View
0
Download
0
Category
Preview:
Citation preview
Étude de l’intégration chromosomique de l’herpèsvirus humain de type 6 et impact de son infection sur la
reconnaissance des dommages aux télomères
Mémoire
Shella Gilbert-Girard
Maîtrise en microbiologie-immunologie Maître ès sciences (M.Sc.)
Québec, Canada
© Shella Gilbert-Girard, 2016
Étude de l’intégration chromosomique de l’herpèsvirus humain de type 6 et impact de son infection sur la
reconnaissance des dommages aux télomères
Mémoire
Shella Gilbert-Girard
Sous la direction de :
Louis Flamand, directeur de recherche
iii
Résumé
L’herpèsvirus humain de type 6B (HHV-6B) infecte près de 100% des humains et établit une latence
pour le reste de la vie de l’hôte. L’épidémiologie d’HHV-6A est moins connue. Ces deux virus sont
capables d’intégrer leur génome dans les télomères des chromosomes humains. Lorsque cette
intégration a lieu dans une cellule germinale et qu’il y a fécondation, ceci mène à un individu portant
une copie du génome viral dans chacune des cellules de son corps. Cette condition, appelée inherited
chromosomally-integrated HHV-6 (iciHHV-6), résulte en une transmission du génome viral intégré à
50% des descendants et est retrouvée chez environ 1% des humains. Malgré cette importante
fréquence dans la population, l’intégration de HHV-6, de même que son infection et son effet sur ses
cellules hôtes, demeurent peu caractérisés. Dans ce travail, nous avons étudié l’effet de l’infection
d’HHV-6A et HHV-6B sur la réponse de dommages à l’ADN (DDR). Nous avons observé une forte
réponse DDR localisée dans les compartiments de la réplication virale (RC), colocalisant avec une
grande quantité d’ADN télomérique d’origine virale. De plus, les niveaux des ARNm des gènes TRF1,
TRF2 et TPP1, membres du complexe shelterin protégeant les télomères, étaient surexprimés dans
les cellules infectées. Cette augmentation se traduit par une surexpression de la protéine TRF2,
recrutée aux séquences télomériques virales dans les RC. Finalement, nous avons étudié l’effet de
BRACO-19, un inhibiteur de la télomérase, sur l’intégration d’HHV-6A et sa persistance. En utilisant
un essai d’intégration récemment mis au point dans notre laboratoire, nous avons démontré que
l’inhibition de la télomérase menait à une diminution significative de la fréquence de cellules porteuses
d’intégration. Ce travail apporte de nouvelles connaissances sur l’infection de HHV-6 et sur son
mécanisme d’intégration potentiel, de même que la première observation d’une possible participation
des protéines du complexe shelterin dans l’infection de HHV-6.
iv
Abstract
Human herpesviruse 6B (HHV-6B) is a very prevalent virus that infect nearly 100% of humans and
establish a life-long latency. Much less is known regarding HHV-6A epidemiology. Both viruses can
integrate their genome into the telomeres of human chromosomes. When this integration occurs in a
germinal cell, it can lead to an individual carrying one copy of the viral genome in every cell of its body.
This condition, called inherited chromosomally-integrated HHV-6 (iciHHV-6), will then be transmitted to
50% of offspring and is found in approximately 1% of individuals across the world. Despite being so
frequent, much remains to be studied on HHV-6 infection and integration processes. In this work, we
studied the effects of viral infection on DNA damage response (DDR) signaling. We observed a DDR
located in viral replication compartments (RC), together with a large amount of telomeric sequences
that we confirmed to be of viral origin. In addition, mRNAs coding for TRF1, TRF2 and TPP1, members
of the shelterin complex protecting telomeres, were upregulated during infection. Consequently, TRF2
protein was overexpressed and relocated to viral telomeric sequences in RC. Lastly, we’ve examined
the effects of BRACO-19, a compound that affects telomerase activity, on HHV-6 integration and
persistence. Using an integration assay recently developed in our laboratory, we could demonstrate
that in the presence of the telomerase inhibitor, the frequency of cells containing integrated HHV-6 was
significantly reduced. This work brings new knowledge regarding HHV-6 infection and its potential
integration mechanism, as well as the first observation of a possible participation of the shelterin
complex proteins during HHV-6 infection.
v
Table des matières
Résumé .............................................................................................................................................. iii Abstract ............................................................................................................................................. iv Table des matières ............................................................................................................................. v Liste des tableaux ............................................................................................................................ vii Liste des figures ............................................................................................................................. viii Liste des abréviations ...................................................................................................................... ix Remerciements ................................................................................................................................. xi Avant-Propos ................................................................................................................................... xii Chapitre 1 : Introduction ................................................................................................................... 1
1.1 L’herpèsvirus humain de type 6 ................................................................................................. 1 1.1.1 Origine et classification ................................................................................................................... 1 1.1.2 Maladies associées à HHV-6 .......................................................................................................... 2 1.1.3 Le cycle des herpèsvirus ................................................................................................................ 4 1.1.4 Le génome de HHV-6 ..................................................................................................................... 7
1.2 L’intégration chromosomique de HHV-6 .................................................................................... 8 1.2.1 Intégration chromosomique chez les herpèsvirus ........................................................................... 8 1.2.2 Forme héritée de ciHHV-6 .............................................................................................................. 9 1.2.3 Conséquences sur la santé .......................................................................................................... 12 1.2.4 Réactivation du virus intégré ........................................................................................................ 15 1.2.5 Mécanisme d’intégration ............................................................................................................... 15
1.3 Les télomères et l’entretien des chromosomes ........................................................................ 19 1.3.1 La structure des télomères ........................................................................................................... 19 1.3.2 Le complexe shelterin ................................................................................................................... 20 1.3.3 Les G-quadruplexes et leurs ligands ............................................................................................ 22 1.3.4 La télomérase et ALT ................................................................................................................... 24 1.3.5 La réparation des bris d’ADN ........................................................................................................ 25 1.3.6 Virus et détection de dommages à l’ADN ..................................................................................... 29
Chapitre 2 : Hypothèses et objectifs des travaux ......................................................................... 30 Chapitre 3 : L’infection de HHV-6 déclenche une réponse de dommage à l’ADN et recrute TRF2 aux télomères viraux ....................................................................................................................... 31
3.1 Résumé ................................................................................................................................... 31 3.2 Abstract .................................................................................................................................... 33 3.3 Introduction .............................................................................................................................. 34 3.4 Materials and Methods ............................................................................................................. 36 3.5 Results ..................................................................................................................................... 41 3.6 Discussion................................................................................................................................ 45 3.7 Acknowledgments .................................................................................................................... 48 3.8 Funding .................................................................................................................................... 48 3.9 Author Contributions ................................................................................................................ 48 3.10 Bibliography ........................................................................................................................... 49 3.11 Figures ................................................................................................................................... 52 3.12 Supplementary Data .............................................................................................................. 64
Chapitre 4 : Activité de la télomérase et intégration chromosomique de HHV-6 ....................... 65 4.1 Résumé ................................................................................................................................... 65 4.2 Abstract .................................................................................................................................... 67 4.3 Introduction .............................................................................................................................. 68
vi
4.4 Materials and Methods ............................................................................................................. 70 4.5 Results ..................................................................................................................................... 74 4.6 Discussion................................................................................................................................ 77 4.7 Acknowledgments .................................................................................................................... 79 4.8 Author contributions ................................................................................................................. 79 4.9 Bibliography ............................................................................................................................. 80 4.10 Figures ................................................................................................................................... 83
Chapitre 5 : Discussion ................................................................................................................... 90 5.1 DDR et TRF2 dans les RC de HHV-6 ...................................................................................... 90 5.2 Inhibition de la télomérase et intégration de HHV-6 ................................................................. 92
Chapitre 6 : Conclusion ................................................................................................................... 95 Bibliographie .................................................................................................................................... 96
vii
Liste des tableaux
Chapitre 1 Tableau 1 : Recensement des cas de iciHHV-6 publiés dans la littérature. ....................................... 12 Chapitre 4 Table 1 : Effects of BRACO-19 (B19) on HHV-6A integration frequency in Hela and U2OS cells ..... 87 Table 2 : Effects of BRACO-19 (B19) on chromosomal integration of HHV-6 into Hela, MCF-7 and U2OS cells ......................................................................................................................................... 89
viii
Liste des figures
Chapitre 1 Figure 1 : Arbre phylogénétique de la famille des herpèsvirus humains. ............................................. 2 Figure 2 : Schématisation du cycle lytique de HHV-6. ......................................................................... 6 Figure 3 : Représentation schématique du génome de HHV-6. ........................................................... 8 Figure 4 : Intégration de HHV-6 dans les chromosomes de cellules somatiques et germinales. ....... 11 Figure 5 : Représentation des risques potentiels associés à iciHHV-6. ............................................. 14 Figure 6 : Schéma du génome de HHV-6 intégré dans un chromosome cellulaire. ........................... 16 Figure 7 : Schématisation de l’intégration chromosomique de HHV-6 dans un chromosome par recombinaison homologue. ................................................................................................................ 17 Figure 8 : Télomère et complexe shelterin. ........................................................................................ 21 Figure 9 : Structure d’un G4 et interaction avec le BRACO-19. ......................................................... 23 Figure 10 : Modèle de réparation d’un bris d’ADN double-brin par NHEJ et HR. ............................... 28 Chapitre 3
Figure 1 : Activation of the DDR during HHV-6A infection of U2OS cells ........................................... 52 Figure 2 : U2OS cells infected with HHV-6A (U1102 strain) .............................................................. 53 Figure 3 : Colocalization of viral proteins, 53BP1 and telomeric signals ............................................ 54 Figure 4 : Detection of viral temoleres using telomeric probe ............................................................ 55 Figure 5 : Localization of TRF2 at viral replication compartments ...................................................... 56 Figure 6 : TRF2 binds to viral DNA .................................................................................................... 57 Figure 7 : MBP-TRF2 binds telomeric motifs ..................................................................................... 59 Figure 8 : MBP-TRF2 bind viral TMR ................................................................................................. 60 Figure 9 : Expression shelterin complex mRNAs in uninfected and HHV-6A-infected HSB2 cells ..... 61 Figure 10 : TRF2 expression during HHV-6A infection ...................................................................... 62 Figure 11 : Increased TRF2 expression in HHV-6A-infected U2OS cells ........................................... 63 Supplementary figure 1 : MBP-TRF2 does not bind non-telomeric motifs .......................................... 64 Chapitre 4
Figure 1 : Binding of BG4 antibody to various DNA oligonucleotides. ................................................ 83 Figure 2 : Association and dissociation curves of ligands (BG4 and BRACO-19) to the DNA oligos by surface plasmon resonance. .............................................................................................................. 84 Figure 3 : Growth of HHV-6B-infected PBMCs (A) and HHV-6B-infected MOLT-3 cells (B) in the presence of BRACO-19. .................................................................................................................... 85 Figure 4 : Effect of BRACO-19 on HHV-6B (Z29 strain) infection of Molt-3 cells (A) and PMBC (B). . 86 Figure 5 : Metaphase spread of a HeLa ciHHV-6A+ clone. ............................................................... 88
ix
Liste des abréviations
53BP1 p53-binding protein 1 A Adénine AAV (-2) Adeno-associated virus (-2) ADN Acide désoxyribonucléique ALT Alternative lengthening of telomeres ARNm Acide ribonucléique messager ATM Ataxia telangiectasia mutated ATP Adénosine Triphosphate ATR Ataxia telangiectasia and Rad3 related BIR Break-induced repair C Cytosine CD46/134 Cluster of Differenciation 46/134 ChIP Chromatin immunoprecipitation ciHHV-6 chromosomally integrated HHV-6 CSE Cellules souches embryonnaires CSH Cellules souches hématopoïétiques CST CTC1-STN1-TEN1 complex Ct Cycle threshold ddPCR digital droplet polymerase chain reaction DDR DNA damage response D-Loop Displacement loop DNA Desoxyribonucleic acid DNA-Pkcs DNA-dependent protein kinase catalytic subunit DRL/R Direct Repeat Left/Right DSB Double-Strand Break EBV Epstein-Barr Virus ELISA Enzyme-linked immunosorbent assay G Guanine G4 G-quadruplex gH/gL/gQ1/gQ2/gp102 Glycoprotéine H/L/Q1/Q2/102 H2AX (γH2AX) Histone H2A, membre X (H2AX phopshorylée) HBLV Human B lymphotropic virus HCMV Human Cytomegalovirus HHV-6A/B (-7, -8) Human Herpesvirus 6A/B (7, 8) HR Homologous recombination (recombinaison homologue) HSV-1/2 Herpes Simplex Virus 1/2 iciHHV-6 inherited chromosomally integrated HHV-6 ICP0 Infected-cell protein 0 IE (1/2) Immediate Early (1/2) impTMR Imperfect telomeric repeats MBP Maltose-binding protein MDV Marek’s Disease Virus MFI Mean fluorescence intensity MNase Micrococcal nuclease
x
MRN Mre11-Rad50-NBS1 MTT 3-(4-5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NHEJ Non-Homologous End Joining ORF Open reading frame Pac1/2 Cleavage and Packaging elements PBMC Peripheral Blood Mononuclear Cells PIKKs Phosphoinositide 3-kinase related protein kinases PML Promyelocytic leukemia PNA Peptide nucleic acid POT1 Protection of telomere 1 qPCR quantitative polymerase chain reaction RAP1 Repressor-activator protein RC Replication compartment RNF8/168 Ring finger protein 8/168 ROS Reactive oxygen species RPA Replication protein A RT Reverse transcriptase SIDA Syndrome d’immunodéficience acquise SPR Surface Plasmon Resonance T Thymine T-circles Telomeric circles TERC Telomerase RNA component TERRA Telomeric repeat-containing RNA TERT Telomerase reverse transcriptase TIN2 TRF-interacting nuclear protein 2 T-Loop Telomeric loop TMPyP4 5,10,15,20-tetrakis(N-methyl-4-pyridyl)porphyrin TMR Telomeric Repeats TPP1 (initiales de TINT1, PTOP et PIP1) TRF1/2 Telomeric repeat binding factor 1/2 T-SCE Telomere-Sister chromatid exchange U (94) Région Unique (gène 94) UV Ultraviolet VIH Virus de l’immunodéficience humaine VZV Varicella-Zoster Virus
xi
Remerciements
Je tiens tout d’abord à remercier le Dr Louis Flamand pour m’avoir accueillie dans son laboratoire et
pour m’avoir soutenue et encadrée tout au long de mon projet. Sa patience, sa compréhension et son
implication en tant que directeur m’ont beaucoup aidé à avancer et à bâtir la confiance nécessaire pour
poursuivre mes études.
Je voudrais aussi remercier Annie Gravel et Isabelle Dubuc, non seulement pour m’avoir guidée pas à
pas dans le laboratoire et avoir été de précieuses ressources toujours présentes en cas de besoin,
mais aussi pour leur personnalité radieuse. Grâce à vous, travailler au laboratoire a toujours été
plaisant. Merci aussi à Vanessa Collin pour les conversations et les encouragements qui ont aidé à
passer au travers des jours moins faciles. Entre étudiantes, on se comprend!
Merci aussi à toutes les autres personnes travaillant au laboratoire qui m’ont aidé avec une expérience,
un appareil ou tout simplement pour avoir rendu le travail plus agréable par votre présence. Un merci
particulier à Guillaume Paré, Marc Boisvert, Maria Fernandes et Julie-Christine Lévesque pour leur
aide.
Finalement, merci à mes parents pour avoir toujours été présents, même à distance, pour me soutenir.
Votre appui inconditionnel est ce qui m’aide à aller de l’avant. Merci aussi à mes sœurs pour votre
support et pour me donner deux si bons exemples de personnes qui savent foncer et mordre dans la
vie. Je termine avec un gros merci au reste de ma famille et à mes amis pour tout simplement faire
partie de mon entourage et m’aider à garder la tête sur les épaules.
xii
Avant-Propos
Le présent projet porte sur l’étude de l’intégration chromosomique de l’herpèsvirus humain de type 6
et sur l’effet de son infection sur les mécanismes de réparation de l’ADN des cellules infectées. Deux
articles sont insérés et au chapitre 3 et 4.
Le premier article joint à ce mémoire et correspondant au chapitre 3 traite de l’influence de l’infection
de HHV-6 sur la réponse aux dommages à l’ADN de la cellule et sur le complexe protéique shelterin
protégeant les télomères cellulaires. Il est question notamment de la protéine TRF2 et de son
interaction avec l’ADN viral. Cet article est présentement en rédaction finale en vue de publication.
Le deuxième article présenté au chapitre 4 porte sur l’effet de BRACO-19, une drogue inhibitrice de la
télomérase, sur l’intégration chromosomique de HHV-6 et le maintien de cette intégration dans
différentes lignées cellulaires. Cet article a été soumis au Journal of Virology.
Louis Flamand a conçu et dirigé le projet et les expériences pour les deux articles. Il a participé à
l’interprétation des résultats et réalisé les analyses statistiques. Il a également corrigé les articles et
participé à leur rédaction. Annie Gravel a réalisé certaines des manipulations présentées dans les deux
articles et elle a participé à l’interprétation des résultats de la majorité des expériences. Nina
Wallasheck et Benedikt Kaufer ont réalisé le FISH sur les cellules iciHHV-6 dans le deuxième article
au chapitre 4. Sara Artusi, dirigée par Sara Richter, a effectué les tests de toxicité de BRACO-19 sur
plusieurs lignées cellulaires et a réalisé les expériences sur l’effet de cette drogue sur l’ADN
intracellulaire de HHV-6 dans les cellules infectées. Ces résultats sont également présentés dans le
deuxième article.
J’ai écrit les manuscrits des deux articles et j’ai fait la mise au point et la réalisation de la majorité des
manipulations dont il y est question dans chacun d’eux. J’ai analysé et interprété les résultats et
effectué certaines des analyses statistiques.
1
Chapitre 1 : Introduction
1.1 L’herpèsvirus humain de type 6
1.1.1 Origine et classification
Les herpèsvirus forment une grande famille de virus enveloppés à ADN double-brin divisée en trois
sous-groupes. Les alphaherpèsvirus, comprenant le virus de l’herpès simplex (Figure 1), infectent une
grande variété de cellules et s’établissent en latence dans les neurones. Les gammaherpèsvirus, qui
comptent le virus Epstein-Barr (EBV), demeurent en latence dans les lymphocytes, alors que les
betaherpèsvirus persistent dans les macrophages et les lymphocytes. Ces deux dernières sous-
familles ont une réplication plus lente que les alphaherpèsvirus [1]. L’herpèsvirus humain de type 6
(HHV-6) appartient à la sous-famille des betaherpèsvirus, avec HHV-7 et le cytomégalovirus humain
(HCMV). Il existe deux espèces différentes de HHV-6, soit HHV-6A et HHV-6B, qui ont d’abord été
considérées comme formant une même espèce. En 2012, ces deux virus ont été reconnus comme
appartenant à deux espèces distinctes sur la base de leurs différences biologiques, épidémiologiques
et immunologiques par l’International Committee on Taxonomy of Viruses [2]. Avec HHV-7, HHV-6A
et B sont les seuls représentants du genre des roséolovirus. HHV-6A a d’abord été découvert en 1986,
lorsqu’il a été isolé de cellules mononucléaires du sang périphérique (PBMC) de patients atteints du
syndrome d’immunodéficience acquise (SIDA) et de désordres lymphoprolifératifs [3]. Il a tout d’abord
été nommé HBLV pour Human B lymphotropic virus. Par la suite, de nombreux spécimens de HHV-6
ont été isolés dans différentes régions à travers le monde et toutes les souches retrouvées ont pu être
ensuite classées en deux groupes différents, soit A et B [4-7]. Les deux virus sont lymphotropiques,
bien qu’ils infectent également d’autres types cellulaires et présentent un tropisme différent pour les
lignées de lymphocytes in vitro et une réactivité distincte aux anticorps monoclonaux [2]. L’ADN de ces
deux virus contient également des sites de restriction aux endonucléases différents et, puisqu’il n’y a
eu aucune observation de recombinaison entre les deux virus, ils semblent occuper des niches
différentes in vivo [2, 8].
2
Figure 1 : Arbre phylogénétique de la famille des herpèsvirus humains.
Cette famille comprend neuf virus répartis en trois sous-familles. Les gammaherpèsvirus
incluent le virus Epstein-Barr (EBV) et l’herpèsvirus de type 8, responsable du sarcome de
Kaposi. Les alphaherpèsvirus comprennent le virus de la varicelle/zona (VZV) et les virus
de l’herpès simplex de type 1 et 2 (HSV-1 et -2). La sous-famille des betaherpèsvirus est
formée du cytomégalovirus (HCMV), de l’herpèsvirus de type 7 (HHV-7) et des herpèsvirus
de type 6A et B (HHV-6A et -6B). Inspirée de [9, 10].
1.1.2 Maladies associées à HHV-6
HHV-6B est l’agent étiologique de la roséole (roseola infantum ou exanthem subitum), aussi connue
sous le nom de sixième maladie [7, 11, 12]. Il s’agit d’une maladie infantile caractérisée par une haute
fièvre durant quelques jours, parfois suivie d’éruptions cutanées maculopapulaires situées
principalement sur le thorax. Cette maladie passe souvent inaperçue car elle est asymptomatique dans
plusieurs cas. La roséole est généralement bénigne, mais peut mener occasionnellement à des
complications telles que des crises d’épilepsie, de la détresse respiratoire, des encéphalites, des otites,
etc [8, 13]. Elle est responsable de 10 à 45% des admissions aux urgences d’enfants avec une maladie
fébrile et de 1% des hospitalisations d’enfants [13]. Le fait que HHV-6B peut affecter ainsi différents
systèmes suggère que ce virus peut atteindre plusieurs organes et possiblement y rester en latence.
Famille des Herpesviridae humains
Alphaherpèsvirus
Gammaherpèsvirus
Betaherpèsvirus
HCMV
HHV-7HHV-6B
HHV-6A
EBV
HHV-8 VZV
HSV-1
HSV-2
3
Il s’agit d’un virus ubiquitaire et plus de 90% de la population mondiale est infectée et contracte la
roséole dans les deux premières années de vie, lorsque la protection offerte par les anticorps maternels
s’est atténuée [8, 14].
Suite à l’infection primaire, le virus demeure en latence toute la vie de l’hôte, entre autres dans les
lymphocytes, les monocytes et probablement divers organes et cette latence est interrompue
périodiquement par des réactivations [8, 15]. Lors de ces réactivations, HHV-6B se réplique dans les
glandes salivaires et est sécrété dans la salive, moyen par lequel le virus se transfère
vraisemblablement des porteurs sains aux enfants [16-18]. Les individus en santé ne sont pas affectés
par les réactivations du virus, car elles sont contrôlées par le système immunitaire. Cependant, HHV-
6B peut également se réactiver chez des individus immunodéprimés, suite à une greffe ou chez des
patients atteints du SIDA par exemple. Le virus se réactive dans 20 à 30% des cas de greffe d’organe
solide et il se réactive très fréquemment, dans 30 à 50% des cas, lors de greffes de cellules souches
hématopoïétiques (CSH) [19, 20]. La réactivation du virus a lieu généralement dans les deux à quatre
semaines suivant l’opération et elle est associée à de nombreuses complications dont des rejets de
greffe, des réactions de greffon contre l’hôte, des réactivations du HCMV, des encéphalites pouvant
être mortelles, des hépatites, une mortalité plus élevée suite à la greffe, etc. [21-26]. Les greffes de
sang de cordon sont particulièrement sujettes à une réactivation de HHV-6B et aux complications qui
s’en suivent [24]. Les cas de greffe de CSH de cordons ombilicaux suivis d’une infection de HHV-6
peuvent présenter un taux de 10% d’encéphalite limbique, caractérisée par une forte morbidité et
mortalité [27].
Malgré une haute fréquence de réactivation et les nombreuses complications qu’engendre le virus, il
n’existe pas de médicament spécifique ou de traitement standard adapté à HHV-6B ni aucun des
roséolovirus. L’absence de preuve directe d’association cause à effet entre HHV-6 et les diverses
maladies auxquelles il a été associé n’encourage pas le développement de nouvelles thérapies ou
l’étude en profondeur de l’efficacité des drogues déjà en circulation. Les cas de réactivation de HHV-
6B sont normalement traités avec des antiviraux déjà très utilisés tels que ganciclovir. Cette drogue
démontre une relativement bonne efficacité contre HHV-6B, mais des cas de virus développant une
résistance ont été observés [28, 29]. Des traitements au foscarnet, utilisé contre le HCMV dans les cas
de résistance au ganciclovir, ont aussi été tentés, parfois en combinaison avec d’autres antiviraux. Ce
4
médicament fait preuve d’une bonne efficacité, bien qu’il cause certains effets secondaires en limitant
l’utilisation [19, 30, 31]. L’usage d’autres drogues est envisagé, mais ces dernières sont d’abord
synthétisées dans le but de neutraliser un autre virus comme le HCMV. À ce jour, aucun traitement
antiviral ne vise spécifiquement HHV-6 et la création de drogues à large spectre demeure la meilleure
option pour combattre ce virus.
Les complications liées à HHV-6A sont nettement moins connues. Il semblerait que l’infection primaire
est asymptomatique et que le virus est acquis plus tard dans la vie dans la majeure partie du monde
[32], à l’exception de l’Afrique subsaharienne, où HHV-6A infecte plus fréquemment les enfants que
HHV-6B [33]. HHV-6A n’est habituellement pas retrouvé chez les enfants atteints de la roséole [12, 34]
et il ne se réplique pas dans les glandes salivaires. Il n’est donc probablement pas transmis de la
même façon que HHV-6B. Une association a été faite entre HHV-6A et un syndrome fébrile semblable
à la roséole, parfois accompagné d’autres symptômes, en République de la Zambie [35]. Des études
ont aussi démontré que HHV-6A pourrait être impliqué dans la thyroïdite de Hashimoto, de même que
dans la sclérose en plaques [36, 37]. Il pourrait également être un facteur aggravant dans les infections
du virus de l’immunodéficience humaine (VIH) [38, 39]. HHV-6A a été détecté dans divers organes
chez des individus sains et malades sans que des associations certaines ne soient établies entre le
virus et des maladies. Il parait régulièrement impliqué dans divers problèmes de santé, mais aucun
lien sûr de cause à effet n’a été établi. Cependant, bien qu’il se réactive moins souvent que HHV-6B
suite à une greffe, HHV-6A semble être retrouvé plus fréquemment dans le système nerveux de
patients atteints de maladies nerveuses post-greffes [2]. Ainsi, ce virus pourrait bien être un agent
causatif, ou du moins participatif, dans plusieurs maladies, en particulier celles touchant le système
nerveux, mais les preuves de telles associations sont encore incomplètes.
