in the human full-term placenta. Biol Reprod 2012; 87:14, 11-11.
46. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation and purification of tot~ lipides from animal tissues. J Biol Chem 1957; 226:497-509.
4 7. Hara A, Radin NS. Lipid extraction of tissues with a low-toxicity sol vent. Anal Biochem 1978; 90:420-426.
48. Lanoix D, Lacasse AA, St-Pierre J, Taylor SC, Ethier-Chiasson M, Lafond J, Vaillancourt C. Quantitative PCR pitfalls: the case of the human placenta. Mol Biotechnol 2012; 52:234-243.
49. Lanoix D, St-Pierre J, Lacasse AA, Viau M, Lafond J, Vaillancourt C. Stability of reference proteins in human placenta: general protein stains are the benchmark. Placenta 2012; 33:151-156.
50. Oliveira CP, Maranhao RC, Bertato MP, Wajchenberg BL, Lerario AC. Removal from the plasma of the free and esterified forms of cholesterol and transfer of lipids to HDL in type 2 diabetes mellitus patients. Lipids Health Dis 2012; 11:65.
51. Jurevics HA, Kidwai FZ, More li P. Sources of cholesterol during development of the rat fetus and fetal organs. Journal of lipid research 1997; 38:723-733.
52. Shi W, Swan KF, Lear SR, O'Neil JS, Erickson SK, Henson MC. Regulation of pathways determining cholesterol availability in the baboon placenta with advancing gestation. Biology of reproduction 1999; 61:1499-1505.
53. Memon N, Bircsak KM, Archer F, Gibson CJ, Ohman-Strickland P, Weinberger BI, Parast MM, Vetrano AM, Aleksunes LM. Regional expression of the BCRP/ABCG2 transporter in term human placentas. Reprod
. Toxicol 2013; 43C:72-77. 54. Lye P, Bloise E, Dunk C, Javam M, Gibb W, Lye SJ, Matthews SG. Effect of
oxygen on multidrug resistance in the first trimester human placenta. Placenta 2013; 34:817-823.
55. Vahakangas K, Myllynen P. Drug transporters in the human blood-placental barrier. Br J Pharmacol2009; 158:665-678.
56. King JC. Physiology of pregnancy and nutrient metabolism. Am J Clin Nutr 2000; 71 :1218S-1225S.
57. Ichihara S, Yamada Y, Kato K, Hibino T, Yokoi K, Matsuo H, Kojima T, Watanabe S, Metoki N, Yoshida H, Satoh K, Aoyagi Y, et al. Association of a
64
polymorphism of ABCB 1 with obesity in Japanese individuals. Genomics 2008; 91:512-516.
58. Rahi M, Heikkinen T, Hartter S, Hakkola J, Hakala K, Wallerman 0, Wadelius M, Wadelius C, Laine K. Placenta! transfer of quetiapine in relation to P-glycoprotein activity. Journal ofpsychopharmacology 2007; 21:751-756.
59. Smith AJ, Timmermans-Hereijgers JL, Roelofsen B, Wirtz KW, van Blitterswijk WJ, Smit JJ, Schinkel AH, Borst P. The human MDR3 Pglycoprotein promotes translocation of phosphatidylcholine through the plasma membrane of fibroblasts from transgenic mice. FEBS letters 1994; 354:263-266.
60. Baig S, Lim JY, Fernandis AZ, Wenk MR, Kale A, Su LL, Biswas A, Vasoo S, Shui G, Choolani M. Lipidomic analysis of human placenta! syncytiotrophoblast microvesicles in adverse pregnancy outcomes. Placenta 2013; 34:436-442.
61. Omatsu K, Kobayashi T, Murakami Y, Suzuki M, Ohashi R, Sugimura M, Kanayama N. Phosphatidylserine/phosphatidylcholine microvesicles can induce preeclampsia-like changes in pregnant mice. Seminars in thrombosis and hemostasis 2005; 31:314-320.
62. Yan X, Huang Y, Wang H, Du M, Hess BW, Ford SP, Nathanielsz PW, Zhu MJ. Maternai obesity induces sustained inflammation in both fetal and offspring large intestine of sheep. lnflamm Bowel Dis 2011; 17:1513-1522.
63. lkebuchi Y, Takada T, lto K, Yoshikado T, Anzai N, Kanai Y, Suzuki H. Receptor for activated C-kinase 1 regulates the cellular localization and function of ABCB4. Hepatol Res 2009; 39:1091-1107.
64. lkebuchi Y, lto K, Takada T, Anzai N, Kanai Y, Suzuki H. Receptor for activated C-kinase 1 regulates the cell surface expression and function of A TP binding cassette 02. Drug Metab Dispos 2010; 38:2320-2328.
65. Prangsaengtong 0, Senda K, Doki Y, Park JY, Jo M, Sakurai H, Shibahara N, Saiki 1, Koizumi K. Calpain 1 and -2 play opposite roles in cord formation of lymphatic endothelial cells via eNOS regulation. Hum Cell2012; 25:36-44.
66. Brass E, Hanson E, O'Tierney-Ginn PF. Placenta! oleic ac id uptake is lower in male offspring of obese women. Placenta 2013; 34:503-509.
67. Pedersen JF. Ultrasound evidence of sexual difference in fetal size in first trimester. Br Med J 1980; 281: 1253.
68. Eriksson JG, Kajantie E, Osmond C, Thornburg K, Barker DJ. Boys live dangerously in the womb. Am J Hum Biol2010; 22:330-335.
69. Dube E, Ethier-Chiasson M, Lafond J. Modulation of cholesterol transport by insulin-treated gestational diabetes mellitus in human full-term placenta. Biol Reprod 2013; 88:16.
70. Wang Y, Minko T. A novel cancer therapy: combined liposomal hypoxia inducible factor 1 alpha antisense oligonucleotides and an anticancer drug. Biochem Pharmacol 2004; 68:2031-2042.
65
71. Langmann T, Mauerer R, Zahn A, Moehle C, Probst M, Stremmel W, Schmitz G. Real-time reverse transcription-PCR expression profiling of the complete human A TP-binding cassette transporter superfamily in various tissues. Clin Chem 2003; 49:230-238.
72. El Roz A, Bard JM, Huvelin JM, Nazih H. The anti-proliferative and proapoptotic effects of the trans9, transll conjugated linoleic acid isomer on MCF-7 breast cancer cells are associated with LXR activation. Prostaglandins Leukot Essent Fatty Acids 2013; 88:265-272.
73. Albermann N, Schmitz-Winnenthal FH, Z'Graggen K, Volk C, Hoffmann MM, Haefeli WE, Weiss J. Expression of the drug transporters MDRl/ABCBl, MRPl/ABCCl, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem Pharmacol 2005; 70:949-958.
66
2. 10 Figure Legends
Figure 2.11: Cholesterol quantification in normal weight (n = 22) and obese
women placentas (n = 11). Lipids were extracted from total placenta} tissues, in
which total cholesterollevels (A) and free cholesterollevels (8) were quantified. The
equation: (total cholesterol = free cholesterol + cholesteryl ester) was used to
determinate placenta} Cholesteryl ester levels ( C). Results were analyzed with the
Student's t test(* P < 0.05).
Figure 2.2: ABC genes and proteins expression quantification in normal weight
(n = 22) and obese women placentas (n = 11). By real-time RT-PCR and Western
blot, mRNA (A-E) and protein (F -J) levels extracted from total placenta! tissues were
quantified for ABCAl, ABCG2, ABCB4, ABCBl and ABCGl respectively. Results
were analyzed with the Student's t test(* P < 0.05, ** P < 0.01).
Figure 2.3: Influence of newborn's sex on ABCAl protein expression in normal
weight (n = 22) and obese women placentas (n = 11). The protein expression of
ABCAI was tested according to the mother's BMI and the newbom sex with a two
way ANOV A and the Bonferroni post-test (* P < 0.05).
Figure 2.4: CAPNl, CAPN2 and DERLl genes and proteins expression
quantification in normal weight (n = 22) and obese women placentas (n =11). By
67
real-time RT-PCR and Western blot, mRNA (A-C) and protein (D-F) levels were
extracted from total placental tissues and quantified for CAPN1, CAPN2 and DERL1
respectively. Results were analyzed with the Student's t test (* P < 0.05, ** P <
0.01).
Figure 2.5: Influence of newborn's sex on CAPNl protein expression in normal
weight and obese women placentas. The protein expression of CAPN1 was tested
according to the mother's BMI and the newborn sex with a two-way ANOVA and the
Bonferroni post-test(** P < 0.01).
Figure 2.6: Model of maternal-fetal cholesterol transfer pathway in presence of
maternai obesity. The full arrows show the maternal-fetal cholesterol transfer,
through the syncytium and the endothelial cells of the human term placenta. Dotted
arrows show a negative regulation by degradation. Lined arrow shows a possibly
positive regulation of another protein by activation. HDL: High-density lipoprotein;
LDL: Low-density lipoprotein; VLDL: Very-low-density lipoprotein; SR-B 1:
Scavenger receptor-81; LDLr: Low-density lipoprotein receptor; VLDLr: Very-low
density lipoprotein receptor; ABC: ATP-binding cassette; APOA1: Apolipoprotein
A1; KGF2: Keratinocyte-growth factor 2; RACK1: Receptor for activated kinase 1;
CAPN1: calpain-1; CAPN2: calpain-2; DERL1: derlin-1.
68
2.11 Tables
Table 2.1: Primers used for real-time RT-PCR analyses.
Product Primers sequences (5'-3')
Gene size References
Sense Antisense (bp)
ABCAJ acccaccctatgaacaacatga gagtcgggtaacggaaacagg 123 [55]
ABCBJ cccatcattgcaatagcagg gttcaaacttctgctcctga 157 [223]
ABCB4 tttttactttcttccttcagggtttc taaaagccattgaccgcagtct 81 [224]
ABCGJ caggaagattagacactgtgg gaaaggggaatggagagaaga 177 [225]
ABCG2 agatgggtttccaagcgttcat ccagtcccagtacgactgtgaca 91 f2261 CAPNJ gttccacccatcactcacca gaga acttgcctg 52 Se1f-designed CAPN2 cctcaaccaggactacgagg tagggccccaactccttgaa 117 Se1f-designed DERLJ aggcctgctatttaccctgg cattgattaccgagcctccl!:a 66 Se1f-designed HP RTl gaccagtcaacaggggacataa aagcttgcgaccttgacc 167 f2271 TOPJ ggcgagtgaatctaagg cttaaagggtacagcgaatg 90 f2271 PP/A gtttgcagacaaggtccca acccgtatgctttaggatg 211 f2271
69
Table 2.2: Maternai, neonatal and placenta! cbaracteri tic . omen er
la ified into two group ace rding to their bod ma ind , (BMI) : a normal w ight
group n=22· 11 mal n 11 :D mal n wborn ) 1 .5 < BMI < 24.9 kg/m2
and an be e group n= 11 ; 4 mal ne born 7 :D mal n wborn) BMI> 30 kg/m1.
R ult are e pre da M an ± EM ( tudent ' t te t, * P < 0.05 , *** P < 0.001) .
Normal weight Obese Parameter
(n = 22) (n = Il)
22.15 ± 0.45 32.52 ± 1.08***
30.00 ± 1.06 29. 0 ± 1.28 13.12 ± 0.80 12.47 ± 1.12
20.34 ± 0.63*** 8.88 ± 0.55
51.81 ± 0.68 3676 ± 172
34.56 ± 0.69 24.04 ± 0.56 26.20 ± 0.74*
525.90 ± 30.06 766.90 ± 53.02*** Pla
6.62 ± 0.30 5.48 ± 0.45*
2. 12 Figures
Ab
un
da
nce
of
est
erl
fie
d p
lace
nta
! ch
ole
ste
rol
(ug
mg
of
tiss
ue
) p
0 0 ~ ~
2.
* ~ .. (I
l ..
(")
Abu
ndan
ce o
f fr
ee
pla
cent
a!
cho
lest
ero
l (u
g/m
g o
f tis
sue
) 0
0 0
0
§ 8 <n
~
0 ~
<n
0 0 ~
~
2.
~ *
0 i" (Il
~ ..
Ab
un
da
nce
of
tota
l pl
acen
ta!
cho
lest
ero
l (u
g/m
g o
f tis
sue
)
0 0 ~ [ 0 cr .. "' .. 0 8
0 0 N
0 0 ....
~ ~
)>
~ ~
0 e; ..
rn R
ol•
r..
AB
CG
1 .-A
ex
pr-e
uion
tew
l (a
rbit
f.-y
unh
s)
p p
r"'
,... L
Ro
t•l"
' A
BC
GI
p<O
ioln
~
ex
pre
ulo
n .. V
III t
arb
hra
ry u
nh
s)
ëL
~ p p
~
,...
0 a' ;:;
n 7<'
~ .... 0 ><
0 ..
CJ
Roi
.. II
IOA
BC
SI
oxp<
oulo
nlo\
101
(orb
ltra
ry u
nllo
) p
p ~
,...
)>
Ro
l•lw
AS
C8
1 p
rooo
ln
3 •K
Pf•
sslo
n l
ew
l t•
bit
nry
un
its)
ii
i " e
" e
~ .. n 7<'
~ .. 0 ..
()
Ro
i•II
IO A
SC
84
-o
pes
on ..
..... (atbh~ l
ftls
) ~
N
.,.
H H
i I·
~ a: 0 a' ;:;
n 7<'
.... N
7<'
0 ..
Roi
.. II
IOA
SC
G2
-•.x
pr-• .
do
n J
.wl
(arb
itr •
Y u
nit
s)
p p
f "
p
Ro
l•lw
AB
CG
2 p<
Oio
in
e.xp
teu
:io
n w
...t
(•b
itr.
-y u
nit
s)
~
p .....
)>
Rot
arr
.. A
SC
A 1
.-A
•X
fl'"H
Ùon
1~ (
arbh
rary
un
its)
,.
,. .,. ..
...
H
~
R ..
Miw
AB
CA
1 pr
c.e.
tn
oxp
<o
uio
n lo
\101
(ar
bhra
ry 1
.01ho
) p
p
)>
Re
lativ
e A
BC
A 1
pro
tei n
3
exp
ress
ion
leve
l (a
rbit
rary
un
its)
g:
)>
C"
OJ
iii
(')
n )>
')I
f:'
....
.
N
N
0 ')If:'
0 Al
0 0 0 0'
1 0
0'1
~ ~------------~
Q.l en ,
I* en 3 Q
.l en
DO
~
0 0 ::l
(fJ ~
CD
0 -..
..)
1
~
(")
Re
btl
ve D
ER
L 1 ~NA
ex.
,..s
slo
n le
ve!
(arb
lt.-
..y
units
)
g e
o o.
~ 1
r 0 1
'Tl
g-0
Rel
3tlv
e D
ER
L1
pro
loln
0
" m
e
xpre
ssio
n le
vel
(arb
ltn
lry u
nh
s)
iï
;o
"' ...
"' ~ ~
n l 1
~ 1· [ 0
(")
0"
1ù iï
n
z ,.
N
0>
0 ,. 0 ..
Rel
ativ
e C
AP
N2 ,_
u
pre
sslo
n le
vel (
arb
ltra
ry u
nMs)
-....
...
H
~
m
Re
l.,l
vo C
AP
N2
prol
ein
expr
essi
on le
\lel
(al'b
ltra
ry u
nit
s)
p e
~ ~
~
g
I· [ 0 ~ .
~ a.
0 0" iï " ,.
(") 1ù ~
0>
0 "" 0 ..
)>
Rel
..tlv
e C
AP
N1
-ex
pres
sion
le\lo
l (a
rbit
rary
unl
ts)
0 p ~
0 'l'
0
~
1
0 R
ebtl
vo C
APN
1 pr
olei
n ex
pres
sion
lev
el (
arbi
trar
y u
nlt
s)
n g [
r~ 0 ~
-....
) w
---------------------------------------------------------------
Re
lativ
e C
AP
N1
pro
tein
~
exp
ress
ion
leve
l ( a
rbit
rary
un
its)
~~ s:
t----'
Ill in t-
----
....
.,
"11
tD
..,.
. _
_,
3 Ill
tD
c: ., ~ N
Ul
Fiom·e 2.6
l\1o em 1 blood
B
Fe al blood
75
~ \ i \ \
.-············)
Tow rd
77
Chapitre Ill : Discussion et conclusions
3. 1 Discussion
Bien qu'il fût démontré que l'obésité maternelle peut influencer le développement
fœtal et que l'étude de ses voies de signalisation est primordiale, elle n'est toutefois
pas la seule pathologie à être la cause de problèmes lors de la grossesse, de
l'accouchement et durant le développement du fœtus. En effet, le diabète gestationnel
fut démontré comme affectant les transporteurs ABCA 1 et ABCG 1 dans le placenta
humain à terme [55], suggérant que cette même voie de transport du cholestérol est
affectée par l'obésité et par le diabète gestationnel. C'est pourquoi il serait intéressant
de tester les régulateurs calpaïne-1 et calpaïne-2 dans le contexte du diabète
gestationnel, car ils pourraient en effet être aussi impliqués dans la modulation
placentaire de l'expression d'ABCAI et ABCGI, tel que démontré dans le placenta
des mères obèses dans le chapitre II. La protéine ABCA1 placentaire est aussi
modulée dans pré-éclampsie [228]. La modulation d' ABCAI dans la pré-éclampsie
pourrait donc se faire également via les régulateurs post-traductionnels calpaïnes. Les
calpaïnes 1 et 2 placentaires, bien que reconnues comme jouant un rôle similaire, ne
variaient pas selon la même tendance en présence d'obésité maternelle (chapitre Il).