1.1.3 Le cycle des herpèsvirus
Le cycle de vie des herpèsvirus comporte deux stades distincts. Tout d’abord la phase productive ou
lytique, au cours de laquelle l’ADN du virus est répliqué et des virions sont produits. Le virus se lie à la
membrane d’une cellule cible par interactions avec des protéines de surface spécifiques et des
récepteurs cellulaires (Figure 2). HHV-6A reconnaît la protéine cellulaire CD46, retrouvée sur toutes
les cellules nucléées, alors que HHV-6B se lie plutôt à CD134, un récepteur des lymphocytes T [40,
5
41]. Les deux virus se lient aux récepteurs cellulaires par l’intermédiaire d’un complexe de
glycoprotéines, gH-gL-gQ1-gQ2, qui comporte quelques différences entre les deux virus, en particulier
en ce qui concerne les protéines gQ1 et gQ2 [42, 43]. L’enveloppe de l’herpèsvirus fusionne ensuite
avec la membrane de la cellule ou entre par endocytose. Le tégument, une région formée de protéines
et remplissant l’espace entre l’enveloppe et la capside du virus, se dissout, libérant la capside [44].
Celle-ci se rend jusqu’au noyau à l’aide des microtubules et du moteur moléculaire de dynéine du
cytoplasme de la cellule [45]. Elle injecte par un pore nucléaire l’ADN viral, qui sera transcrit à l’aide
de la machinerie de transcription de la cellule [32].
Au cours de cette phase, les herpèsvirus expriment différents gènes de façon séquentielle pour réguler
les activités de la cellule et leur propre réplication. Les gènes viraux peuvent être divisés en trois
catégories dépendamment du temps auquel ils sont exprimés au cours de l’infection. Les gènes
précoces immédiats (IE pour Immediate Early) sont exprimés en premier, au tout début de l’infection.
Ce sont des gènes codant pour des protéines régulatrices contrôlant, entre autres, la transcription des
gènes précoces (Early). Ces derniers sont nécessaires pour la réplication de l’ADN viral, l’accumulation
d’ARN messagers (ARNm) dans le cytoplasme et l’expression des gènes tardifs (Late). Ceux-ci sont
régulés différemment des autres gènes et dépendent de la réplication de l’ADN viral [1]. Nombre d’entre
eux codent pour des glycoprotéines qui formeront l’enveloppe du virus. Les herpèsvirus utilisent à la
fois leurs facteurs viraux et des facteurs cellulaires pour compléter leur cycle. La transcription est
assurée par la polymérase à ARN II cellulaire, mais les herpèsvirus possèdent leur propre machinerie
de réplication d’ADN [1, 46]. Ainsi, HHV-6 contient des gènes codant pour une polymérase à ADN, des
hélicases et des primases, une protéine de liaison à l’origine de réplication et une autre de liaison à
l’ADN simple brin, des protéines de réparation de l’ADN, etc [47]. La réplication du génome du virus a
lieu dans des compartiments de réplication virale (RC) se formant à travers le noyau de la cellule. Dans
le cas de HHV-6, l’ADN viral est répliqué par la polymérase virale de façon circulaire en continu, par
un mécanisme dit « rolling-circle », et le produit résultant est un concatémère, une longue molécule
d’ADN double-brin contenant plusieurs copies du génome. Le concatémère est ensuite clivé en
plusieurs segments contenant chacun le génome complet du virus et ces derniers sont répartis dans
des capsides [32, 48]. Les capsides traversent ensuite la membrane nucléaire interne, puis externe,
par bourgeonnement, ce qui leur fait acquérir temporairement une membrane sans glycoprotéines
qu’elles perdent aussitôt en sortant du noyau [32]. Les protéines du tégument s’assemblent autour des
6
capsides au cours de leur transport jusqu’au site d’enveloppement où les protéines de l’enveloppe sont
présentes, mais le site exact de la tégumentation n’est pas connu [45, 49]. L’enveloppe, contenant les
glycoprotéines nécessaires à l’attachement du virus à ses cellules cibles, est assemblée autour des
capsides et les virions matures sont complétés, puis relâchés dans l’espace extracellulaire. Certains
virus sortent par exocytose, bourgeonnement ou, comme HHV-6 dans ses cellules de prédilection, par
lyse de la cellule, ce qui libère tous les virions [50].
Figure 2 : Schématisation du cycle lytique de HHV-6.
Les étapes du cycle sont expliquées en détails dans la section 1.1.3 ci-dessus. Les lettres IE,
E et L représentent les gènes Immediate Early, Early et Late, respectivement. Inspirée de [32,
49].
La seconde phase du cycle est la latence, pendant laquelle il n’y a pas production de virus. Les
herpèsvirus sont bien connus pour persister en latence dans certaines cellules de l’hôte pour le reste
de la vie de ce dernier. Lors de la phase de latence, ces virus se maintiennent normalement sous forme
d’épisomes circulaires et extrachromosomiques dans les noyaux des cellules hôtes. À ce stade,
l’expression des gènes viraux est minimale, permettant au virus de passer inaperçu. Les épisomes
7
sont maintenus par la machinerie de réplication de la cellule [32]. In vivo, HHV-6 établit probablement
sa latence dans les monocytes et macrophages [15], mais il a été montré qu’il peut entrer en latence
dans une variété de lignées cellulaires telles que des cellules souches hématopoïétiques [51], des
cellules myéloïdes [52], des astrocytes [53] et des oligodendrocytes [54], et il ne s’agit fort
probablement que d’une liste partielle. Les réservoirs in vivo du virus n’ont pas encore été
complètement définis. En latence, HHV-6 n’exprime pas les transcrits spécifiques au cycle lytique,
mais des transcrits de latence sont néanmoins exprimés, provenant par exemple des gènes IE1/IE2,
leur ARNm étant alors épicés spécifiquement pour la latence [55]. L’expression du gène U94 a aussi
été observée et il pourrait être impliqué dans l’établissement ou le maintien de la latence, car il inhibe
l’expression virale pendant cette phase [56-58].
1.1.4 Le génome de HHV-6
Les herpèsvirus ont un large génome de 120kb à 250kb. HHV-6 possède un génome d’une longueur
d’environ 159 kpb pour HHV-6A et environ 162 kpb pour HHV-6B, avec de légères divergences entre
les différentes souches [8, 59]. Au centre du génome se trouve une séquence unique (U)
d’approximativement 145 kpb, contenant l’origine de réplication du génome, flanquée par deux
séquences identiques de répétitions directes (DRL et DRR) d’environ 9 kpb chacune (Figure 3) [47, 59-
61]. La composition de ces régions en guanines et cytosines varie entre 40% dans U et 60% dans les
DR. Les extrémités de chaque DR se terminent par les séquences pac1 (56 pb) et pac2 (80 pb)
impliquées dans le clivage et l’empaquetage du génome du virus pendant l’infection [47, 48]. Dans les
deux DR, pac2 est adjacent à une série de répétitions parfaites du motif TTAGGG (TMR pour telomeric
repeats), qui est typiquement retrouvé à la fin des chromosomes humains dans la région nommée
télomère. Quelques-unes de ces répétitions télomériques se retrouvent aussi réparties dans la région
U [59]. De l’autre côté des DR, attenant à pac1, se trouve une autre série de répétitions télomériques,
cette fois entrecoupées d’autres motifs répétés, nommées répétitions télomériques imparfaites
(impTMR) [62]. La longueur des TMR de HHV-6 varie selon les souches et est généralement longue
de 15 à plus de 180 copies de répétitions télomériques (environ 90pb à 1,1 kpb) [63]. Les deux espèces
de HHV-6 partagent 90% d’homologie de séquence et certains gènes semblent très conservés,
notamment U94 avec plus de 95% d’homologie, mais les deux virus possèdent tout de même des
régions de plus grande hétérogénéité, dont le DRL et sa jonction avec U et le gène IE1, qui est la
section la plus hétérogène entre HHV-6A et B [47, 59, 61]. De tous les autres virus, HHV-7 est celui
8
possédant le génome le plus semblable à ceux de HHV-6A et B. HCMV partage aussi plusieurs
similarités, surtout dans la région U, mais son génome est plus long et plus riche en guanines et
cytosines [47]. HHV-6 a plusieurs glycoprotéines qui sont conservées dans tous les herpèsvirus, dont
gH et gL qui jouent un rôle dans l’attachement de HHV-6 à ses cellules cibles [61].
Figure 3 : Représentation schématique du génome de HHV-6.
Il est composé d’une région unique (U) d’environ 145kpb flanquée par deux séquences
identiques de répétitions directes (DRL et DRR). Les DRs contiennent chacun deux séquences
d’empaquetage (pac1 et pac2), des séquences de répétitions télomériques parfaites (TMR) et
imparfaites (impTMR) et plusieurs cadres de lecture ouverts (ORF) (pas représentés). Tirée de
[64].
1.2 L’intégration chromosomique de HHV-6
1.2.1 Intégration chromosomique chez les herpèsvirus
L’intégration chromosomique du génome viral est un mécanisme utilisé par plusieurs virus, comme les
rétrovirus et les virus adéno-associés (AAV) et qui permet l’entrée en latence. Cependant, ce n’est
généralement pas le cas des herpèsvirus, qui établissent normalement une latence en maintenant leur
ADN sous la forme d’un épisome dans le noyau de leur cellule hôte (section 1.1.3). Une latence par
intégration chromosomique représente donc une façon inhabituelle de procéder pour ce type de virus.
Plusieurs observations d’insertions de fragments de génome de certains herpèsvirus dans des
9
chromosomes cellulaires ont été faites, mais il s’agit surtout de fragments provenant de virus
défectueux qui ne peuvent mener à la réplication d’un produit viral [65]. Quelques herpèsvirus peuvent
toutefois intégrer leur génome entier dans des chromosomes, soit le virus de la maladie de Marek
(MDV), EBV et HHV-6. MDV est un alphaherpèsvirus oncogène causant des lymphomes des
lymphocytes T chez la volaille. Le génome de ce virus, tout comme celui de HHV-6, comprend des
régions répétées contenant des séquences de répétitions télomériques (TTAGGG)n [66]. Suite à une
infection, MDV s’intègre souvent et ne semble pas avoir de préférence pour un chromosome en
particulier, mais il s’intègre davantage dans les télomères à la fin des chromosomes [67]. Il semblerait
que l’intégration chromosomique de ce virus est directement reliée à sa capacité oncogénique. Une
fois intégré, le génome de MDV peut être répliqué, ce qui résulte en la formation de nouvelles copies
simple brin de l’ADN du virus [68]. EBV, appartient plutôt à la sous-famille des gammaherpèsvirus et il
s’agit d’un virus oncogène ubiquitaire dont l’infection primaire, asymptomatique chez les enfants, cause
la mononucléose chez les jeunes adultes. Il infecte les lymphocytes B et les cellules épithéliales et est
également impliqué, entre autres, dans le développement des lymphomes de Burkitt et de Hodgkin, de
même que dans le développement du cancer du nasopharynx [69]. EBV peut intégrer son génome
dans différents sites des chromosomes, souvent, mais pas exclusivement, dans les régions contenant
plusieurs répétitions, riches en guanines et ne codant pour aucun gène. Il a été observé que
l’intégration ne se fait pas au hasard et semble se trouver dans certaines sections précises [70]. Pour
EBV, tout comme pour MDV, l’intégration chromosomique est responsable du pouvoir carcinogène du
virus. Une fois intégré, il semble que le virus ne puisse pas se réactiver, bien qu’il y ait expression de
certains gènes [65].
1.2.2 Forme héritée de ciHHV-6
L’intégration chromosomique de HHV-6 (ciHHV-6) est nettement plus fréquente que celles de MDV et
EBV. Elle a été observée pour la première fois dans le génome de PBMC par Luppi et al [71, 72]. De
nombreuses autres observations de telles intégrations ont ensuite été faites, confirmant la récurrence
du phénomène [73-75]. Depuis, cette intégration, possible pour HHV-6A et B, a été observée chez
plusieurs familles portant le génome entier du virus dans l’un de leurs chromosomes et le transmettant
de génération en génération [76, 77]. Il a été démontré in vitro que HHV-6 peut s’intégrer dans de
nombreuses lignées cellulaires. Il est donc probable qu’à la suite d’une infection lytique chez l’humain,
10
quelques cellules infectées portent l’intégration du virus dans l’un de leurs chromosomes. Lorsque
cette intégration chromosomique a lieu dans une cellule germinale (Figure 4), elle peut être transmise
au descendant, qui porte alors une copie du génome du virus dans chacune des cellules de son corps
et peut le transmettre comme l’un de ses propres gènes à 50% de ses descendants, selon la loi de
Mendel [78, 79]. D’ailleurs, il a été observé que HHV-6 est le virus le plus souvent présent dans le
sperme de donneurs sains et qu’il peut s’attacher à l’acrosome des spermatozoïdes, ce qui pourrait
constituer la voie d’entrée du virus dans un ovule, pour ensuite s’y intégrer [80]. Cette intégration
chromosomique transmise de parent à enfant est nommée « inherited chromosomally integrated HHV-
6 » (iciHHV-6). Approximativement 1% de la population mondiale est iciHHV-6+, ce qui représente plus
de 70 millions d’individus [65, 81]. Le virus le plus fréquemment retrouvé dans le génome des humains
est iciHHV-6B, qui représente environ 75% des cas d’intégration chromosomique de HHV-6, alors
qu’iciHHV-6A est retrouvé dans 25% des cas, un taux assez élevé considérant la fréquence à laquelle
il est retrouvé en infection active dans les humains [81]. Les deux virus peuvent s’intégrer dans
différents chromosomes (Tableau 1), mais l’intégration a toujours lieu dans une région située aux
extrémités des chromosomes nommée le télomère (section 1.3.1) [75].
11
Figure 4 : Intégration de HHV-6 dans les chromosomes de cellules somatiques et
germinales.
Section supérieure : Au cours de l’infection primaire de HHV-6, le virus infecte des cellules
somatiques (lymphocytes, monocytes, etc.) où il intègre son génome et demeure ainsi en
latence pour le reste de la vie de l’hôte. Il n’y a pas transmission du virus intégré aux
descendants. Section inférieure : HHV-6 peut infecter des cellules germinales (spermatozoïde
ou ovule) et s’y intégrer. L’intégration est alors transmise à 50% des descendants. Tirée de [64].
12
Espèce Nombre de cas/ localisation
chromosomique Références
A 1/10q26.3 [75]
2/17p13.3 [75, 77, 82, 83]
1/18q23 [77]
29/ N/A [76, 79, 84-91]
B 1/1q44 [92, 93]
2/9q34.3 [75, 83]
1/11p15.5 [75, 82, 83]
5/17p13.3 [71, 73, 75, 83, 94]
1/18p11.3 [87]
2/19q13.4 [75, 83]
3/22q13 [77, 79]
1/22q13 et 1q44 [74, 78]
51/ N/A [77, 79, 84, 85, 88, 89, 91, 95, 96]
N/A 1/1q44 [97]
1/9q [98]
1/22q [99]
2/ N/A [100, 101] a Les cas d’une même famille sont rapportés comme un événement unique. N/A, non-disponible
Tableau 1 : Recensement des cas de iciHHV-6 publiés dans la littérature.
Cas de iciHHV-6 et sites chromosomiques de l’intégration rapportés dans la littérature en 2010.
Traduit de [65].
1.2.3 Conséquences sur la santé
Les individus iciHHV-6+ peuvent aisément être identifiés en mesurant le nombre relatif de copies de
génome de HHV-6 par cellule, ce qui peut être fait en utilisant une PCR en temps réel (qPCR) ou une
PCR digitale en micro-compartiments (ddPCR) [102, 103]. Les individus ne portant pas iciHHV-6 qui
ont été infectés à l’enfance par HHV-6 et conservent toujours le virus en latence dans certaines cellules
ont normalement de 60 à 80 copies de l’ADN du virus par million de cellules. Les individus portant
iciHHV-6, puisqu’ils ont une copie du génome viral par cellule, ont approximativement un million de
copies de HHV-6 par million de cellules [104]. Lorsqu’une telle quantité de copies virales est détectée
chez un patient, elle peut être faussement interprétée comme une infection active du virus, pendant
laquelle la quantité d’ADN viral en circulation est plus élevée. Cela est particulièrement important lors
d’une greffe où le donneur ou le receveur porte iciHHV-6. La détection de l’ADN du virus peut mener
à un traitement antiviral non nécessaire pouvant avoir des conséquences néfastes sur le patient, d’où
13
l’importance pour les praticiens de s’assurer de bien différencier une infection lytique de HHV-6 d’une
intégration chromosomique lorsqu’un taux élevé de copies de HHV-6 est détecté. Ceci est possible en
vérifiant si de l’ADN de HHV-6 est détectable dans les follicules des cheveux par exemple [81, 105] ou
en usant de tests plus sensibles pouvant distinguer un cas de iciHHV-6 d’une infection active [106].
Outre la possibilité d’un faux diagnostic d’infection lytique, les conséquences sur la santé des individus
portant iciHHV-6 ne sont pas encore bien définies. La condition n’est pas létale et, bien que plusieurs
études aient rapporté quelques possibles associations entre iciHHV-6 et certaines pathologies, jusqu’à
tout récemment, aucune maladie n’avait été directement associée au virus intégré. Des études
récentes suggèrent qu’iciHHV-6 pourrait bel et bien contribuer au développement de certaines
maladies. Pellet et al. ont regroupé les résultats de plusieurs études indépendantes et ont observé que
les individus iciHHV-6+ étaient plus représentés dans la population malade (souffrant de diverses
maladies) que dans la population en santé [81]. En 2015, Flamand et al. ont analysé l’ADN de 20 000
Québécoises et Québécois pour y trouver les individus iciHHV-6+ et vérifier si certaines maladies
étaient plus représentées dans cette population. Cette étude a démontré une association entre iciHHV-
6 et l’angine de poitrine. En effet, les individus iciHHV-6+ sont trois fois plus à risque de développer la
maladie [107].
L’intégration de HHV-6 dans les chromosomes présente plusieurs risques potentiels, dont l’effet de
l’intégration elle-même dans un chromosome. L’insertion d’une séquence étrangère dans le génome
humain peut avoir des conséquences telles que de l’instabilité chromosomique, l’activation de certains
gènes cellulaires ou le rétrécissement du chromosome suite à la résection de l’ADN situé après
l’intégration (Figure 5) [65]. Il est possible que la présence du génome du virus dans les cellules n’ait
aucun effet, mais, comme mentionné à la section 1.1.3, des transcrits viraux sont exprimés pendant la
phase de latence et ont été détectés dans des lignées cellulaires portant ciHHV-6 [55, 56, 58].
L’expression spontanée d’une protéine virale, IE1, a aussi été observée dans certaines cellules ciHHV-
6+, malgré l’absence d’infection lytique (Gravel et al, en soumission). La détection de ces transcrits ou
protéines par le système immunitaire dans un individu iciHHV-6 pourrait causer une réaction en
apparence “auto-immune” contre les cellules exprimant ces antigènes viraux. Dans la situation où les
antigènes HHV-6 sont exprimés dans les cellules endothéliales, cette inflammation chronique et à long
terme pourrait mener à des troubles du système cardiovasculaire, ce qui pourrait expliquer pourquoi
14
iciHHV-6 serait associé à l’angine de poitrine [107]. Un autre risque potentiel d’iciHHV-6 est bien sûr
la possibilité d’une réactivation complète du virus avec production de virion (section 1.2.3).
Figure 5 : Représentation des risques potentiels associés à iciHHV-6.
(1) Aucune transcription de gènes viraux. (2) Expression de gènes viraux, réplication de l’ADN
viral et production de virions. (3) Expression de certains gènes de HHV-6. (4 et 5) Impact de
l’intégration de HHV-6 sur la fonction et l’architecture des télomères et la stabilité
chromosomique. (6) Activation en trans et/ou en cis de gènes cellulaires à la suite de
l’intégration. (7) Tolérance immunitaire grâce à l’expression de gènes de HHV-6 pendant
l’embryogenèse. (8) Destruction de tissus ou de cellules exprimant des antigènes de HHV-6
(provenant de HHV-6 intégré) par des mécanismes de défense immunitaire développés en
réponse à une infection naturelle de HHV-6. Tirée de [65].
15
1.2.4 Réactivation du virus intégré
L’intégration chromosomique de HHV-6 a d’abord été considérée comme un cul-de-sac évolutif ne
permettant pas au virus de reprendre son cycle lytique. Suite à l’intégration, le génome du virus perd
certaines séquences à ses extrémités normalement utiles à son cycle lytique [77]. La possibilité d’une
réactivation de ciHHV-6 était, jusqu’à récemment, un sujet de controverse dans la littérature.
Cependant, de plus en plus de preuves s’accumulent montrant que HHV-6 peut s’exciser des
chromosomes et commencer un cycle lytique de novo in vitro et in vivo, ce qui indique que cette
intégration est bien un moyen d’entrer en latence [77, 108-111]. Une étude en particulier, rapportant
un cas de réactivation de iciHHV-6 in vivo chez un enfant sévèrement immunodéprimé atteint d’un
déficit immunitaire combiné sévère lié à l’X a offert une preuve très convaincante de la possibilité d’une
excision du virus intégré pouvant mener à une infection active [109]. En effet, chez cet enfant, la
réactivation du virus intégré a causé une infection lytique avec pathologies qui a dû être traitée à l’aide
d’antiviraux [109]
Un possible mécanisme de réactivation de ciHHV-6 impliquerait l’excision du virus de sa forme intégrée
par la formation d’un cercle télomérique (T-circle), une molécule d’ADN circulaire qui se détache du
chromosome par un événement de recombinaison homologue (HR) [108, 112]. Dans ce cas-ci, la
recombinaison aurait lieu entre les DR du virus et les T-circles contiendraient alors le génome complet
de HHV-6 avec un seul DR. Ces molécules d’ADN pourraient ensuite être répliquées et des
concatémères pourraient être créés et permettre la reprise du cycle lytique [64]. Il ne s’agit toutefois
que d’une supposition et le mécanisme précis de l’excision du HHV-6 une fois qu’il est intégré est
encore largement inconnu.
1.2.5 Mécanisme d’intégration
Alors même que l’on tente de découvrir comment iciHHV-6 arrive à se réactiver, le mécanisme précis
de l’intégration elle-même demeure très peu compris. Plusieurs hypothèses ont été suggérées et
l’observation des sites d’intégration a permis de faire certaines déductions. Tel que mentionné plus
haut, bien qu’il s’intègre dans plusieurs chromosomes différents, ciHHV-6 n’est retrouvé que dans les
télomères, situés à la fin des chromosomes [65, 73-75, 77]. Les sites d’intégration de iciHHV-6 ont été
analysés et il a été découvert que la jonction entre le télomère et le génome viral se trouve dans la
16
séquence des TMR parfaites du virus, à l’extrémité de la région du DRR (Figure 6) [77]. La région pac2
semble être perdue pendant l’intégration. De plus, à l’autre extrémité du génome viral, la séquence
des TMR imparfaites du DRL est allongée par des répétitions télomériques supplémentaires et la région
pac1 est perdue [112, 113]. Cela suggère que les impTMR à l’extrémité du DRL servent de nouveau
télomère suite à l’intégration et sont prolongées par la télomérase dans les cellules germinales,
permettant au chromosome de retrouver un télomère de longueur suffisante (voir section 1.3.4) [114].
Toutefois, il semble que cet ajout de répétitions télomériques ne compense pas la perte du télomère
naturel, car il a été observé que le télomère portant l’intégration de HHV-6 est souvent le plus court
[112]. Un télomère trop court est synonyme d’instabilité chromosomique pouvant mener à la mort
cellulaire (voir section 1.3.1) et cela pourrait constituer une raison pour laquelle iciHHV-6 a un effet
négatif sur la santé.
Figure 6 : Schéma du génome de HHV-6 intégré dans un chromosome cellulaire.
La jonction entre le chromosome et l’ADN viral se trouve aux TMR parfaites à l’extrémité du
DRR. La séquence de pac2 est perdue lors de l’intégration. La séquence pac1 du DRL est
également perdue et de nouvelles répétitions télomériques sont ajoutées aux TMR imparfaites
du DRL. Adaptée de [112].
Avec ces observations faites sur la forme intégrée du virus, un mécanisme en particulier a été reconnu
comme très probable pour l’intégration chromosomique de HHV-6. L’orientation et les séquences
manquantes du virus intégré sont compatibles avec une intégration par HR entre les TMR du virus et
les télomères chromosomiques [77, 112, 115]. La perte de pac2 au niveau du DRR est un signe que
17
l’intégration se fait en aval de ce site, dans les TMR virales. De plus, il a été démontré que ces
séquences télomériques dans le génome du virus sont essentielles pour son intégration dans les
chromosomes [116], ce qui constitue une preuve en faveur d’une intégration par HR. Les TMR sont
d’ailleurs aussi utiles à l’intégration chromosomique dans le cas de MDV. Des TMR sont également
retrouvées dans plusieurs autres herpèsvirus (HHV-2 équin, HHV-1 à 3 cyprinide, etc) [117]. Des
intégrations chromosomiques dans les télomères n’ont été observées que pour HHV-6A et B et MDV,
mais il n’est pas impossible que d’autres virus possédant des TMR soient capables de s’intégrer.