Il faudrait alors envisager la possibilité que ses deux régulateurs puissent jouer des
rôles différents dans le placenta humain, comme par exemple, en régulant
négativement ABCA1 et ABCGI pour une calpaine et positivement pour l'autre. La
calpaïne-1 est impliquée dans la régulation des gènes de la leptine et de la
CCAA T/enhancer-binding protein u (Cebpa) dans les adipocytes, l'impliquant ainsi
dans la régulation de la prolifération et la différenciation cellulaire [229]. Calpaïne-1
pourrait donc, au niveau du placenta humain, être majoritairement impliquée dans la
différenciation cellulaire. La calpaïne-2 est quant à elle, dans le foie, impliquée dans
les nécroses hépatocellulaires causés par une autophagie dysfonctionnelle [230].
78
Ainsi, dans le placenta humain, calpaïne-2 pourrait, à l'opposé de calpaïne-1, être
impliquée dans la dégradation cellulaire et affecter les échanges materno-fœtaux. De
plus, l'expression de calpaïne-2 augmente dans le tissu utérin de rat, lors de la phase
d'implantation de l'embryon, suggérant que calpaïne-2 joue un rôle primordial dans
le clivage de protéines d'adhésion, processus démontré comme nécessaire à
1' implantation [231]. Cette étude vient donc appuyer la théorie selon laquelle
calpaïne-2 serait impliquée dans la dégradation cellulaire, à l'instar de calpaïne-1. La
calpaïne-2 pourrait également affecter le placenta humain à cause d'une augmentation
des acides gras dans le placenta. En effet, les acides gras libres causent un stress au
niveau du réticulum endoplasmique et même l'apoptose dans les cellules-~ via
calpaïne-2 [232]. Comme il fut démontré dans notre laboratoire qu'en présence
d'obésité maternelle, le placenta humain semble accumuler l'excès d'acides gras afin
d'en protéger le fœtus [233], il se pourrait qu'en présence de ce phénomène de
compensation placentaire, un stress y soit tout de même induit, stress qui pourrait
affecter les fonctions de transport placentaire via la voie de calpaïne-2, menant
possiblement à la dégradation cellulaire dans le placenta. D'autres protéines seraient
intéressantes à étudier dans le contexte des calpaïnes et des deux pathologies
placentaires. Il s'agit des calpastatines, qui sont reconnues comme inhibant les
calpaïnes [234]. De plus, dans le placenta, l'ensemble calpaïne-calpastatine est
nécessaire à la survie de l'embryon [193]. Ces protéines (calpastatines) pourraient
donc être du moins en partie responsables de la modulation de l'activation des
calpaïnes dans le placenta humain à terme en présence d'obésité maternelle.
La protéine derlin-1 est également un régulateur post-traductionnel très important
d'un point de vue reproductif, car une déficience de cette protéine s'avère létale pour
l'embryon, suggérant qu'elle doit jouer un rôle majeur au niveau de sa croissance et
de son métabolisme [197]. Son implication majeure dans le métabolisme lipidique
placentaire devient ainsi de plus en plus probable, et cette piste devrait être explorée
au cours de futurs projets de recherche. Son expression placentaire étant maintenant
79
confirmée (démontré dans le Chapitre II), derlin-1 devient aussi une protéine
intéressante à étudier au niveau cellulaire pour démontrer son implication dans le
transport du cholestérol, d'autant plus que dans le Chapitre II, il fut démontré que
l'expression de derlin-1 était modulée à la hausse par l'obésité maternelle. Étant
donné son possible rôle de régulateur post-traductionnel d' ABCG2 [198] au niveau
du placenta, il serait intéressant de voir si derlin-1 peut réguler cette protéine dans le
cadre d'autres pathologies où ABCG2 y joue un rôle majeur, tel que le retard de
croissance idiopathique du fœtus [235], pathologie où l'expression placentaire
d' ABCG2 est anormalement diminuée, cette baisse d'expression pouvant être due à la
voie de régulation de derlin-1. De plus, derlin-1 pourrait être impliquée dans des
pathologies telles que la pré-éclampsie. Dans la pré..;éclampsie, l'expression des
métalloprotéinases matricielles 2 et 9 (MMP2, MMP9) diminue dans les
trophoblastes extravilleux, affectant ainsi leur prolifération et leur différenciation
[236]. Derlin-1 pourrait, comme démontré dans des cellules cancéreuses pulmonaires,
réguler ses métalloprotéinases placentaires, car c'est bel et bien le rôle qu'elle y joue
[23 7]. Derlin-1 pourrait également interagir avec d'autres protéines présentes dans le
placenta et ainsi être impliquée dans d'autres voies de signalisation. Par exemple, elle
peut s'unir avec calvéoline-1 pour dégrader la cyclo-oxygenase-2 (Cox-2) [238],
laquelle est impliquée dans les problèmes d'hypertension durant la grossesse [239].
De plus, la protéine derlin-1 pourrait être impliquée dans la régulation de plusieurs
transporteurs ABC autres qu' ABCG2 tel qu'il fut démontré [198]. En effet, même s'il
n'est pas considéré comme un transporteur, mais bien comme un canal où circulent
les ions calcium et potassium, le régulateur de la perméabilité transmembranaire de la
fibrose kystique (CFTR alias ABCC7) est régulé par derlin-1 qui promouvoit sa
dégradation par ubiquitination, initiant la voie d'ERAD [240]. L'expression de
plusieurs autres protéines ABC pourrait ainsi être influencée par derlin-1. Démontrer
son implication dans la régulation placentaire des transporteurs ABC modulés par
l'obésité amènerait la preuve que cette protéine joue un rôle important dans le
métabolisme lipidique placentaire. En transfectant des cellules placentaires avec un
80
petit ARN interférant avec le gène DERL1 ou en mettant un inhibiteur de derlin-1, il
serait possible d'observer l'effet d'une baisse d'expression de derlin-1 sur
l'expression d'un ensemble de protéines impliquées dans le transport du cholestérol.
Il se pourrait que se soit également le cas pour son homologue, dfm1, protéine qui va
de pair avec derlin-1 et qui est aussi nécessaire à la voie de dégradation du réticulum .
endoplasmique (ERAD) [241]. Cette protéine pourrait donc être une piste à explorer
dans le contexte de pathologies placentaires, tout comme derlin-1. Une autre protéine
serait intéressante à étudier. Il s'agit de la protéine de choc thermique 90 (Hsp90), car
elle fut démontrée comme inhibant les effets des protéines ubiquitinantes, telles que
derlin-1 [242]. Dans le contexte de pathologies où l'expression de derlin-1 est
anormalement élevée, comme en présence d'obésité maternelle, elle pourrait être une
cible potentielle pour un futur traitement visant à contrer l'activité trop importante de
derlin-1 et ses effets néfastes sur l'expression des transporteurs ABC. Derlin-1 fut
aussi démontrée comme .régulant l'apolipoprotéine B100 (Apo-B100). En effet, Apo
B100, reconnue comme un ligand principal des LDL [243], subit une translocation
depuis le réticulum endoplasmique jusqu'à la surface des gouttelettes lipidiques.
Derlin-1 affecte cette translocation en initiant la dégradation de 1 'Apo-B 100 via la
voie d'ERAD [244]. Derlin-1 semble ainsi être impliquée dans la régulation du
transport des lipides via les gouttelettes lipidiques. Il se pourrait donc que derlin-1
soit impliquée dans le transport des lipides véhiculés par les lipoprotéines dans le
placenta. De plus, comme démontré dans l'Annexe 1, en présence
d 'hypercholestérolérnie, derlin-1 semble impliquée dans la régulation de 1' ApoB-1 00
dans le placenta humain à terme, suggérant que derlin-1 est impliquée dans la
modulation de plusieurs protéines jouant un rôle dans le transport des lipides et
impliquée dans la modulation de plusieurs pathologies. Derlin-1 devient alors une
cible de choix pour l'étude des voies de transport placentaire du cholestérol pouvant
être modulées par les pathologies influençant la grossesse.
81
Dans le cadre d'un futur projet sur l'obésité maternelle et ses effets sur les
transporteurs ABC dans le placenta humain à terme, il serait pertinent, à 1' aide de la
technique d'immunohistochimie, d'identifier dans quels types de cellules ces
transporteurs ABC sont modulés. Leur régulation diffère dans chaque type cellulaire.
Par exemple certains transporteurs ABC ne sont pas exprimés de façon équivalente
dans les cytotrophoblastes et le syncytiotrophoblaste [141;157]. Cela permettrait de
voir la régulation de 1' expression placentaire des t.ransporteurs ABC, mais plus
précisément à chaque étape du transfert placentaire du cholestérol entre la mère au
fœtus. Il serait également pertinent d'isoler les membranes de ses cellules
placentaires, car il fut démontré que les protéines présentes à la face apicale et
basolatérale du syncytiotrophoblaste sont régulées de façon indépendante 1 'une de
l'autre [90]. Une pathologie particulière pourrait donc ainsi non seulement affecter
l'expression d'une protéine dans un type de cellules en particulier, mais également la
réguler selon la surface (maternelle ou fœtale) où elle est exprimée.
Aussi, comme il fut démontré que le sexe du nouveau-né pouvait être un facteur à
prendre en compte dans l'expression placentaire des transporteurs de cholestérol
(Chapitre Il) et des acides gras [57], il serait important d'identifier les facteurs
ciblant un sexe en particulier, car une fois connus, cela permettrait une meilleure
compréhension de la pathologie et pourrait offrir des pistes quant à de futurs
traitements visant à enrayer 1 'effet néfaste de 1 'obésité maternelle sur le
développement fœtal.
3.2 Conclusions
Ce projet a permis de démontrer que l'expression des protéines ABC transportant le
cholestérol est modulée par l'obésité maternelle dans le placenta humain à terme.
Dans le tissu placentaire, 1 'expression des protéines ABCG2 et ABCA 1 diminuent en
82
présence d'obésité maternelle, alors que l'expression d'ABCB4 augmente, suggérant
que cette modulation d'expression amène un transfert plus important du cholestérol
maternel au fœtus, Ces résultats suggèrent une piste expliquant comment l'obésité
maternelle affecte le développement du système nerveux central du fœtus et
prédispose le nouveau-né à souffrir lui-même d'obésité et de maladies
cardiovasculaires. Cette modulation d'expression semble due aux régulateurs post
traductionnels Calpaïne-1 et Calpaïne-2, ainsi que derlin-1, car l'expression de ceux
ci semble également modulée par l'obésité maternelle dans le placenta humain à
terme.
APPENDICE A : Contributions de l'étudiant au projet
Ce qu'il a fait
~ Extraction d' ARNm de tissus placentaires totaux.
~ RT-PCR en temps réel (et mise au point).
~ Extraction de protéines de tissus placentaires totaux.
~ Immunobuvardages de type Western (et mise au point).
83
~ Extraction de la fraction lipidique de tissus placentaires totaux (mise au point
d'un protocole).
~ Dosages du cholestérol placentaire total, ainsi que de ses formes (libre et
estérifié).
~ Culture cellulaire sur la lignée Be Wo
~ Extraction de protéines de cellules BeWo.
Ce qu'il n'a pas fait
-! Recrutement des mères pour former la cohorte de placentas
-! Compilation des données des questionnaires socio-médicaux
-1 Recueillement et disposition des placentas
-1 Dosages des lipides plasmatiques
-1 Compilation des données des dosages lipidiques plasmatiques
-1 Isolation de cytotrophoblastes de placentas humains
-1 Extraction de protéines de cultures primaires cytotrophoblastiques humaines
84
Annexe 1 : Projet sur les lipoprotéines
1. 1 Contributions de l'étudiant au projet
)o> Mise au point des immunobuvardages de type Western (25% des expériences réalisées dans cet article)
85
1.2 Résumé de l'article des lipoprotéines
L 'hypercholestérolémie constitue un facteur de risque pour le développement de maladies athérosclérotiques et pourrait être impliquée dans la programmation fœtale de ces maladies. Le cholestérol peut être intégré dans le placenta d'une manière récepteur-dépendante suivant la liaison des lipoprotéines (apo) aux récepteurs spécifiques. Le but de cette étude vise à évaluer l'impact de l'hypercholestérolémie sur le transport du cholestérol via la modulation de l'expression des apolipoprotéines. Des échantillons de placenta à terme et de sang provenant de la mère et de de la veine du cordon ombilical furent obtenus à l'accouchement des femmes normocholestérolémiques et hypercholestérolémiques. Les échantillons de sang maternel furent également obtenus lors du premier et second trimestre. Les concentrations lipidiques (cholestérol total, HDL, LDL, triglycérides, acides gras libres, apolipoprotéine-Al, apolipoprotéine-BlOO) furent dosées dans les échantillons de sang. Les niveaux d'expression d'ARNm et/ou de protéines (apos, MTP, DERLl) furent testés dans le placenta humain à terme, respectivement par RT-PCR en temps réel et immunobuvardages de type Western. L'activité de MTP fut évaluée avec des trousses commerciales sur les homogénats tissulaires. En conclusion, notre étude démontre que l'hypercholestérolémie affecte le profil lipidique maternel et néonatal, ainsi que l'expression d'apoB et DERLl. Ces changements pourraient affecter le métabolisme fœtal et prédispose le fœtus à de futures maladies athérosclérotiques.
86
1. 3 L'article scientifique en préparation
EFFECT OF MATERNAL OBESITY AND HYPERCHOLESTEROLEMIA ON PLACENT AL APOLIPOPROTEINS
Evemie Dubé 1•2, Guillaume Desparois 1
•2.3, Laurent Perrier1
•2 and Julie Lafond1
•2•4
1Laboratoire de physiologie materno-fœtale, Université du Québec à Montréal, Montréal, Québec, Canada, H3C 3P8; 2Centre de Recherche Biomed, Université du Québec à Montréal, Montréal, Québec, Canada, H3C 3P8. 3INRS-Institut ArmandFrappier, Université du Québec, Laval, QC, H7V 187, Canada.
4To whom correspondence should be addressed: Julie Lafond PhD
Centre de Recherche BioMed
Université du Québec à Montréal
C.P. 8888, Succursale Centreville
Montréal, Canada H3C 3P8
Phone: (514) 987 3000 ext 7857
Fax: (514) 987 4647
Email: lafond.julie@uqam.ca
87
Abstract
Hypercholesterolemia constitutes a risk factor for developing atherosclerotic diseases
and could be involved in the fetal programming of these diseases. Cholesterol can be
taken up by the placenta in a receptor-dependent manner following the binding of
apolipoproteins (apo) to specifie receptors. The goal ofthis study was to evaluate the
impact of hypercholesterolemia on cholesterol transport through the modulation of
the expression of apolipoproteins. Human full-term placenta, maternai and venous
cord blood samples were obtained at delivery from normocholestrolemic and
hypercholesterolemic women. Maternai blood samples were also obtained during the
151 and 2nd trimesters. Lipids (total cholesterol, HDL, LDL, triglycerides, free fatty
acids, apolipoprotein Al, apolipoprotein 8100) levels were evaluated in blood
samples. mRNA and/or protein expression levels (apos, MTP, DERLI) were assessed
in human full-term placenta respectively by real-time RT-PCR and western blots.
MTP activity was evaluated using a commercial kit on tissue homogenates. Overall,
our study demonstrates that hypercholestrolemia affects the maternai and neonatal
lipid profiles as weil as the expression of apoB and DERL 1. These changes could
affect the fetal metabolism and predispose the fetus to future atherosclerotic diseases.
Keywords: hypercholesterolemia, obesity, placenta, apolipoproteins, DERL1, BMPI,
PCEP2.
88
Introduction
Lipoproteins are responsible for the transport of cholesterol, an essential nutrient for
proper growth and development of the fetus [1]. Althought the fetus is capable of de
novo synthesis, fetal cholesterol originates in part from the maternai circulation
through placenta} transport [2-5]. Lipoproteins are complexes of lipids and proteins
known as apolipoproteins. Apolipoproteins are involved in the regulation of
lipoprotein metabolism by redistributing lipids to cells and tissues, acting as cofactors
for enzymes of lipid metabolism and maintaining lipoprotein structure [6]. Specifie
apolipoproteins are recognized by cell surface lipoprotein receptors. The human
placenta expresses several apolipoproteins (APOA 1, APOD, APOL, APOB, APOE)
[7-11] and lipoprotein recepors (the lectin-like oxidized low-density lipoprotein
receptor-1 (LOX1/0LR1), the low density lipoprotein receptor (LDLR), the
scavenger receptors SRBI and CD36) [12-14]. APOB100, a constituent of LDL and
VLDL, is mainly synthetized in the liver and is involved in the transport of
cholesterol from the liver to peripheral tissues whereas APOA1 and APOE,
constituents of HDL, are involved in the reverse cholesterol transport to remove
cholesterol from peripheral cells [15, 16]. APOA1 and APOE promote HDL
assembly notably through the activation of the lecithin cholesterol acyltransferanse
(LCAT) [17-19]. Finally, cholesterol is transfered to fetal lipoproteins (mainly
APOAI, APOE and HDL particles) by the ATP-binding cassette (ABC) transporters
ABCA 1 and ABCG 1 [20, 21]. Studies suggest that severa} steps in placenta}
89
cholesterol transport are affected by maternai obesity and hypercholestrolemia [12,
14, 22, 23].
Hypercholesterolemia and obesity have been shown to increase the rates of early
development of atherosclerosis in children [24-26]. Even if the clinicat symtoms of
atherosclerosis occur later in life, it has been suggested that pathogenic events
occuring during fetal development may influence the susceptibility to atherosclerosis
and cardiovascular diseases in childhood and adulthood. Indeed, studies have
observed an increased formation of fatty streaks, the early precursors of
atherosclerotic plaques, in human arteries of fetuses and children of
hypercholesterolemic mothers [27, 28]. This formation offatty streaks is known to be
initiated by the deposit of cholesterol; through the accumulation and subsequent
oxidation of low-density lipoproteins (LDL) in monocyte-derived macrophages [29].
Moreover the earl y onset of the atherogenic process in childhood and the severity of
the lesions has been correlated to body mass index (BMI) and lipoprotein levels [30].
Studies have even demonstrated that newborns of obese women are more likely to
suffer from obesity and cardiovascular diseases [31 ]. Thus it is important to unravel
the mechanisms involved in the early development of atherosclerosis to limit the
pandemie of obesity and the related diseases in our future generations.
We hypothesize that maternai obesity and hypercholestrolemia impact the placenta!
transport of cholesterol from the maternai to the fetal circulation by modulating the
90
placenta! expression of apolipoproteins. This study was designed to characterize the
effect of maternai obesity and hypercholestrolemia on maternai circulating lipids, on
the expression of apolipoproteins in the human full-term placenta of normal weight
and overweight/obese women. Overall it will provide a better understanding of the
impact of maternai obesity and hypercholesterolemia on fetal programming of
cardiovascular diseases.
Materials and Methods
Study participants
Recruitment of the participants was done during their first prenatal visit at Hôpital St
Luc of the Centre Hospitalier Universitaire de Montréal (CHUM; Montréal, QC,
Canada). An informed consent and an interview-administrated questionnaire on
socio-demographic characteristics were completed and signed by each participant.
Subjects presenting diabetes, preeclampsia, hypertension, drug medication and
complication during pregnancy or at delivery were excluded from the study.
Participants were classified according to their pre-pregnancy BMI (kg/m2) as normal
weight (18.5<BM1<24.9 kg/m2) or overweight/obese (BMI > 26 kg/m2) based on the
World Health Organization criteria [32] or according to their plasma level of total
cholesterol (CHOL) at delivery. Cut-off for hypercholesterolemia was set at 6.26
mmol/1 (240 mg/dl) according to the criteria of the National Cholesterol Education
Program (NCEP) [33]. The weight (kg), height (cm), head circurnference (cm) and
sex of the newborn was also noted. The ethical committees on human subjects of
91
Saint-Luc Hospital and Université du Québec à Montréal (UQÀM; Montréal, QC,
Canada) approved this study.
Measurement of plasma lipid /evels
During the 1st (10-17 weeks), 2nd (22-28 weeks) and at delivery (36-42 weeks),
maternai blood was collected in Vacutainer gel tubes (BD, Oakville, Canada). Blood
from the venous umbilical cord was also taken at delivery. Plasma was recovered
after centrifugation at 3500 g for 15 min and stored at -20°C until further analysis of
different plasma lipid levels. Plasma levels of cholesterol (CHOL), low density
lipoproteins (LDL), high density lipoproteins (HDL), triglycerides (TG),
apolipoproteins (apoA1 and apoB100) and total free fatty acids (FFA) were measured
as previously described [34].
Real-time RT-PCR
Placentas were collected at delivery and immediately immersed in Dulbecco modified
Eagle Medium (DMEM) (Sigma, Oakville, ON, Canada) containing antibiotics (0.12
mg/ml penicillin, 5J.1g/ml amphotericin, 50J.1g/ml gentamycin) (lnvitrogen,
Burlington, ON, Canada) and NaHC03 (90mg/ml). The amnion, chorion and
decidual layers were removed and the resulting villous tissue was eut ( 5 cm2 pieces)
and kept at -80°C until further analysis. 500ng of total RNA, extracted from frozen
placenta} tissues with the High Pure RNA Tissue Kit (Roche Diagnostics), was
reverse transcribed and used for real-time PCR reactions as previously described [34].
92
Primers were previously published or designed with PrimerBlast (National Center for
Biotechnology Information; Table 1 ). The expression of each target gene was
normalized with three reference genes (HPRT1, PPIA, TOP1) as described by Lanoix
et al. (2012) [35, 36].
ELISA and Western blot
Total proteins were extracted from frozen placenta! tissues with a Polytron Tissue
homogenizer PT 3000 (Brinkmann, Canada) in ice-cold hypertonie buffer (125 mM
Tris-HCI, 2 mM CaCl2, 1.4% (v/v) Triton X-100, pH 8.0) containing the Complete
mini EDTA-free anti-protease cocktail (Roche diagnostics). Apolipoproteins
(APOA1, APOB, APOE) levels in placentas were evaluated by ELISA using the
Total Human Apolipoprotein Al ELISA Assay, the Total Human Apolipoprotein B
ELISA Assay-.11 (AlerCheck Portland, ME, USA) and the ApoE4/Pan-ApoE ELISA
kit (Medical and Biological Laboratories CO., Nakaku, Nagoya, Japan) according to
the manufacturer's instructions. The expression of microsomal triglyceride transfer
protein (MTP), degradation in endoplasmic reticulum protein 1 (DERL 1 ), bone
morphogenetic protein 1 (BMP 1) and procollagen C-endopeptidase enhancer 2
(PCEP2) was evaluated by Western blot. 50 ug of total proteins were diluted in
sample buffer, heated at 95°C for 5 min, resolved on a SDS-PAGE and electroblotted
onto PDVF membranes (Millipore, Cambridge, ON, Canada). Membranes were then
blocked in TBS-T (20 mM Tris Base, pH 7,6, 137 mM NaCl, 0.1% Tween-20)
containing 5% skimmed milk 2hrs at room temperature, incubated ovemight at 4°C
93
with anti-MTP (1:500; Abgent, San Diego, CA, USA), anti-DERL1 (1:1000;
Origene, Rockville, MD, USA), anti-BMP1 (1 :2000; Cedarlane, ON, Canada) or anti
PCPE2 (1:2000; Cedarlane) antibodies. Blots were washed with TBS-T and probed
with appropriate secondary antibodies coup led to horseradish peroxidase ( 1: 1 0000;
New England Biolabs, ON, Canada). Detection was realized using the LuminataTM
Forte Western HRP Substrate (Millipore) and visualized by autoradiography
(Hyperfilm ECL, GE Healthcare, Baie d'Urfée, Qc, Canada). The Quantity One
Software (Bio-Rad Laboratories, Mississauga, ON, Canada) was used to quantify the
bands. Normalization was done with Amido Black staining (Sigma Aldrich) [37].
MTP activity
Tissues were homogenized with a pestle homogenizer in ice-cold extraction buffer
(150mM NaCl 10mM Tris 2mM EDTA pH 7.4). Homogenates were centrifuged for
30 min at 10 OOOg at 4°C. LPL enzyme activity was measured in supernatants using a
commercial kit (Roar Biomedical, New York, USA) and a SpectraMax MS
(Molecular Deviees, Sunnyvale, CA) according to the manufacturer's instructions.
Statistica/ Analysis
Ail statistical analyses were performed with Prism 4.0 (GraphPad Software, San
Diego, CA, USA). Data (presented as mean -41- SEM) were analysed regardless of
newborn gender using the unpaired Student t-test and considered statistically
significant at P < 0.05. Correlation coefficients between maternai, placental and
94
neonatal factors were calculated with Pearson test. A two-way ANOVA followed by
Bonferroni post-test was also perfonned to evaluate the effect of newborn gender on
maternai, placenta! and neonatal factors.
Results
Influence of materna/ BMI on lipid profiles and apolipoproteins
Subject characteristics
Women participating to this study were separated in two groups according to their
pre-pregnancy BMI (kg/m2): nonnalweight (18.5<BM1<24.9; n=24) and
overweight/obese (BMI>26; n=13) women. Both groups were significantly different
in their pre-pregnancy BMI (P=0.0454) but were similar in the maternai weight gain,
maternai age, gestational age, placental weight, birth weight and lenght and head
circumference (Table 2).
Materna/ and neonata/lipid profiles
During ali trimesters, HDL and APOA1 levels were lower (respectively P=0.0087,
P=0.0373, P=0.0359, P=0.0311) in overweight/obese (n=13) compared to
nonnalweight mothers (n=24) (Figure 1). No changes were noted in maternai plasma
levels for CHOL, LDL, TG, APOB 100 and FF A or in the neonatal lipid profile
(Figure 1).
95
Expression of apolipoproteins in humanfull-term placentas
We compared the expression of APOA1, APOB and APOE m placentas from
normalweight (n=24) and overweight/obese (n=13) women. The placenta! expression
of APOA1, APOB and APOE m.RNA did not change between groups (Figure 2A)
whereas the protein level of APOA 1 was significantly lower in overweight/obese
compared to normalweight women (P<0.0001; Figure 2A). No differences were
observed in the protein levels of APOB100 and APOE between the two groups
(Figure 2A).
Expression and activity of MTP in human full-term placentas
We compared the protein expression and activity of MTP m placentas from
normalweight (n=24) and overweight/obese (n=13) (Figure 2B). No differences were
observed in the expression and activity of MTP between the two groups.
Expression of BMP 1 and PCP E2 in human full-term placentas
We compared the protein expression of BMP1 and PCPE2 m placentas from
normalweight (n=24) and overweight/obese (n=13) women (Figure 2C). The
placenta! expression of BMP 1 and PCPE2 proteins was significantly lower in
overweight/obese compared to normalweight women (P<O.OS; Figure 2C).
96
Correlations between placenta/ APOA 1 prote in leve/ and other parameters
The placenta! protein level of APOAI was correlated to maternai BMI (r=-0.3736,
P=0.0161; data not shown). No correlation was observed between APOAl protein
level and the other parameters (maternai, neonatal and placenta!; data not shown).
Influence of materna/ hypercho/esterolemia on lipid profiles and apolipoproteins
Subject characteristics
Women participating to this study were separated in two groups according to their
plasmal level of CHOL at delivery: Low cholesterol (LC, n=20) (<6.26mmol) and
High cholesterol (HC, n=21) (>6.26mmol) women. Both groups were significantly
different in their pre-pregnancy BMI (P=0.0454) but were similar in the maternai
weight gain, maternai age, gestational age, placenta! weight, birth weight and lenght
and head circumference (Table 3).
Materna/ and neonatallipid profiles
During the lst trimester, CHOL, LDL, HDL and APOBlOO levels were higher
(respectively P=0.0087, P=0.0373, P=0.0359, P=0.0311) in HC than LC mothers
(Figure 3). During the 2nd trimester, CHOL, LDL and APOBlOO levels were higher
(respectively P<O.OOOl, P<O.OOOl, P=0.0003) in HC than LC mothers (Figure 3).
During the 3rd trimester, TG, CHOL, LDL, apoBlOO and FFA levels were higher
(respectively P=0.047, P<O.OOOl, P<O.OOOl, P<O.OOOl, p=0.019) in HC than LC
mothers (Figure 3). No differences were noted for APOAl levels in LC and HC
97
women (Figure 3). In newboms, TG (P=0.0448) plasma levels were significantly
increased in HC compared to LC pregnancies while no changes were noted for
CHOL, LDL, HDL, APOA1, APOB100 and FFA levels (Figure 3).
Expression of APOs in humanfull-term placentas
We compared the mRNA and protein expression of APOA1, APOB and APOE in
placentas from LC (n=20) and HC (n=21) women. The expression of APOA1, APOB
and APOE mRNA did not change between groups (Figure 4A) whereas the protein
level of APOB100 was significantly higher in HC than LC women (P<O.OOOI; Figure
4A). No differences were observed in the protein levels of APOA1 and APOE
between the two groups (Figure 4A).
Expression and activity of MTP in human full-term placentas
We compared the protein expression and activity of MTP in placentas from LC
(n=20) and HC (n=21) women. No differences were observed in· the protein
expression and activity ofMTP between the two groups (Figure 4B).
Expression DERLJ in human full-term placentas
We compared the protein expression of DERL 1 in placentas from LC (n=20) and HC
(n=21) women. The protein expression of DERL 1 was decreased in the placentas of
HC pregnancies compared to LC pregnancies (Figure 4C).
98
Correlations between placenta/ APOBJOO protein leve/ and other parame/ers
The placenta! protein level of APOB 100 was correlated to maternai CHOL, LDL and
TG plasma levels at 1st trimester (respectively r-0.3293, P=0.0499; r=0.378,
P=0.0230; r=-0.4005, P=0.0155); to maternai CHOL, LDL and APOB100 plasma
levels at 2nd trimester (respectively r-0.3470, P=0.0354; r-0.3446, P=0.0367;
r-0.3849, P=0.0205); to maternai APOB 100, TG, CHOL, LDL levels at 3rd trimester
(respectively r-0.4914, P=0.001; r-0.3481, P=0.0222; r-0.4893, P=0.0009 and
r-0.4718, P=0.0016); to neonatal APOB100 plasma levels (r-0.3253, P=0.0463). No
correlation was observed between placenta! APOB 100 protein level and other
maternai, placenta} and neonatal characteristics (data not shown).
Discussion
The mechanisms by which maternai hypercholesterolemia and obesity increase the
risk of developing atherosclerosis and related diseases are uncertain, but likely
include changes in placenta} and fetal lipid metabolism. In our study, we have
focused on the role of APOs in the CHOL transport between the mother, the placenta
and the fetus.
Maternai and neonatal clinicat factors were not affected by BMI or matemallevels of
CHOL with an exception for pre-gregnancy BMI in our LC/HC groups. According to
the World Health Organization, adult normal BMI is between 18,5 and 24,9 kg/m2
[32]. Our values in our LC group are mostly included in this range, suggesting that
99
the BMI variation observed between our two groups is negligible. Moreover, several
studies showed no relation between BMI and CHOL rate [38, 39]. On the other band,
maternai BMI and hypercholestrolemia, as previously demonstrated in our laboratory,
influences the maternai lipid profile: HC women have higher levels of TG, CHOL,
LDL and APOB 100 at delivery than LC women while overweight/obese women have
lower HDL and APOA1 levels than normalweight women [12, 14, 22, 40].
Interestingly the effect of hypercholesterolemia and high BMI on the maternai lipid
profile can be seen as earl y as the 1 st trimester, suggesting that hypercholesterolemia
and high BMI influences fetal development throughout pregnancy even if the
mechanisms involved could however differ. Numerous studies have observed an
increase in LDL and APOB100 associated to elevated plasma CHOL levels [41-43].
In our study, most of the CHOL excess in HC pregnancies appeared to be also
incorporated in LDL particles whereas in overweight/obese pregnancies it is the
CHOL incorporated in HDL particles that is reduced. Several mechanisms might be
involved rn these variations. The frrst mechanism could be a
downregulation/upregulation of LDLR, LOX-1 and SRBI by plasma LDL/HDL
resulting in an uptake decrease or increase [44]. We have previously demonstrated
that the placental expression of CD36 and LOX-1 increases in pregnancies associated
with high BMI white the placenta} expression of LDLR decreases in HC pregnancies
[12, 14, 22]. Althought LDLR and LRP decreased during pregnancy, when maternai
CHOL is elevated, these receptors are responsible of a large but not ali the amount of
CHOL uptake by the placenta. It bas been shown that LOX-1 and LDLR are
100
respectively up- and downregulated in HC patients [12, 45]. A second mechanism
could be that the placenta secretes more APOB100 in HC pregnancies than LC
pregnancies and less APOA 1 in overweight/obese pregnancies than normalweight
pregnancies. Indeed, Abraham et al. [ 46] have demonstrated that primary hepatocytes
from atherogenic diet fed rats secreted more APOB and LDL than normal diet fed
rats. Concerning cord blood composition, our results are consistent with other studies
[ 4 7, 48]. Lipids and lipoproteins levels were lower compared to maternai blood, but
no significant variation except for TG levels was observed between the different
groups which is consistent with the lack of an association between maternai and fetal
CHOL level near to term [27, 49]. Even if the neonatallipid profile is not affected by
high BMI or CHOL, alteration of maternai lipid profile could still have an impact on
the neonatal health. Indeed, maternai pre-pregnancy BMI and APOB levels in early
gestation have been positively associated with the offspring's adiposity at age 5-6
years [50]. In addition, Marseille-Tremblay et al. [40] showed that the amount of
CHOL accumulated in the placenta ofLC and HC pregnancies was similar. Thus, our
results suggest lipid regulation at fetal and/or at placentallevel.
Uptake of lipoproteins by the placenta is weil etablished [51-54] and constitute a
major source of CHOL for the fetus in addition to de novo synthesis [55]. Thus, we
expected that elevated maternai CHOL and BMI would induce a modulation of APOs
expression to promote CHOL efflux from placenta to fetal circulation. Our results
showed correlations between APOA 1 expression and maternai BMI as weil as
101
between placenta} APOB100 expression and maternai plasma levels of CHOL, LDL,
TG and apoB 100, but not with neonatal levels. This suggests that variations in
maternai BMI and plasma levels of CHOL affect mostly APOA1 and APOB100 in
the human full-term placenta. Interestingly, in baboons, it has been demonstrated that
increasing levels of dietary CHOL affects the genetic correlation between APOAI,
APOB and lipoproteins's size (HDL and LDL), suggesting a complex network of
genes affecting lipoprotein metabolism [56]. In our study, no variation was observed
in APOs gene expression, which could be due to the complexity of APOs gene
regulation [57, 58]. Moreover, other studies demonstrated no influence ofCHOL diet
on liver APOB mRNA [43, 59]. Kraft et al. [44] also showed no variation of APOB
mRNA in HepG2 cells loaded with LDL whereas APOB secretion was increased. On
the other hand, a significant increase of APOB 100 and a significant decrease of
APOA1 protein levels were seen. Numerous mechanisms are involved in the post
transcriptional regulation of APOA1 and APOBtOO [60, 61]. A potential mechanism
of regulation could be through MTP. Indeed, Hagan et al. [62] and Bennett et al. [63]
have demonstrated that liver MTP was upregulated in CHOL fed hamsters compared
to normal diet and this regulation might be induced at a transcriptional level by
presence of modified sterol response element (SRE) in MTP gene. Since Madsen et
al. [10] showed MTP expression in human placenta, maternai CHOL could induce
MTP expression through SRE activation, promoting an increase of APOB 100
translocation and initiation of APOB-rich lipoprotein assembly (VLDL and LDL).