Cependant, posséder des TMR à ses extrémités pourrait ne pas être suffisant pour permettre
l’intégration chromosomique. HHV-7 possède lui aussi de telles séquences, mais aucune intégration
de HHV-7 n’a été observée [118]. Il infecte cependant très peu de cellules comparativement à HHV-6
et il est possible qu’il n’infecte pas les cellules germinales, ce qui rend l’intégration chromosomique
plus rare et plus difficile à observer [64].
Figure 7 : Schématisation de l’intégration chromosomique de HHV-6 dans un
chromosome par recombinaison homologue.
Celle-ci prend naissance entre le télomère du chromosome et les TMR parfaites du DRR. Le
génome viral et copié et à la division cellulaire suivante, son extrémité distale est érodée et perd
la séquence pac1. Les TMR imparfaites du DRL peuvent ensuite être reconnues comme un
télomère et des répétitions TTAGGG y sont ajoutées. Tirée de [64].
18
En regard des preuves disponibles, la HR semble un mécanisme d’intégration probable pour HHV-6,
mais cette hypothèse n’indique pas les protéines impliquées et le mécanisme exact permettant la HR.
Pour tenter d’expliquer cette recombinaison entre les TMR virales et chromosomiques, plusieurs
mécanismes ont été suggérés. Par exemple, l’intégration de HHV-6 pourrait s’effectuer grâce à un
mécanisme cellulaire de réparation de l’ADN nommé réplication induite par un bris (BIR). Ce
mécanisme permet de réparer les cassures n’ayant qu’une extrémité, à la fourche de réplication par
exemple, ou d’allonger les télomères en absence de télomérase (voir section 1.3.5). Si l’extrémité
simple-brin 3’ du télomère parvenait à s’insérer dans le génome de HHV-6 au niveau des TMR, BIR
pourrait être activée et une copie du génome pourrait être ajoutée au télomère. Suite à cela, comme
supposé plus tôt, le génome du virus pourrait être dégradé jusqu’aux TMR qui seraient alors utilisées
comme modèle pour ajouter de nouvelles répétitions télomériques [115]. Les protéines nécessaires au
processus d’intégration ne sont pas connues, mais dans le cas où l’intégration s’effectuerait par BIR,
aucune protéine virale ne serait essentielle. D’autres mécanismes ont aussi été proposés et certaines
protéines virales ont été soupçonnées de jouer un rôle dans l’intégration chromosomique de HHV-6,
en particulier U94. En effet, il s’agit d’une protéine de HHV-6 qui possède plusieurs caractéristiques
pouvant être utiles à un tel processus comme une activité exonucléase et hélicase, une liaison à l’ADN
préférentiellement aux séquences télomériques et une capacité d’hydrolyser l’ATP [119]. De plus, la
séquence génique codant pour U94 partage 24% d’homologie avec la protéine REP68/78 du
parvovirus adéno-associé de type 2 (AAV-2), qui est essentielle pour l’intégration d’AAV-2 dans le
chromosome 19 [120-122]. U94 peut également substituer REP68/78 dans un mutant où cette protéine
est absente, signifiant qu’U94 a aussi les fonctions nécessaires pour aider à une intégration
chromosomique [123]. HHV-6A et HHV-6B sont d’ailleurs les seuls herpèsvirus humains à posséder
une telle protéine, autant de raisons qui permettaient de supposer qu’U94 pourrait participer à
l’intégration du virus. Toutefois, il a été montré récemment que l’intégration est possible et tout aussi
fréquente, même en l’absence de U94, ce qui indique fortement qu’elle n’est pas nécessaire à
l’intégration [124]. Aucune autre protéine virale n’a été démontrée nécessaire à l’intégration
chromosomique à ce jour. Sachant que HHV-6 peut se réactiver de son état latent intégré et causer
une pathologie, il est important de comprendre comment une telle excision est possible et pour cela,
caractériser le mécanisme d’intégration est nécessaire.
19
1.3 Les télomères et l’entretien des chromosomes
1.3.1 La structure des télomères
Les chromosomes des vertébrés sont terminés par une région nommée télomère composée d’une
série de répétitions TTAGGG qui, bien que très hétérogène, s’étire normalement sur environ 8 à 13
kpb de long chez l’humain [125]. À l’extrémité de cette région se trouve une section simple brin en 3’
d’environ 30 à 500 nucléotides [126-128]. Les télomères jouent un rôle essentiel dans le maintien de
l’intégrité chromosomique et dans la détermination du potentiel réplicatif des cellules. En effet, à
chaque division cellulaire les extrémités des chromosomes ne sont pas complètement répliquées à
cause de la nature semi-conservative de la réplication de l’ADN et de l’incapacité de l’ADN polymérase
à répliquer l’ADN de 3’ vers 5’ [129]. Pour éviter que de l’information génétique ne soit perdue et que
le chromosome ne devienne instable, chaque fin de chromosome est protégée par un télomère qui
sert de zone tampon qui rétrécit à chaque cycle cellulaire jusqu’à l’atteinte d’une longueur critique qui
déclenche la sénescence ou l’apoptose de la cellule via les voies ATR (ataxia telangiectasia and Rad3
related) ou ATM (ataxia telangiectasia mutated) [114, 130, 131]. Si le télomère est raccourci au point
d’avoir moins de 13 répétitions télomériques, il n’est plus protégé et devient instable [132]. Ce
mécanisme permet d’empêcher que les chromosomes deviennent instables ou accumulent trop de
mutations en se débarrassant des cellules trop vieilles, c’est-à-dire, lorsque l’un de leurs télomères
devient trop court. Ainsi, en absence de mécanismes d’élongation de télomères, les cellules
somatiques ont un nombre de divisions limité et leur potentiel de réplication est proportionnel à la
longueur de leur télomère le plus court [133, 134]. En effet, c’est le télomère le plus court qui détermine
la durée de vie d’une cellule, pas la longueur moyenne de tous les télomères.
Les télomères jouent également un autre rôle de première importance. Pour éviter que l’extrémité du
chromosome soit reconnue comme un bris d’ADN double-brin (DSB), la section simple brin en 3’ se
replie et se lie à la portion double brin du télomère pour former la T-Loop (section 1.3.2) [135, 136].
Cette conformation est possible grâce à un complexe protéique, le complexe shelterin, formé de six
protéines qui s’attachent aux télomères et en stabilisent les extrémités en plus d’activement réprimer
les mécanismes de reconnaissance de dommage à l’ADN [130].
20
1.3.2 Le complexe shelterin
Le complexe shelterin (Figure 8) est composé des protéines TRF1 (Telomeric Repeat binding Factor
1), TRF2 (Telomeric Repeat binding Factor 2), RAP1 (Repressor-activator protein), TIN2 (TRF-
interacting nuclear protein 2), POT1 (Protection of Telomere 1) et TPP1 (combiné des noms précédents
attribués à cette protéine) [137]. TRF1 et TRF2, qui partagent 30% d’homologie, sont responsables de
l’attachement du complexe à la section double brin du télomère [138]. Toutes deux forment des
homodimères se liant avec une grande affinité à l’ADN double-brin de façon spécifique à la séquence
TTAGGG, mais ne forment pas d’hétérodimères [139-142]. TRF1 est impliquée dans la réplication des
répétitions télomériques et évite à la fourche de réplication d’être bloquée [143]. Cette protéine est
aussi un régulateur de la longueur des télomères, une fonction qu’elle exécute avec la tankyrase [144].
TRF1 pourrait aussi jouer un rôle dans la répression de la voie ATR en phase S [145]. TRF2 joue un
rôle très important dans la protection des télomères contre les mécanismes de réparation de l’ADN en
réprimant la jonction d’extrémités non homologues (NHEJ) [146, 147]. Elle réprime également la HR
avec l’aide de POT1 et d’un autre complexe, Ku70/80 [130, 148]. TRF2 est également impliquée dans
la répression de la voie ATM et de l’arrêt du cycle cellulaire [146, 149]. Cette protéine est de première
importance dans le maintien de l’intégrité des chromosomes, qu’elle protège des fusions par les
télomères en plus de remplir bien d’autres rôles [150-152]. Tout comme TRF1 et TRF2, POT1 possède
aussi la capacité de se lier directement à l’ADN par une reconnaissance spécifique du motif TTAGGG,
mais elle se charge plutôt de la liaison avec la section simple brin des télomères [153, 154]. Elle est
aussi impliquée dans la protection contre la réponse aux dommages à l’ADN (DDR) et réprime la voie
ATR [146, 155]. TPP1 ne s’attache pas directement à l’ADN, elle interagit avec POT1 et relie cette
dernière au reste du complexe. Cette liaison avec TPP1 augmente substantiellement l’affinité de POT1
pour l’ADN [137]. Il a été suggéré que ces deux protéines jouent un rôle dans la régulation de la
longueur des télomères et agissent comme facteur de processivité de la télomérase [156-159]. TIN2
ne se lie pas non plus à l’ADN, mais elle est importante dans la stabilisation du complexe par ses
liaisons avec TRF1, TRF2 et TPP1 et elle aide ces protéines à accomplir leurs rôles respectifs [160-
163]. L’absence de TPP1 ou TIN2, qui relient POT1 au reste du complexe, provoque l’activation de la
voie ATR [130, 145]. Finalement, RAP1 est très conservée de la levure à l’humain et elle possède
plusieurs domaines de liaison à l’ADN et aux protéines et ses fonctions ne se limitent pas aux télomères
[164]. Elle n’est pas nécessaire pour la formation de la T-Loop, mais joue un rôle dans la protection
21
des télomères contre la NHEJ et la HR [165, 166]. Elle se lie préférentiellement aux jonctions d’ADN,
bien que faiblement, mais n’a pas de reconnaissance d’une séquence spécifique [167].
Figure 8 : Télomère et complexe shelterin.
Trois protéines reconnaissent spécifiquement la séquence télomérique TTAGGG et
interagissent directement avec l’ADN : TRF1 et TRF2 dans la séquence double brin, POT1 dans
la séquence simple brin. TIN2 et TPP1 relient POT1 à TRF1 et TRF2 et RAP1 est lié au
complexe par une interaction avec TRF2. Le complexe est très abondant et recouvre le
télomère. Tirée de [130].
Bien entendu, shelterin n’est pas le seul complexe interagissant avec les télomères, sans compter
l’ARN non-codant TERRA (telomeric repeat-containing RNA), qui se lie à shelterin et est aussi impliqué
dans le maintien de l’intégrité des télomères [152]. Par exemple, le complexe CST (CTC1-STN1-TEN1)
se lie aussi à la section simple brin des télomères indépendamment de POT1 et offre une protection
supplémentaire en plus d’avoir lui aussi un effet sur l’activité de la télomérase [168, 169]. Ku70/80 est
un autre complexe se retrouvant aux télomères par une interaction avec TRF1 [148]. Ce complexe est
impliqué dans le mécanisme de réparation NHEJ, mais exerce également un effet protecteur contre la
HR aux télomères [148, 170]. Son rôle dans la NHEJ est vraisemblablement inhibé par shelterin [171].
22
Malgré la présence d’autres protéines aux télomères, shelterin est un complexe de première
importance en ce qui concerne l’intégrité des télomères et il est tout à fait concevable qu’il soit affecté
par un événement tel que l’intégration chromosomique d’un génome viral dans un télomère.
1.3.3 Les G-quadruplexes et leurs ligands
Outre la T-Loop, les télomères peuvent s’organiser en plusieurs conformations, parmi celles-ci les G-
quadruplexes (G4). Il s’agit de structures secondaires que les brins d’ADN ou d’ARN peuvent former
dans les régions riches en guanines comme certains promoteurs oncogéniques et les télomères [172].
Un G4 est formé de plusieurs quartets planaires de guanines qui s’empilent les uns sur les autres
(Figure 9). Les guanines sont reliées entre elles par des ponts hydrogène entre leur face Hoogsteen
et Watson-Crick et sont stabilisées par un cation monovalent (ex : potassium, sodium, magnésium)
situé au centre du canal formé par les guanines [173, 174]. Un G4 peut se former à partir d’un nombre
variable de quartets et ceux-ci peuvent être composés d’un ou de plusieurs brins d’ADN (jusqu’à
concurrence de quatre brins), qui peuvent chacun être dans différentes orientations. De plus, les autres
nucléotides séparant les guanines peuvent former des boucles aux dimensions et aux propriétés
variables et les rainures dans la structure des G4 servant de zones d’interaction avec des ligands
peuvent également avoir différentes propriétés. Toutes ces possibilités de structure confèrent aux G4
une grande diversité de conformation [175]. Ces structures ont une influence sur de nombreuses
activités dont la régulation des télomères, l’expression de certains gènes et la réplication de l’ADN
[176]. En effet, il a été démontré que les G4 peuvent bloquer la fourche de réplication et causer de
l’instabilité. Lors de la réplication, la séparation des brins d’ADN donne une opportunité à des G4 de
se former. Ils doivent être désassemblés par une hélicase pour permettre le passage de la polymérase
[177, 178]. Une possible fonction des G4 serait d’aider à la protection des télomères contre la
dégradation, potentiellement en entrant en interaction avec le complexe shelterin, comme le suggère
l’observation que RAP1 se lie aux G4 in vitro et en promeut la formation [176, 179]. De plus, les G4
sont très fréquents dans les promoteurs (ex : c-myc), ce qui pourrait indiquer un rôle dans le contrôle
de leur expression [180, 181].
23
Figure 9 : Structure d’un G4 et interaction avec le BRACO-19.
(A) : Interaction des guanines et d’un cation dans le quartet d’un G4. (B) : Différentes possibilités
d’orientation et de nombre de brins d’ADN dans un G4. Tiré de [181]. (C) : Structure de deux
G4 (bleu et rouge) en complexe avec deux molécules du ligand BRACO-19 (jaune) avec la
surface des interactions de Van der Waals du ligand visible en jaune. Tirée de [182].
Plusieurs drogues ont été synthétisées dans le but de lier et stabiliser les G4 dans leur conformation
pour affecter les activités que les G4 contrôlent. Ces ligands s’attachent aux extrémités des G4,
s’intercalent entre les quartets ou se lient aux boucles, aux rainures ou à la structure même des G4,
dépendamment de leur nature et de leur conformation, mais ne modifient pas la structure des G4 [183].
Parmi ces drogues, on compte les porphyrines, les anthraquinones, les analogues de l’acridine et
plusieurs autres. L’une des porphyrines les plus étudiées est TMPyP4 (5,10,15,20-tetrakis(N-methyl-
4-pyridyl)porphyrin), qui se lie aux boucles extérieures ou aux extrémités des G4 dans une proportion
de deux ligands pour un G4 [182, 184]. Un autre ligand des G4 bien connu est BRACO-19, qui
appartient à la famille des analogues de l’acridine. Il s’agit d’une acridine 3,6,9-tri-substituée créée
spécifiquement pour fixer les G4 au niveau des télomères dans le but d’inhiber l’activité de la
24
télomérase dans les cellules cancéreuses [185]. BRACO-19 s’insère entre deux G4 (Figure 9), se liant
de façon asymétrique à l’extrémité 3’ d’un G4 et à la tétrade TATA en 5’ du G4 suivant, et ses trois
substituants ont été synthétisés pour interagir chacun avec une rainure le long du squelette des G4
[182, 186]. BRACO-19 se lie à ses cibles avec une grande spécificité et a démontré une capacité à
inhiber la télomérase dans des cellules cancéreuses, y causant des fusions entre les extrémités des
chromosomes [186, 187].
1.3.4 La télomérase et ALT
Comme mentionné à la section 1.3.1, dans la plupart des cellules somatiques, les télomères se
raccourcissent à chaque division cellulaire et il en résulte que les cellules ont un nombre limité de
divisions possibles [130]. Cependant, il en va autrement des cellules souches embryonnaires (CSE) et
des cellules cancéreuses, qui sont dites immortelles car elles ont un potentiel de réplication
théoriquement infini. Cela est possible par l’action de la télomérase ou d’un mécanisme d’allongement
des télomères alternatif (ALT). La télomérase est une enzyme possédant une sous-unité catalytique
de transcriptase inverse (TERT) et une sous-unité d’ARN contenant la séquence répétitive télomérique
(TERC) [114]. Elle a d’abord été découverte par Greider et Blackburn, qui ont également proposé son
mécanisme par la suite [188, 189]. Elle prolonge le brin 3’ des télomères en y ajoutant des répétitions
TTAGGG par son activité de transcriptase inverse. Elle n’a pas besoin d’amorce pour cela grâce à sa
sous-unité constituée d’un brin d’ARN guide lui servant de modèle pour sa polymérisation. La
machinerie de polymérisation du brin tardif peut ensuite compléter le brin 5’ des télomères en utilisant
la nouvelle séquence télomérique comme guide [190]. Grâce à cette enzyme, les cellules souches
peuvent rallonger leurs télomères à chaque division cellulaire et conserver ainsi des télomères
suffisamment longs pour ne pas déclencher la sénescence ou l’apoptose. Les CSE expriment la
télomérase en grande quantité, mais les cellules souches chez les adultes ne l’expriment par
suffisamment pour complètement contrecarrer le raccourcissement des télomères, ce qui explique le
vieillissement. Les cellules somatiques n’expriment que très peu ou pas la télomérase [191, 192].
Cependant, les cellules peuvent retrouver l’immortalité en réactivant la télomérase au moyen de
mutations oncogéniques dans le promoteur de la télomérase. C’est le cas dans environ 90% des
cancers. Les cellules cancéreuses qui acquièrent cette modification peuvent se diviser de façon
excessive sans que jamais leurs télomères ne deviennent trop courts, entraînant la formation de
tumeurs [193].
25
Bien que la plupart des cellules cancéreuses utilisent la télomérase pour maintenir leurs télomères,
certaines développent une stratégie différente et se servent d’un mécanisme ALT. De tels mécanismes
sont souvent basés sur la HR, qui n’est pas aussi réprimée dans les cellules exprimant ALT que dans
les cellules à la télomérase réactivée ou dans les cellules non-immortelles [147, 194]. Des événements
de HR sont donc plus fréquents dans les cellules utilisant ALT et mènent à la formation de cercles
d’ADN télomérique extra-chromosomiques, suite à la résolution normalement réprimée de la jonction
de la T-Loop des télomères par HR [195-197]. Il a été proposé que l’allongement des télomères dans
les cellules exprimant ALT pourrait avoir lieu par recombinaison entre les télomères et ces cercles
d’ADN télomérique (T-circles) [197], ou encore par HR entre deux télomères de différents
chromosomes [198]. Ce mécanisme d’allongement des télomères n’est pas parfaitement bien défini,
mais il semble que la HR allongeant les télomères ne se produit pas à chaque division cellulaire, mais
lorsqu’un télomère atteint une longueur critique trop courte. Les cercles d’ADN télomérique formés
dans les cellules utilisant ALT peuvent avoir plusieurs formes, mais sont majoritairement formés d’ADN
double-brin télomérique [194]. En plus de posséder beaucoup de T-circles (qui ne sont toutefois pas
uniques aux cellules avec ALT), les cellules utilisant ALT sont reconnaissables par le fait qu’elles
n’expriment pas la télomérase et ont des télomères très longs et hétérogènes [196, 199]. Une autre
caractéristique de ces cellules est qu’elles ont des corps nucléaires PML (Promyelocytic leukemia)
nommés ALT-associated PML bodies qui contiennent les protéines PML, TRF2, TRF1, le facteur de
réplication A, Rad51 et Rad52 [200]. Toutefois, la fonction de ces corps n’est pas encore établie et on
ignore s’ils sont nécessaires au mécanisme ALT, bien que certaines études penchent en ce sens [194].
1.3.5 La réparation des bris d’ADN
Les mécanismes de la DDR doivent être réprimés aux télomères pour protéger l’intégrité des
chromosomes (section 1.3.2). Cependant, ces mécanismes sont très importants dans la protection des
chromosomes lorsque survient véritablement un bris à l’ADN. Suite à un dommage à l’ADN, la
réparation du bris suit normalement trois étapes, soit la détection du bris, le recrutement des facteurs
de réparation au site du dommage et la réparation elle-même [201]. Ces étapes sont principalement
régulées par des modifications post-transcriptionnelles. ATM et ATR, deux kinases de la famille des
PIKKs (phosphoinositide 3-kinase related protein kinases), sont particulièrement importantes dans la
26
réparation des dommages à l’ADN et chacune active une voie particulière [202]. La voie ATM est
activée suite à un bris d’ADN double-brin qui est détecté par le complexe protéique MRN (Mre11,
Rad50, NBS1) [203]. La kinase ATM est alors recrutée au dommage et elle déclenche une cascade
de signalisation comprenant la phosphorylation de cibles telles que H2AX, 53BP1, ChK2, MDC1,
BRCA1 et p53 [201, 204]. p53 déclenche l’arrêt du cycle cellulaire en G1/S pour permettre la réparation
des dommages avant la poursuite du cycle [201]. Si une réparation est impossible, la cellule entre en
sénescence ou en apoptose. L’histone H2AX (γH2AX une fois phosphorylée) participe à la
signalisation du bris d’ADN et forme des foyers rapidement après la détection des dommages. Sa
présence mène à l’accumulation au site du dommage de protéines effectrices nécessaires à la
réparation, dont fait partie 53BP1, une protéine promotrice de jonction des extrémités non-homologues
(NHEJ) [201, 205]. La voie ATR est activée suite à de nombreux types de bris contenant de l’ADN
simple brin, comprenant principalement les dégâts au niveau de la fourche de réplication [202, 206].
L’ADN simple brin non protégé est repéré par la protéine RPA qui s’y accumule et permet le
recrutement de la kinase ATR (et son cofacteur ATRIP) au dommage [207]. ATR active ensuite
plusieurs autres protéines, dont ChK1, Rad9, Rad1, Hus1, TOPBP1, BRCA1 et p53 [202, 208]. Tout
comme ATM, l’activation d’ATR mène à l’arrêt du cycle cellulaire et à la réparation du bris, sans quoi
la cellule entre en sénescence ou en apoptose.
Il existe deux mécanismes principaux de réparation de dommage à l’ADN. La NHEJ est le mécanisme
le plus utilisé dans les cellules humaines. Elle permet de joindre les deux extrémités du bris sans
nécessiter une séquence homologue pour effectuer cette réparation. En cas de besoin, elle peut
occasionner la perte ou l’ajout de quelques nucléotides au niveau des bris pour permettre la ligation
de deux extrémités non-compatibles, ce qui peut incorporer des mutations dans la séquence d’ADN
[204]. Les protéines principales de la NHEJ sont Ku, les complexes des ligases à ADN et
potentiellement MRN [209]. La HR, aussi utilisée par les cellules exprimant ALT pour prolonger leurs
télomères, est un échange de séquence identiques ou presque qui survient normalement en phase S
et G2 [204]. Le brin d’ADN endommagé est réparé de façon très précise grâce à l’utilisation de la
chromatide sœur comme modèle. Si la séquence utilisée comme modèle n’est pas identique, la HR
peut mener à l’insertion de mutations ou de séquences qui peuvent être délétères à la cellule. Ce
mécanisme utilise principalement les protéines du groupe de Rad52 et quelques autres, en plus de
nucléases, d’hélicases, de polymérases, de topoisomérases et de ligases [210]. La HR s’effectue en
27
trois principales étapes (Figure 10). Elle débute par une résection de l’extrémité 5’ de l’ADN brisé par
une nucléase pour générer une extrémité simple brin en 3’ [204, 211-213]. Cette étape est suivie par
le recouvrement de l’ADN simple-brin par la protéine RPA (Replication protein A), qui permet la
formation des filaments de Rad51 et interagit avec Rad52 [214]. Vient ensuite la recherche d’une
séquence homologue, menée par Rad51, et l’invasion de cette séquence par l’un des brins brisés pour
créer la boucle de déplacement (D-loop), puis l’échange de séquence, qui peut prendre plusieurs
formes de recombinaison, et la résolution de la jonction [204, 213, 215]. RAD52 est essentielle à
chacune des étapes. La HR peut également être observée aux télomères non-protégés. La fin des
chromosomes est alors reconnue comme une cassure de l’ADN qui est réparée par HR, ce qui peut
mener à un échange indésirable entre les télomères de chromatides sœurs (T-SCE) ou encore à
l’excision de la T-Loop [145]. Un autre mécanisme de réparation, moins commun, est la BIR, qui a lieu
lorsqu’une seule des extrémités du bris est homologue à une autre séquence. Cela peut être le cas au
niveau des télomères qui ont perdu leur protection. Il s’agit d’un mécanisme dépendant de Rad51 et
de quelques autres protéines de ce groupe [216]. Il y a invasion d’une séquence homologue par le brin
brisé et il s’en suit une réplication unidirectionnelle de la séquence modèle jusqu’à l’atteinte de
l’extrémité de celle-ci. Si une telle réparation a lieu entre deux chromosomes homologues, il peut y
avoir perte de l’hétérozygocité de ces chromosomes [204].
28
Figure 10 : Modèle de réparation d’un bris d’ADN double-brin par NHEJ et HR.
(A) Les extrémités du bris sont recouvertes par les complexes protéiques Ku et MRN. (B) Dans
la voie de NHEJ, le bris est stabilisé par les complexes puis (C) le complexe de la ligase est
recruté et les extrémités sont alignées. (D) Si les extrémités sont compatibles, elles sont reliées
par la ligase et, sinon, elles sont d’abord modifiées avant la ligation. (E) Dans la voie HR, les
extrémités 5’ du bris sont dégradées par des nucléases. (F) Les sections simple-brin se font
protéger par la protéine RPA, qui permet le recrutement (G) des protéines Rad qui forment des
filaments et recherchent (H) une séquence homologue et initient l’insertion d’un brin dans cette
séquence pour former la D-loop. (I) La HR s’effectue et après création du nouvel ADN, la
jonction se résout. Tirée de [204].
29
1.3.6 Virus et détection de dommages à l’ADN
De nombreux facteurs comme les rayons UV ou les ROS (reactive oxygen species) peuvent causer
des mutations ou des dommages à l’ADN. Plusieurs virus provoquent aussi un signal de dommage au
cours de l’infection, suite à la reconnaissance de leur ADN ou de leurs protéines par les composants
de la DDR. Pour éviter les effets délétères que pourrait avoir cette réponse, nombre de virus ont
développé des tactiques pour échapper à la DDR ou pour utiliser la machinerie de réparation à leur
avantage. D’ailleurs, des protéines de réparation de l’ADN ont été observées dans les RC de plusieurs
virus [217]. HSV1 est un exemple de virus déclenchant la voie ATM et réprimant la voie ATR [218,
219]. Il utilise certaines protéines de la voie ATM se retrouvant dans ses RC pour compléter sa
réplication [220]. Il prévient néanmoins le recrutement de certaines protéines, γH2AX par exemple, à
ses RC [218]. HCMV active aussi partiellement la voie ATM avec le recrutement de certaines protéines
telles que γH2AX, 53BP1 et p53 dans ses RC. Cependant, d’autres composants de cette voie sont
exclus des RC pour éviter une réparation de son génome par la cellule [221]. Similairement, EBV
déclenche également une réponse de la voie ATM et plusieurs protéines de la DDR sont retrouvées
dans ses RC [222]. La protéine 53BP1 est même nécessaire à la réplication du virus, mais EBV réprime
certaines protéines en aval de la voie ATM pour en éviter les conséquences [223]. Les AAV répriment
la voie ATM, mais il a été suggéré qu’ils utilisent la machinerie de la NHEJ pour compléter son
intégration dans les chromosomes [217, 224]. Il est donc très fréquent d’observer une DDR lors d’une
infection virale, mais le cas de HHV-6 est peu étudié. Il est connu qu’il parvient à réprimer l’entrée en
apoptose médiée par p53 [225], mais les interactions exactes de HHV-6 avec les protéines de la DDR
demeurent inconnues.
30
Chapitre 2 : Hypothèses et objectifs des travaux
L’herpèsvirus humain 6 est un virus ubiquitaire retrouvé chez la majorité des adultes et dont la
réactivation chez des individus immunodéprimés peut avoir de graves conséquences. Il est également
présent sous forme intégrée dans le génome de nombreux individus. Malgré cette importante
prévalence, HHV-6 demeure peu connu et son effet sur les cellules qu’il infecte est très peu caractérisé.
De même, le mécanisme d’intégration chromosomique de HHV-6 est également largement inconnu et
seule l’observation du virus dans sa forme intégrée a permis de faire certaines déductions à ce sujet.
Notre objectif principal est d’accroître les connaissances sur l’infection de HHV-6, de même que sur
son intégration chromosomique dans les télomères. Plus particulièrement, nous avons voulu
déterminer si HHV-6 déclenche des signaux de dommages à l’ADN dans les cellules infectées. Nous
avons également étudié l’expression du complexe shelterin au cours de l’infection, en particulier celle
de la protéine TRF2, qui joue un important rôle dans la répression des voies de réparation de l’ADN
aux télomères. De plus, nous avons évalué la capacité de cette protéine à interagir avec l’ADN de
HHV-6, puisque son génome possède des répétitions télomériques. En prenant en compte que de
nombreux virus déclenchent un signal de dommage dans leurs cellules cibles, nous avons supposé
que HHV-6 en ferait de même et que des protéines de signalisation de dommages à l’ADN seraient
activées. Puisque HHV-6 peut aussi s’intégrer dans les télomères, nous avons posé l’hypothèse que
le complexe les protégeant serait affecté lors de l’infection.
Il a été supposé que, suite à l’intégration de HHV-6, les TMR virales sont utilisées comme substrat
pour l’ajout de nouvelles répétitions afin de recréer un télomère, permettant ainsi à l’intégration de
demeurer dans le chromosome sans provoquer d’instabilité ou de déclencher une mort précoce de la
cellule. Dans le cas d’une intégration dans une cellule germinale, cet allongement s’effectuerait lors de
l’embryogenèse par la télomérase. Pour tester cette hypothèse, nous avons inhibé la télomérase à
l’aide de BRACO-19 et observé l’effet de cette inhibition sur la prévalence de l’intégration
chromosomique de HHV-6 dans différentes lignées cellulaires. Nous avons posé l’hypothèse que les
cellules portant nouvellement une intégration virale auraient un télomère plus court qui serait plus
rapidement dégradé, entraînant la mort précoce de ces cellules.
31
Chapitre 3 : L’infection de HHV-6 déclenche une réponse de dommage à l’ADN et recrute TRF2 aux télomères viraux
3.1 Résumé
Au cours d’une infection virale, il est fréquent d’observer que l’ADN viral induise une réponse de
dommage à l’ADN (DDR). À notre connaissance, aucune étude n’a été réalisée sur l’infection de
l’herpèsvirus humain de type 6 (HHV-6) et la DDR. HHV-6 peut à la fois infecter de façon productive
des cellules et intégrer son génome dans les télomères cellulaires. Les télomères, une région
composée de répétitions de nucléotides à chaque extrémité d’un chromosome, protègent ce dernier
d’une détérioration ou d’une fusion avec d’autres chromosomes. Nous avons analysé la DDR et
l’expression du complexe télomérique shelterin pendant l’infection de HHV-6. Tout d’abord, nous avons
observé que 53BP1 et γH2AX, deux effecteurs de la DDR, sont activés et colocalisent avec les
protéines virales IE2 et P41 associées aux compartiments de réplication virale (RC). De forts signaux
télomériques ont également été observés dans les RC de HHV-6 sauvage, mais pas dans les RC d’un
HHV-6 mutant dont les répétitions télomériques ont été retirées. L’infection de HHV-6 mène aussi à
l’augmentation de l’expression de trois gènes du complexe shelterin, TRF1, TRF2 et TPP1. Nous avons
confirmé par cytométrie de flux et immunofluorescence que la protéine TRF2 était également
surexprimée au cours de l’infection. Par la suite, nous avons observé que TRF2 était recrutée aux RC.
La liaison de TRF2 aux répétitions télomériques de HHV-6 a été confirmée par immunoprécipitation de
chromatine et par ELISA. En résumé, nous rapportons que l’infection de HHV-6 induit une DDR qui se
localise aux RC, de même que la surexpression et le recrutement de la protéine TRF2 aux télomères
viraux. Nos résultats suggèrent un rôle potentiel des protéines du complexe shelterin dans l’infection
et possiblement dans l’intégration de HHV-6 dans les chromosomes.
32
HHV-6 infection triggers a DNA damage response and recruits TRF2 at
viral telomeres.
Shella Gilbert-Girard1, Annie Gravel1 and Louis Flamand1,2
1Division of Infectious Disease and Immunity, CHU de Québec Research Center, Quebec city, Quebec
G1V 4G2, Canada and 2Department of microbiology, infectious disease and immunology, Faculty of
Medicine, Université Laval, Quebec city, Québec,G1V 0A6 Canada
To whom correspondence should be addressed:
Louis Flamand PhD MBA
Division of Infectious Disease and Immunity
Room T1-49
CHU de Quebec Research Center,
Quebec city, Canada
G1V 4G2
Tel (418)-525-4444 ext 46164; Fax (418)-654-2765
Email:Louis.flamand@crchul.ulaval.ca
33
3.2 Abstract
Upon infection, incoming or newly synthesized viral DNA frequently triggers a DNA-damage response
(DDR). To our knowledge, studies on Human herpesvirus-6 (HHV-6) infection and DDR have not been
performed. Considering that HHV-6 can productively infect cells as well as integrate its genome in
cellular telomeres, a region of repetitive nucleotides at each end of a chromosome that protect the
chromosome from deterioration or from fusion with other chromosomes, we analyzed the DDR and the
expression of the telomeric shelterin complex proteins during HHV-6 infection. First, we report that both
53BP1 and γH2AX, two DDR effectors, are activated and colocalize with HHV-6 IE2 and P41 proteins
associated with viral replication compartments (RC). Strong telomeric signals were also observed in
RC of wild-type HHV-6 but not in RC of a HHV-6 mutant lacking telomeric motifs. Next, we observed
that TRF2 was recruited to RC. TRF2 binding to the HHV-6 telomeric repeats was confirmed using
chromatin immunoprecipitation and ELISA. HHV-6 infection also lead to increased expression of three
shelterin genes, TRF1, TRF2 and TPP1. Increased TRF2 protein expression during infection was
confirmed by flow cytometry and immunofluorescence assays. In summary, we report that HHV-6
infection triggers a DDR that localizes at RC as well as overexpression and recruitment of the shelterin
protein TRF2 to viral telomeres. Our results highlight a potential role for shelterin complex proteins
during infection and possibly integration of HHV-6 into host chromosomes.
34
3.3 Introduction
Human herpesvirus-6A (HHV-6A) and HHV-6B are two distinct DNA viruses with different epidemiology
and biological characteristics belonging to the betaherpesviruses subfamily (1). HHV-6B is a ubiquitous
virus that infects nearly 100% of world population and is the etiological agent of roseola infantum, an
infantile febrile illness characterized by high fever and, in some cases, a skin rash (2, 3). HHV-6A and
HHV-6B can integrate their genomes into human chromosomes (reviewed in (4). When integration
occurs in a germinal cell, the viral genome can be inherited resulting in individuals carrying a copy of
the viral genome in every cell, a condition called inherited chromosomally integrated HHV-6 (iciHHV-
6). Approximately 1% of the world population is considered iciHHV-6+ (4, 5). The consequences of
iciHHV-6 are not well defined but a recent study indicates that iciHHV-6+ individuals are at greater risks
of developing angina pectoris (6).
Although HHV-6 integration can occur in several distinct chromosomes, it invariably takes place in the
telomeric/sub-telomeric regions of chromosomes (7-10). In mammalian cells, the ends of
chromosomes are protected by the telomeres consisting in 5 to 15 kb of hexameric repeats (TTAGGG)
followed by a 200 +/- 75 nucleotide TTAGGG single-stranded 3’-overhang (11). The telomeres function
as a buffer zone to avoid instability and loss of genetic information. Every time a cell divides, the
extremities of the chromosomes are incompletely replicated due to the end replication problem (12).
As a consequence, the telomeres shorten after every cell division until they reach a minimal threshold
length, which triggers cell apoptosis or senescence via the ATR (ataxia telangiectasia and Rad3
related) or the ATM (ataxia telangiectasia mutated) pathway (reviewed in (13, 14). Unless telomere
elongating processes are present, somatic cells are therefore capable of a limited number of replication
cycles.
Many proteins are implicated in the DNA damage repair pathway (DDR). The reparation of damaged
DNA typically follows three steps: the detection of the break, the recruitment of proteins to the damage
site and the repair (15). Depending on the cell cycle and on the type of damage, different pathways
can be followed and the two main pathways include either the ATM or the ATR kinase (15, 16). The
H2AX histone is one of the protein that is phosphorylated (γH2AX) in both the ATM and the ATR
damage repair pathway. Formation of γH2AX foci happens very quickly after a DNA break and the
35
protein is necessary for recruitment of repair factors to the damage site. 53BP1 is one of these DNA
repair effector proteins that are recruited and accumulate to the damage site (15). Both γH2AX and
53BP1 are used in microscopy to locate DNA damage.
To prevent activation of the damage recognition pathways at inappropriate times, telomeres are
protected by the shelterin complex (14). The shelterin complex folds the telomere in a structure called
the T-Loop, preventing the recognition of the telomere extremity as a double-strand break (DSB) (17).
The shelterin complex is made of six proteins: TRF1, TRF2, TPP1, RAP1, TPP2 and POT1. TRF1 and
TRF2 both form homodimers that bind directly to the double-strand TTAGGG repeats in a sequence-
specific manner (18-20). TRF2 represses the ATM pathway and cell cycle arrest (21). It is implicated
in the repression of telomere repair by non-homologous end-joining (NHEJ) and homologous
recombination (HR) (22, 23). POT1 binds to the single-strand section of the telomeres and protects the
telomeres against recognition by the ATR pathway (22, 24-26).
During infection by DNA viruses such as herpesvirus simplex-1 (HSV1) and cytomegalovirus (CMV),
the linear viral genomes are likely to be recognized as broken DNA molecules and trigger a DNA-
damage response. Considering that such a response could have negative effects on viral growth, these
viruses have evolved counter measures that block the DDR pathway. For example, during infection,
the HSV1 ICP0 protein inhibits or degrade the DNA-PKcs involved in classic NHEJ repair (27).
Furthermore, ICP0 also inhibits the HR pathway by degrading RNF8 and RNF168 (28). An example of
a different tactic is that used by CMV, whose infection also induces a DNA damage response. At early
stages, γH2AX and 53BP1 are both found in viral replication compartments, but the MRN complex is
excluded from them. P53 is also relocalized to viral DNA and its expression is increased during infection
(29). Later on, γH2AX and Rad50/51 expressions are increased, while that of 53BP1 is inhibited. Unlike
HSV1, CMV infection does not require the activation of the ATM pathway for efficient replication. In the
present study, we analyzed the DNA damage response and the expression of shelterin complex
proteins during HHV-6 infection.
36
3.4 Materials and Methods
Cell lines and viruses
U2OS cells (American Type culture collection (ATCC), Manassas, VA, USA) were cultured in
Dulbecco’s modified Eagle’s medium (DMEM, Corning Cellgro, Manassas, VA, USA) supplemented
with 10% Nu serum (Corning Cellgro), non-essential amino acids (Corning Cellgro), HEPES, sodium
pyruvate (Multicell Wisent Inc., St-Bruno, Québec, Canada) and plasmocin 5 μg/ml (InvivoGen, San
Diego, CA, USA). HeLa and MCF-7 cells (ATCC) were cultured in the same medium supplemented
with 10% fetal bovine serum (FBS) (Thermo Fisher). MOLT-3 (ATCC, CRL-1552), HSB-2 (ATCC, CCL-
120.1), both human T lymphoblastic cell lines, were cultured in RPMI-1640 (Corning Cellgro)
supplemented with 10% Nu serum (Corning Cellgro), HEPES and plasmocin 5 μg/ml (InvivoGen).
Peripheral blood mononuclear cells (PBMCs) were cultured in RPMI-1640 supplemented with 10%
FBS. JJhan cells infected with HHV-6A mutants (double∆ and ∆imp) (30) were kindly provided by
Benedikt B. Kaufer and were cultured in RPMI-1640 supplemented with 10% FBS.
HHV-6B (Z29 strain) and HHV-6A (U1102 strain) were propagated on MOLT-3 and HSB-2 cells
respectively, as previously described (31).
IF-FISH and microscopy
Immunofluorescence (IF) combined with fluorescence in situ hybridization (FISH) was performed as
previously described (32). U2OS cells were seeded at 5x104 cells per well in 6-wells plates over
coverslips, cultured 24h and infected with HHV-6A or HHV-6B at a multiplicity of infection (MOI) of 5
for 4 hours and then washed with PBS and cultured in media for a set period of time. Cells were fixed
with 2% paraformaldehyde. HeLa cells were treated the same way, but seeded at 3.5x104 cells per
well. MOLT-3 and HSB-2 cells were infected at a MOI of 1 and cultured for a set period of time before
being deposited on a 10-wells microscope slide, dried and fixed in acetone at -20°C for 10 minutes.
The following primary antibody were used: mouse-α-IE1-Alexa-488 (31), mouse-α-IE2-Alexa-568
(Arsenault et al, 2003, JCV), mouse-α-P41 (NIH AIDS Reagent Program), rabbit-α-TRF2 (NB100-
56694, Novus Biologicals), rabbit-α-53BP1 (H-300, Santa Cruz Biotechnology), mouse-α-γH2AX
(Ser139, clone JBW301, EMD Millipore) and PML (PG-M3, Santa Cruz Biotechnology). Secondary
antibodies used were goat-α-rabbit-Alexa-488, goat-α-rabbit-Alexa-594, goat-α-mouse-Alexa-488 and
37
goat-α-mouse-Alexa-594 (Life Technologies). FISH was performed using a PNA probe specific to the
telomeric sequence (CCCTAA)3 (Tel-Cy5 F1003, PNA BIO).
Slides were observed using a spinning disc confocal microscope (Leica DMI6000B) and analyzed using
the Volocity software 5.4.
To compare TRF2 expression in uninfected and HHV-6-infected cells, cells were dually stained with
HHV-6 IE2 protein and TRF2. The relative TRF2 fluorescence in IE2- and IE2+ individual cell was then
determined using the ImageJ software. TRF2 expression levels were compared using unpaired student
t-test with Welch’s correction.
RNA isolation and RT-qPCR
HSB-2 and MOLT-3 cells (107 cells) were incubated in a 50 mL tube and infected with HHV-6A or HHV-
6B at a MOI of 0,25. After 4h at 37°C, cells were washed and placed in a 25 cm2 culture flask at 500
000 cells per ml in complete media. A portion of the cells were harvested on day 1, 2, 3, 5 and 7 post-
infection. Total RNA was isolated and processed by reverse transcriptase quantitative PCR (RT-
QPCR) as previously described (33). The cDNAs obtained were analyzed by TaqMan qPCR using
Rotor-Gene Q apparatus (Qiagen) and Rotor-Gene Multiplex PCR Kit reagent (Qiagen) using validated
HHV-6- (IE1 gene) and GAPDH-specific primers and probes (33). cDNAs were analyzed for telomerase
(hTERT), TRF1, TIN2, TPP1 using specific primers and SyBr green as described (34). TRF2, POT1,
RAP1 were analyzed using the following primers:
TRF2 FWD: 5’-GTACCCAAAGGCAAGTGGAA-3’ TRF2 REV: 5’-TGACCCACTCGCTTTCTTCT-3’ POT1 FWD: 5’-TGAAGTTCTTTAAGCCCCCA-3’ POT1 REV: 5’-AGCCTGTGAAAGCGAACAAT-3’ RAP1 FWD: 5’-GCCACCCGGGAGTTTGA-3’ RAP1 REV: 5’-GGGTGGATCATCATCACACATAGT-3’
The Ct value of genes from infected cells was compared to the value of uninfected cells and normalized
with the cellular gene GAPDH.
38
Flow cytometry
HSB-2 cells were mock-treated or infected with HHV-6A (U1102) at a MOI of 0.5. After 48 hours, 1x106
cells/assay were fixed, permeabilized and processed for detection of HHV-6 antigens (p41 (9A5D12
from NIH AIDS Reagent Program) and gp102 (7A2 from NIH AIDS Reagent Program)) and TRF2
(Novus Biologicals) using the intracellular fixation and permeabilization buffer kit (eBiosciences, San
Diego, CA, USA). One μg of antibody was used per assay. Cells were analyzed by flow cytometry
using a FACS scan apparatus and CellQuest software.
ChIP and dot blot
The manipulations were made using the Pierce Magnetic ChIP Kit (Thermo Scientific) according to the
manufacturer’s instructions with a few modifications. The same amounts of MOLT-3 cells was used for
all samples (4x106 cells/sample). Cross-linking lasted 10 minutes at RT. As MOLT-3 cells are grown in
suspension, cells were centrifuged at 1100 x g for 3 minutes before every wash during DNA pellet
isolation. 2 μl of diluted MNase (1:10) were added to each sample for MNase Digestion. Before
sonication, a 10% total input control was sampled from each tube. Sonication was made with a Branson
Sonifier 450, with an Output Control set at 1. Each sample was sonicated with five pulses of 20
seconds, each pulse followed by a 20 seconds incubation on ice. Before immunoprecipitation, samples
were incubated with magnetic beads alone for one hour at 4°C before discarding the beads. The
immunoprecipitation was realised with 10 μl of anti-RNA Pol II antibody as a positive control, 2 μl of
Normal Rabbit IgG as a negative control (both provided with the ChIP kit) and 4 μg of rabbit anti-TRF2
antibody (NB100-56694, Novus Biologicals) with an overnight incubation at 4°C. The DNA form the
eluted IP was recovered in 50 μl of DNA Column Elution Solution. A qPCR was conducted on 5 μl of
the DNA solution with a Rotor-Gene Q (Qiagen) with the Rotor-Gene Multiplex PCR Kit (Qiagen) using
GAPDH-specific primers provided with the ChIP kit to verify the chromatin input in each samples.
Eluted DNA was analyzed by qPCR (GAPDH), telomeric ((CCCTTA)4 probe) or HHV-6 DNA (DR6
probe) by dot blot hybridization. DNA was first denatured for 10 minutes at room temperature in 0.25
N NaOH and 0.5 M NaCl. Samples were then serially diluted in 0.1 X SSC and 0.125 N NaOH, on ice,
loaded onto nylon membrane, neutralized in 0.5 N NaCl and 0.5 M Tris-HCl pH 7.5 and crosslinked
using UV irradiation. Membrane was pre-incubated in Perfecthyb Plus hybridization buffer (Sigma-
39
Aldrich) for 2h at 60°C before addition of 1x106 CPM/ml of 32P-labeled probes. Hybridization was
carried out for 16h at 60°C. Membrane was washed twice with 2X SSC-1% SDS, twice with 1X SSC-
1% SDS and once with 0.5X SSC-1% SDS at 60°C, for 15 minutes each. Membrane was then exposed
to X-ray films at -80°C. Membrane was stripped in boiling 0.1X SSC-1% SDS for 20 minutes, exposed
to X-ray films at -80°C before a new hybridization was done.
Cloning and purification of MBP-TRF2
The pLPC-NMYC TRF2 was a gift from Titia de Lange (Addgene plasmid # 16066). The TRF2 coding
sequence was excised from pLPC-NMYC TRF2 vector using with BamHI and XhoI and cloned in frame
with the MBP coding sequence of the pMAL-C2 vector (New England Biolabs) using BamHI and SalI
enzymes. MBP and MBP-TRF2 proteins were expressed in BL21 DE3 RIL bacteria and purified by
affinity chromatography, as described (35).
Electropheretic mobility shif assay (EMSA)
EMSA was performed essentially as described (35). In brief, recombinant proteins were incubated with
non-telomeric or telomeric labeled probes in 20 µl of the following reaction buffer: 20 mM Hepes-KOH
pH 7.9, 150 mM KCl, 1 mM MgCl2, 0.1 mM EDTA, 0.5 mM DTT, 5% glycerol and 0.1 mg/ml BSA. For
competition experiments, 10-1000 fold excess of unlabeled non-telo or telomeric probes were included
in the reaction buffer. After a 30 minute incubation at room temperature, 2 µl of loading dye were added
and the samples were electrophoresed through a non-denaturing 5% acrylamide:bis (29:1) gel. After
migration, the gels were dried and exposed to X-ray films at -80°C.
Detection of TRF2 binding to HHV-6 telomeric sequence
The wells of a 96-well ELISA plate were coated with MBP or MBP-TRF2 proteins by overnight
incubation at 4°C in pH 9.0 carbonate buffer. After rinsing, 1% BSA was added to block non-specific
sites. Twenty-five nanograms of digoxigenin-labeled HHV6 DNA fragments (HHV-6-BAC DNA digested
with the frequent cutter HaeIII that cuts the viral genome in 289 fragments) in EMSA reaction buffer
were added. For competition experiments, 2.5 or 5.0 pmoles of non-telomeric or telomeric dsDNA were
added 15 minutes prior to the addition of HHV-6-BAC DNA fragments. The plate was incubated for 2h
at room temperature (RT). After 3 washes with TBS-0.1% Tween-20 (TBS-T), peroxidase-labeled
40
mouse anti-DIG antibodies were added to each well for 1h at RT. After 3 additional TBS-T washes,
TMB substrate was added and the reaction allowed to develop for 15 minutes before addition of 50 µl
of 2N sulfuric acid. Absorbance was measured at 450 nm.
41
3.5 Results
HHV-6 infection triggers a DNA damage response
Whether HHV-6 infection triggers the DDR pathway is unknown. To find out, HHV-6A-infected and
control U2OS cells were analyzed for expression of 53BP1 and γH2AX, two DDR markers. Infected
cells were detected using antibodies against the IE2 and P41 viral proteins and telomeric sequences
were detected using a (CCCTTA)3 PNA probe. After 24h of infection, infected cells were identified by
the expression of the IE2 protein. These cells did not express 53BP1 (figure 1). After 48h of infection,
the IE2 staining pattern changed to much larger structures reminiscent of viral DNA replication
compartments, as previously described (36). Interestingly, these cells also expressed 53BP1 which
colocalized with IE2. In addition of discrete and well defined telomeric signals observed, we noticed
rather diffuse and large telomeric signals that colocalized with IE2 and 53BP1. Similar results were
obtained using the anti-γH2AX antibodies (data not shown).
In addition of IE2, we studied P41, a second HHV-6 protein associated with viral DNA replication
compartments (RC). As shown in figure 2, P41 was distributed in large well-defined regions alike IE2.
Colocalization of P41 and IE2 was confirmed by confocal microscopy (data not shown). 53BP1
colocalized with p41 as well. Once again, intense telomeric signals were observed in regions where
P41 and 53BP1 were located. In contrast, expression of the HHV-6 IE1 protein, which is not associated
with viral DNA replication compartments, did not colocalize with IE2 or 53BP1 (data not shown). Similar
results were observed in HHV-6B-infected U2OS cells (not shown).
Although U2OS cells represent a useful model to study HHV-6 infection and integration, lymphocytes
are the major cell type in which HHV-6 efficiently replicates. We therefore repeated these experiments
using HSB-2 and Molt3 lymphoid cells lines that are routinely used to grow HHV-6A and HHV-6B,
respectively. As shown, in HHV-6B-infected Molt3 cells, the P41 antigen colocalized with 53BP1 and
telomeric signals (figure 3A). Similar results were obtained in HHV-6A-infected HSB-2 cells where the
IE2 protein colocalized with 53BP1 and the telomeric probe (figure 3B).
42
In summary, HHV-6 infection triggers a DDR that localized with viral proteins associated with viral DNA
replication compartments. Furthermore, telomeric signals were detected at sites of DDR and viral
proteins expression.