But this is not the case in our study since we didn't observe any changes in the
102
expression and activity of MTP. Another mechanism that could explain our results is
the recognition and/or the degradation of proteins that are misfolded at the plasma
membrane and/or within the endosomal system by Derlin proteins. Studies have
shown that DERL 1 is involved in post-transcriptional regulation of APOB 100, breast
cancer resistance protein (BCRP) and LDLR [64-66]. Thus the decrease in DERL 1
expression could partly explain the increase in APOB and LDLR expression in the
placenta of HC pregnancies. A third mechanism could be through BMP1 (bone
morphogenetic protein-1) and PCPE2/PCOLCE2 (procollagen C-proteinase
enhancer-2) involved in APOA1 processing [67]. In HepG2 cells, the inhibition of
BMP1 blocks the maturation of secreted pro-APOA1 to its phospholipid-binding
form, thus reducing circulating levels of APOA1 [68]. In addition, PCPE2 knock out
mice present high levels of pro-APOA1 associated with an impairment of the ability
of HDL to efflux CHOL through ABCA1 [69]. We did observed a decrease in
placenta} expression of BMP 1 and PCPE2 in overweight/obese pregnancies,
suggesting that the maturation of APOA1 could be impaired.
In conclusion, we have demonstrated that placental APOs pool, but not APOs mRNA,
was modulated in HC and overweight/obese pregnancies possibly due to a
downregulation of DERL1, BMP1 and PCPE2 expression. This is the first study
reporting a possible role for DERL1, BMPI and PCPE2 in the human full-term
placenta. But further investigations are needed to identify the exact role of these
proteins. Elevation of APOB100 secretion and decrease of APOA1 secretion in fetal
103
circulation as LDL or HDL particles could promote LDL oxidation susceptibility
leading to atherogenic conditions. This suggests a possible pathway for
atherosclerosis development during fetal life. Moreover, a compensatory action of
reverse CHOL transport appeared to be absent since no variation of APOE expression
was observed. Study of regulation of placenta! ABCA 1 could be interesting to
elucidate placenta} reverse CHOL transport in response to high maternai CHOL/BMI.
Aknowledgements
We wish to thank the employees of St-Luc Hospital for their help. This work was
supported by a CIHR research grant to JL. ED is the recipient of a post-doctoral
scholarship from the FRQS.
104
References
[1] Nicholson AC, Frieda S, Pearce A and Silverstein RL. Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines. Evidence implicating the lipid moiety of the lipoprotein as the binding site. Arteriosclerosis, thrombosis, and vascular biology. 1995; 15(2):269-75. [2] Winkel CA, Gilmore 1, MacDonald PC and Simpson ER. Uptake and degradation of lipoproteins by human trophoblastic cells in primary culture. Endocrinology. 1980;1 07(6): 1892-8. [3] Wadsack C, Hammer A, Levak-Frank S, Desoye G, Kozarsky KF, Hirschrnugl B, Sattler W and Malle E. Selective cholesteryl ester uptake from high density lipoprotein by human frrst trimester and term villous trophoblast cells. Placenta. 2003;24(2-3): 131-43. [4] Woollett LA. Review: Transport of maternai cholesterol to the fetal circulation. Placenta. 2011 ;32 Suppl 2:S218-21. [5] Shao B, Oda MN, Oram 1F and Heinecke 1W. Myeloperoxidase: an oxidative pathway for generating dysfunctional high-density lipoprotein. Chem Res Toxicol. 201 0;23(3):447-54. [6] Mahley RW, Innerarity TL, Rall SC, 1r. and Weisgraber KH. Plasma lipoproteins: apolipoprotein structure and function. 1 Lipid Res. 1984;25(12):1277-94. [7] Richardson B, Palgunachari MN, Anantharamaiah GM, Richards RG, Azrolan N, Wiginton D and Handwerger S. Human placenta! tissue expresses a novel 22.7 kDa apolipoprotein A-1-like protein. Biochemistry. 1996;35(23):7580-5. [8] Do Carmo S, Forest 1C, Giguere Y, Masse A, Lafond 1 and Rassart E. Modulation of Apolipoprotein D levels in human pregnancy and association with gestational weight gain. Reprod Biol Endocrinol. 2009;7:92. [9] Page NM, Butlin D1, Lomthaisong K and Lowry Pl The human apolipoprotein L gene cluster: identification, classification, and sites of distribution. Genomics. 2001 ;74(1 ):71-8. [ 10] Madsen EM, Lindegaard ML, Andersen CB, Damm P and Nielsen LB. Human placenta secretes apolipoprotein B-1 00-containing lipoproteins. 1 Biol Chem. 2004;279(53):55271-6. [11] Rindler M1, Traber MG, Esterman AL, Bersinger NA and Dancis 1. Synthesis and secretion of apolipoprotein E by human placenta and choriocarcinoma cell lines. Placenta. 1991;12(6):615-24. [12] Ethier-Chiasson M, Forest 1C, Giguere Y, Masse A, Marseille-Tremblay C, Levy E and Lafond 1. Modulation of placenta! protein expression of OLR1: implication in pregnancy-related disorders or pathologies. Reproduction. 2008; 136(4):491-502. [13] Furuhashi M, Seo H, Mizutani S, Narita 0, Tomoda Y and Matsui N. Expression of low density lipoprotein receptor gene in human placenta during pregnancy. Mol Endocrinol. 1989;3(8): 1252-6.
105
[14] Ethier-Chiasson M, Duchesne A, Forest JC, Giguere Y, Masse A, Mounier C and Lafond J. Influence of maternallipid profile on placenta! protein expression of LDLr and SR-BI. Biochemical and biophysical research communications. 2007;359(1 ):8-14. [15] Brodsky JL and Fisher EA. The many intersecting pathways underlying apolipoprotein B secretion and degradation. Trends Endocrinol Metab. 2008; 19(7):254-9. [16] van der Velde AE. Reverse cholesterol transport: from classical view to new insights. World J Gastroenterol. 2010;16(47):5908-15. [17] Fielding PE, Miida T and Fielding CJ. Metabolism of low-density lipoprotein free cholesterol by human plasma lecithin-cholesterol acyltransferase. Biochemistry. 1991 ;30(35):8551-7. [18] Zhao Y, Thorngate Apolipoprotein E is the acyltransferase (LCA T) 2005;44(3):1 013-25.
FE, Weisgraber KH, Williams DL and Parks JS. major physiological activator of lecithin-cholesterol on apolipoprotein B lipoproteins. Biochemistry.
[19] Roosbeek S, Vanloo B, Duverger N, Caster H, Breyne J, De Beun 1, Patel H, V andekerckhove J, Shoulders C, Rosseneu M and Peelman F. Three arginine residues in apolipoprotein A-1 are critical for activation of lecithin:cholesterol acyltransferase. J Lipid Res. 2001;42(1):31-40. [20] Aye IL, Waddell BJ, Mark PJ and Keelan JA. Placenta! ABCA1 and ABCG1 transporters efflux cholesterol and protect trophoblasts from oxysterol induced toxicity. Biochim Biophys Acta. 2010;1801(9):1013-24. [21] Stefulj J, Panzenboeck U, Becker T, Hirschmugl B, Schweinzer C, Lang 1, Marsche G, Sadjak A, Lang U, Desoye Gand Wadsack C. Human endothelial cells of the placenta! barrier efficiently de li ver cholesterol to the fetal circulation via ABCA 1 aQ.d ABCGl. Circulation research. 2009;104(5):600-8. [22] Dube E, Gravel A, Martin C, Desparois G, Moussa 1, Ethier-Chiasson M, Forest JC, Giguere Y, Masse A and Lafond J. Modulation of fatty acid transport and metabolism by maternai obesity in the human full-term placenta. Biology of reproduction. 2012;87(1):14, 1-1. [23] Kypreos KE, Teusink B, Van Dijk KW, Havekes LM and Zannis VI. Analysis of the structure and function relationship of the human apolipoprotein E in vivo, using adenovirus-mediated gene transfer. F ASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2001;15(9):1598-600. [24] Palinski W, Yarnashita T, Freigang S and Napoli C. Developmental programming: maternai hypercholesterolemia and immunity influence susceptibility to atherosclerosis. Nutr Rev. 2007;65(12 Pt 2):8182-7. [25] Zhu W, Huang X, He J, Li M and Neubauer H. Arterial intima-media thickening and endothelial dysfunction in obese Chinese children. European journal of pediatries. 2005;164(6):337-44.
106
[26] Weiss R, Shaw M, Savoye M and Caprio S. Obesity dynamics and cardiovascular risk factor stability in obese adolescents. Pediatr Diabetes. 2009; 1 0(6):360-7. [27] Napoli C, D'Armiento FP, Mancini FP, Postiglione A, Witztum JL, Palumbo G and Palinski W. Fatty streak formation occurs in human fetal aortas and is greatly enhanced by maternai hypercholesterolernia. Intimai accumulation of low density lipoprotein and its oxidation precede monocyte recruitment into early atherosclerotic lesions. J Clin Invest. 1997; 1 00( 11 ):2680-90. [28] Napoli C, Glass CK, Witzturn JL, Deutsch R, D'Armiento FP and Palinski W. Influence of maternai hypercholesterolaemia during pregnancy on progression of early atherosclerotic lesions in childhood: Fate of Early Lesions in Children (FELIC) study. Lancet. 1999;354(9186):1234-41. [29] ltabe H, Obama T and Kato R. The Dynamics of Oxidized LDL during Atherogenesis. J Lipids. 2011 ;2011 :418313. [30] Calvo D, Gomez-Coronado D, Suarez Y, Lasuncion MA and Vega MA. Human CD36 is a high affmity receptor for the native lipoproteins HDL, LDL, and VLDL. Journal oflipid research. 1998;39(4):777-88. [31] Freeman DJ. Effects of maternai obesity on fetal growth and body composition: implications for prograrnming and future health. Sernin Fetal Neonatal Med. 2010;15(2):113-8. [32] 2012. World Health Organization. [33] NIH. [34] Dube E, Ethier-Chiasson M and Lafond J. Modulation of cholesterol transport by insulin-treated gestational diabetes mellitus in hurnan full-term placenta. Biology of reproduction. 2013;88(1):16. [35] Lanoix D, Lacasse AA, St-Pierre J, Taylor SC, Ethier-Chiasson M, Lafond J and Vaillancourt C. Erratum to: Quantitative PCR Pitfails: The Case of the Hurnan Placenta. Mol Biotechnol. 2012. [36] Lanoix D, Lacasse AA, St-Pierre J, Taylor SC, Ethier-Chiasson M, Lafond J and Vaillancourt C. Quantitative PCR pitfalls: the case of the hurnan placenta. Mol Biotechnol. 20 12;52(3 ):234-43. [37] Lanoix D, St-Pierre J, Lacasse AA, Viau M, Lafond J and Vaillancourt C. Stability of reference proteins in hurnan placenta: general protein stains are the benchmark. Placenta. 2012;33(3):151-6. [38] Ramsay JE, Ferrell WR, Crawford L, Wallace AM, Greer lA and Sattar N. Maternai obesity is associated with dysregulation of metabolic, vascular, and inflarnmatory pathways. J Clin Endocrinol Metab. 2002;87(9):4231-7. [39] Silliman K, Tall AR, Kretchmer N and Forte TM. Unusual high-density lipoprotein subclass distribution during late pregnancy. Metabolism. 1993;42(12): 1592-9. [40] Marseille-Tremblay C, Ethier-Chiasson M, Forest JC, Giguere Y, Masse A, Mounier C and Lafond J. Impact of maternai circulating cholesterol and gestational
107
diabetes mellitus on lipid metabolism in human term placenta. Molecular reproduction and development. 2008;75(6): 1054-62. [41]'Srivastava RA, Jiao S, Tang JJ, Pfleger BA, Kitchens RT and Schonfeld G. In vivo regulation of low-density lipoprotein receptor and apolipoprotein B gene expressions by dietary fat and cholesterol J.n inbred strains of mi ce. Biochim Biophys Acta. 1991;1086(1):29-43. [42] Dhingra S and Bansat MP. Hypercholesterolemia and apolipoprotein B expression: regulation by selenium status. Lipids Health Dis. 2005;4:28. [43] Serougne C, Felgines C, Ferezou J, Hajri T, Bertin C and Mazur A. Hypercholesterolemia induced by cholesterol- or cystine-enriched diets is characterized by different plasma lipoprotein and apolipoprotein concentrations in rats. J Nutr. 1995;125(1):35-41. [44] Kraft HG, Demosky SJ, Jr., Schumacher K, Brewer HB, Jr. and Hoeg JM. Regulation of LDL receptor, apoB, and apoE protein and mRNA in Hep G2 cells. DNA Cell Biol. 1992;11(4):291-300. [45] Lee H, Park H, Kim YJ, Kim HJ, Ahn YM, Park B, Park JH and Lee BE. Expression of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) in human preeclamptic placenta: possible implications in the process of trophoblast apoptosis. Placenta. 2005 ;26(2-3) :226-3 3. [46] Abraham R, Kumar NS, Kumar GS, Sudhakaran PR and Kurup PA. Synthesis and secretion of apo B containing lipoproteins by primary cultures of hepatocytes isolated from rats fed atherogenic di et. Atherosclerosis. 1993; 1 00( 1 ):75-83. [47] Saba N and Wong HB. Serum HDL cholesterol and apolipoprotein AI, Ail and B levels in Singapore newborns. Biol Neonate. 1987;52(2):93-6. [48] Nagasaka H, Chiba H, Kikuta H, Akita H, Takahashi Y, Yanai H, Hui SP, Fuda H, Fujiwara H and Kobayashi K. Unique character and metabolism of high density lipoprotein (HDL) in fetus. Atherosclerosis. 2002;161(1):215-23. [49] Khoury J, Henriksen T, Christophersen B and Tonstad S. Effect of a· cholesterollowering diet on maternai, cord, and neonatal lipids, and pregnancy outcome: a randomized clinicat trial. Am J Obstet Gynecol. 2005;193(4):1292-301. [50] Gademan MG, Vermeulen M, Oostvogels AJ, Roseboom TJ, Visscher TL, van Eijsden M, Twickler MT and Vrijkotte TG. Maternai Prepregancy BMI and Lipid Profile during Early Pregnancy Are lndependently Associated with Offspring's Body Composition at Age 5-6 Years: The ABCD Study. PLoS One. 2014;9(4):e94594. [51] Cummings SW, Hatley W, Simpson ER and Ohashi M. The binding ofhigh and low density lipoproteins to human placenta! membrane fractions. J Clin Endocrinol Metab. 1982;54(5):903-8. [52] Alsat E, Bouali Y, Goldstein S, Malassine A, Berthelier M, Mondon F and Cedard L. Low-density lipoprotein binding sites in the microvillous membranes of human placenta at different stages of gestation. Mol Cell Endocrinol. 1984;38(2-3):197-203. [53] Gafvels ME, Coukos G, Sayegh R, Coutifaris C, Strickland DK and Strauss JF, 3rd. ·Regulated expression of the trophoblast alpha 2-macroglobulin receptorllow
108
density lipoprotein receptor-related protein. Differentiation and cAMP modulate protein and mRNA levels. J Biol Chem. 1992;267(29):21230-4. [54] Wittmaack FM, Gafvels ME, Bronner M, Matsuo H, McCrae KR, Tomaszewski JE, Robinson SL, Strickland DK and Strauss JF, 3rd. Localization and regulation of the human very low density lipoprotein/apolipoprotein-E receptor: trophoblast expression predicts a role for the receptor in placentallipid transport. Endocrinology. 1995; 136(1 ):340-8. [55] Woollett LA. Origin of cholesterol in the fetal golden Syrian hamster: contribution of de novo sterol synthesis and matemal-derived lipoprotein cholesterol. J Lipid Res. 1996;37(6):1246-57. [56] Rainwater DL, VandeBerg JL and Mahaney MC. Effects of diet on genetic regulation of lipoprotein metabolism in baboons. Atherosclerosis. 201 0;213(2):499-504. [57] Wang AB, Liu DP and Liang CC. Regulation of human apolipoprotein B gene expression at multiple levels. Exp Cell Res. 2003;290(1):1-12. [58] Miller M, Rhyne J, Hamlette S, Bimbaum J and Rodriguez A. Genetics of HDL regulation in humans. Current opinion in lipidology. 2003;14(3):273-9. [59] Sorci-Thomas M, Wilson MD, Johnson FL, Williams DL and Rudel LL. Studies on the expression of genes encoding apolipoproteins B 1 00 and B48 and the low density lipoprotein receptor in nonhuman primates. Comparison of dietary fat and cholesterol. J Biol Chem. 1989;264( 15):9039-45. [60] Davidson NO and Shelness GS. APOLIPOPROTEIN B: mRNA editing, lipoprotein assembly, and presecretory degradation. Annu Rev Nutr. 2000;20:169-93. [61] Fisher EA and Ginsberg HN. Complexity in the secretory pathway: the assembly and secretion of apolipoprotein B-containing lipoproteins. J Biol Chem. 2002;277(20): 17377-80. [62] Hagan DL, Kienzle B, Jamil H and Hariharan N. Transcriptional regulation of human and hamster microsomal triglyceride transfer protein genes. Cell type-specifie expression and response to metabolic regulators. J Biol Chem. 1994;269( 46):28737-44. [63] Bennett AJ, Bruce JS, Salter AM, White DA and Billett MA. Hepatic microsomal triglyceride transfer protein messenger RNA concentrations are increased by dietary cholesterol in hamsters. FEBS Lett. 1996;394(3):247-50. [64] Suzuki M, Otsuka T, Ohsaki Y, Cheng J, Taniguchi T, Hashimoto H, Taniguchi H and Fujimoto T. Derlin-1 and UBXD8 are engaged in dislocation and degradation oflipidated ApoB-100 at lipid droplets. Mol Biol Cell. 2012;23(5):800-10. [65] Sugiyama T, Shuto T, Suzuki S, Sato T, Koga T, Suico MA, Kusuhara H, Sugiyama Y, Cyr DM and Kai H. Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1. Biochemical and biophysical research communications. 2011;404(3):853-8. [66] Schaheen B, Dang H and Fares H. Derlin-dependent accumulation of integral membrane proteins at cell surfaces. Journal ofcell science. 2009;122(Pt 13):2228-39.