Viral telomeric sequences colocalize with DDR and viral proteins
In the results presented in figures 1-3, telomeric signals were detected at sites of viral protein
expression and DDR localization. Each extremity of the HHV-6 genome has a G-rich section called DR
(direct repeat) that contains telomeric motifs (TMR) (37-40). As the PNA probe is specific for the
TTAGGG motif, it does not discriminate between human and viral telomeric sequences. To determine
the nature of the telomeric signal observed in RC, IF-FISH was performed on JJhan infected with
recombinant wild-type HHV-6A lacking all TMR (double∆) or a mutant lacking only imperfect TMR
(∆imp). Uninfected JJhan were used as a negative control. As shown in figure 4, IE2 expression in
cells infected with HHV-6A ∆imp colocalized with telomeric signals. In contract, in cells infected with
HHV-6A double∆, telomere signals remained dispersed throughout the cells and did not co-stain with
IE2. In summary, these results provide evidence that telomeric staining in zones of HHV-6 infection
represents hybridization of the telomeric probe to the viral telomeres.
Binding of TRF2 to HHV-6 DNA
We next determined, using IF-FISH, whether TRF2, a component of the shelterin complex, could bind
the TTAGGG telomeric sequence found in HHV-6 DNA. As shown in figure 5A, in HHV-6-infected
U2OS cells, TRF2 colocalized with IE2 and telomeric signals. Furthermore, TRF2 also colocalized with
γH2AX and telomeric signals (figure 5B).
These results suggest that the telomeric sequences within HHV-6 DNA are recognized and bound by
TRF2 during infection. To provide additional support to this hypothesis, we performed TRF2 ChIP in
HHV-6B productively-infected Molt3 cells. Uninfected Molt3 cells were used as negative controls. Using
equal amounts of starting material, DNA-bound by TRF2 was immunoprecipitated (IP), using anti-TRF2
antibodies and the DNA analyzed by dot blot hybridization. As shown in figure 6, TRF2 efficiently bound
telomeric sequences in both uninfected and HHV-6-infected cells. In fact, a stronger telomeric signal
was observed in infected cells (figure 6B and C). To discriminate between telomeres of cellular and
43
viral origin, the eluted DNA was hybridized with the DR6 probe, corresponding to a region of the viral
genome approximately 1.5kbp from the TMR (refer to figure 6A). The DR6 probe bound preferentially
to DNA isolated from HHV-6-infected cells (figure 6B and D). As negative control, DNA was
immunoprecipitated with an irrelevant mouse anti-IgG. Under such conditions, no telomeric DNA was
retrieved. As positive control, DNA was IP using anti-RNA PolII antibodies and analyzed by qPCR for
GAPDH promoter DNA. As shown in figure 6E, both mock and HHV-6B-infected IP contained a similar
amount of GAPDH DNA. These results suggest that during infection, HHV-6 TMR are physically bound
by TRF2.
To study TRF2 and viral TMR interactions in greater details, we generated a MBP-TRF2 recombinant
protein and analyzed its ability to bind viral TMR. First, we determined whether purified MBP-TRF2 was
functionally capable of binding telomeric DNA by EMSA. As shown in figure 7, unlike MBP (- control),
MBP-TRF2 efficiently bound dsDNA with telomeric motifs causing a gel shift of the probe. MBP-TRF2
did not bind to non-telomeric dsDNA (supplementary figure 1). Specificity of TRF2 binding was
confirmed by efficient competition with non-labeled telomeric dsDNA but not with non-telomeric dsDNA.
Having validated the ability of recombinant MBP-TRF2 to bond telomeric DNA, we then studied whether
it could bind to viral TMR. To do this, DIG-labeled HHV-6A-BAC DNA was digested with HaeIII enzyme
that cuts on both sides of the viral telomeric motifs. MBP and MBP-TRF2 coated plates were incubated
with the mixtures of DNA fragments (25 ng) and DNA binding assessed using anti-DIG antibodies. As
shown in figure 8, MBP did not bind viral DNA. In contrast, MBP-TRF2 efficiently bound viral DNA.
Specificity for telomeric sequences was validated by efficient competition with ds oligonucleotides
containing the TTAGGG motif but not by non-telomeric dsDNA. In summary, three independent assays
provide evidence that TRF2 binds the telomeric motifs present in HHV-6 DNA.
Alteration of the shelterin complex’s expression during HHV-6 infection
Considering that the DDR is triggered during HHV-6 infection and that part of TRF2 is redistributed to
viral TMR, we became interested in studying the impact of an HHV-6 infection on shelterin components
expression. We first examined the shelterin mRNA levels during HHV-6 infection to determine if a
difference can be observed between infected and uninfected cells. Total RNA was isolated at varying
time points. RT-qPCR was performed with primers specific for each of the shelterin genes as well as
44
the telomerase gene. The cellular gene GAPDH was used as normalization control. As showed in figure
9, in HHV-6A-infected HSB-2 cells, we observed a statistically significant increase in the expression of
three mRNAs: TRF1, TRF2 and TPP1 after five and seven days post-infection. The other shelterin
mRNAs (POT1, Rap1 and TIN2) either remained relatively stable or were slightly increased (p > 0.05)
(not shown). In MOLT-3 cells, the expression of the TRF1, TRF2 and TPP1 mRNAs was also increased
in infected cells compared to controls but the differences did not reach statistical significance (p > 0.05)
(not shown).
We next decided to investigate if these changes in mRNAs level could translate into increased protein
expression. We infected HSB-2 cells with HHV-6A and analysed TRF2 expression by flow cytometry.
To identify HHV-6A-infected cells, cells were also stained with P41 or gp102. In uninfected cells (figure
10), the mean TRF2 fluorescence intensity (MFI) varied between 261 and 210. In HHV-6A infected
cells, two cell populations were observed. Infected ones, expressing p41 or gp102 and uninfected
bystander cells. As shown, infected cells expressed TRF2 at higher levels (MFI of 385 and 376) than
uninfected cells within the same population (MFI of 204 and 259). These results confirm the mRNA
data and indicate that TRF2 is expressed at higher levels during HHV-6A infection.
We also measured TRF2 expression in HHV-6A-infected U2OS cells using confocal microscopy. After
24h, 48h and 72h post-infection, individual cells were analyzed for TRF2 expression. Infected cells
were distinguished from uninfected bystander cells using anti-IE2 antibodies (see figure 1).
Fluorescence was quantified using ImageJ software (figure 11). The results obtained indicate starting
at 24h post-infection, TRF2 is expressed at significantly higher levels in infected cells than bystanders
or uninfected cells (p ≤ 0.01).
In summary, these results show that HHV-6 infected express higher levels of TRF1, TRF2 and TPP1
mRNAs. Using two independent assays and cell types, we confirmed that the increased in TRF2 mRNA
observed results in increased TRF2 protein expression levels.
45
3.6 Discussion
Cells have many pathways to detect DNA damages, transfer and amplify the signal and repair the
breaks. Detection of DNA breaks and regulation of repair is particularly important at chromosomal ends,
where telomeres have to be constantly protected to avoid being recognized as damaged DNA. The
shelterin complex protects the telomeres against recognition as a DSB by folding them into T-Loop
structure (41). The shelterin complex also actively represses proteins involved in DNA damage
signaling and repair pathways. As examples, TRF2 has been shown to be a repressor of the ATM
kinase, while POT1 represses the ATR kinase (22). The loss of TRF2 triggers the ATM pathway and
causes cell cycle arrest (14).
During infection, many viruses provoke a DNA damage response, either because their unprotected
genome is recognized as damaged DNA or because of viral proteins triggering a damage signal. While
several viruses have ways to evade the DDR pathways, some have developed strategies to make use
the cellular DNA repair proteins to their advantage. Cellular DNA repair proteins have been observed
in viral replication compartment in various cases and can be helpful or even necessary for completion
of the infection (42). During Epstein-Barr virus (EBV) infection, the proteins involved in the ATM
pathway checkpoint and HR repair are found in replication compartments (43). The use of the DDR
machinery by EBV likely increases the possibility of molecular events, stimulating the damage signals
causing instability and promoting carcinogenic transformations. Whether viruses can use the DDR
proteins in chromosomal integration is controversial, but some studies have suggested it (42). One
example is the Adeno-associated virus (AAV) that uses the cellular NHEJ mechanism for its site-
specific integration (44). HHV-6 could use a similar tactic during its cycle or to achieve chromosomal
integration.
In this work, we report the presence of damage signaling proteins in HHV-6 RC. Also present in RC
are large quantities of viral TMRs. The origin of the damage signal is unclear as it could be a recognition
of the viral genome extremities as broken DNA, a response to viral proteins or a signal following a
change in the shelterin complex’s homeostasis. When investigating this last possibility, we observed
increased expression of TRF1, TRF2 and TPP1 mRNAs in HHV-6A-infected cells. The expression of
the TRF2 protein was also visibly increased during infection. TRF2 was observed in RC, colocalizing
46
with damage proteins and telomeric sequences. Binding of TRF2 to viral TMR was confirmed by ELISA
and ChIP. Whether TRF1 and TPP1 are also present in RC remains to be investigated. TRF2 binding
to HHV-6 DNA is not unique considering that TRF2 was reported to bind telomeric-like sequences in
the EBV episome (45). By being attracted to HHV-6 TMRs, TRF2 may leave telomeres unprotected,
leading to instability or damage repair. The increase in TRF2 production by the infected cell may
compensate the lack of this protein at cellular telomeres, or it could be in response to the presence of
numerous viral TMRs present. The lack of DDR at telomeres during infection argues in favor of the
latter hypothesis.
HHV-6 chromosomal integration’s mechanism is not fully understood but it appears probable that the
virus integrates by HR between the TMRs in the virus’s genome and the cellular telomeres. The
integration not only occurs solely in telomeres, but it has been shown that the telomeric sequences in
the virus’s genome are essentials for efficient integration into chromosomes (30). Furthermore, the
integrated virus has been sequenced and its orientation and missing sections are compatible with an
integration by HR between the viral TMRs and the telomeres (10, 46, 47). HR is usually used as a DNA
repair mechanism during S and G2 phases (16). The presence of proteins implicated in DNA damage
signaling, such as 53BP1 and γH2AX, in the viral replication compartment is consistent with the
hypothesis of a chromosomal integration by HR. In response to these DSB signals, a DNA repair
mechanism could be triggered. HR starts by the resection of the 5’ extremity of the broken DNA by a
nuclease to generate a 3’overhang (16, 48-50). Since the damage signals co-localize with the viral
DNA, the later could be degraded up to the TMR region, creating a perfect template for reparation by
HR between the viral TMR and a nearby chromosomal telomere and allowing chromosomal integration
of HHV-6. The role of TRF2 in the damage response observed in the viral replication compartments is
not known. Considering that TRF2 is important for inhibiting HR at telomeres (22, 23), our results
suggest that during active viral DNA replication, binding of TRF2 to viral TMR may help limit integration
of the viral DNA into telomeres, thus allowing for an efficient replication to occur.
In summary, we showed that HHV-6 provokes DNA damage signaling events during infection and
affects the expression of the shelterin complex proteins. During HHV-6 infection, damage signals such
as 53BP1 and γH2AX are present with viral TMRs in the viral DNA replication compartment and the
shelterin complex mRNAs are affected by the infection. The TRF2 protein is also found with the TMRs
47
and damage signals in the viral compartments during infection and is overexpressed in infected cells.
These results suggest a complex interplay between HHV-6 and the shelterin complex and could also
be consistent with the notion that HHV-6 chromosomal integration occurs by homologous
recombination in the telomeres. Inhibition of HR during HHV-6 infection might help to confirm its
importance in the chromosomal integration process.
48
3.7 Acknowledgments
We are grateful to Maria J. Fernandes for the use of her microscopy equipment.
We acknowledge the Bioimaging platform of the Infectious Disease Research Centre, funded by an
equipment and infrastructure grant from the Canadian Foundation Innovation (CFI).
We thank Benedikt B. Kaufer for providing the ∆imp and double∆ TMR HHV-6A mutants.
3.8 Funding
This work was funded by a Canadian Institutes of Health research grant (MOP_123214) awarded to
LF. SGG is the recipient of a FRQ-S studentship award.
3.9 Author Contributions
Experimental manipulations: A.G., S.G.G., Data analysis: A.G., S.G.G., L.F., Writing: S.G.G., L.F.
49
3.10 Bibliography
1. Ablashi D, Agut H, Alvarez-Lafuente R, Clark DA, Dewhurst S, DiLuca D, et al. Classification of HHV-6A and HHV-6B as distinct viruses. Arch Virol. 2014;159(5):863-70. 2. Yamanishi K, Okuno T, Shiraki K, Takahashi M, Kondo T, Asano Y, et al. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet. 1988;1(8594):1065-7. 3. Tesini BL, Epstein LG, Caserta MT. Clinical impact of primary infection with roseoloviruses. Curr Opin Virol. 2014;9:91-6. 4. Morissette G, Flamand L. Herpesviruses and chromosomal integration. J Virol. 84. United States2010. p. 12100-9. 5. Pellett PE, Ablashi DV, Ambros PF, Agut H, Caserta MT, Descamps V, et al. Chromosomally integrated human herpesvirus 6: questions and answers. Rev Med Virol. 2012;22(3):144-55. 6. Gravel A, Dubuc I, Morissette G, Sedlak RH, Jerome KR, Flamand L. Inherited chromosomally integrated human herpesvirus 6 as a predisposing risk factor for the development of angina pectoris. Proc Natl Acad Sci U S A. 2015;112(26):8058-63. 7. Torelli G, Barozzi P, Marasca R, Cocconcelli P, Merelli E, Ceccherini-Nelli L, et al. Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. J Med Virol. 1995;46(3):178-88. 8. Daibata M, Taguchi T, Taguchi H, Miyoshi I. Integration of human herpesvirus 6 in a Burkitt's lymphoma cell line. Br J Haematol. 1998;102(5):1307-13. 9. Nacheva EP, Ward KN, Brazma D, Virgili A, Howard J, Leong HN, et al. Human herpesvirus 6 integrates within telomeric regions as evidenced by five different chromosomal sites. J Med Virol. 2008;80(11):1952-8. 10. Arbuckle JH, Medveczky MM, Luka J, Hadley SH, Luegmayr A, Ablashi D, et al. The latent human herpesvirus-6A genome specifically integrates in telomeres of human chromosomes in vivo and in vitro. Proc Natl Acad Sci U S A. 2010;107(12):5563-8. 11. Wright WE, Tesmer VM, Huffman KE, Levene SD, Shay JW. Normal human chromosomes have long G-rich telomeric overhangs at one end. Genes Dev. 1997;11(21):2801-9. 12. Olovnikov AM. A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol. 1973;41(1):181-90. 13. Zhang J, Rane G, Dai X, Shanmugam MK, Arfuso F, Samy RP, et al. Ageing and the telomere connection: An intimate relationship with inflammation. Ageing Res Rev. 2016;25:55-69. 14. de Lange T. How telomeres solve the end-protection problem. Science. 2009;326(5955):948-52. 15. Liu Y, Li Y, Lu X. Regulators in the DNA damage response. Arch Biochem Biophys. 2016;594:18-25. 16. Pardo B, Gomez-Gonzalez B, Aguilera A. DNA repair in mammalian cells: DNA double-strand break repair: how to fix a broken relationship. Cell Mol Life Sci. 2009;66(6):1039-56. 17. Griffith JD, Comeau L, Rosenfield S, Stansel RM, Bianchi A, Moss H, et al. Mammalian telomeres end in a large duplex loop. Cell. 1999;97(4):503-14. 18. Bilaud T, Brun C, Ancelin K, Koering CE, Laroche T, Gilson E. Telomeric localization of TRF2, a novel human telobox protein. Nat Genet. 1997;17(2):236-9. 19. Zhong Z, Shiue L, Kaplan S, de Lange T. A mammalian factor that binds telomeric TTAGGG repeats in vitro. Mol Cell Biol. 1992;12(11):4834-43.
50
20. Broccoli D, Smogorzewska A, Chong L, de Lange T. Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet. 1997;17(2):231-5. 21. Karlseder J, Broccoli D, Dai Y, Hardy S, de Lange T. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science. 1999;283(5406):1321-5. 22. Denchi EL, de Lange T. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature. 2007;448(7157):1068-71. 23. Wang RC, Smogorzewska A, de Lange T. Homologous recombination generates T-loop-sized deletions at human telomeres. Cell. 2004;119(3):355-68. 24. Lei M, Podell ER, Cech TR. Structure of human POT1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol. 2004;11(12):1223-9. 25. Baumann P, Cech TR. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science. 2001;292(5519):1171-5. 26. Loayza D, Parsons H, Donigian J, Hoke K, de Lange T. DNA binding features of human POT1: a nonamer 5'-TAGGGTTAG-3' minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem. 2004;279(13):13241-8. 27. Lees-Miller SP, Long MC, Kilvert MA, Lam V, Rice SA, Spencer CA. Attenuation of DNA-dependent protein kinase activity and its catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. J Virol. 1996;70(11):7471-7. 28. Lilley CE, Chaurushiya MS, Boutell C, Landry S, Suh J, Panier S, et al. A viral E3 ligase targets RNF8 and RNF168 to control histone ubiquitination and DNA damage responses. Embo j. 2010;29(5):943-55. 29. Luo MH, Rosenke K, Czornak K, Fortunato EA. Human cytomegalovirus disrupts both ataxia telangiectasia mutated protein (ATM)- and ATM-Rad3-related kinase-mediated DNA damage responses during lytic infection. J Virol. 2007;81(4):1934-50. 30. Wallaschek N, Sanyal A, Pirzer F, Gravel A, Mori Y, Flamand L, et al. The Telomeric Repeats of Human Herpesvirus 6A (HHV-6A) Are Required for Efficient Virus Integration. PLoS Pathog. 2016;12(5):e1005666. 31. Gravel A, Gosselin J, Flamand L. Human Herpesvirus 6 immediate-early 1 protein is a sumoylated nuclear phosphoprotein colocalizing with promyelocytic leukemia protein-associated nuclear bodies. J Biol Chem. 2002;277(22):19679-87. 32. Herbig U, Jobling WA, Chen BP, Chen DJ, Sedivy JM. Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol Cell. 2004;14(4):501-13. 33. Jaworska J, Gravel A, Fink K, Grandvaux N, Flamand L. Inhibition of transcription of the beta interferon gene by the human herpesvirus 6 immediate-early 1 protein. J Virol. 2007;81(11):5737-48. 34. Poncet D, Belleville A, t'kint de Roodenbeke C, Roborel de Climens A, Ben Simon E, Merle-Beral H, et al. Changes in the expression of telomere maintenance genes suggest global telomere dysfunction in B-chronic lymphocytic leukemia. Blood. 2008;111(4):2388-91. 35. Trempe F, Gravel A, Dubuc I, Wallaschek N, Collin V, Gilbert-Girard S, et al. Characterization of human herpesvirus 6A/B U94 as ATPase, helicase, exonuclease and DNA-binding proteins. Nucleic Acids Res. 2015;43(12):6084-98. 36. Gravel A, Tomoiu A, Cloutier N, Gosselin J, Flamand L. Characterization of the immediate-early 2 protein of human herpesvirus 6, a promiscuous transcriptional activator. Virology. 2003;308(2):340-53. 37. Gompels UA, Nicholas J, Lawrence G, Jones M, Thomson BJ, Martin ME, et al. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology. 1995;209(1):29-51.
51
38. Dominguez G, Dambaugh TR, Stamey FR, Dewhurst S, Inoue N, Pellett PE. Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. J Virol. 1999;73(10):8040-52. 39. Isegawa Y, Mukai T, Nakano K, Kagawa M, Chen J, Mori Y, et al. Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B. J Virol. 1999;73(10):8053-63. 40. Thomson BJ, Dewhurst S, Gray D. Structure and heterogeneity of the a sequences of human herpesvirus 6 strain variants U1102 and Z29 and identification of human telomeric repeat sequences at the genomic termini. J Virol. 1994;68(5):3007-14. 41. de Lange T. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev. 2005;19(18):2100-10. 42. Weitzman MD, Lilley CE, Chaurushiya MS. Genomes in conflict: maintaining genome integrity during virus infection. Annu Rev Microbiol. 2010;64:61-81. 43. Kudoh A, Iwahori S, Sato Y, Nakayama S, Isomura H, Murata T, et al. Homologous recombinational repair factors are recruited and loaded onto the viral DNA genome in Epstein-Barr virus replication compartments. J Virol. 2009;83(13):6641-51. 44. Daya S, Cortez N, Berns KI. Adeno-associated virus site-specific integration is mediated by proteins of the nonhomologous end-joining pathway. J Virol. 2009;83(22):11655-64. 45. Deng Z, Lezina L, Chen CJ, Shtivelband S, So W, Lieberman PM. Telomeric proteins regulate episomal maintenance of Epstein-Barr virus origin of plasmid replication. Mol Cell. 2002;9(3):493-503. 46. Ohye T, Inagaki H, Ihira M, Higashimoto Y, Kato K, Oikawa J, et al. Dual roles for the telomeric repeats in chromosomally integrated human herpesvirus-6. Sci Rep. 2014;4:4559. 47. Huang Y, Hidalgo-Bravo A, Zhang E, Cotton VE, Mendez-Bermudez A, Wig G, et al. Human telomeres that carry an integrated copy of human herpesvirus 6 are often short and unstable, facilitating release of the viral genome from the chromosome. Nucleic Acids Res. 2014;42(1):315-27. 48. White CI, Haber JE. Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. Embo j. 1990;9(3):663-73. 49. Sun H, Treco D, Szostak JW. Extensive 3'-overhanging, single-stranded DNA associated with the meiosis-specific double-strand breaks at the ARG4 recombination initiation site. Cell. 1991;64(6):1155-61. 50. Li X, Heyer WD. Homologous recombination in DNA repair and DNA damage tolerance. Cell Res. 2008;18(1):99-113.
52
3.11 Figures
Figure 1 : Activation of the DDR during HHV-6A infection of U2OS cells
Cells were mock (top) or infected with HHV-6A for 24h (second), 48h (third) or 72h (bottom)
before processed for IF-FISH using anti-IE2 (red), anti-53BP1 (green) antibodies and telomeric
probes (magenta).
53
Figure 2 : U2OS cells infected with HHV-6A (U1102 strain)
After 48h post-infection, the compartments observed with IE2 (Fig 1) are also observed with the
viral protein P41 (red), co-localizing with DDR protein 53BP1 (green) and telomeric sequences
(magenta).
54
Figure 3 : Colocalization of viral proteins, 53BP1 and telomeric signals
A) Colocalization of P41, 53BP1 and telomeric signals in HHV-6B-infected Molt3 cells. Cells
were infected with HHV-6B and 48h post-infection cells were processed for IF-FISH using anti-
P41 (green), anti-53BP1 (red) antibodies and telomeric probes (cyan). B) Colocalization of IE2,
53BP1 and telomeric signals in HHV-6A-infected HSB2 cells. Cells were infected with HHV-6A
and 48h post-infection cells were processed for IF-FISH using anti-IE2 (green), anti-53BP1 (red)
antibodies and telomeric probes (magenta).
55
Figure 4 : Detection of viral temoleres using telomeric probe
JJhan cells infected with HHV-6A mutants lacking a portion (∆imp) or all TMR sequences
(double∆). Cells were infected with HHV-6A for 72h and processed for IF-FISH using anti-IE2
(red) and telomeric probe (Cyan).
56
Figure 5 : Localization of TRF2 at viral replication compartments
A) U2OS cells were infected with HHV-6A and 48h and 72h post-infection, cells were processed
for IF-FISH using anti-TRF2 and anti-IE2 antibodies and PNA telomeric probe. B) Co-
localization of TRF2, γH2AX with telomeric signals. HHV-6A-infected U2OS cells were
processed for IF-FISH using anti-TRF2 and anti-γH2AX antibodies and PNA telomeric probe.
48h post-infection, TRF2 colocalize in viral replication compartments with γH2AX and the
telomeric probe, as it does with IE2.
57
Figure 6 : TRF2 binds to viral DNA
A) Structure of the HHV-6 genome (not to scale) to show location of telomeric repeats and DR6
probe. B) Uninfected and HHV-6B-infected Molt3 cells were analyzed by ChIP. Anti-IgG (-
control) or TRF2 antibodies were used to precipitate DNA. Eluted DNA was serially diluted and
58
hybridized with 32P-labeled telomeric (TTAGGG)3 (left panels) or HHV-6 (DR6) probes (right
panels). After hybridization the membranes were washed and exposed to X-ray films. C-D)
Densitomeric analysis of results from 3 independent experiments. Results are expressed as
mean + SD TRF2 binding to telomeric (C) or viral DNA (D) in HHV-6B-infected cells relative to
TRF2 binding in uninfected cells. E) Negative and positive control of the ChIP experiments.
Uninfected and HHV-6B-infected Molt3 cells were analyzed by ChIP using a non-relevant anti-
IgG (- control) or anti-RNA PolII antibodies (+ control) and analyzed by QPCR for GAPDH
promoter binding. Results are normalized with the negative control on mock-infected cells.
59
Figure 7 : MBP-TRF2 binds telomeric motifs
Recombinant MBP or MBP-TRF2 were incubated with 32P-labeled telomeric dsDNA and
binding was analyzed by EMSA. Excess of unlabeled telomeric and non-telomeric dsDNA were
added as competitors (10 to 1000 fold excess relative to the probe). Samples were migrated on
non-denaturing acrylamide gel, dried and exposed to X-ray films.
60
Figure 8 : MBP-TRF2 bind viral TMR
Recombinant MBP and MBP-TRF-2 were incubated with HaeIII digested DIG-labeled HHV-6A
DNA (25 ng/condition) in the presence or absence on competitors. Bound DNA was quantified
by adding peroxidase labelled anti-DIG antibodies and substrate. Results are expressed as
mead absorbance +SD of triplicate values. Experiment is representative of two additional
experiments. *** P<0.001.
61
Figure 9 : Expression shelterin complex mRNAs in uninfected and HHV-6A-infected
HSB2 cells
Cells were infected and at varying time points mRNA was analyzed for TRF1 (A), TRF2 (B) and
TPP1 (C) expression by RT-QPCR. Results from 5 independent experiments are expressed as
mean + SD over expression of uninfected cells (day 0) after normalization with GAPDH
expression. *p<0.05. D) IE1 viral mRNA expression during infection analyzed by RT-qPCR.
Results from one representative experiment.
62
Figure 10 : TRF2 expression during HHV-6A infection
Mock or HHV-6A-infected HSB-2 cells were fixed, permeabilized and analyzed for TRF2, P41
and gp102 protein expression by flow cytometry. Results are representative of two independent
experiments.
63
Figure 11 : Increased TRF2 expression in HHV-6A-infected U2OS cells
TRF2 expression in uninfected or infected cells (IE2+) was determined at 24h, 48h and 72h
post-infection and compared to uninfected cells (IE2-).Results are expressed as mean + SD.
Each symbol represents the relative TRF2 fluorescence from a single cell.
64
3.12 Supplementary Data
Supplementary figure 1 : MBP-TRF2 does not bind non-telomeric motifs
Recombinant MBP or MBP-TRF2 were incubated with 32P-labeled non-telomeric dsDNA and
binding was analyzed by EMSA. Samples were migrated on non-denaturing acrylamide gel,
dried and exposed to X-ray films.
65
Chapitre 4 : Activité de la télomérase et intégration chromosomique de HHV-6
4.1 Résumé
L’herpèsvirus de type 6 (HHV-6) peut intégrer son génome dans les télomères humains en utilisant un
mécanisme qui demeure peu compris. L’élongation des télomères humains est assurée par le
complexe de la télomérase, qui pourrait restaurer le télomère suite à l’intégration de HHV-6. Dans ce
travail, nous avons étudié le rôle du complexe de la télomérase dans la réplication et l’intégration de
HHV-6 en utilisant BRACO-19, un composé qui stabilise les structures G-quadruplexes présentes dans
les télomères, inhibant ainsi l’action de la télomérase. En premier lieu, nous avons confirmé la
spécificité de BRACO-19 pour les G-quadruplexes par résonnance de plasmon de surface. Nous avons
ensuite testé la toxicité de BRACO-19 et son effet sur la réplication de HHV-6. Nos analyses ont
démontré que l’inhibition de l’activité de la télomérase par BRACO-19 n’affecte pas l’entrée du virus
dans les cellules hôtes, ni la réplication virale. Par la suite, nous avons cherché à déterminer si
l’inhibition de l’activité télomérase affecte l’intégration de HHV-6. L’inhibition de l’activité de la
télomérase a diminué d’environ 50% la fréquence d’observation de clones portant l’intégration HHV-6
dans les cellules Hela (télomérase positives) (P < 0.002), alors que BRACO-19 n’a eu aucun effet dans
les cellules U2OS (télomérase négatives). Ces résultats ont été confirmés par PCR en micro-
compartiments dans les lignées cellulaires Hela et MCF-7 (télomérase+) (P < 0.01). Nos données
suggèrent que l’activité télomérase est nécessaire pour le maintien de l’intégration chromosomique de
HHV-6 et sont en accord avec l’hypothèse selon laquelle les télomères doivent être prolongés par la
télomérase suite à l’intégration de HHV-6.
66
Telomerase activity and human herpesvirus 6 chromosomal
integration.
Shella Gilbert-Girard1, Annie Gravel1, Sara Artusi2, Sara N. Richter2, Nina Wallaschek3, Benedikt B.
Kaufer3 and Louis Flamand1,4
1Division of Infectious Disease and Immunity, CHU de Québec Research Center, Quebec city, Quebec
G1V 4G2, Canada, 2Department of Molecular Medicine, University of Padua, via Gabelli, 63, 35121
Padua, Italy, 3Institut für Virologie, Freie Universität Berlin, Berlin 14163, Germany and 4Department of
microbiology, infectious disease and immunology, Faculty of Medicine, Université Laval, Quebec city,
Québec, G1V 0A6 Canada
*To whom correspondence should be addressed:
Louis Flamand PhD MBA
Division of Infectious Disease and Immunity
Room T1-49
CHU de Quebec Research Center,
Quebec city, Canada
G1V 4G2
Tel (418)-525-4444 ext 46164; Fax (418)-654-2765
Email:Louis.flamand@crchul.ulaval.ca
67
4.2 Abstract
Human herpesvirus-6 (HHV-6) can integrate its genome into the telomeres at the end of human
chromosomes using a mechanism that remains poorly understood. The telomeres of human cells are
maintained by the telomerase complex, which is also thought to restore telomere length upon
integration of the virus. In this report, we determined the role of the telomerase complex in HHV-6
replication and integration using BRACO-19, a telomerase inhibitor that stabilizes G-quadruplexes.
First, surface plasmon resonance confirmed the specificity of BRACO-19 for telomeric G-quadruplexes.
Subsequently we assessed the toxicity of BRACO-19 and its effect on HHV-6 replication. Our analyses
demonstrated that inhibition of telomerase activity does not affect virus entry into host cells nor virus
replication. Next, we investigated if telomerase inhibition affected integration of HHV-6 using a recently
established integration assay. Inhibition of telomerase activity reduced the integration frequency of
HHV-6 in telomerase positive Hela cells by about 50% (P < 0.002), while BRACO-19 did not have a
significant effect in telomerase negative U2OS cells. These results were confirmed by digital droplet
PCR in Hela cells and MCF-7 (telomerase+) cell lines (P < 0.01). Our data demonstrate that telomerase
activity is required for efficient persistence of integrated HHV-6 and is consistent with the hypothesis
that telomeric extension from the viral telomere is needed to ensure long-term survival of cells carrying
integrated HHV-6.
68
4.3 Introduction
Human herpesvirus-6A (HHV-6A) and HHV-6B are two distinct lymphotropic DNA viruses that belong
to the subfamily Betaherpesvirinae. Despite their high genome sequence similarity, they have different
biological and epidemiological properties [1]. HHV-6B is a ubiquitous virus that infects nearly 100% of
the human population. It is the etiological agent of the febrile illness roseola infantum, also known as
sixth disease [2, 3]. Reactivation of HHV-6B in immunosuppressed individuals is associated with
complications including life-threatening encephalitis or graft rejection in transplant patients [4]. The
etiology of HHV-6A is not as well described. Unlike other human herpesviruses, HHV-6A and HHV-6B
do not maintain their genome in an episomal form during latency [5], but integrate their genomes into
chromosomes. This integration was first described by Luppi et al., who observed the presence of the
integrated HHV-6 genome in the chromosomes of freshly isolated peripheral blood mononuclear cells
(PBMC) [6, 7]. HHV-6 integration can occur in somatic and germinal cells and, in the latter case, can
be transmitted vertically to descendants [8, 9]. This condition is termed inherited chromosomally
integrated HHV-6 (iciHHV-6) and is prevalent in about 0.2% to 1% of the human population across the
world (reviewed in [10, 11]). In 2015, Gravel et al. analyzed the DNA of a cohort of 20 000 Quebecers
(Canada), for the presence of iciHHV-6 and determined associations with different diseases [12]. This
study identified iciHHV-6 as a predisposing risk factor for angina pectoris, with a three folds higher
prevalence in iciHHV-6+ individuals.
Although HHV-6 integration can occur in various chromosomes, the viral genome is consistently
detected in the telomere region at the end of host chromosomes [5, 10, 13-15]. Telomeres are
composed of double-stranded TTAGGG repeats (8-13 kbp long) followed by a 30 to 200 bp single-
stranded 3’ overhang [16-19]. Telomeres protect the chromosome against information loss and
instability [20, 21] and are shortened every time a cell divides. The telomerase complex counteracts
this shortening in stem and cancer cells by adding telomeric repeats at the very end of chromosomes.
Maintenance of telomere length by the telomerase extends the replication capacity of cells [20]. An
alternative mechanism of lengthening of telomeres (ALT) that is mostly based on homologous
recombination is also active in some cancer cells [22].
69
Despite recent advances, the HHV-6 integration mechanism is still not well defined yet. The HHV-6
genome consists of a unique sequence (U) that is flanked by G-rich direct repeat regions (DR) that
harbor the packaging sequences (pac1 and pac2) and two arrays of either perfect or imperfect
telomeric repeats (TMR) at the genome termini [23-27]. The presence of these repeats at the end of
the virus genome and the fact that chromosomal integration occurs in telomere lead to the hypothesis
that HHV-6 integrates the human genome by homologous recombination between viral TMRs and
chromosomal telomeric sequences [10, 28]. Wallascheck et al. recently demonstrated that the viral
telomeric repeats facilitate HHV-6 integration into host telomeres [29]. Analysis of the integrated virus
genome revealed that the perfect TMR of the DRR region are fused to the host chromosome while the
pac2 sequence is lost, consistent with an integration mediated by HR between the viral TMR and the
host telomere [5]. At the other end of the viral genome, the pac1 region is also lost and additional
telomeric repeats are added, indicating that the TMR in the DRL is likely used to form a neo-telomere
[30-32]. To avoid recognition as a shortened telomere, telomerase or an alternative mechanism has
been proposed to extend these viral telomeres after virus genome integration, facilitating the recovery
chromosome’s protective end.
In this work, we set to determine if inhibition of the telomerase activity affects the establishment of cell
lines harboring the virus genome in the host telomeres. To achieve this, we used a specific inhibitor
termed BRACO-19 that, by binding the G-quadruplexes secondary structure of the telomeres,
represses telomerase activity and provokes the displacement of the telomerase complex [33, 34]. We
confirmed the specificity of the inhibitor and assessed its effect on HHV-6 replication and integration.
Our results demonstrate that BRACO-19 does not affect virus replication, but inhibits the integration
frequency in cell lines established in our recently developed in vitro integration assay. Taken together,
our data provides the first evidence for the involvement of telomerase in the integration process and
long term maintenance of integrated HHV-6.
70
4.4 Materials and Methods
Cell lines and viruses
U2OS cells (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium
(DMEM, Corning Cellgro, Manassas, VA, USA) supplemented with 10% Nu serum (Corning Cellgro),
non-essential amino acids (Corning Cellgro), HEPES, sodium pyruvate (Wisent Inc., St-Bruno,
Québec, Canada) and plasmocin 5 μg/ml (InvivoGen, San Diego, CA, USA). HeLa and MCF-7 cells
(ATCC) were cultured in the same medium, but supplemented with 10% fetal bovine serum (FBS)
(Thermo Fisher Scientific, Waltham, MA, USA) instead of Nu serum. MOLT-3 (ATCC, CRL-1552) and
HSB-2 (ATCC, CCL-120.1), both human T lymphoblastic cell lines, were cultured in RPMI-1640
(Corning Cellgro) supplemented with 10% Nu serum (Corning Cellgro), HEPES and plasmocin 5 μg/ml
(InvivoGen, San Diego, CA, USA). Peripheral blood mononuclear cells (PBMCs) were isolated from
blood samples of donors aged between 18 and 50 years old by centrifugation over a Ficoll gradient
(Wisent Inc.) and cultured in RPMI-1640 supplemented with 10% FBS. HHV6A and HHV-6B were
propagated in HSB-2 and Molt3 cells, respectively as previously described [35, 36].
BRACO-19 cytotoxicity
BRACO-19 was purchased from Sigma-Aldrich Canada. To verify the cytotoxic effect of BRACO-19, a
3-(4-5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was performed. Molt-3 and
2-day old PHA-activated PBMCs were plated at 5x105 cells/well in duplicates. Cells were treated with
increasing concentrations of BRACO-19 (0-3 µM) and incubated at 37°C. After 48h, cells were treated
a second time. Cell proliferation was evaluated on day 1, 3, 5 and 7.
Effect of BRACO-19 on HHV-6 infection
To investigate the effect of BRACO-19 on HHV-6 infection, PHA-activated PBMC or Molt-3 cells were
infected with HHV-6B (Z29) at a MOI of 0.5 in complete RPMI-1640, for 4h at 37°C. Cells were then
washed twice with PBS and suspended in complete medium at a density of 5x105 cells/ml in 6-well
culture plates. The cells were treated with increasing concentrations of BRACO-19 (2-fold dilutions
from 2 μM to 0.25 μM or from 3 μM to 0.1875 μM) at 0h, 48h, 96h and 144h post-infection. Total DNA
was isolated using QIAamp DNA blood mini kit (Qiagen Inc., Toronto, ON, Canada) according to the
manufacturer’s instructions. 100 ng of DNA were analyzed by qPCR with a Rotor-Gene Q (Qiagen)
71
with the Rotor-Gene Multiplex PCR Kit (Qiagen) using HHV-6-specific primers as previously described
[12, 37]. As a cellular control, GAPDH-specific probe and primers (IDT) were used with the following
sequences: FWD 5’-GTCCCTCAATATGGTCCTGTC-3’, REV 5’-TTCTCCATGGTGGTGAAGAC-3’
and probe 5’-/5HEX/CGACGTACT/ZEN/CAGCGCCAGCATC/3IABkFQ/-3’. The PCR programs used
were designed according to the manufacturer’s instructions.
BG4 antibody production
The pSANG10-3F-BG4 was a gift from Shankar Balasubramanian (Addgene plasmid # 55756) [38].
The single chain Flag-BG4 antibody was expressed in E coli and purified by affinity chromatography,
as described [38].
ELISA
The ELISA was performed with the antibody BG4 that binds specifically to the G-quadruplex structure
[38]. Biotinylated-oligonucleotides of the Myc promoter (5’-/5Biosg/ACTACTACTGGGGAGGGTGG
GGAGGGTGGGGAAGG-3’), G-rich telomeric repeats (5’-/5Biosg/ACTACTACTGGTTAGGGTTAG
GGTTAGGGTTAGGGTTAG-3’) and C-rich telomeric repeats (5’-/5Biosg/ACTACTACTTAACCCTAAC
CCTAACCCTAACCCTAACCCT-3’) were purchased from IDT (Coralville, Iowa, USA). 96-well plates
were coated with an avidin solution at 5 μg/ml in water at 37˚C overnight. The oligos were folded by
incubation at 95˚C for 10 min in an annealing buffer (10 mM Tris-HCl pH 7.5, 100 mM KCl) and were
left to cool down at RT overnight. The oligos were added to the wells at a concentration of 2
pmoles/well. The BG4 antibody was added at different concentrations ranging from 0 nM to 12.5 nM.
After 3 washes with PBS-Tween 0.1% (PBS-T), 1 μg/mL of anti-FLAG antibody (Applied Biological
Materials, Richmond, BC, Canada) were added and the plate was incubated for 1h at room
temperature. After 3 additional washes, 0.1 mL of horseradish-peroxidase-conjugated goat anti-mouse
antibody (1:20000 dilution) (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA) were
added to each well for 1h at room temperature. After washing, the tetramethylbenzidine substrate (BD
Biosciences, Mississauga, ON, Canada) was added and the reaction allowed to proceed for 15 minutes
after which 0.05 mL of sulfuric acid were added. The absorbance of each well was measured at 450
nm with the Infinite M200 microplate reader.
72
Surface Plasmon Resonance (SPR)
All SPR experiments were conducted using the ProteOn XPR36 apparatus (Bio-Rad, Mississauga,
Canada). Biotin-labeled DNA oligonucleotides were attached to the surface of a neutravidin-coated
NLC chip (Bio-Rad). The neutravidin-coated NLC chip (Bio-Rad) was preconditioned by injecting two
times sequentially, 50 mM NaOH and 1 M NaCl in the two directions (horizontally and vertically). The
same biotinylated-oligonucleotides used for the ELISA (Myc, human Telo G-rich and human Telo C-
rich) were diluted to 25 nM in running buffer (10 mM Hepes-KOH pH 7.4, 0.2 M KCl, 3 mM EDTA and
0.005% Tween-20). The equivalent of 60 Response Unit (RU) of biotinylated-oligonucleotides was
attached to the NLC chip. The chip was then ready for protein binding analyses. Between each of these
injections, a three-step regeneration (2 M NaCl, 5 mM NaOH + 0.5 M NaCl, 0.1% SDS) program was
performed to remove residual binding. BG4 was injected at 50 μl/min over 180 seconds, followed by a
dissociation time of 600 seconds. BRACO-19 was injected at 25 μl/min over 900 seconds, followed by
a dissociation time of 1800 seconds.
HHV-6 integration assay
HeLa and U2OS cells were seeded in 48-wells plates at 1x104 cells per well and cultured overnight.
BRACO-19 (1 µM) was added to half of the wells 3 hours before infection. All cells were infected at a
MOI of 5 for 4 hours, washed with PBS and cultured in media with or without BRACO-19 (1 μM) for
72h. Cells were then detached with trypsin, counted and seeded at 2 cells per well in 96-well plates.
Cells were cultured in media with or without BRACO-19 (100 nM) and changed every three days until
the clones had sufficiently divided. Wells containing more than one clone were excluded. Clones were
detached with trypsin and grown in 24-well plates. When clones were confluent, DNA was isolated and
tested for the presence of HHV-6 DNA by qPCR.
To further confirm the above results, we measured the frequency of integrated HHV-6 in bulk cultures
using droplet digital PCR (ddPCR), instead of isolating individual clones. Briefly, Hela, MCF-7 and
U2OS were infected using the same conditions as described above. Three days after infection, cells
were transferred into a 25 cm2 flask and cultured with or without BRACO-19 (100 nM) for 21 days.
Cells were detached with trypsin and DNA was isolated and tested by ddPCR for the presence HHV-6
73
and the cellular reference gene RPP30 as described previously [39]. U65-U66 specific primers were
validated previously [12, 37] and used for the detection of the integrated HHV-6 genome.
Fluorescence In Situ Hybridization (FISH)
To confirm HHV-6 chromosomal integration, we performed FISH using a HHV-6 specific DIG-labeled
probe on metaphase chromosome spreads of several clones as described [40, 41].
Statistical analyses
Clone integration frequencies were analyzed using Fisher’s exact test. A p value < 0.05 was considered
significant.
74
4.5 Results
Biophysical characterization of BRACO-19 binding to G-quadruplex telomere structures
To ensure the correct folding of oligonucleotides into G-quadruplex structures, we initially performed
an ELISA assay as described in materials and methods section. We demonstrated that the BG4
antibody bound specifically the G-rich telomeric oligo as well as the myc control, an oligonucleotide
that contains the G-quadruplex structure present in the promoter of the c-Myc oncogene [42, 43] (Figure
1). As expected, no specific binding was observed for the C-rich oligos. These results confirm that both
the G-rich and myc oligonucleotides can fold in a structure recognized by the G-quadruplex -specific
BG4 antibody.
Next we tested BRACO-19’s biophysical binding constants to the telomeric and myc oligonucleotides
by surface plasmon resonance using the BG4 antibody as a positive control. The BG4 antibody
efficiently bound the G-quadruplex -folded telomeric sequence (KD = 5.46x10-7 M) and the myc
promoter sequence (KD = 2.52x10-8 M), confirming the ELISA results. In addition, we confirmed that
BRACO-19 specifically binds both telomeric and myc G-quadruplex oligonucleotides, with KDs in the
range of 10-8 M, while only minimal binding was observed for the C-rich telomeric sequence and no
constant was calculated as no proper curves were visible (Figure 2-F). Our results confirm that BRACO-
19 specifically binds the G-quadruplex structure formed in the single-stranded G-rich telomeric DNA.
Toxicity analyses of BRACO-19
To assess BRACO-19 concentrations to be used without inducing cytotoxic effects, we performed cell
proliferation assays in infected Molt-3 cells and PBMC. The cells were incubated for seven days with
varying concentrations of BRACO-19 ranging from 0.25 to 2 µM. No toxicity of BRACO-19 was
observed in HHV-6-infected PBMC at concentrations between 0.25 to 2 µM (Figure 3A). For HHV-6-
infected Molt3 cells, only BRACO-19 concentration higher than 1.5 µM showed some toxicity starting
at day 5 of culture (figure 3B).
75
Effects of BRACO-19 on HHV-6 replication
The HHV-6 genome contains G-rich sequences, including telomeric repeats, that might interact with
BRACO-19 and affect viral genome replication. Therefore, we determined the impact of BRACO-19 (0
- 3 µM) on HHV-6 replication. PBMC and Molt3 cells were infected with HHV-6B (Z29) and cultured for
several days with or without BRACO-19. Intracellular DNA was extracted and the amount of HHV-6B
DNA was assessed by qPCR. We could demonstrate that BRACO-19 had no impact on virus replication
in Molt-3 and PBMCs (Figure 4), suggesting that the drug does neither affect HHV-6 entry nor viral
genome replication.
Effects of BRACO-19 on HHV-6 chromosomal integration
We next examined the effects of the BRACO-19 on HHV-6 chromosomal integration using a recently
established integration assay (Gravel et al., submitted to JVI). Telomerase positive Hela cells and
negative U2OS cells were either left untreated or were treated with 1µM BRACO-19 prior to and during
infection and subsequently reduced to 0.1 µM for the rest of the experiment. Single cell cloning was
performed and the frequency of clones containing chromosomally-integrated HHV-6 was determined
by qPCR in four independent experiments (Table 1). In the telomerase positive HeLa cells, BRACO-
19 treatment resulted in a 45% reduction in integration frequency relative to the untreated control cells
(P < 0.001). In contrast, no statistically significant difference was observed in the HHV-6 integration
frequency of telomerase negative U2OS cells treated with BRACO-19 compared to untreated cells. To
ensure that clones contained integrated HHV-6, we performed a FISH analyses on several clones
(figure 5).
To confirm these results, we included an additional telomerase positive cell line, MCF-7, and used the
more comprehensive ddPCR analysis platform. Treated and untreated Hela, MCF-7 and U2OS cells
were infected with HHV-6 and prepared cellular DNA of the corresponding cell populations. The
percentage of cells containing integrated HHV-6A determined by ddPCR as previous work confirmed
that each cell only harbors a single integrated HHV-6 genome (Gravel et al, submitted). In this assay,
U2OS cells showed a higher integration frequency than HeLa cells. This could be due to the fact that
the HHV-6 integration frequency using assays is calculated from four independent experiments, one of
which yielded a particularly high integration frequency in HeLa cells. In all other experiments, ddPCR
76
included, U2OS showed a higher integration frequency than HeLa cells. ddPCR analyses confirmed
that the integration frequency was significantly reduced in Hela (52.66%) and MCF-7 cells (51.05%)
treated with BRACO-19 (Table 2). No significant impact on HHV-6 integration was observed in the
telomerase negative U2OS cells upon BRACO-19 treatment. Taken together, our data suggests that
integration and/or the long-term maintenance of the integrated viral genome is compromised in
telomerase positive cells treated with BRACO-19.
77
4.6 Discussion
Although HHV-6 chromosomal integration was first thought to be an evolutionary dead-end, it is now
considered as a way to maintain the viral genome during latency from which HHV-6 can be excised
and initiate lytic replication in vitro and in vivo [5, 44-47]. Following integration, addition of telomeric
sequences at the viral end is essential to avoid loss of genetic information upon repeated cell division.
When integration takes place in gametes, stem cells or cells with high proliferative potential, this is
likely achieved by the telomerase complex [20]. In cells that lack telomerase activity or telomere
elongation compensatory mechanisms, the chromosome end will be left unprotected, leading to
apoptosis or senescence [21].
To shed light on the HHV-6 integration process, we made use of BRACO-19, a compound that inhibits
telomerase activity through G-quadruplex stabilization of the telomeric ends [33, 34]. Cells expressing
telomerase (HeLa and MCF-7) and cells using ALT to extend their telomeres (U2OS) were studied.
Based on previous work [30-32] we predict that HHV-6 integration at the end of the host chromosome
would result in a terminus containing the HHV-6 Pac1 sequence. The Pac1 sequence is thought to be
lost after 1-2 cellular passages leaving the chromosome extremity with viral TMR. These would then
be used as substrate for telomere elongation via the telomerase complex. In the presence of BRACO-
19 that inhibits telomerase activity, elongation of the viral telomere would be reduced, leading to
chromosomal erosion beyond the viral TMR. In the absence of a functional telomere, the cell carrying
integrated HHV-6 would be subject to chromosomal instability and cell death. Our results support this
hypothesis. A statistically significant reduction in the frequency of ciHHV-6 cells was observed in Hela
and MCF-7 cells treated with BRACO-19. This reduction in integration frequency is not due to negative
effects of BRACO-19 on viral entry or viral DNA replication, as no difference in viral genome copies
was observed between mock and BRACO-19-treated cells (figure 4). Analyses also indicate that at the
doses used, BRACO-19 did not influence cell cycle progression (not shown). The specificity of BRACO-
19 for telomeric G-quadruplex was also confirmed by surface plasmon resonance, underlining that its
effects are likely to be related to telomere binding and subsequent telomerase inhibition. BRACO-19
inhibition of telomerase complex [48, 49] therefore likely prevents telomerase from adding telomeric
sequences at the viral terminus. Intriguingly, it was previously shown that the chromosome containing
the HHV-6 integration is often the shortest, suggesting that the newly synthesized telomere at the end
of the virus genome does not reach the length of the other telomeres [31].
78
In contrast, in U2OS cells that use the alternative elongation mechanism (ALT), HHV-6 integration is
not dependent on the telomerase activity as no effect was observed upon BRACO-19 treatment. The
ALT elongation mechanism is mostly based on homologous recombination [22] and could therefore
bypasses the shortening of the telomeres. Repression of homologous recombination appears to be
loosened in ALT cells to allow telomere maintenance, which might be the cause of the more frequent
homologous recombination and telomere sister chromatid exchange observed in these cells [50, 51].
This could explain in part why HHV-6 integration in U2OS is not affected by BRACO-19.
It has been previously shown that the G-quadruplex stabilizing properties of BRACO-19 in the genome
of other herpes viruses, HSV-1 [52] and EBV [53], and the lentivirus HIV-1 [54], lead to inhibition of
genome processing activity such as replication and transcription. Intriguingly, in the case of HHV-6, the
effect of BRACO-19 is restrained to inhibition of telomerase activity. Since BRACO-19’s target telomeric
repeats are present both in the virus and cell genome, it is possible that specific proteins untangle the
G-quadruplex coiling during the viral replication process: several proteins able to relax the G-
quadruplex-folded nucleic acid structure have been so far reported [55]. In contrast, our data show that
inhibition at the telomerase level is maintained: indeed, telomeres are subject to specific shelterin-
mediated protective/repair mechanisms [56], which are unique to chromosomes ends. This evidence
suggests the possibility that BRACO-19 is able to selectively target one G-quadruplex-related process
within the HHV-6 biology. This aspect may provide a useful mean to develop anti-HHV-6 compounds
with a well-understood mechanism of action.