109
[67] Zhu J, Gardner J, Pullinger CR, Kane JP, Thompson JF and Francone OL. Regulation of apoAI processing by procollagen C-proteinase enhancer-2 and bone morphogenetic protein-1. Journal oflipid research. 2009;50(7):1330-9. [68] ChauP, Fielding PE and Fielding CJ. Bone morphogenetic protein-1 (BMP-1) cleaves human proapolipoprotein A 1 and regulates its activation for lipid binding. Biochemistry. 2007;46(28):8445-50. [69] Francone OL, Ishida BY, de la Llera-Moya M, Royer L, Happe C, Zhu J, Chalkey RJ, Schaefer P, Cox C, Burlingame A, Kane JP and Rothblat GH. Disruption of the murine procollagen C-proteinase enhancer 2 gene causes accumulation of proapoA-1 and increased HDL levels. Journal oflipid research. 2011;52(11):1974-83.
110
TABLES
Table 1: Primers used for reat-time RT-PCR
Gene Primer set (5'-3') Product Ref size (bp)
APOAJ Sense : GTGACCTCCACCTTCAGCAA 108 Antisense : CTTGCTCATCTCCTGCCTCA
APOBJOO Sense: ACACACTGGACGCT AAGAGGA 106 Antisense : ACTTGTGCT ACCA TCCCA TACT
APOE Sense : GACTGGCCAA TCACAGGC 103 Antisense : CTGTCTCCACCGCTTGCTC
HP RTl Sense : GACCAGTCAACAGGGGACATAA 167 [35, 36] Antisense : AAGCTTGCGACCTTGACC
PP/A Sense: GTTTGCAGACAAGGTCCCA 211 [35, 36] Antisense : ACCCGT A TGCTTT AGGA TG
TOPJ Sense : GGCGAGTGAA TCT AAGG 90 [35, 36] Antisense : CTTAAAGGGT ACAGCGAATG
Ill
Table 2: Maternai, placenta) and neonatal general characteristics of
normalweight and overweight/obese pregnancies. Women are classified according
to the pre-pregnancy maternai BMI (kg/m2) defmed by the World Heaith
Organization. Resuits are expressed as mean ± SEM (*p<0.05, **p<O.Ol,
***p<O.OOI, Student t-test).
Parameters 18.5<BMI<24.9 BMI>26 n 24 13
Mother Maternai BMI (kg/m2
) 21.91±0.45 29.16±0.98*** Maternai weight gain (k_g}_ 12.95±0.74 12.39±0.95 Maternai age (years) 31.86±0.87 33.46±1.58 Gestational age ( weeks)_ 39.23±0.26 39.23±0.36
Placenta Placenta! weightjg}_ 565.4±27.35 628.5±40.08
New born Birth weight {g)_ 3388±88.23 3494±138.1 Birth Iength (cm) 51.6±0.49 51.62±0.63 Head circumference (cm) 34.04±0.27 34.35±0.47
112
Table 3: Maternai, placenta( and neonatal general characteristics of normo and
hypercholesterolemic pregnancies. Women are classified according to their plasma
level of total cholesterol at delivery. Results are expressed as mean ± SEM (*p<0.05,
**p<O.Ol, ***p<O.OOl, Student t-test). LC, low cholesterol level (<6.26 mmol/L);
HC, high cholesterollevel (>6.26 mmol/L).
113
FIGURE LEGENDS
Figure 1: Maternai plasma hormonal and lipid profiles of normalweight and
overweight/obese women. Women are classified according to their pre-pregnancy
maternai BMI (kg/m2). Results are expressed as mean± SEM (*p<0.05, Student t
test). Normalweight, 18.5<BM1<24.9 kg/m2; Overweight/obese, BM1>26 kg/m2•
Figure 2: Expression of APOs, MTP, BMPl and PCEP2 in hum an full-term
placentas of normalweight and overweight/obese women. (A) Placenta! expression
of APOAI, APOB and APOE mRNA and protein were evaluated in normalweight
(n=24) and overweight/obese women (n=13) (B) Placenta! expression and activity of
MTP were evaluated in normalweight (n=24) and overweight/obese women (n=13).
(C) Protein expression of BMPI and PCPE2 was evaluated in normalweight (n=24)
and overweight/obese women (n=13). Results are expressed as mean ± SEM (*
p<0.05, **p<O.Ol, Student t-test). Normalweight, 18.5<BMI<24.9 kg/m2;
Overweight/obese, BMI>26 kg/m2• ·
Figure 3: Maternai plasma hormonal and lipid profiles of normo and
hypercholesterolemic women. Women are classified according to their plasma level
of total cholesterol at delivery. Results are expressed as mean ± SEM (*p<0.05,
**p<O.Ol, ***p<O.OOl, Student t-test). LC, low cholesterol level (<6.26 mmol/L);
HC, high cholesterol levet (>6.26 mmol/L).
114
Figure 4: Expression of APOs, MTP and DERLl in human full-term placentas
of normo and hypercholesterolemic women. (A) Placenta} expression of APOA1,
APOB100 and APOE mRNA and protein was evaluated in LC (n=20) and HC
women (n=21 ). (B) Placenta} expression and activity of MTP were evaluated in LC
(n=20) and HC women (n=21). (C) Densitometric analysis of DERL1 protein levels
was performed in LC (n=20) and HC women (n=21) after normalization with Amido
Black staining. Results are expressed as mean± SEM ( ***P<O.OOOI, Student t-test).
LC, low cholesterol level (<6.26 mmol/L); HC, high cholesterol level (>6.26
mmol/L).
FIGURES
Figure 1
'; ·-'11::! .1! ·< lt: 1:
Venous trimester trimester trimester cord blood
Maternai blood
Venous trimester trimester trimester cord blood
Maternai blood
trimester trimester trimester cord blood
Maternai blood
trimester trimes ter trimester cord blood
Maternai blood
~~ .! lt 1: •
Venous trimester trimester trimester cord blood
Maternai blood
trimester trimester trimester cord blood
Maternai blood
trimester trimester
Maternai blood
115
116
Figure 2
A ! -o. 1:4 li li o.s '1 1 3 '1 1
J! '1 t' o. J! ! 1!
112 ii ~ 0.3 li 1 l!!. 0.2 Il-
r~~ Il~ .. ~ -~ 1 ~ 0.1 t1 .J 1 1 1 o. Il: Normalweisht Ovcrweight ;: Normalweight Ovcrwoight Il: Normalweight Ovcrwcight
i sÎ i -.
_ln r.lj
li -.a =- ~i 1:~ '1 .. 1 '1 ..
Ji 'il 1 ~~ ~~ .:! .:- 1 1 ] lllormalweighl Ovcrweight
B c ~-:;- 0.7 -.. _
::E • '1 i o. =i ti:: li ~o . l! • .... 0.2 Il-
:'Il : ~ : [ 0.1 -~ .. o. Il Il: 'lormalweisht Ovcrweight
~-...
::!~ ~i '11 '11 J t' J! li! ., .:1 (. !-1 1 s:< ![ 1~
IIJ ... --.Iu-O...&.t Ck,,,..,.~-ioA~.t ! 1
Figure 3
'! iii ~ !2.5 .,.;j
.9 15:
Venous trimes ter trimes ter trimes ter cord blood
Maternai blood
First Venous trimestcr trimcster trimester cord blood
Maternai blood
trimes ter trimester trimester cord blood
Maternai blood
nd nd
First Second trimestcr trimester
Maternai blood
.... c,-.
lî -,.;j
•o ·= ~u
-Le E:=:J HC
Venous trimester trimestcr trimester cord blood
Maternai blood
trimester trimes ter trimes ter cord blood
Maternai blood
Venous trimester trimester trimester cord blood
Maternai blood
117
Rel
ativ
e n
pre
a•'
-fi
l .,.
E
•RN
A (
artJ
itn
ry •
lts)
Pla
cnta
l apo
BIO
O
leve
! (•c
f•c fi
l tis
sue)
Re
lllt
M npn~~slœ e
l DE
RL
I p
nte
ln (a
rtJi
tnry
-'t
s)
Pla
cnta
l ap
oBIO
O
leve
! (m
lr'•
cfl
ltl•
••)
Rel
ativ
e n
pre
aai•
ol M
TP
pr
otel
n (a
rtJi
tnry
nnl
ts)
Pla
cnta
l apo
AI
leve
! (•c
f•co
ftln
•)
Rel
ativ
e np
reas
looo
or M
TP
pr
otei
n (a
rtJi
tnry
aal
to)
- -00
119
Annexe 2
Résultats préliminaires sur l'expression'des protéines ABC et de Der/in-1 dans des cultures primaires de trophoblastes humains et dans la lignée BeWo
120
A D
*
.laur 1 .laur z .laur 1 .laur .. Jaur1 JaurZ Jourl
"""""" ........ ~-~21kDo - .,__.1 12 kDo -·•1 1
_____ .__ B
*
z .laur 1 .laur.. .laur 1 Jour z .laur 1 Jour .. AIICG1 1 ~- 1.... ~J110 kilo A11C111 _,._.. 110 kDo
-~---- -·~r··
Figure A2.1: Expression des transporteurs ABC et de derlin-1 dans des cultures primaires de cytotrophoblastes en fonction de leur différenciation progressive en syncytiotrophoblaste. Les cellules cytotrophoblastiques furent isolées de placentas frais selon la technique trypsine-DNase/percoll. Les protéines furent extraites à chaque jour de leur différenciation progressive en syncytiotrophoblaste, soit aux jours 1 à 4, avec l'ajout du tampon RIPA. Les protéines d'intérêt furent quantifiées par immunobuvardage de type Western et normalisées avec une coloration à l'amidoblack. Les résultats ont été quantifiés avec des analyses ANOVA à une variable (* P < 0.05).
A
ill Jh -k B
Îlf Jh
c
Îlf l!t
21-1
ttOkDo
121
D
Îlf 1ft
~72kDII 1
E
Îlf lh
t70kDo
F
Figure A2.2: Expression des transporteurs ABC et de derUn-1 dans la lignée cellulaire BeWo différenciée à la forskoline. Les protéines furent extraites, avec le tampon de lyse RIPA de cellules BeWo différenciées ou non avec l'ajout de forskoline (FSK) (0.5%), le DMSO (0.5%) étant le véhicule dans lequel la FSK est diluée. La technique d'immunobuvardage de type Western a permis de quantifier les protéines d'intérêt, qui furent normalisées avec une coloration à l'amidoblack. Les résultats ont été quantifiés avec des tests t de Student (* P < 0.05, ** P < 0.01, *** P < 0.001).
122
Bibliographie
1. Janssen 1 (2013) The public health burden of obesity in Canada. Can J Diabetes, 37(2): 90-6.
2. Swinburn BA, Sacks G, Hall KD, McPherson K, Finegood DT, Moodie ML et al. (2011) The global obesity pandemie: shaped by global drivers and local environments. Lancet, 378(9793): 804-14.
3. Mittendorfer B, Magkos F, Fabbrini E, Mohammed BS, and Klein S (2009) Relationship between body fat mass and free fatty acid kinetics in men and women. Obesity (Silver Spring), 17( 1 0): 1872-7.
4. Mann n (2002) Diet and risk of coronary heart disease and type 2 diabetes. Lancet, 360(9335): 783-9.
5. Kapil U, Bhadoria AS, Sareen N, and Kaur S (2013) Association of body mass index and waist circumference with hypertension among school children in the age group of 5-16 years belonging to lower income group and middle income group in National Capital Territory of Delhi. lndian J Endocrinol Metab, 17(Suppl 1 ): S345-8.
6. Gotay CC, Katzmarzyk PT, Janssen 1, Dawson MY, Aminoltejari K, and Bartley NL (2013) Updating the Canadian obesity maps: an epidemie in progress. Can J Public Health, 1 04( 1 ): e64-8.
7. Sebire NJ, JoUy M, Harris JP, Wadsworth J, Joffe M, Beard RW et al. (2001) Maternai obesity and pregnancy outcome: a study of 287,213 pregnancies in London Int J Obes Relat Metab Disord, 25(8): 1175-82.
8. Seligman LC, Duncan BB, Branchtein L, Gaio DS, Mengue SS, and Schmidt MI (2006) Obesity and gestational weight gain: cesarean delivery and labor complications. Rev Saude Publica, 40(3): 457-65.
9. Racusin D, Stevens B, Campbell G, and Aagaard KM (2012) Obesity and the risk and detection offetal malformations. Sernin Perinatol, 36(3): 213-21.
10. Power ML and Schulkin J (2012) Maternai obesity, metabolic disease, and allostatic load. Physiol Behav, 106(1): 22-8.
11. V ahratian A, Misra VK, Trudeau S, and Misra DP (20 1 0) Prepregnancy body mass index and gestational age-dependent changes in lipid levels during pregnancy. Obstet Gynecol, 116(1): 107-13.
12. Koukkou E, Watts GF, and Lowy C (1996) Serum lipid, lipoprotein and apolipoprotein changes in gestational diabetes mellitus: a cross-sectional and prospective study. J Clin Pathol, 49(8): 634-7.
13. Whyte K, Kelly H, O'Dwyer V, Gibbs M, O'Higgins A, and Turner MJ (2013) Offspring birth weight and maternai fasting lipids in women screened for gestational diabetes mellitus (GDM). Eur J Obstet Gynecol Reprod Biol, 170(1): 67-70.
123
14. Bell AW and Bauman DE (1997) Adaptations of glucose metabolism during pregnancy and lactation. J Mammary Gland Biol Neoplasia, 2(3): 265-78.
15. Avagliano L, Garo C, and Marconi AM (2012) Placenta! amino acids transport in intrauterine growth restriction. J Pregnancy, 2012: 972562.
16. Rossant J ( 1987) Cell lineage analysis in mammalian embryogenesis. Curr Top Dev Biol, 23: 115-46.
1 7. Choy MY and Manyonda IT ( 1998) The phagocytic activity of human first trimester extravillous trophoblast Hum Reprod, 13(10): 2941-9.
18. Blankenship TN, Enders AC, and King BF (1993) Trophoblastic invasion and the development of uteroplacental arteries in the macaque: immunohistochernical localization of cytokeratins, desmin, type IV collagen, larninin, and fibronectin. Cell Tissue Res, 272(2): 227-36.
19. Huppertz B, Frank HG, Reister F, Kingdom J, Korr H, and Kaufmann P (1999) Apoptosis cascade progresses during turnover of human trophoblast: analysis of villous cytotrophoblast and syncytial fragments in vitro. Lab lnvest, 79(12): 1687-702.
20. Chaouat G, Kolb JP, and Wegmann TG (1983) The murine placenta as an immunological barrier between the mother and the fetus. Immunol Rev, 75: 31-60.
21. King JC (2000) Physiology of pregnancy and nutrient metabolism. Am J Clin Nutr, 71(5 Suppl): 1218S-25S.
22. Feldt-Rasmussen U and Mathiesen ER (2011) Endocrine disorders in pregnancy: physiological and hormonal aspects of pregnancy. Best Pract Res Clin Endocrinol Metab, 25(6): 875-84.
23. Gallego MJ, Porayette P, Kaltcheva MM, Bowen RL, Vadakkadath Meethal S, and Atwood CS (2010) The pregnancy hormones human chorionic gonadotropin and progesterone induce human embryonic stem cell proliferation and differentiation into neuroectodermal rosettes. Stem Cell Res Ther, 1(4): 28.
24. Tan H, Yi L, Rote NS, Hurd WW, and Mesiano S (2012) Progesterone receptor-A and -B have opposite effects on proinflammatory gene expression in human myometrial cells: implications for progesterone actions in human pregnancy and parturition. J Clin Endocrinol Metab, 97(5): E719-30.
25. Robbins JR, Skrzypczynska KM, Zeldovich VB, Kapidzic M, and Bakardjiev Al (2010) Placenta! syncytiotrophoblast constitutes a major barrier to vertical transmission ofListeria monocytogenes. PLoS Pathog, 6(1): e1000732.
26. Omata W, Ackerman WEt, Vandre DD, and Robinson JM (2013) Trophoblast cell fusion and differentiation are mediated by both the protein kinase C and a pathways. PLoS One, 8(11): e81003.
27. Marlin R, Nugeyre MT, Duriez M, Cannou C, Le Breton A, Berkane Net al. (20 11) Decidual soluble factors participate in the control of IDV -1 infection at the matemofetal interface. Retrovirology, 8: 58.
124
28. Gangnard S, Tuikue Ndam NG, Gnidehou S, Quiviger M, Juillerat A, Faure G et al. (2010) Functional and immunological characterization ofthe var2CSADBL5epsilon domain of a placenta! Plasmodium falciparum isolate. Mol Biochem Parasitol, 173(2): 115-22.
29. Hayati AR, Mohamed AE, and Tan GC (2010) An immunohistochemical study of Toll-like receptors 2 and 4 in placenta with and without infection. Malays J Pathol, 32(1): 13-9.
30. van den Berg JP, Westerbeek EA, Berbers GA, van Gageldonk PG, van der Klis FR, and van El burg RM (20 1 0) Transplacental transport of IgG antibodies specifie for pertussis, diphtheria, tetanus, haemophilus influenzae type b, and Neisseria meningitidis serogroup C is lower in preterm compared with term infants. Pediatr Infect Dis J, 29(9): 801-5.
31. Wagener J, Schneider JJ, Baxmann S, Kalbacher H, Borelli C, Nuding S et al. (2013) A peptide derived from the highly conserved protein GAPDH is involved in tissue protection by different antifungal strategies and epithelial immunomodulation. J Invest Dermatol, 133(1): 144-53.
32. Hsiao EY and Patterson PH (2012) Placenta} regulation of matemal-fetal interactions and brain development. Dev Neurobiol, 72(10): 1317-26.
33. Elad D, Levkovitz R, Jaffa AJ, Desoye G, and Hod M (2013) Have We Neglected the Role of Fetal Endothelium in Trans-placenta! Transport? Traffic.
34. Abrams SA (2007) In utero physiology: role in nutrient delivery and fetal development for calcium, phosphorus, and vitamin D. Am J Clin Nutr, 85(2): 604S-7S.
35. Illsley NP (2000) Glucose transporters in the human placenta. Placenta, 21(1): 14-22.
36. Takata K, Kasahara T, Kasahara M, Ezaki 0, and Hirano H (1994) Immunolocalization of glucose transporter GLUTl in the rat placenta! barrier: possible role of GLUT1 and the gap junction in the transport of glucose across the placenta} barrier. Cell Tissue Res, 276(3): 411-8.
3 7. Hauguel-de Mouzon S, Challier JC, Kacemi A, Cauzac M, Malek A, and Girard J (1997) The GLUT3 glucose transporter isoform is differentially expressed within human placenta} cell types. J Clin Endocrinol Metab, 82(8): 2689-94.
38. Wolf HJ and Desoye G (1993) Immunohistochemicallocalization of glucose transporters and insulin receptors in human fetal membranes at term. Histochemistry, 1 00( 5): 3 79-85.
39. Tadokoro C, Yoshimoto Y, Sakata M, Fujimiya M, Kurachi H, Adachi E et al. (1996) Localization of human placenta! glucose transporter 1 during pregnancy. An immunohistochemical study. Histol Histopathol, 11(3): 673-81.
125
40. Leonce J, Brockton N, RobinsonS, Venkatesan S, Bannister P, Raman V et al. (2006) Glucose production in the human placenta Placenta, 27 Suppl A: S103-8.
41. Cleal JK and Lewis RM (2008) The mechanisms and regulation of placenta! amino acid transport to the human foetus. J Neuroendocrinol, 20(4): 419-26.
42. Cleal JK, Glazier JD, Ntani G, Crozier SR, Day PE, Harvey NC et al. (2011) Facilitated transporters mediate net effiux of amino acids to the fetus across the basal membrane of the placenta! syncytiotrophoblast. J Physiol, 589(Pt 4): 987-97.
43. Lattka E, Koletzko B, Zeilinger S, Hibbeln JR, Klopp N, Ring SM et al. (2012) Umbilical cord PUFA are determined by maternai and child fatty acid desaturase (F ADS) genetic variants in the A von Longitudinal Study of Parents and Children (ALSPAC). Br J Nutr, 109(7): 1196-210.
44. Gil-Sanchez A, Koletzko B, and Larque E (2012) Current understanding of placental fatty acid transport Curr Opin Clin Nutr Metab Care, 15(3): 265-72.
45. Baardman ME, Kerstjens-Frederikse WS, Berger RM, Bakker MK, Hofstra RM, and Plosch T (2012) The role of maternal-fetal cholesterol transport in early fetallife: current insights. Biol Reprod, 88(1): 24.
46. Lindegaard ML, WassifCA, Vaisman B, Amar M, Wasmuth EV, Shamburek R et al. (2008) Characterization of placenta! cholesterol transport: ABCA 1 is a potential target for in utero therapy of Smith-Lemli-Opitz syndrome. Hum Mol Genet, 17(23): 3806-13.
47. Woollett LA (2005) Maternai cholesterol in fetal development: transport of cholesterol from the maternai to the fetal circulation. Am J Clin Nutr, 82(6): 1155-61.
48. Larque E, Ruiz-Palacios M, and Koletzko B (2013) Placental regulation of fetal nutrient supply. Curr Opin Clin Nutr Metab Care, 16(3): 292-7.
49. Hanebutt FL, Demmelmair H, Schiessl B, Larque E, and Koletzko B (2008) Long-chain polyunsaturated fatty acid (LC-PUFA) transfer across the placenta Clin Nutr, 27(5): 685-93.
50. Leiva A, de Medina CD, Salsoso R, Saez T, San Martin S, Abarzua F et al. (2013) Maternai hypercholesterolemia in pregnancy associates with umbilical vein endothelial dysfunction: role of endothelial nitric oxide synthase and arginase II. Arterioscler Thromb Vase Biol, 33(10): 2444-53.
51. Herrera E, Amusquivar E, Lopez-Soldado 1, and Ortega H (2006) Maternai lipid metabolism and placentallipid transfer. Horm Res, 65 Suppl 3: 59-64.
52. Hentschke MR, Poli-de-Figueiredo CE, da Costa BE, Kurlak LO, Williams PJ, and Mistry HD (2013) Is the atherosclerotic phenotype of preeclamptic placentas due to altered lipoprotein concentrations and placental lipoprotein receptors? Role of a small-for-gestational-age phenotype. J Lipid Res, 54( 1 0): 2658-64.
126
53. Gautier T, Becker S, Drouineaud V, Menetrier F, Sagot P, Nofer JR et al. (20 1 0) Human luteinized granulosa cells secrete apoB 1 00-containing lipoproteins. J Lipid Res, 51 (8): 2245-52.
54. Ethier-Chiasson M, Duchesne A, Forest JC, Giguere Y, Masse A, Mounier C et al. (2007) Influence of matemallipid profile on placental prote in expression ofLDLr and SR-BI. Biochem Biophys Res Commun, 359(1): 8-14.
55. Dube E, Ethier-Chiasson M, and Lafond J (2013) Modulation of cholesterol transport by insulin-treated gestational diabetes mellitus in human full-term placenta. Biol Reprod, 88(1): 16.
56. lkonen E and Jansen M (2008) Cellular sterol trafficking and metabolism: spotlight on structure. Curr Opin Cell Biol, 20(4): 371-7.
57. BrassE, Hanson E, and O'Tiemey-Ginn PF (2013) Placental oleic acid uptake is lower in male offspring of obese women. Placenta, 34(6): 503-9.
58. Gelissen IC, Harris M, Rye KA, Quinn C, Brown AJ, Kockx Met al. (2006) ABCAl and ABCGI synergize to mediate cholesterol export to apoA-1. Arterioscler Thromb Vase Biol, 26(3): 534-40.
59. Mani 0, Komer M, Ontsouka CE, Sorensen MT, Sejrsen K, Bruckmaier RM et al. (20 11) Identification of ABCA 1 and ABCG 1 in milk fat globules and mammary cells--implications for milk cholesterol secretion. J Dairy Sei, 94(3): 1265-76.
60. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G et al. (1999) Molecular cloning of the human A TP-binding cassette transporter 1 (hABC 1 ): evidence for sterol-dependent regulation in macrophages. Bi oc hem Biophys Res Commun, 257(1): 29-33.
61. Kielar D, Dietmaier W, Langmann T, Aslanidis C, Probst M, Naruszewicz M et al. (200 1) Rapid quantification of human ABCA 1 mRNA in various cell types and tissues by real-time reverse transcription-PCR. Clin Chem, 47(12): 2089-97.
62. Davis W, Jr. (2011) The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells. Biochim Biophys Acta, 1811 ( 12): 1152-64.
63. Ban N, Matsumura Y, Sakai H, Takanezawa Y, Sasaki M, Arai H et al. (2007) ABCA3 as a lipid transporter in pulmonary surfactant biogenesis. J Biol Chem, 282(13): 9628-34.
64. Connors TD, Van Raay TJ, Petry LR, Klinger KW, Landes GM, and Bum TC (1997) The cloning of a human ABC gene (ABC3) mapping to chromosome 16p13.3. Genomics, 39(2): 231-4.
65. Ahn J, Wong JT, and Molday RS (2000) The effect of lipid environment and retinoids on the A TPase activity of AB CR, the photoreceptor ABC transporter responsible for Stargardt macular dystrophy. J Biol Chem, 275(27): 20399-405.
127
66. Molday LL, Rabin AR, and Molday RS (2000) ABCR expression in foveal cone photoreceptors and its role in Stargardt macular dystrophy. Nat Genet, 25(3): 257-8.
67. Sun H and Nathans J (1997) Stargardt's ABCR is localized to the dise membrane ofretinal rod outer segments. Nat Genet, 17(1): 15-6.
68. Kubo Y, Sekiya S, Ohigashi M, Takenaka C, Tamura K, Nada S et al. (2005) ABCA5 resides in lysosomes, and ABCA5 knockout mice develop lysosomal disease-like symptoms. Mol Cell Biol, 25(10): 4138-49.
69. Ye D, Hoekstra M, Out R, Meurs I, Kruijt JK, Hildebrand RB et al. (2008) Hepatic cell-specific A TP-binding cassette (ABC) transporter profiling identifies putative novel candidates for lipid homeostasis in mice. Atherosclerosis, 196(2): 650-8.
70. Gai J, Ji M, Shi C, Li W, Chen S, Wang Y et al. (2013) FoxO regulates expression of ABCA6, an intracellular A TP-binding-cassette transporter responsive to cholesterol. Int J Biochem Cell Biol, 45(11): 2651-9.
71. Yokoyama S, Arakawa R, Wu CA, Iwamoto N, Lu R, Tsujita Met al. (2012) Calpain-mediated ABCA 1 degradation: post-translational regulation of ABCA1 for HDL biogenesis. Biochim Biophys Acta, 1821(3): 547-51.
72. Kaminski WE, Orso E, Diederich W, Klucken J, Drobnik W, and Schmitz G (2000) Identification of a novel human sterol-sensitive A TP-binding cassette transporter (ABCA 7). Biochem Biophys Res Commun, 273(2): 532-8.
73. Mani 0, Korner M, Sorensen MT, Sejrsen K, Wotzkow C, Ontsouka CE et al. (2010) Expression, localization, and functional model of cholesterol transportees in lactating and nonlactating mammary tissues of murine, bovine, and human origin Am J Physiol Regul Integr Comp Physiol, 299(2): R642-54.
74. Tsuruoka S, Ishibashi K, Yamamoto H, Wakaumi M, Suzuki M, Schwartz GJ et al. (2002) Functional analysis of ABCA8, a new drug transporter. Biochem Biophys Res Commun, 298(1): 41-5.
75. Matsumoto N, Kitayama H, Kitada M, Kimura K, Noda M, and Ide C (2003) Isolation of a set of genes expressed in the choroid plexus of the mo use using suppression subtractive hybridization. Neuroscience, 117(2): 405-15.
76. Piehler A, Kaminski WE, Wenzel JJ, Langmann T, and Schmitz G (2002) Molecular structure of a novel cholesterol-responsive A subclass ABC transporter, ABCA9. Biochem Biophys Res Commun, 295(2): 408-16.
77. Wenzel JJ, Kaminski WE, Piehler A, Heimerl S, Langmann T, and Schmitz G (2003) ABCA10, a novel cholesterol-regulated ABCA6-like ABC transporter. Biochem Biophys Res Commun, 306(4): 1089-98.
78. Akiyama M, Sugiyama-Nakagiri Y, Sakai K, McMillan JR, Goto M, Arita K . et al. (2005) Mutations in lipid transporter ABCA 12 in harlequin ichthyosis and functional recovery by corrective gene transfer. J Clin Invest, 115(7): 1777-84.
128
79. Yamanaka Y, Akiyama M, Sugiyama-Nakagiri Y, Sakai K, Goto M, McMillan JR et al. (2007) Expression of the keratinocyte lipid transporter ABCA 12 in developing and reconstituted human epidermis. Am J Pathol, 171(1): 43-52.
80. Knight HM, Pickard BS, Maclean A, Malloy MP, Soares DC, McRae AF et al. (2009) A cytogenetic abnormality and rare coding variants identify ABCA13 as a candidate gene in schizophrenia, bipolar disorder, and depression. Am J Hum Genet, 85(6): 833-46.
81. Garrigues A, Escargueil AE, and Orlowski S (2002) The multidrug transporter, P-glycoprotein, actively mediates cholesterol redistribution in the cell membrane. Proc Natl Acad Sei US A, 99(16): 10347-52.
82. Cordon-Cardo C, O'Brien JP, Casals D, Rittman-Grauer L, Biedler JL, Melamed MR et al. (1989) Multidrug-resistance gene (P-glycoprotein) is expressed by endothelial cells at blood-brain barrier sites. Proc Nad Acad Sei U S A, 86(2): 695-8.
83. Sun M, Kingdom J, Baczyk D, Lye SJ, Matthews SG, and Gibb W (2006) Expression of the multidrug resistance P-glycoprotein, (ABCB 1 glycoprotein) in the human placenta decreases with advancing gestation. Placenta, 27(6-7): 602-9.
84. Demeule M, Jodoin J, Beaulieu E, Brossard M, and Beliveau R (1999) Dexamethasone modulation of multidrug transporters in normal tissues. FEBS Lett, 442(2-3): 208-14.
85. Yu M, Zhang W, Qin L, Tian L, and Zhou C (2010) Enhancement of Pglycoprotein expression by hepatocyte transplantation in carbon tetrachlorideinduced rat liver. Anat Rec (Hoboken), 293(7): 1167-74.
86. Lankat-Buttgereit B and Tampe R (1999) The transporter associated with antigen processing TAP: structure and function. FEBS Lett, 464(3): 108-12.
87. Mutch DM, Anderle P, Fiaux M, Mansourian R, Vidal K, Wahli W et al. (2004) Regional variations in ABC transporter expression along the mo use intestinal tract Physiol Genornics, 17(1): 11-20.
88. Lankat-Buttgereit B and Tampe R (2002) The transporter associated with antigen processing: function and implications in human diseases. Physiol Rev, 82(1): 187-204.
89. Rosmorduc 0, Hermelin B, and Poupon R (2001) MDR3 gene defect in adults with symptomatic intrahepatic and gallbladder cholesterol cholelithiasis. Gastroenterology, 120(6): 1459-67.
90. Evseenk.o DA, Paxton JW, and Keelan JA (2007) lndependent regulation of apical and basolateral drug transporter expression and function in placental trophoblasts by cytokines, steroids, and growth factors. Drug Metab Dispos, 35(4): 595-601.
91. Kojima H, Nies AT, Konig J, Hagmann W, Spring H, Uemura Met al. (2003) Changes in the expression and localization of hepatocellular transporters and radixin in primary biliary cirrhosis. J Hepatol, 39(5): 693-702.
129
92. Frank NY, Margaryan A, Huang Y, Schatton T, Waaga-Gasser AM, Gasser M et al. (2005) ABCB5-mediated doxorubicin transport and chemoresistance in human malignant melanoma Cancer Res, 65(10): 4320-33.
93. Volpicelli ER, Lezcano C, Zhan Q, Girouard SD, Kindelberger DW, Frank MH et al. (2014) The multidrug-resistance transporter ABCB5 is expressed in human placenta Int J Gynecol Pathol, 33( 1 ): 45-51.
94. Krishnamurthy P, Xie T, and Schuetz JD (2007) The role of transportees in cellular herne and porphyrin homeostasis. Pharmacol Ther, 114(3): 345-58.
95. Kiss K, Brozik A, Kucsma N, Toth A, Gera M, Berry Let al. (2012) Shifting the paradigm: the putative mitochondrial protein ABCB6 resides in the lysosomes of cells and in the plasma membrane of erythrocytes. PLoS One, 7(5): e37378.
96. Bekri S, Kispal G, Lange H, Fitzsimons E, Tolmie J, Lill R et al. (2000) Human ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation Blood, 96(9): 3256-64.
97. Mitsuhashi N, Miki T, Senbongi H, Yokoi N, Yano H, Miyazaki M et al. (2000) MT ABC3, a novel mitochondrial A TP-binding cassette protein involved in iron homeostasis. J Biol Chem, 275(23): 17536-40.
98. Melaine N, Satie AP, Lassurguere J, Desmots S, Jegou B, and Samson M (2006) Molecular cloning of several rat ABC transportees including a new ABC transporter, Abcb8, and their expression in rat testis. Int J Androl, 29(3): 392-9.
99. Demirel 0, Bangert 1, Tampe R, and Abele R (2010) Tuning the cellular trafficking of the lysosomal peptide transporter TAPL by its N-terminal domain. Traffic, 11(3): 383-93.
100. Shirihai OS, Gregory T, Yu C, Orkin SH, and Weiss MJ (2000) ABC-me: a novel mitochondrial transporter induced by GA TA-1 during erythroid differentiation Embo J, 19(11 ): 2492-502.
101. Graf SA, Haigh SE, Corson ED, and Shirihai OS (2004) Targeting, irnport, and dimerization of a mammalian mitochondrial ATP binding cassette (ABC) transporter, ABCB10 (ABC-me). J Biol Chem, 279(41): 42954-63.
102. Childs S, Yeh RL, Georges E, and Ling V (1995) Identification of a sister gene to P-glycoprotein. Cancer Res, 55(10): 2029-34.