In summary, our results are consistent with the current model that suggests that the viral TMR serves
as a substrate for telomerase and telomere elongation upon HHV-6 integration. Inhibition of telomerase
activity, by stabilization of the G-quadruplex telomere structure, may cause cells containing the
integrated HHV-6 genome to die faster than cells in the absence of integration. Our results provide
indirect proofs that the telomere bearing HHV-6 integration needs to be extended for a cell to survive.
Finally, considering that integration results often in a chromosome with the shortest telomere,
chromosomally-integrated HHV-6 could prove problematic in conditions that require extensive somatic
cell division in the absence of telomerase activity such as skin grafts or other conditions.
79
4.7 Acknowledgments
The following study was supported by a grant from the Canadian Institutes of Health research awarded
to LF (MOP_123214) and the ERC starting grant StG-677673 awarded to BBK. SGG is supported by
a studentship from the Fonds de Recherche Québec-Santé.
4.8 Author contributions
Experimental manipulations: S.G.G., A.G., S.A., N.W., Providing materials: L.F., B.K., Data analysis:
S.G.G., A.G., L.F., Critical revision SA, SNR, BBK, NW, AG. Writing: S.G.G, L.F.
80
4.9 Bibliography
1. Ablashi, D., et al., Classification of HHV-6A and HHV-6B as distinct viruses. Arch Virol, 2014. 159(5): p. 863-70. 2. Yamanishi, K., et al., Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet, 1988. 1(8594): p. 1065-7. 3. Tesini, B.L., L.G. Epstein, and M.T. Caserta, Clinical impact of primary infection with roseoloviruses. Curr Opin Virol, 2014. 9: p. 91-6. 4. Hill, J.A. and D.M. Zerr, Roseoloviruses in transplant recipients: clinical consequences and prospects for treatment and prevention trials. Curr Opin Virol, 2014. 9: p. 53-60. 5. Arbuckle, J.H., et al., The latent human herpesvirus-6A genome specifically integrates in telomeres of human chromosomes in vivo and in vitro. Proc Natl Acad Sci U S A, 2010. 107(12): p. 5563-8. 6. Luppi, M., et al., Three cases of human herpesvirus-6 latent infection: integration of viral genome in peripheral blood mononuclear cell DNA. J Med Virol, 1993. 40(1): p. 44-52. 7. Luppi, M., et al., Integration of human herpesvirus-6 (HHV-6) genome in chromosome 17 in two lymphoma patients. Leukemia, 1994. 8 Suppl 1: p. S41-5. 8. Daibata, M., et al., Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood, 1999. 94(5): p. 1545-9. 9. Tanaka-Taya, K., et al., Human herpesvirus 6 (HHV-6) is transmitted from parent to child in an integrated form and characterization of cases with chromosomally integrated HHV-6 DNA. J Med Virol, 2004. 73(3): p. 465-73. 10. Morissette, G. and L. Flamand, Herpesviruses and chromosomal integration, in J Virol. 2010: United States. p. 12100-9. 11. Pellett, P.E., et al., Chromosomally integrated human herpesvirus 6: questions and answers. Rev Med Virol, 2012. 22(3): p. 144-55. 12. Gravel, A., et al., Inherited chromosomally integrated human herpesvirus 6 as a predisposing risk factor for the development of angina pectoris. Proc Natl Acad Sci U S A, 2015. 112(26): p. 8058-63. 13. Torelli, G., et al., Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. J Med Virol, 1995. 46(3): p. 178-88. 14. Daibata, M., et al., Integration of human herpesvirus 6 in a Burkitt's lymphoma cell line. Br J Haematol, 1998. 102(5): p. 1307-13. 15. Nacheva, E.P., et al., Human herpesvirus 6 integrates within telomeric regions as evidenced by five different chromosomal sites. J Med Virol, 2008. 80(11): p. 1952-8. 16. Takubo, K., et al., Changes of telomere length with aging. Geriatr Gerontol Int, 2010. 10 Suppl 1: p. S197-206. 17. Makarov, V.L., Y. Hirose, and J.P. Langmore, Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell, 1997. 88(5): p. 657-66. 18. McElligott, R. and R.J. Wellinger, The terminal DNA structure of mammalian chromosomes. EMBO J, 1997. 16(12): p. 3705-14. 19. Chai, W., J.W. Shay, and W.E. Wright, Human telomeres maintain their overhang length at senescence. Mol Cell Biol, 2005. 25(6): p. 2158-68. 20. Zhang, J., et al., Ageing and the telomere connection: An intimate relationship with inflammation. Ageing Res Rev, 2016. 25: p. 55-69.
81
21. de Lange, T., How telomeres solve the end-protection problem. Science, 2009. 326(5955): p. 948-52. 22. Cesare, A.J. and R.R. Reddel, Alternative lengthening of telomeres: models, mechanisms and implications. Nat Rev Genet, 2010. 11(5): p. 319-30. 23. Gompels, U.A., et al., The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology, 1995. 209(1): p. 29-51. 24. Dominguez, G., et al., Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. J Virol, 1999. 73(10): p. 8040-52. 25. Isegawa, Y., et al., Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B. J Virol, 1999. 73(10): p. 8053-63. 26. Deng, H. and S. Dewhurst, Functional identification and analysis of cis-acting sequences which mediate genome cleavage and packaging in human herpesvirus 6. J Virol, 1998. 72(1): p. 320-9. 27. Thomson, B.J., S. Dewhurst, and D. Gray, Structure and heterogeneity of the a sequences of human herpesvirus 6 strain variants U1102 and Z29 and identification of human telomeric repeat sequences at the genomic termini. J Virol, 1994. 68(5): p. 3007-14. 28. Kaufer, B.B. and L. Flamand, Chromosomally integrated HHV-6: impact on virus, cell and organismal biology. Curr Opin Virol, 2014. 9C: p. 111-118. 29. Wallaschek, N., et al., The Telomeric Repeats of Human Herpesvirus 6A (HHV-6A) Are Required for Efficient Virus Integration. PLoS Pathog, 2016. 12(5): p. e1005666. 30. Arbuckle, J.H., et al., Mapping the telomere integrated genome of human herpesvirus 6A and 6B. Virology, 2013. 442(1): p. 3-11. 31. Huang, Y., et al., Human telomeres that carry an integrated copy of human herpesvirus 6 are often short and unstable, facilitating release of the viral genome from the chromosome. Nucleic Acids Res, 2014. 42(1): p. 315-27. 32. Ohye, T., et al., Dual roles for the telomeric repeats in chromosomally integrated human herpesvirus-6. Sci Rep, 2014. 4: p. 4559. 33. Campbell, N.H., et al., Structural basis of DNA quadruplex recognition by an acridine drug. J Am Chem Soc, 2008. 130(21): p. 6722-4. 34. Zhou, G., et al., Telomere targeting with a novel G-quadruplex-interactive ligand BRACO-19 induces T-loop disassembly and telomerase displacement in human glioblastoma cells. Oncotarget, 2016. 7(12): p. 14925-39. 35. Gravel, A., J. Gosselin, and L. Flamand, Human Herpesvirus 6 immediate-early 1 protein is a sumoylated nuclear phosphoprotein colocalizing with promyelocytic leukemia protein-associated nuclear bodies. J Biol Chem, 2002. 277(22): p. 19679-87. 36. Flamand, L., et al., Human herpesvirus 6 induces interleukin-1 beta and tumor necrosis factor alpha, but not interleukin-6, in peripheral blood mononuclear cell cultures. J Virol, 1991. 65(9): p. 5105-10. 37. Flamand, L., et al., Multicenter comparison of PCR assays for detection of human herpesvirus 6 DNA in serum. J Clin Microbiol, 2008. 46(8): p. 2700-6. 38. Biffi, G., et al., Quantitative visualization of DNA G-quadruplex structures in human cells. Nat Chem, 2013. 5(3): p. 182-6. 39. Sedlak, R.H., et al., Identification of chromosomally integrated human herpesvirus 6 by droplet digital PCR. Clin Chem, 2014. 60(5): p. 765-72. 40. Kaufer, B.B., K.W. Jarosinski, and N. Osterrieder, Herpesvirus telomeric repeats facilitate genomic integration into host telomeres and mobilization of viral DNA during reactivation. J Exp Med, 2011. 208(3): p. 605-15.
82
41. Kaufer, B.B., Detection of integrated herpesvirus genomes by fluorescence in situ hybridization (FISH). Methods Mol Biol, 2013. 1064: p. 141-52. 42. Siddiqui-Jain, A., et al., Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci U S A, 2002. 99(18): p. 11593-8. 43. Oganesian, L. and T.M. Bryan, Physiological relevance of telomeric G-quadruplex formation: a potential drug target. Bioessays, 2007. 29(2): p. 155-65. 44. Endo, A., et al., Molecular and Virological Evidence of Viral Activation From Chromosomally Integrated Human Herpesvirus 6A in a Patient With X-Linked Severe Combined Immunodeficiency. Clin Infect Dis, 2014. 59(4): p. 545-8. 45. Gravel, A., C.B. Hall, and L. Flamand, Sequence analysis of transplacentally acquired human herpesvirus 6 DNA is consistent with transmission of a chromosomally integrated reactivated virus. J Infect Dis, 2013. 207(10): p. 1585-9. 46. Hill, J.A., et al., Prevalence of chromosomally integrated human herpesvirus 6 in patients with human herpesvirus 6-central nervous system dysfunction. Biol Blood Marrow Transplant, 2015. 21(2): p. 371-3. 47. Prusty, B.K., G. Krohne, and T. Rudel, Reactivation of chromosomally integrated human herpesvirus-6 by telomeric circle formation. PLoS Genet, 2013. 9(12): p. e1004033. 48. Burger, A.M., et al., The G-quadruplex-interactive molecule BRACO-19 inhibits tumor growth, consistent with telomere targeting and interference with telomerase function. Cancer Res, 2005. 65(4): p. 1489-96. 49. Gunaratnam, M., et al., Mechanism of acridine-based telomerase inhibition and telomere shortening. Biochem Pharmacol, 2007. 74(5): p. 679-89. 50. de Lange, T., Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev, 2005. 19(18): p. 2100-10. 51. Wang, R.C., A. Smogorzewska, and T. de Lange, Homologous recombination generates T-loop-sized deletions at human telomeres. Cell, 2004. 119(3): p. 355-68. 52. Artusi, S., et al., The Herpes Simplex Virus-1 genome contains multiple clusters of repeated G-quadruplex: Implications for the antiviral activity of a G-quadruplex ligand. Antiviral Res, 2015. 53. Norseen, J., F.B. Johnson, and P.M. Lieberman, Role for G-quadruplex RNA binding by Epstein-Barr virus nuclear antigen 1 in DNA replication and metaphase chromosome attachment. J Virol, 2009. 83(20): p. 10336-46. 54. Perrone, R., et al., Synthesis, Binding and Antiviral Properties of Potent Core-Extended Naphthalene Diimides Targeting the HIV-1 Long Terminal Repeat Promoter G-Quadruplexes. J Med Chem, 2015. 58(24): p. 9639-52. 55. Mendoza, O., et al., G-quadruplexes and helicases. Nucleic Acids Res, 2016. 44(5): p. 1989-2006. 56. Fouquerel, E., D. Parikh, and P. Opresko, DNA damage processing at telomeres: The ends justify the means. DNA Repair (Amst), 2016. 44: p. 159-68.
83
4.10 Figures
Figure 1 : Binding of BG4 antibody to various DNA oligonucleotides.
ELISA plates were coated with different oligonucleotides (cyc, G-rich, C-rich and double
stranded telomeric oligonucleotides) and the binding of BG4 measured. Results are expressed
as absorbance at 450 nm and are representative of three independent experiments.
0 2 4 6 8 10 12 140.0
0.2
0.4
0.6
0.8
1.0
G-rich (TTAGGG)3
C-rich (CCCTAA)3Myc
(TTAGGG)3(AATCCC)3
BG4 (nM)
Ab
so
rba
nc
e (4
50
nm
)
84
Figure 2 : Association and dissociation curves of ligands (BG4 and BRACO-19) to the
DNA oligos by surface plasmon resonance.
Curves of the association and dissociation over time between the ligands (BG4 antibody and
BRACO-19) and the DNA sequences (myc promoter, G-rich telomere and C-rich telomere) and
corresponding to association (Ka), dissociation (Kd) and equilibrium (KD) constants. Curves
with BG4 (0 nM - 800 nM) are from A to C and curves with BRACO-19 (0 nM - 100 nM) are from
D to F.
A) Myc – BG4 B) (TTAGGG)4 – BG4
C) (CCCTAA)4– BG4 D) Myc – BRACO‐19
F) (CCCTAA)4– BRACO‐19 E) (TTAGGG)
4 – BRACO‐19
Ka = 1.82 E04 1/MsKd = 4.57 E‐04 1/s KD = 2.52 E‐08 M
Ka = 3.61 E04 1/MsKd = 1.97 E‐02 1/s KD = 5.46 E‐07 M
Ka = 9.85 E02 1/MsKd = 1.29 E‐03 1/s KD = 1.31 E‐06 M
Ka = 4.48 E05 1/MsKd = 8.51 E‐03 1/s KD = 1.90 E‐08 M
Ka = 2.28 E05 1/MsKd = 6.65 E‐03 1/s KD = 2.91 E‐08 M
85
Figure 3 : Growth of HHV-6B-infected PBMCs (A) and HHV-6B-infected MOLT-3 cells (B)
in the presence of BRACO-19.
Cells were infected with HHV-6B and incubated with various concentrations of BRACO-19. Cell
number was determined at indicated time points. Results are presented as mean ± SD cell
number. Data are representative of two independent experiments.
86
Figure 4 : Effect of BRACO-19 on HHV-6B (Z29 strain) infection of Molt-3 cells (A) and
PMBC (B).
Cells were infected with HHV-6 and incubated with indicated concentrations of BRACO-19.
Total DNA was extracted at different times and the number of HHV-6B DNA copies determined
by qPCR. The results are presented as normalized viral DNA genome levels relative to mock-
treated cells. Data are representative of two independent experiments.
B
A
87
Table 1 : Effects of BRACO-19 (B19) on HHV-6A integration frequency in Hela and U2OS
cells
HeLa N ciHHV‐6A‐ (%) N ciHHV‐6A+ (%)
HeLa controls 413/495 (83.4) 82/495 (16.6)
HeLa +B19 338/372 (90.9) 34/372 (9.1)
U2OS controls 202/219 (92.2) 17/219 (7.8)
U2OS +B19 137/148 (92.6) 11/148 (7.4)
* p < 0.002
% of reduction of ciHHV‐
6A+ clones with B19
45.18*
5.13
88
Figure 5 : Metaphase spread of a HeLa ciHHV-6A+ clone.
The HHV-6A genome was detected using a DIG-labeled probe (green) by FISH. Chromosomes
are colored using DAPI (blue).
89
Table 2 : Effects of BRACO-19 (B19) on chromosomal integration of HHV-6 into Hela,
MCF-7 and U2OS cells
N copies of U65‐U66/
N copies of RPP30
ratio % of ciHHV‐6A+ cells % of reduction of ciHHV‐6A+
cells with B19
HeLa controls 42.2/1070 0.0395 7.9
HeLa +B19 16.7/893 0.0187 3.74
MCF‐7 controls 40.1/701 0.057 11.4
MCF‐7 +B19 18.6/665 0.0279 5.58
U2OS controls 151/1683 0.09 18
U2OS +B19 67.6/980 0.069 13.8
*p ≤ 0.01
52.66*
51.05*
23.33
90
Chapitre 5 : Discussion
5.1 DDR et TRF2 dans les RC de HHV-6
De nombreux virus provoquent une DDR au cours de leur infection. Pour éviter de subir les
conséquences d’un mécanisme de réparation, plusieurs répriment cette réponse, alors que certains
utilisent les protéines de ce mécanisme pour compléter leur infection [217]. Des protéines du DDR sont
parfois retrouvées dans les RC et la présence de ces protéines est essentielle à la réplication de
certains virus, comme dans le cas de EBV, pour qui la présence de 53BP1 est nécessaire [222]. Ce
virus active plusieurs protéines de la voie ATM, dont H2AX, et un certain nombre se retrouve dans les
RC [222, 223]. EBV évite toutefois d’être affecté par les mécanismes de réparation à l’ADN en bloquant
l’activité d’autres protéines en aval de la voie ATM. HSV est un autre exemple de virus activant la voie
ATM. Dans son cas cependant, bien que 53BP1 soit activée, γH2AX est exclue des RC, ce qui pourrait
indiquer une tactique différente pour échapper au DDR [218, 219]. De nombreux autres exemples de
virus utilisant ou réprimant les protéines du DDR existent, mais l’effet de HHV-6 sur les mécanismes
de détection de dommages à l’ADN est très peu connu.
Nous avons découvert que HHV-6 provoque également des signaux de dommage à l’ADN au cours
de son infection. Des protéines de la voie ATM (γH2AX et 53BP1) se retrouvent dans les RC du virus.
La raison exacte de cette DDR est incertaine, mais elle pourrait être due à une reconnaissance du
génome viral comme un dommage ou à un déséquilibre du complexe shelterin dans ces
compartiments. Il est également encore impossible d’affirmer si HHV-6 utilise les protéines de
signalisation des dommages pour compléter son infection ou si elles lui nuisent. L’expression de
certaines protéines peut permettre l’arrêt du cycle cellulaire dans une phase favorable pour la
réplication du virus ou peut éviter l’apoptose de la cellule [217]. Il est intéressant de noter que HHV-6
entraîne justement les cellules en phase S [226]. Comme HHV-6 active des protéines de dommage à
l’ADN et en considérant les cas des autres herpèsvirus provoquant de semblables réactions, il est fort
possible qu’HHV-6 parviennent à réprimer ou exclure certaines autres protéines de la DDR de ses RC
pour éviter l’enclenchement complet du mécanisme de réparation. Les interactions plus précises entre
HHV-6 et les protéines du DDR seront à explorer dans le futur pour comprendre comment HHV-6
complète son infection et parvient à utiliser ou réprimer les mécanismes de DDR cellulaires.
91
Dans les RC de HHV-6, en plus des signaux de dommages à l’ADN, nous avons également observé
une grande concentration de séquences télomériques et nous avons confirmé leur origine virale. Nous
nous sommes demandé si la présence de telles séquences aurait un effet sur le complexe shelterin,
en particulier la protéine TRF2, puisqu’elle a une reconnaissance séquence-spécifique pour les
télomères. Par IF-FISH, nous avons observé que TRF2 se trouvait elle aussi dans les RC, avec les
protéines de dommages à l’ADN, les protéines virales et les séquences télomériques. Nous avons
voulu vérifier si TRF2 se retrouvait dans les RC en raison d’une reconnaissance de la séquence des
TMR du virus. Par trois techniques distinctes, nous avons confirmé que TRF2 se liait bien directement
aux séquences télomériques du virus, indiquant que TRF2 est probablement liée aux TMR virales dans
les RC au cours de l’infection. Cette liaison n’est pas unique à HHV-6 puisque TRF2 se lie également
aux TMR du virus EBV [227]. TRF2 étant vraisemblablement recrutée aux TMR virales, nous avons
voulu vérifier si l’expression des autres composants du complexe shelterin était affectée par l’infection
de HHV-6. Par RT-qPCR, nous avons observé une augmentation de l’expression de trois des ARNm
de shelterin, soit TRF1, TRF2 et TPP1, dans les cellules HSB2 infectées avec HHV-6A après cinq et
sept jours d’infection. De plus, l’expression de la protéine TRF2 était aussi significativement augmentée
dans les cellules infectées, et ce, dès 24h post-infection. Cette dernière observation a été confirmée
avec des cellules en infection active (HSB2) par cytométrie de flux et avec des cellules en infection
abortive (U2OS) par immunofluorescence. Il a déjà été observé que l’expression du complexe shelterin
était affectée par un virus. Dans le cas de EBV, l’expression de TRF2 diminue au fil de l’infection,
pendant que celle de TRF1 demeure stable [228]. Nos expériences ont plutôt démontré une
surexpression de certains ARNm du complexe et de la protéine TRF2 lors de l’infection de HHV-6. La
raison de cette surexpression demeure inconnue, mais il semble probable que la cellule infectée
produise plus de TRF2 dans le but de recouvrir les séquences télomériques supplémentaires détectées
dans les RC. Malgré ce recrutement de TRF2 aux RC, la protéine a été observée aux télomères
cellulaires, même en cours d’infection, et aucun signal de dommage n’a été détecté au niveau des
télomères. Il semble donc que la présence de TRF2 aux TMR virales n’ait pas d’effet sur la protection
des télomères cellulaires. Cependant, il n’est pas clair si TRF2 a un rôle dans la production virale ou
si elle nuit à cette dernière. À notre connaissance, il s’agit de la première observation de la présence
de TRF2 dans les RC d’un virus. TRF2 réprime normalement les mécanismes de réparation de l’ADN
et sa présence aux côtés de γH2AX et 53BP1 est donc inhabituelle. D’un autre côté, TRF2 pourrait
participer à la répression de la DDR aux TMR virales, permettant au virus de compléter sa réplication
92
sans subir les effets des mécanismes de réparation de l’ADN. Ces résultats pourraient suggérer un
mécanisme différent de réplication virale chez HHV-6 impliquant une interaction complexe entre HHV-
6 et shelterin.
De plus, il n’est pas possible d’affirmer si TRF2 a un rôle dans l’intégration de HHV-6 en se liant aux
TMR ou si elle la réprime. Comme mentionné plus haut, des protéines de réparation de l’ADN se
retrouvent dans les RC. La possibilité que les virus utilisent les mécanismes de DDR pour s’intégrer
est débattue, mais certains mécanismes ont été suggérés, par exemple dans le cas des virus adéno-
associés [217, 224]. L’hypothèse la plus probable du mécanisme d’intégration de HHV-6 est la HR
(section 1.2.5), qui est un mécanisme de réparation de l’ADN. La présence de protéines du DDR dans
les RC du virus est donc compatible avec cette hypothèse. Cependant, 53BP1 est normalement un
promoteur de la NHEJ et non de la HR [205]. Une possible explication serait que l’intégration
chromosomique pourrait avoir lieu pendant une autre phase du cycle cellulaire où 53BP1 est réprimée.
La HR a normalement lieu en phase S et G2 et, comme mentionné précédemment, HHV-6 conduit les
cellules en phase S, ce qui pourrait être une façon de favoriser l’entrée en latence par l’intégration [204,
226]. Également, la présence de TRF2 vient contredire la possibilité de HR aux TMR virales car TRF2
inhibe normalement les mécanismes de réparation de l’ADN aux télomères. Il est possible que
l’intégration de HHV-6 n’ait pas lieu dans les cellules où il y a réplication virale. Certaines cellules
infectées ne contenaient pas de RC, même après 48h d’infection. Après 72h d’infection, ces cellules,
possiblement moins sensibles à l’infection de HHV-6, étaient largement plus fréquentes que celles
entretenant une réplication virale active. Aucune accumulation de protéines virales dans des RC, aucun
signal de dommage ni aucune accumulation de TRF2 n’était visible dans ces cellules, suggérant un
patron d’infection différent. Il est possible que l’intégration de HHV-6 n’ait lieu que dans ces cellules où
l’infection est minimale, encourageant la latence. L’existence de différents patrons d’infection de HHV-
6 reste cependant à confirmer, de même que la possibilité d’une intégration chromosomique dans des
cellules à l’infection abortive.
5.2 Inhibition de la télomérase et intégration de HHV-6
L’intégration chromosomique de HHV-6 a d’abord été considérée comme un cul-de-sac évolutif, mais
suite à l’observation de réactivations du virus in vitro et in vivo, elle a été acceptée comme un moyen
93
d’entrer en latence in vivo [77, 108, 110, 111, 229]. L’intégration peut avoir lieu dans les gamètes et elle
peut alors être transmise aux descendants [71]. Le mécanisme précis de cette intégration héréditaire
n’est pas connu, mais, comme mentionné plus haut, l’hypothèse la plus probable selon les
observations des sites d’intégration est celle d’une intégration par HR dans le télomère d’un gamète
(section 1.2.5). Cette intégration se fait au niveau de la région DRR du génome viral, signifiant que le
DRL se retrouve à l’extrémité du chromosome [77]. L’observation de répétitions supplémentaires à la
suite du DRL mène à l’hypothèse qu’après quelques divisions cellulaires, l’extrémité du génome serait
dégradée jusqu’aux TMR, qui seraient ensuite utilisées comme substrat par la télomérase, exprimée
chez les cellules embryonnaires, pour ajouter de nouvelles répétitions et reconstituer un télomère d’une
longueur suffisante [112-114]. Pour explorer cette hypothèse, nous avons étudié l’effet de l’inhibition
de la télomérase sur l’intégration de HHV-6, plus précisément sur le maintien de cette intégration.
Pour ce faire, nous avons infecté des cellules avec HHV-6 en présence de BRACO-19, une drogue qui
stabilise les G4 dans les télomères et qui, par conséquent, inhibe la télomérase [186, 230]. Des clones
de cellules exprimant la télomérase (Hela) et des cellules télomérase négatives (U2OS) ont été créés.