103. Jedlitschky G, Leier 1, Buchholz U, Bamouin K, Kurz G, and Keppler D ( 1996) Transport of glutathione, glucuronate, and sulfate conjugates by the MRP gene-encoded conjugate export pump. Cancer Res, 56(5): 988-94.
104. St-Pierre MV, Serrano MA, Macias RI, Dubs U, Hoechli M, Lauper U et al. (2000) Expression of members of the multidrug resistance protein family in human term placenta Am J Physiol Regul Integr Comp Physiol, 279(4): R1495-503.
130
105. Daood M, Tsai C, Ahdab-Bannada M, and Watchko JF (2008) ABC transporter (P-gp/ABCB1, MRPIIABCC1, BCRP/ABCG2) expression in the developing human CNS. Neuropediatrics, 39(4): 211-8.
106. Borst P, Evers R, Kool M, and Wijnholds J (2000) A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst, 92(16): 1295-302.
107. Meyer zu Schwabedissen HE, Jedlitschky G, Gratz M, Haenisch S, Linnemann K, Fusch Cet al. (2005) Variable expression of MRP2 (ABCC2) in human placenta: influence of gestational age and cellular differentiation. Drug Metab Dispos, 33(7): 896-904.
108. Nicol MR, Fedoriw Y, Mathews M, Prince HM, Patterson KB, Geller E et al. (2013) Expression of six drug transporters in vaginal, cervical, and colorectal tissues: Implications for drug disposition in HIV prevention. J Clin Phannacol.
109. Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree JM, Smith AJ et al. (1999) MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sei US A, 96(12): 6914-9.
110. Zeng H, Liu G, Rea PA, and Kruh GD (2000) Transport of amphipathic anions by human multidrug resistance protein 3. Cancer Res, 60(17): 4779-84.
111. Lai L and Tan TM (2002) Role of glutathione in the multidrug resistance protein 4 (MRP4/ABCC4)-mediated efflux of cAMP and resistance to purine analogues. Biochem J, 361(Pt 3): 497-503.
112. Kool M, de Haas M, Scheffer GL, Scheper RJ, van Eijk MJ, Juijn JA et al. (1997) Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer celllines. Cancer Res, 57(16): 3537-47.
113. McAleer MA, Breen MA, White NL, and Matthews N (1999) pABC11 (also known as MOAT-C and MRP5), a member of the ABC family of proteins, has anion transporter activity but does not confer multidrug resistance when overexpressed in human embryonic kidney 293 cells. J Biol Chem, 274(33): 23541-8.
114. Wijnholds J, Mol CA, van Deemter L, de Haas M, Scheffer GL, Baas F et al. (2000) Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proc Natl Acad Sei U S A, 97(13): 7476-81.
115. Belinsky MG, Chen ZS, Shchaveleva 1, Zeng H, and Kruh GD (2002) Characterization of the drug resistance and transport properties of multidrug resistance protein 6 (MRP6, ABCC6). Cancer Res, 62(21 ): 6172-7.
116. Kool M, van der Linden M, de Haas M, Baas F, and Borst P (1999) Expression of human MRP6, a homologue of the multidrug resistance protein gene MRP1, in tissues and cancer cells. Cancer Res, 59(1): 175-82.
131
117. Riordan JR, Rommens JM, Kerem B, Alon N, Rozmahel R, Grzelczak Z et al. (1989) Identification of the cystic fibrosis gene: cloning and characterization ofcomplementary DNA. Science, 245(4922): 1066-73.
118. Zhou M, He HJ, Suzuki R, Tanaka 0, Sekiguchi M, Yasuoka Y et al. (2007) Expression of ATP sensitive K+ channel subunit Kir6.1 in rat kidney. Eur J Histochem, 51(1): 43-51.
119. Zhou M, He HJ, Tanaka 0, Sekiguchi M, Kawahara K, and Abe H (2011) Different localization of A TP sensitive K + channel subunits in rat testis. Anat Rec (Hoboken), 294(4): 729-37.
120. Zhou M, He HJ, Suzuki R, Liu KX, Tanaka 0, Sekiguchi M et al. (2007) Localization of sulfonylurea receptor subunits, SUR2A and SUR2B, in rat heart J Histochem Cytochem, 55(8): 795-804.
121. Zhou M, He HJ, Tanaka 0, Sekiguchi M, Kawahara K, and Abe H (2008) Localization of the A TP-sensitive K( +) channel regulatory subunits SUR2A and SUR2B in the rat brain Neurosci Res, 74(2): 91-105.
122. Chen ZS, Hopper-Borge E, Belinsky MG, Shchaveleva I, Kotova E, and Kruh GD (2003) Characterization of the transport properties of human multidrug resistance protein 7 (MRP7, ABCC10). Mol Pharmacol, 63(2): 351-8.
123. Hopper E, Belinsky MG, Zeng H, Tosolini A, Testa JR, and Kruh GD (2001) Analysis of the structure and expression pattern of MRP7 (ABCC 1 0), a new member of the MRP subfamily. Cancer Lett, 162(2): 181-91.
124. Bera TK, Lee S, Salvatore G, Lee B, and Pastan I (2001) MRP8, a new member of ABC transporter superfamily, identified by EST database mining and gene prediction program, is highly expressed in breast cancer. Mol Med, 7(8): 509-16.
125. Yabuuchi H, Shimizu H, Takayanagi S, and Ishikawa T (2001) Multiple splicing variants of two new human A TP-binding cassette transporters, ABCC11 and ABCC12. Biochem Biophys Res Commun, 288(4): 933-9.
126. Yabuuchi H, Takayanagi S, Yoshinaga K, Taniguchi N, Aburatani H, and Ishikawa T (2002) ABCC13, an unusual truncated ABC transporter, is highly expressed in fetal human liver. Biochem Biophys Res Commun, 299(3): 410-7.
127. De Marcos Lousa C, van Roermund CW, Postis VL, Dietrich D, Kerr ID, Wanders RJ et al. (2013) Intrinsic acyl-CoA thioesterase activity of a peroxisomal A TP binding cassette transporter is required for transport and metabolism offatty acids. Proc Nad Acad Sei US A, 110(4): 1279-84.
128. Contreras M, Mosser J, Mandel JL, Aubourg P, and Singh I (1994) The protein coded by the X-adrenoleukodystrophy gene is a peroxisomal integral membrane protein. FEBS Lett, 344(2-3): 211-5.
129. Hoftberger R, Kunze M, Weinhofer I, Aboul-Enein F, Voigtlander T, Oezen I et al. (2007) Distribution and cellular localization of adrenoleukodystrophy protein in human tissues: implications for X-linked adrenoleukodystrophy.
· Neurobiol Dis, 28(2): 165-74.
132
130. Fourcade S, Ruiz M, Camps C, Schluter A, Houten SM, Mooyer PA et al. (2009) A key role for the peroxisomal ABCD2 transporter in fatty acid homeostasis. Am J Physiol Endocrinol Metab, 296(1): E211-21.
131. van Roermund CW, ljlst L, Wagemans T, Wanders RJ, and Waterham HR (2014) A role for the human peroxisomal half-transporter ABCD3 in the oxidation of dicarboxylic acids. Biochim Biophys Acta, 1841(4): 563-8.
132. Coelho D, Kim JC, Miousse IR, Fung S, du Moulin M, Buers 1 et al. (2012) Mutations in ABCD4 cause a new inbom error of vitamin B 12 metabolism. Nat Genet, 44(10): 1152-5.
133. Huang B, Gao Y, Tian D, and Zheng M (2010) A small interfering ABCE1-targeting RNA inhibits the proliferation and invasiveness of small cell lung cancer. Int J Mol Med, 25(5): 687-93.
134. Hassel BA, Zhou A, Sotomayor C, Maran A, and Silverman RH (1993) A dominant negative mutant of 2-5A-dependent RNase suppresses antiproliferative and antiviral effects of interferon. Embo J, 12(8): 3297-304.
135. Tian Y, Han X, and Tian DL (2012) The biological regulation of ABCEI. IUBMB Life, 64(10): 795-800.
136. Richard M, Drouin R, and Beaulieu AD (1998) ABC50, a novel human ATPbinding cassette protein found in tumor necrosis factor-alpha-stimulated synoviocytes. Genomics, 53(2): 137-45.
137. Ando-Akatsuka Y, Shimizu T, Numata T, and Okada Y (2012) Involvements of the ABC protein ABCF2 and alpha-actinin-4 in regulation of cell volume and anion channe1s in human epithelial cells. J Cell Physiol, 227(1 0): 3498-510.
138. Marko L, Paragh G, Ugocsai P, Boettcher A, Vogt T, Schling Pet al. (2012) Keratinocyte A TP binding cassette transporter expression is regulated by ultraviolet light J Photochem Photobiol B, 116: 79-88.
139. Courtney SC, Di H, Stockman BM, Liu H, Scherbik SV, and Brinton MA (20 12) Identification of novel host cell binding partners of Oas 1 b, the prote in conferring resistance to flavivirus-induced disease in mice. J Virol, 86(15): 7953-63.
140. Out R, Hoekstra M, Hildebrand RB, Kruit JK, Meurs 1, Li Z et al. (2006) Macrophage ABCG 1 deletion disrupts lipid homeostasis in alveolar macrophages and moderately influences atherosclerotic lesion development in LDL receptor-deficient mice. Arterioscler Thromb Vase Biol, 26(10): 2295-300.
141. Aye IL, Waddell BJ, Mark PJ, and Keelan JA (2010) Placenta! ABCA1 and ABCG 1 transporters efflux cholesterol and protect trophoblasts from oxysterol induced toxicity. Biochim Biophys Acta, 1801(9): 1013-24.
142. Stefulj J, Panzenboeck U, Becker T, Hirschmugl B, Schweinzer C, Lang 1 et al. (2009) Human endothelial cells of the placenta! barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCGI. Circ Res, 104(5): 600-8.
133
143. Tarr PT and Edwards PA (2008) ABCG1 and ABCG4 are coexpressed in neurons and astrocytes of the CNS and regulate cholesterol homeostasis through SREBP-2. J Lipid Res, 49(1): 169-82.
144. Woehlecke H, Pohl A, Alder-Baerens N, Lage H, and Herrmann A (2003) Enhanced exposure of phosphatidylserine in human gastric carcinoma cells overexpressing the half-size ABC transporter BCRP (ABCG2). Biochem J, 376(Pt 2): 489-95.
145. Yeboah D, Sun M, Kingdom J, Baczyk D, Lye SJ, Matthews SG et al. (2006) Expression of breast cancer resistance protein (BCRP/ABCG2) in human placenta throughout gestation and at term before and after tabor. Can J Physiol Pharmacol, 84(12): 1251-8.
146. Xia CQ, Liu N, Yang D, Miwa G, and Gan LS (2005) Expression, localization, and functional characteristics of breast cancer resistance protein in Caco-2 cells. Drug Metab Dispos, 33(5): 637-43.
147. Robillard KR, HoqueT, and Bendayan R (2012) Expression of ATP-binding cassette membrane transporters in rodent and human sertoli cells: relevance to the permeability of antiretroviral therapy at the blood-testis barrier. J Pharmacol Exp Ther, 340(1): 96-108.
148. Huis M, Brown CD, Windass AS, Sayer R, van den Heuvel JJ, Heemskerk S et al. (2008) The breast cancer resistance protein transporter ABCG2 is expressed in the human kidney proximal tubule apical membrane. Kidney lnt, 73(2): 220-5.
149. Mickley L, Jaïn P, Miyake K, Schriml LM, Rao K, Fojo Tet al. (2001) An ATP-binding cassette gene {ABCG3) closely related to the multidrug transporter ABCG2 (MXRI ABCP) has an unusual A TP-binding domain. Mamm Genome, 12(1): 86-8.
150. Bojanic DD, Tarr PT, Gale GD, Smith DJ, Bok D, Chen B et al. (2010) Differentiai expression and function of ABCG 1 and ABCG4 during development and aging. J Lipid Res, 51(1): 169-81.
151. Phang YL, Soga T, Kitahashi T, and Parhar IS (2012) Cloning and functional expression of novel cholesterol transporters ABCG 1 and ABCG4 in gonadotropin-releasing hormone neurons of the tilapia. Neuroscience, 203: 39-49.
152. Yu L, Li-Hawkins J, Hammer RE, Berge KE, Horton ID, Cohen JC et al. (2002) Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J Clin Invest, 110(5): 671-80.
153. Klett EL, Lee MH, Adams DB, Chavin KD, and Patel SB (2004) Localization of ABCG5 and ABCG8 proteins in human liver, gall bladder and intestine. BMC Gastroenterol, 4: 21.
154. Ceckova M, Libra A, Pavek P, Nachtigal P, Brabec M, Fuchs Ret al. (2006) Expression and functional activity of breast cancer resistance protein (BCRP,
134
ABCG2) transporter in the human choriocarcinoma cellline BeWo. Clin Exp Pharmacol Physiol, 33(1-2): 58-65.
155. Ni Z and Mao Q (2011) ATP-binding cassette efflux transporters in human placenta Curr Pharm Biotechnol, 12(4): 674-85.
156. Evseenko DA, Paxton JW, and Keelan JA (2006) ABC drug transporter expression and functional activity in trophoblast-like cell tines and differentiating primary trophoblast. Am J Physiol Regul lntegr Comp Physiol, 290(5): R1357-65.
157. Bhattacharjee J, Ietta F, Giacomello E, Bechi N, Romagnoli R, Fava A et al. (20 1 0) Expression and localization of A TP binding cassette transporter A 1 (ABCA1) in first trimester and term human placenta. Placenta, 31(5): 423-30.
158. Zhao GJ, Yin K, Fu YC, and Tang CK (2011) The interaction of ApoA-1 and ABCA 1 triggers signal transduction pa th ways to mediate efflux of cellular lipids. Mol Med, 18: 149-58.
159. Yokoyama S (2006) ABCA1 and biogenesis of HDL. J Atheroscler Thromb, 13(1): 1-15.
160. Klon AE, Segrest JP, and Harvey SC (2002) Molecular dynarnics simulations on discoïdal HDL particles suggest a mechanism for rotation in the apo A-1 belt model. J Mol Biol, 324(4): 703-21.
161. Kimura Y, Kodan A, Matsuo M, and Ueda K (2007) Cholesterol fill-in model: mechanism for substrate recognition by ABC proteins. J Bioenerg Biomembr, 39(5-6): 447-52.
162. Janvilisri T, Shahi S, Venter H, Balakrishnan L, and van Veen HW (2005) Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem J, 385(Pt 2): 419-26.
163. Stienstra R, Mandard S, Patsouris D, Maass C, Kersten S, and Muller M (2007) Peroxisome proliferator-activated receptor alpha protects against obesity-induced hepatic inflammation. Endocrinology, 148(6): 2753-63.
164. Tsuchida A, Yamauchi T, Takekawa S, Hada Y, lto Y, Maki Tet al. (2005) Peroxisome proliferator-activated receptor (PP AR)alpha activation increases adiponectin receptors and reduces obesity-related inflammation in adipose tissue: comparison of activation of PP ARalpha, PP ARgamma, and their combination. Diabetes, 54(12): 3358-70.
165. Martinez N, Capobianco E, White V, Pustovrh MC, Higa R, and Jawerbaum A (2008) Peroxisome proliferator-activated receptor alpha activation regulates lipid metabolism in the feto-placental unit from diabetic rats. Reproduction, 136(1): 95-103.
166. Mikael LG, Pancer J, Wu Q, and Rozen R (2012) Disturbed one-carbon metabolism causing adverse reproductive outcomes in rnice is associated with altered expression of apolipoprotein AI and inflammatory mediators PPARalpha, interferon-gamma, and interleukin-10. J Nutr, 142(3): 411-8.
135
167. Hoque MT, Robillard KR, and Bendayan R (2012) Regulation of breast cancer resistant protein by peroxisome proliferator-activated receptor alpha in human brain microvessel endothelial cells. Mol Pharmacol, 81(4): 598-609.
168. Knight BL, Patel DD, Humphreys SM, Wiggins D, and Gibbons GF (2003) Inhibition of cholesterol absorption associated with a PP AR alpha-dependent increase in ABC binding cassette transporter Al in rnice. J Lipid Res, 44(11): 2049-58.
169. Marathe C, Bradley MN, Hong C, Chao L, Wilpitz D, Salazar Jet al. (2009) Preserved glucose tolerance in high-fat-fed C57BL/6 rnice transplanted with PP ARgamma-/-, PP ARdelta-/-, PPARgammadelta-/-, or LXRalphabeta-/bone marrow. J Lipid Res, 50(2): 214-24.
170. Reilly SM and Lee CH (2008) PPAR delta as a therapeutic target in metabolic disease. FEBS.Lett, 582(1): 26-31.
171. Hansen JB, Zhang H, Rasmussen TH, Petersen RK., Flindt EN, and Kristiansen K (200 1) Peroxisome proliferator-activated receptor delta (PP ARdelta )-mediated regulation of preadipocyte proliferation and gene expression is dependent on cAMP signaling. J Biol Chem, 276(5): 3175-82.
172. Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM et al. (2002) Effects of peroxisome proliferator-activated receptor delta on placentation, adiposity, and colorectal cancer. Proc Natl Acad Sei US A, 99(1): 303-8.
173. Barish GD, Narkar VA, and Evans RM (2006) PPAR delta: a dagger in the heart ofthe metabolic syndrome. J Clin Invest, 116(3): 590-7.
174. Wang H, Xie H, Sun X, Tranguch S, Zhang H, Jia X et al. (2007) Stagespecifie integration of maternai and embryonic peroxisome proliferatoractivated receptor delta signaling is critical to pregnancy success. J Biol Chem, 282(52): 37770-82.
175. Jiang YJ, Lu B, Kim P, Paragh G, Schmitz G, Elias PM et al. (2008) PPAR and LXR activators regulate ABCA12 expression in human keratinocytes. J Invest Dermatol, 128(1): 104-9.
176. Brun RP, Tontonoz P, Forman BM, Ellis R, Chen J, Eyans RM et al. (1996) Differentiai activation of adipogenesis by multiple PP AR isoforms .. Genes Dev, 10(8): 974-84.
177. Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K et al. (1999) PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell, 4(4): 597-609.
178. Diaz M, Bassots J, Lopez-Bermejo A, Gomez-Roig MD, de Zegher F, and lbanez L (2012) Placental expression of peroxisome proliferator-activated receptor gamma (PPARgamma): relation to placental and fetal growth. J Clin Endocrinol Metab, 97(8): E1468-72.
179. Capobianco E, White V, Higa R, Martinez N, and Jawerbaum A (2008) Effects of natural ligands of PP ARgamma on lipid metabolism in placenta! tissues from healthy and diabetic rats. Mol Hum Reprod, 14(8): 491-9.
136
180. Yang CM, Lu IH, Chen HY, and Hu ML (2012) Lycopene inhibits the proliferation of androgen-dependent human prostate tumor cells through activation of PPARgamma-LXRalpha-ABCA1 pathway. J Nutr Biochem, 23(1): 8-17.
181. Dong SZ, Zhao SP, Wu ZH, Yang J, Xie XZ, Yu BLet al. (2011) Curcumin promotes cholesterol efflux from adipocytes related to PP ARgammaLXRalpha-ABCA1 passway. Mol Cell Biochem, 358(1-2): 281-5.
182. Szatmari 1, Vamosi G, Brazda P, Balint BL, Benko S, Szeles Let al. (2006) Peroxisome proliferator-activated receptor gamma-regulated ABCG2 expression confers cytoprotection to human dendritic cells. J Biol Chem, 281(33): 23812-23.
183. Miyata KS, McCaw SE, Pa tel HV, Rachubinski RA, and Capone JP ( 1996) The orphan nuclear hormone receptor LXR alpha interacts with the peroxisome proliferator-activated receptor and inhibits peroxisome proliferator signaling. J Biol Chem, 271(16): 9189-92.
184. Wagsater D, Dimberg J, and Sirsjo A (2003) Induction of A TP-binding cassette A 1 by aU-trans retinoic ac id: possible role of li ver X receptor-alpha. Int J Mol Med, 11(4): 419-23.
185. Wu J, Zhang Y, Wang N, Davis L, Yang G, Wang X et al. (2004) Liver X receptor-alpha mediates cholesterol efflux in glomerular mesangial cells. Am J Physiol Renal Physiol, 287(5): F886-95.
186. Gondcaille C, Genin EC, Lopez TE, Dias AM, Geillon F, Andreoletti P et al. (2013) LXR antagonists induce ABCD2 expression. Biochim Biophys Acta, 1841 (2): 259-66.
187. Pawar A, Xu J, Jerks E, Mangelsdorf DJ, and Jump DB (2002) Fatty acid regulation of liver X receptors (LXR) and peroxisome proliferator-activated receptor alpha (PPARalpha) in HEK293 cells. J Biol Chem, 277(42): 39243-50.
188. Weedon-Fekjaer MS, Johnsen GM, Anthonisen EH, Sugulle M, Nebb HI, Duttaroy AK et al. (20 1 0) Expression of Ii ver X receptors in pregnancies complicated by preeclampsia. Placenta, 31 (9): 818-24.
189. Repa JJ and Mangelsdorf DJ (2002) The liver X receptor gene team: potential new players in atherosclerosis. Nat Med, 8(11): 1243-8.
190. Pavan L, Hermouet A, Tsatsaris V, Therond P, Sawamura T, Evain-Brion D et al. (2004) Lipids from oxidized low-density lipoprotein modulate human trophob1ast invasion: invo1vement of nuclear liver X receptors. Endocrinology, 145(10): 4583-91.
191. El Roz A, Bard JM, Valin S, Huvelin JM, and Nazih H (2012) Macrophage apolipoprotein E and proliferation of MCF -7 breast cancer cells: role of LXR. Anticancer Res, 33(9): 3783-9.
192. Ozasa H, Ayaori M, lizuka M, Terao Y, Uto-Kondo H, Yakushiji E et al. (2011) Pioglitazone enhances cholesterol efflux from macrophages by increasing ABCA 11 ABCG 1 expressions vta PPARgamma!LXRalpha
137
pathway: findings from in vitro and ex vivo studies. Atherosclerosis, 219( 1 ): 141-50.
193. Takano J, Mihira N, Fujioka R, Hosoki E, Chishti AH, and Saido TC (2011) Vital role of the calpain-calpastatin system for placental-integrity-dependent embryonic survival. Mol Cell Biol, 31(19): 4097-106.
194. Kumagai K, Ozaki Y, Nakanishi T, Inomata M, Furuno T, Nakanishi Met al. (2008) Role of mu-calpain in human decidua for recurrent miscarriage. Am J Reprod Immunol, 59(4): 339-46.
195. Prangsaengtong 0, Senda K, Doki Y, Park JY, Jo M, Sakurai H et al. (2012) Calpain 1 and -2 play opposite rotes in cord formation of lymphatic endothelial cells via eNOS regulation. Hum Cell, 25(2): 36-44.
196. Hori N, Hayashi H, and Sugiyama Y (2011) Calpain-mediated cleavage negatively regulates the expression levet of ABCG 1. Atherosclerosis, 215(2): 383-91.
197. Eura Y, Yanamoto H, Arai Y, Okuda T, Miyata T, and Kokame K (2012) Derlin-1 deficiency is embryonic lethal, Derlin-3 deficiency appears normal, and Herp deficiency is intolerant to glucose 1oad and ischemia in mice. PLoS One, 7(3): e34298.
198. Sugiyama T, Shuto T, Suzuki S, Sato T, Koga T, Suico MA et al. (2011) Posttranslational negative regulation of glycosylated and non-glycosylated BCRP expression by Derlin-1. Biochem Biophys Res Commun, 404(3): 853-8.
199. Cho S, Lee M, and Jun Y (2013) Forced interaction of cell surface proteins with Derlin-1 in the endoplasmic reticulum is sufficient to induce their dislocation into the cytosol for degradation. Biochem Biophys Res Commun, 430(2): 787-92.
200. Hitt R and Wolf DH (2004) Der1p, a protein required for degradation of malfolded soluble proteins ofthe endoplasmic reticulum: topology and Derllike proteins. FEMS Y east Res, 4(7): 721-9.
201. Knop M, Finger A, Braun T, Hellmuth K, and WolfDH (1996) Derl, a novel protein specifically required for endoplasmic reticulum degradation in yeast. Embo J, 15(4): 753-63.
202. Desforges M, Ditchfield A, Hirst CR, Pegorie C, Martyn-Smith K, Sibley CP et al. (2013) Reduced placental taurine transporter (TauT) activity in pregnancies complicated by pre-eclampsia and maternai obesity. Adv Exp Med Biol, 776: 81-91.
203. Jansson N, Rosario FJ, Gaccioli F, Lager S, Jones HN, Roos Set al. (2013) Activation of placental mTOR signaling and amino acid transporters in obese women giving birth to large babies. J Clin Endocrinol Metab, 98(1): 105-13.
204. Farley DM, Choi J, Dudley DJ, Li C, Jenkins SL, Myatt L et al. (2010) Placenta! amino acid transport and placental leptin resistance in pregnancies complicated by maternai obesity. Placenta, 31 (8): 718-24.
138
205. Webb T, Whittington J, Holland AJ, Soni S, Boer H, Clarke D et al. (2006) CD36 expression and its relationship with obesity in blood cells from people with and without Prader-Willi syndrome. Clin Genet, 69(1): 26-32.
206. Volcik KA, Shaw GM, Zhu H, Lammer EJ, and Finnell RH (2003) Risk factors for neural tube defects: associations between uncoupling protein 2 polymorphisms and spina bifida. Birth Defects Res A Clin Mol Teratol, 67(3): 158-61.
207. Roberts JM, Pearson G, Cutler J, and Lindheimer M (2003) Summary of the NHLBI Working Group on Research on Hypertension During Pregnancy. Hypertension, 41(3): 437-45.
208. NHBP (2000) Report of the National High Blood Pressure Education Program Working Group on High Blood Pressure in Pregnancy. Am J Obstet Gynecol, 183(1 ): S 1-S22.
209. Roberts JM and Cooper DW (2001) Pathogenesis and genetics of preeclampsia Lancet, 357(9249): 53-6.
210. Plosch T, Gellhaus A, van Straten EM, WolfN, Huijkman NC, Schmidt Met al. (2010) The liver X receptor (LXR) and its target gene ABCA1 are regulated upon low oxygen in human trophoblast cells: a reason for alterations in preeclampsia? Placenta, 31 (1 0): 910-8.
211. Bogacz A, Mrozikiewicz PM, Deka-Pawlik D, Seremak-Mrozikiewicz A, Bartkowiak-Wieczorek J, Barlik Met al. (2013) Frequency of G2677T/A and C3435T polymorphisms ofMDR1 gene in preeclamptic women. Ginekol Pol, 84(9): 781-7.
212. Ehrenthal DB, Maiden K, Rao A, West DW, Gidding SS, Bartoshesky Let al. (2013) Independent relation of maternai prenatal factors to early childhood obesity in the offspring. Obstet Gynecol, 121(1): 115-21.
213. Falavigna M, Schmidt MI, Trujillo J, Alves LF, Wendland ER, Torloni MR et al. (20 12) Effectiveness of gestational diabetes treatment: a systematic review with quality of evidence assessment. Diabetes Res Clin Pract, 98(3): 396-405.
214. Anger GJ, Cressman AM, and Piquette-Miller M (2012) Expression of ABC Effiux transporters in placenta from women with insulin-managed diabetes. PLoS One, 7(4): e35027.
215. Kobori T, Harada S, Nakamoto K, and Tokuyama S (2013) Functional alterations of intestinal P-glycoprotein under diabetic conditions. Biol Pharm Bull, 36(9): 1381-90.
216. Nenseter MS, Narverud 1, Graesdal A, Bogsrud MP, Aukrust P, Retterstol K et al. (20 13) Cholesterol effiux mediators in homozygous familial hypercholesterolemia patients on low-density lipoprotein apheresis. J Clin Lipidol, 7(2): 109-16.
217. Gluckman PD, Hanson MA, and Low FM (2011) The role ofdevelopmental plasticity and epigenetics in human health. Birth Defects Res C Embryo Today, 93(1): 12-8.
139
218. Boerschmann H, Pfluger M, Henneberger L, Ziegler AG, and Hummel S (20 1 0) Prevalence and predictors of overweight and insulin resistance in offspring of mothers with gestational diabetes mellitus. Diabetes Care, 33(8): 1845-9.
219. Krishnaveni GV, Veena SR, Hill JC, Kehoe S, Karat SC, and Fall CH (2010) Intrauterine exposure to maternai diabetes is associated with higher adiposity and insulin resistance and clustering of cardiovascular risk markers in lndian children Diabetes Care, 33(2): 402-4.
220. Mills JL, Troendle J, Conley MR, Carter T, and Druschel CM (2010) Maternai obesity and congenital heart defects: a population-based study. Am J Clin Nutr, 91(6): 1543-9.
221. Zielinsky P and Piccoli AL, Jr. (2012) Myocardial hypertrophy and dysfunction in maternai diabetes. Early Hum Dev, 88(5): 273-8.
222. Adlakha YK, Khanna S, Singh R, Singh VP, Agrawal A, and Saini N (2013) Pro-apoptotic miRNA-128-2 modulates ABCA1, ABCG1 and RXRalpha expression and cholesterol homeostasis. Cell Death Dis, 4: e780.
223. Wang Y and Minko T (2004) A novel cancer therapy: combined liposomal hypoxia inducible factor 1 alpha antisense oligonucleotides and an anticancer drug. Biochem Pharmacol, 68(10): 2031-42.
224. Langmann T, Mauerer R, Zahn A, Moehle C, Probst M, Stremmel W et al. (2003) Real-time reverse transcription-PCR expression profiling of the complete human A TP-binding cassette transporter superfamily in various tissues. Clin Chem, 49(2): 230-8.
225. El Roz A, Bard JM, Huvelin JM, and Nazih H (2013) The anti-proliferative and pro-apoptotic effects of the trans9, trans11 conjugated linoleic acid isomer on MCF -7 breast cancer cells are associated with LXR activation. Prostaglandins Leukot Essent Fatty Acids, 88(4): 265-72.
226. Albermann N, Schmitz-Winnenthal FH, Z'Graggen K, Volk C, Hoffmann MM, Haefeli WE et al. (2005) Expression of the drug transporters MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem Pharmacol, 70(6): 949-58.
227. Lano ix D, Lacasse AA, St-Pierre J, Taylor SC, Ethier-Chiasson M, Lafond J et al. (2012) Quantitative PCR pitfalls: the case of the human placenta. Mol Biotechnol, 52(3): 234-43.
228. Baumann M, Korner M, Huang X, Wenger F, Surbek D, and Albrecht C (2013) Placenta! ABCA1 and ABCG1 expression in gestational disease: preeclampsia affects ABCA 1 levels in syncytiotrophoblasts. Placenta, 34( 11): 1079-86.
229. Amandis T, Ferrer-Vicens 1, Torres L, Garcia C, Garcia-Trevijano ER, Zaragoza Ret al. (2014) Differentiai functions of calpain 1 during epithelial cell death and adipocyte differentiation in mammary gland involution. Biochem J, 459(2): 355-68.
140
230. Yun N, Cho Hl, and Lee SM (2014) Impaired autophagy contributes to hepatocellular damage during ischernialreperfusion: herne oxygenase-1 as a possible regulator. Free Radie Biol Med, 68: 168-77.
231. Kaneko Y, Murphy CR, and Day ML (2014) Calpain 2 activity increases at the time of implantation in rat uterine luminal epithelial cells and administration of calpain inhibitor significantly reduces implantation sites. Histochem Cell Biol, 141(4): 423-30.
232. Cui W, Ma J, Wang X, Yang W, Zhang J, and Ji Q (2013) Free fatty acid induces endoplasrnic reticulum stress and apoptosis of beta-cells by Ca2+/calpain-2 pathways. PLoS One, 8(3): e59921.
233. Dube E, Grave} A, Martin C, Desparois G, Moussa 1, Ethier-Chiasson Met al. (20 12) Modulation of fatty ac id transport and metabolism by maternai obesity in the human full-term placenta Biol Reprod, 87(1): 14, 1-1.
234. Ma H, Yang HQ, Takano E, Lee WJ, Hatanaka M, and Maki M (1993) Requirement of different subdomains of calpastatin for calpain inhibition and for binding to calmodulin-like domains. J Biochem, 113(5): 591-9.
235. Evseenko DA, Murthi P, Paxton JW, Reid G, Emerald BS, Mohankumar KM et al. (2007) The ABC transporter BCRP/ABCG2 is a placenta! survival factor, and its expression is reduced in idiopathie human fetal growth restriction. Faseb J, 21(13): 3592-605.
236. Wang L, Zhang D, Yu Y, Guan H, Qiao C, and Shang T (2013) RNA interference-mediated silencing of laminin receptor 1 (LR1) suppresses migration and invasion and down-regulates matrix metalloproteinase (MMP)-2 and MMP-9 in trophoblast cells: implication in the pathogenesis of preeclampsia J Mol Histol, 44(6): 661-8.
237. Dong QZ, Wang Y, Tang ZP, Fu L, Li QC, Wang ED et al. (2013) Derlin-1 is overexpressed in non-small cell lung cancer and promotes cancer cell invasion via EGFR-ERK-mediated up-regulation of MMP-2 and MMP-9. Am J Pathol, 182(3 ): 954-64.
238. Chen SF, Wu CH, Lee YM, Tarn K, Tsai YC, Liou JY et al. (2013) Caveolin-1 interacts with Derlin-1 and promotes ubiquitination and degradation of cyclooxygenase-2 via collaboration with p97 complex. J Biol Chem, 288( 46): 33462-9.
239. Okawara M, Seki H, Matsuoka K, Hashimoto F, Hayashi H, and Takeda S (2009) Exarnination of the expression of cyclooxygenase-2 in placenta villi from sufferers of pregnancy induced hypertension. Biol Pharm Bull, 32(12): 2053-6.
240. Sun F, Zhang R, Gong X, Geng X, Drain PF, and Frizzell RA (2006) Derlin-1 promotes the efficient degradation of the cystic fibrosis transmembrane conductance regulator (CFTR) and CFTR folding mutants. J Biol Chem, 281(48): 36856-63.
141
241. Stolz A, Schweizer RS, Schafer A, and Wolf DH (2010) Dfm1 forms distinct complexes with Cdc48 and the ER ubiquitin ligases and is required for ERAD. Traffic, 11(10): 1363-9.
242. Lee JG, Kim W, Gygi S, and Ye Y (2014) Characterization of the deubiquitinating activity of USP19 and its role in endoplasmic reticulumassociated degradation J Biol Chem, 289(6): 3510-7.
243. Pentikainen MO, Lehtonen EM, and Kovanen PT (1996) Aggregation and fusion ofmodified low density lipoprotein. J Lipid Res, 37(12): 2638-49.
244. Suzuki M, Otsuka T, Ohsaki Y, Cheng J, Taniguchi T, Hashimoto H et al. (2012) Derlin-1 and UBXD8 are engaged in dislocation and degradation of lipidated ApoB-100 at lipid droplets. Mol Biol Cell, 23(5): 800-10.
Recommended