Dans les cellules télomérase positives, une diminution de près de 50% du nombre de clones ciHHV-
6+ a été observée en présence de BRACO-19, en comparaison avec les cellules non traitées. Ces
résultats suggèrent un effet négatif de l’inhibition de la télomérase sur la survie des clones portant une
intégration. Cette réduction de 50% a été confirmée de nouveau en utilisant deux lignées télomérase
positives (Hela et MCF-7) dans un nouvel essai par ddPCR. Nous avons vérifié que cette réduction du
nombre cellules ciHHV-6+ n’était pas le résultat d’un effet de BRACO-19 sur l’entrée du virus dans les
cellules ou sur la réplication de son ADN et nous nous sommes également assurés que BRACO-19
n’influençait pas le cycle cellulaire, ce qui aurait pu défavoriser la réplication ou l’intégration de HHV-
6. De plus, nous avons confirmé la spécificité de BRACO-19 pour les G4 situés aux télomères par
résonnance de plasmon de surface. Le tout indique que l’effet de BRACO-19 sur la fréquence
d’intégrations chromosomiques de HHV-6 retrouvées dans les clones est fort probablement attribuable
à son effet inhibiteur de la télomérase. Cette réduction du nombre de cellules ciHHV-6+ obtenues en
présence de BRACO-19 n’a pas été observée dans les cellules télomérase négatives. Ces cellules
utilisent un mécanisme alternatif ALT, basé sur la HR, pour allonger leurs télomères et ne dépendent
donc pas de la télomérase [194, 195]. Ainsi, même en présence d’un inhibiteur de la télomérase, les
cellules ALT+ semblent avoir maintenu leurs télomères par leur propre mécanisme, évitant l’entrée en
94
apoptose. De plus, le fait que l’intégration de HHV-6 ait été retrouvée aussi fréquemment en présence
qu’en absence de BRACO-19 dans les cellules ALT+ suggère que la diminution du nombre de cellules
ciHHV-6+ observée avec BRACO-19 dans les autres lignées cellulaires était bien due à un
raccourcissement des télomères suite à l’inhibition de la télomérase, conduisant à une mort cellulaire
prématurée, et non à un effet de BRACO-19 sur la fréquence d’intégration elle-même.
Nos résultats sont en accord avec l’hypothèse présentement favorisée selon laquelle l’intégration de
HHV-6 est suivie de l’ajout de répétitions TTAGGG aux TMR virales par la télomérase afin de former
un nouveau télomère. Nous apportons une preuve indirecte de la nécessité d’un allongement des
télomères par la télomérase suite à l’intégration de HHV-6 pour permettre la viabilité de la cellule. Il a
été observé que, dans les cellules somatiques d’individus iciHHV-6, le chromosome portant
l’intégration de HHV-6 est souvent le plus court et instable, suggérant que l’ajout de répétitions
télomériques à la suite d’une intégration de HHV-6 ne suffit toutefois pas à ramener le télomère à sa
longueur originale [112]. De plus, des troncations sont fréquentes dans les chromosomes portant le
génome de HHV-6, ce qui peut mener à un télomère plus court encore. Des T-circles contenant parfois
le génome entier de HHV-6 (avec un seul DR) sont aussi observés [112]. Il est possible que, malgré
l’allongement des TMR virales dans les cellules germinales, l’intégration de HHV-6 aille des
conséquences sur l’intégrité du chromosome une fois les cellules différenciées. Un télomère plus court
et potentiellement instable pourrait représenter un problème sérieux dans des cellules somatiques
nécessitant plusieurs divisions.
95
Chapitre 6 : Conclusion
HHV-6 est un virus très répandu dont l’infection primaire est généralement bénigne chez les enfants,
mais dont la réactivation peut s’avérer dangereuse chez des individus immunodéprimés. Malgré tout
cela, ce virus est peu caractérisé et l’effet de son infection sur les cellules est peu défini. Sa forme
intégrée est retrouvée chez environ 1% de la population mondiale, mais les conséquences de la
présence du génome du virus dans un chromosome de chaque cellule sont également inconnues [65,
81]. Une récente étude a cependant associé iciHHV-6 avec l’angine de poitrine [107]. Devant l’évidence
d’effets négatifs potentiels sur la santé, il devient important d’en apprendre davantage sur l’infection et
l’intégration chromosomique de HHV-6.
Nos travaux ont permis d’en savoir davantage sur la réaction de dommage à l’ADN provoquée par
l’infection du virus dans les cellules. Nous avons démontré la présence simultanée de protéines virales
(IE2 et P41), de protéines de la DDR (γH2AX et 53BP1), de séquences télomériques virales et de la
protéine TRF2 dans les RC de HHV-6. Nous avons également observé une hausse de l’expression de
trois ARNm du complexe shelterin, TRF1, TRF2 et TPP1, dans les stades avancés d’infection et une
augmentation de l’expression de la protéine TRF2 dans les cellules infectées rapidement après le
début de l’infection. De plus, nous avons apporté plusieurs preuves d’une interaction directe entre la
protéine TRF2 et les séquences télomériques virales. La surexpression de TRF2 et sa présence dans
les RC sont inhabituelles chez les virus et pourraient être les premiers indices d’une interaction entre
le complexe shelterin et HHV-6 dans le cadre de son infection. De plus, les résultats obtenus suite à
l’inhibition de la télomérase dans des cellules infectées exprimant la télomérase ou un mécanisme ALT
supportent l’hypothèse selon laquelle l’intégration chromosomique de HHV-6 dans une cellule
germinale doit être suivie d’un allongement des TMR virales pour permettre la survie de la cellule et,
par conséquent, le maintien de l’intégration dans le matériel héréditaire. Nos travaux apportent de
nouveaux éléments dans le mécanisme d’infection et d’intégration de HHV-6. À la suite de ces travaux,
il sera d’intérêt d’étudier l’inhibition de la HR dans le contexte de l’intégration de HHV-6 et d’investiguer
l’effet de l’infection de HHV-6 sur la distribution des autres protéines de la DDR. De plus, puisque TRF2
est présente aux TMR virales dans les RC, il serait intéressant de voir si les autres protéines de
shelterin s’y retrouvent également afin de clarifier le processus d’infection et d’intégration de HHV-6 et,
éventuellement, de comprendre les répercussions de iciHHV-6 sur la santé.
96
Bibliographie
1. Gruffat, H., R. Marchione, and E. Manet, Herpesvirus Late Gene Expression: A Viral-Specific Pre-initiation Complex Is Key. Front Microbiol, 2016. 7: p. 869.
2. Ablashi, D., et al., Classification of HHV-6A and HHV-6B as distinct viruses. Arch Virol, 2014. 159(5): p. 863-70.
3. Salahuddin, S.Z., et al., Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science, 1986. 234(4776): p. 596-601.
4. Downing, R.G., et al., Isolation of human lymphotropic herpesviruses from Uganda, in Lancet. 1987: England. p. 390.
5. Tedder, R.S., et al., A novel lymphotropic herpesvirus, in Lancet. 1987: England. p. 390-2. 6. Aubin, J.T., et al., Several groups among human herpesvirus 6 strains can be distinguished by
Southern blotting and polymerase chain reaction. J Clin Microbiol, 1991. 29(2): p. 367-72. 7. Schirmer, E.C., et al., Differentiation between two distinct classes of viruses now classified as human
herpesvirus 6. Proc Natl Acad Sci U S A, 1991. 88(13): p. 5922-6. 8. Campadelli-Fiume, G., P. Mirandola, and L. Menotti, Human herpesvirus 6: An emerging pathogen.
Emerg Infect Dis, 1999. 5(3): p. 353-66. 9. Krug, L.T. and P.E. Pellett, Roseolovirus molecular biology: recent advances. Curr Opin Virol, 2014.
9: p. 170-7. 10. Liu, X., et al., Molecular epidemiology of porcine Cytomegalovirus (PCMV) in Sichuan Province,
China: 2010-2012. PLoS One, 2013. 8(6): p. e64648. 11. Yamanishi, K., et al., Identification of human herpesvirus-6 as a causal agent for exanthem subitum.
Lancet, 1988. 1(8594): p. 1065-7. 12. Dewhurst, S., et al., Human herpesvirus 6 (HHV-6) variant B accounts for the majority of symptomatic
primary HHV-6 infections in a population of U.S. infants. J Clin Microbiol, 1993. 31(2): p. 416-8. 13. Hall, C.B., et al., Human herpesvirus-6 infection in children. A prospective study of complications and
reactivation. N Engl J Med, 1994. 331(7): p. 432-8. 14. Yoshikawa, T., et al., Distribution of antibodies to a causative agent of exanthem subitum (human
herpesvirus-6) in healthy individuals. Pediatrics, 1989. 84(4): p. 675-7. 15. Kondo, K., et al., Latent human herpesvirus 6 infection of human monocytes/macrophages. J Gen
Virol, 1991. 72 ( Pt 6): p. 1401-8. 16. Tesini, B.L., L.G. Epstein, and M.T. Caserta, Clinical impact of primary infection with roseoloviruses.
Curr Opin Virol, 2014. 9: p. 91-6. 17. Levy, J.A., et al., Frequent isolation of HHV-6 from saliva and high seroprevalence of the virus in the
population. Lancet, 1990. 335(8697): p. 1047-50. 18. Lucht, E., et al., Shedding of cytomegalovirus and herpesviruses 6, 7, and 8 in saliva of human
immunodeficiency virus type 1-infected patients and healthy controls. Clin Infect Dis, 1998. 27(1): p. 137-41.
19. Hill, J.A. and D.M. Zerr, Roseoloviruses in transplant recipients: clinical consequences and prospects for treatment and prevention trials. Curr Opin Virol, 2014. 9: p. 53-60.
20. Yoshikawa, T., Human herpesvirus-6 and -7 infections in transplantation. Pediatr Transplant, 2003. 7(1): p. 11-7.
21. Zerr, D.M., et al., HHV-6 reactivation and associated sequelae after hematopoietic cell transplantation. Biol Blood Marrow Transplant, 2012. 18(11): p. 1700-8.
22. Razonable, R.R., Human herpesviruses 6, 7 and 8 in solid organ transplant recipients. Am J Transplant, 2013. 13 Suppl 3: p. 67-77; quiz 77-8.
23. Dulery, R., et al., Early human herpesvirus type 6 reactivation after allogeneic stem cell transplantation: a large-scale clinical study. Biol Blood Marrow Transplant, 2012. 18(7): p. 1080-9.
97
24. Ogata, M., et al., Human herpesvirus 6 (HHV-6) reactivation and HHV-6 encephalitis after allogeneic hematopoietic cell transplantation: a multicenter, prospective study. Clin Infect Dis, 2013. 57(5): p. 671-81.
25. Scheurer, M.E., et al., HHV-6 encephalitis in umbilical cord blood transplantation: a systematic review and meta-analysis. Bone Marrow Transplant, 2013. 48(4): p. 574-80.
26. Hill, J.A., et al., Hepatitis due to human herpesvirus 6B after hematopoietic cell transplantation and a review of the literature. Transpl Infect Dis, 2014. 16(3): p. 477-83.
27. Hill, J.A., et al., Cord-blood hematopoietic stem cell transplant confers an increased risk for human herpesvirus-6-associated acute limbic encephalitis: a cohort analysis. Biol Blood Marrow Transplant, 2012. 18(11): p. 1638-48.
28. Baldwin, K., Ganciclovir-resistant human herpesvirus-6 encephalitis in a liver transplant patient: a case report. J Neurovirol, 2011. 17(2): p. 193-5.
29. Isegawa, Y., et al., Human herpesvirus 6 ganciclovir-resistant strain with amino acid substitutions associated with the death of an allogeneic stem cell transplant recipient. J Clin Virol, 2009. 44(1): p. 15-9.
30. Prichard, M.N. and R.J. Whitley, The development of new therapies for human herpesvirus 6. Curr Opin Virol, 2014. 9: p. 148-53.
31. Reymen, D., et al., Antiviral activity of selected acyclic nucleoside analogues against human herpesvirus 6. Antiviral Res, 1995. 28(4): p. 343-57.
32. De Bolle, L., L. Naesens, and E. De Clercq, Update on human herpesvirus 6 biology, clinical features, and therapy. Clin Microbiol Rev, 2005. 18(1): p. 217-45.
33. Bates, M., et al., Predominant human herpesvirus 6 variant A infant infections in an HIV-1 endemic region of Sub-Saharan Africa. J Med Virol, 2009. 81(5): p. 779-89.
34. Pruksananonda, P., et al., Primary human herpesvirus 6 infection in young children. N Engl J Med, 1992. 326(22): p. 1445-50.
35. Kasolo, F.C., E. Mpabalwani, and U.A. Gompels, Infection with AIDS-related herpesviruses in human immunodeficiency virus-negative infants and endemic childhood Kaposi's sarcoma in Africa. J Gen Virol, 1997. 78 ( Pt 4): p. 847-55.
36. Caselli, E., et al., Virologic and immunologic evidence supporting an association between HHV-6 and Hashimoto's thyroiditis. PLoS Pathog, 2012. 8(10): p. e1002951.
37. Leibovitch, E.C. and S. Jacobson, Evidence linking HHV-6 with multiple sclerosis: an update. Curr Opin Virol, 2014. 9: p. 127-33.
38. Biancotto, A., et al., Evolution of SIV toward RANTES resistance in macaques rapidly progressing to AIDS upon coinfection with HHV-6A. Retrovirology, 2009. 6: p. 61.
39. Lusso, P., et al., Human herpesvirus 6A accelerates AIDS progression in macaques. Proc Natl Acad Sci U S A, 2007. 104(12): p. 5067-72.
40. Santoro, F., et al., CD46 is a cellular receptor for human herpesvirus 6. Cell, 1999. 99(7): p. 817-27. 41. Tang, H., et al., CD134 is a cellular receptor specific for human herpesvirus-6B entry. Proc Natl Acad
Sci U S A, 2013. 110(22): p. 9096-9. 42. Akkapaiboon, P., et al., Intracellular processing of human herpesvirus 6 glycoproteins Q1 and Q2 into
tetrameric complexes expressed on the viral envelope. J Virol, 2004. 78(15): p. 7969-83. 43. Tang, H., et al., Detailed study of the interaction between human herpesvirus 6B glycoprotein
complex and its cellular receptor, human CD134. J Virol, 2014. 88(18): p. 10875-82. 44. Henaff, D., K. Radtke, and R. Lippe, Herpesviruses exploit several host compartments for
envelopment. Traffic, 2012. 13(11): p. 1443-9. 45. Roberts, K.L. and J.D. Baines, Actin in herpesvirus infection. Viruses, 2011. 3(4): p. 336-46. 46. Costanzo, F., et al., Evidence that herpes simplex virus DNA is transcribed by cellular RNA
polymerase B. J Virol, 1977. 21(3): p. 996-1001. 47. Gompels, U.A., et al., The DNA sequence of human herpesvirus-6: structure, coding content, and
genome evolution. Virology, 1995. 209(1): p. 29-51.
98
48. Deng, H. and S. Dewhurst, Functional identification and analysis of cis-acting sequences which mediate genome cleavage and packaging in human herpesvirus 6. J Virol, 1998. 72(1): p. 320-9.
49. Maeki, T. and Y. Mori, Features of Human Herpesvirus-6A and -6B Entry. Adv Virol, 2012. 2012: p. 384069.
50. Radtke, K., K. Dohner, and B. Sodeik, Viral interactions with the cytoskeleton: a hitchhiker's guide to the cell. Cell Microbiol, 2006. 8(3): p. 387-400.
51. Luppi, M., et al., Human herpesvirus 6 latently infects early bone marrow progenitors in vivo. J Virol, 1999. 73(1): p. 754-9.
52. Yasukawa, M., et al., Latent infection and reactivation of human herpesvirus 6 in two novel myeloid cell lines. Blood, 1999. 93(3): p. 991-9.
53. Yoshikawa, T., et al., Latent infection of human herpesvirus 6 in astrocytoma cell line and alteration of cytokine synthesis. J Med Virol, 2002. 66(4): p. 497-505.
54. Ahlqvist, J., et al., Differential tropism of human herpesvirus 6 (HHV-6) variants and induction of latency by HHV-6A in oligodendrocytes. J Neurovirol, 2005. 11(4): p. 384-94.
55. Kondo, K., et al., Identification of human herpesvirus 6 latency-associated transcripts. J Virol, 2002. 76(8): p. 4145-51.
56. Rotola, A., et al., U94 of human herpesvirus 6 is expressed in latently infected peripheral blood mononuclear cells and blocks viral gene expression in transformed lymphocytes in culture. Proc Natl Acad Sci U S A, 1998. 95(23): p. 13911-6.
57. Caselli, E., et al., Human herpesvirus 6 (HHV-6) U94/REP protein inhibits betaherpesvirus replication. Virology, 2006. 346(2): p. 402-14.
58. Rapp, J.C., et al., U94, the human herpesvirus 6 homolog of the parvovirus nonstructural gene, is highly conserved among isolates and is expressed at low mRNA levels as a spliced transcript. Virology, 2000. 268(2): p. 504-16.
59. Dominguez, G., et al., Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. J Virol, 1999. 73(10): p. 8040-52.
60. Martin, M.E., et al., The genome of human herpesvirus 6: maps of unit-length and concatemeric genomes for nine restriction endonucleases. J Gen Virol, 1991. 72 ( Pt 1): p. 157-68.
61. Isegawa, Y., et al., Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B. J Virol, 1999. 73(10): p. 8053-63.
62. Thomson, B.J., S. Dewhurst, and D. Gray, Structure and heterogeneity of the a sequences of human herpesvirus 6 strain variants U1102 and Z29 and identification of human telomeric repeat sequences at the genomic termini. J Virol, 1994. 68(5): p. 3007-14.
63. Achour, A., et al., Length variability of telomeric repeat sequences of human herpesvirus 6 DNA. J Virol Methods, 2009. 159(1): p. 127-30.
64. Kaufer, B.B. and L. Flamand, Chromosomally integrated HHV-6: impact on virus, cell and organismal biology. Curr Opin Virol, 2014. 9: p. 111-8.
65. Morissette, G. and L. Flamand, Herpesviruses and chromosomal integration, in J Virol. 2010: United States. p. 12100-9.
66. Kishi, M., et al., Inverted repeat regions of Marek's disease virus DNA possess a structure similar to that of the a sequence of herpes simplex virus DNA and contain host cell telomere sequences. J Virol, 1991. 65(6): p. 2791-7.
67. Delecluse, H.J. and W. Hammerschmidt, Status of Marek's disease virus in established lymphoma cell lines: herpesvirus integration is common. J Virol, 1993. 67(1): p. 82-92.
68. Delecluse, H.J., S. Schuller, and W. Hammerschmidt, Latent Marek's disease virus can be activated from its chromosomally integrated state in herpesvirus-transformed lymphoma cells. Embo j, 1993. 12(8): p. 3277-86.
69. Kutok, J.L. and F. Wang, Spectrum of Epstein-Barr virus-associated diseases. Annu Rev Pathol, 2006. 1: p. 375-404.
70. Lestou, V.S., et al., Non-random integration of Epstein-Barr virus in lymphoblastoid cell lines. Genes Chromosomes Cancer, 1993. 8(1): p. 38-48.
99
71. Luppi, M., et al., Three cases of human herpesvirus-6 latent infection: integration of viral genome in peripheral blood mononuclear cell DNA. J Med Virol, 1993. 40(1): p. 44-52.
72. Luppi, M., et al., Integration of human herpesvirus-6 (HHV-6) genome in chromosome 17 in two lymphoma patients. Leukemia, 1994. 8 Suppl 1: p. S41-5.
73. Torelli, G., et al., Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. J Med Virol, 1995. 46(3): p. 178-88.
74. Daibata, M., et al., Integration of human herpesvirus 6 in a Burkitt's lymphoma cell line. Br J Haematol, 1998. 102(5): p. 1307-13.
75. Nacheva, E.P., et al., Human herpesvirus 6 integrates within telomeric regions as evidenced by five different chromosomal sites. J Med Virol, 2008. 80(11): p. 1952-8.
76. Mori, T., et al., Transmission of chromosomally integrated human herpesvirsus 6 (HHV-6) variant A from a parent to children leading to misdiagnosis of active HHV-6 infection. Transpl Infect Dis, 2009. 11(6): p. 503-6.
77. Arbuckle, J.H., et al., The latent human herpesvirus-6A genome specifically integrates in telomeres of human chromosomes in vivo and in vitro. Proc Natl Acad Sci U S A, 2010. 107(12): p. 5563-8.
78. Daibata, M., et al., Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood, 1999. 94(5): p. 1545-9.
79. Tanaka-Taya, K., et al., Human herpesvirus 6 (HHV-6) is transmitted from parent to child in an integrated form and characterization of cases with chromosomally integrated HHV-6 DNA. J Med Virol, 2004. 73(3): p. 465-73.
80. Kaspersen, M.D., et al., Human herpesvirus-6A/B binds to spermatozoa acrosome and is the most prevalent herpesvirus in semen from sperm donors. PLoS One, 2012. 7(11): p. e48810.
81. Pellett, P.E., et al., Chromosomally integrated human herpesvirus 6: questions and answers. Rev Med Virol, 2012. 22(3): p. 144-55.
82. Clark, D.A., et al., Transmission of integrated human herpesvirus 6 through stem cell transplantation: implications for laboratory diagnosis. J Infect Dis, 2006. 193(7): p. 912-6.
83. Ward, K.N., et al., Human herpesvirus 6 chromosomal integration in immunocompetent patients results in high levels of viral DNA in blood, sera, and hair follicles. J Clin Microbiol, 2006. 44(4): p. 1571-4.
84. Hall, C.B., et al., Transplacental Human Herpesvirus 6 (HHV-6) Congenital Infection Caused by Maternal Chromosomally Integrated Virus. J Infect Dis, 2010. 201(4): p. 505-7.
85. Hall, C.B., et al., Chromosomal integration of human herpesvirus 6 is the major mode of congenital human herpesvirus 6 infection. Pediatrics, 2008. 122(3): p. 513-20.
86. Hubacek, P., et al., Failure of multiple antivirals to affect high HHV-6 DNAaemia resulting from viral chromosomal integration in case of severe aplastic anaemia. Haematologica, 2007. 92(10): p. e98-e100.
87. Hubacek, P., et al., HHV-6 DNA throughout the tissues of two stem cell transplant patients with chromosomally integrated HHV-6 and fatal CMV pneumonitis. Br J Haematol, 2009. 145(3): p. 394-8.
88. Hubacek, P., et al., Prevalence of HHV-6 integrated chromosomally among children treated for acute lymphoblastic or myeloid leukemia in the Czech Republic. J Med Virol, 2009. 81(2): p. 258-63.
89. Potenza, L., et al., Prevalence of human herpesvirus-6 chromosomal integration (CIHHV-6) in Italian solid organ and allogeneic stem cell transplant patients. Am J Transplant, 2009. 9(7): p. 1690-7.
90. Troy, S.B., et al., Severe encephalomyelitis in an immunocompetent adult with chromosomally integrated human herpesvirus 6 and clinical response to treatment with foscarnet plus ganciclovir. Clin Infect Dis, 2008. 47(12): p. e93-6.
91. Ward, K.N., et al., Human herpesvirus 6 DNA levels in cerebrospinal fluid due to primary infection differ from those due to chromosomal viral integration and have implications for diagnosis of encephalitis. J Clin Microbiol, 2007. 45(4): p. 1298-304.
92. Daibata, M., et al., Identification of integrated human herpesvirus 6 DNA in early pre-B cell acute lymphoblastic leukemia. Leukemia, 1998. 12(6): p. 1002-4.
100
93. Daibata, M., et al., Chromosomal transmission of human herpesvirus 6 DNA in acute lymphoblastic leukaemia, in Lancet. 1998: England. p. 543-4.
94. Morris, C., et al., Fine mapping of an apparently targeted latent human herpesvirus type 6 integration site in chromosome band 17p13.3. J Med Virol, 1999. 58(1): p. 69-75.
95. Jeulin, H., et al., Contribution of human herpesvirus 6 (HHV-6) viral load in whole blood and serum to investigate integrated HHV-6 transmission after haematopoietic stem cell transplantation. J Clin Virol, 2009. 45(1): p. 43-6.
96. Leong, H.N., et al., The prevalence of chromosomally integrated human herpesvirus 6 genomes in the blood of UK blood donors. J Med Virol, 2007. 79(1): p. 45-51.
97. Watanabe, H., et al., Chromosomal integration of human herpesvirus 6 DNA in anticonvulsant hypersensitivity syndrome, in Br J Dermatol. 2008: England. p. 640-2.
98. Delecluse, H.J., et al., Episomal and integrated copies of Epstein-Barr virus coexist in Burkitt lymphoma cell lines. J Virol, 1993. 67(3): p. 1292-9.
99. Lohi, O., et al., A high circulating copy number of HHV-6 due to chromosomal integration in a child with acute lymphoblastic leukemia. Pediatr Blood Cancer, 2010. 55(6): p. 1236-8.
100. Jeulin, H., et al., Chromosomally integrated HHV-6: slow decrease of HHV-6 viral load after hematopoietic stem-cell transplantation, in Transplantation. 2009: United States. p. 1142-3.
101. Kamble, R.T., et al., Transmission of integrated human herpesvirus-6 in allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant, 2007. 40(6): p. 563-6.
102. Gravel, A., D. Sinnett, and L. Flamand, Frequency of chromosomally-integrated human herpesvirus 6 in children with acute lymphoblastic leukemia. PLoS One, 2013. 8(12): p. e84322.
103. Sedlak, R.H., et al., Identification of chromosomally integrated human herpesvirus 6 by droplet digital PCR. Clin Chem, 2014. 60(5): p. 765-72.
104. Geraudie, B., et al., Quantitation of human herpesvirus-6A, -6B and -7 DNAs in whole blood, mononuclear and polymorphonuclear cell fractions from healthy blood donors. J Clin Virol, 2012. 53(2): p. 151-5.
105. Clark, D.A. and K.N. Ward, Importance of chromosomally integrated HHV-6A and -6B in the diagnosis of active HHV-6 infection. Herpes, 2008. 15(2): p. 28-32.
106. Sedlak, R.H., et al., Detection of Human Herpesvirus 6B (HHV-6B) Reactivation in Hematopoietic Cell Transplant Recipients with Inherited Chromosomally Integrated HHV-6A by Droplet Digital PCR. J Clin Microbiol, 2016. 54(5): p. 1223-7.
107. Gravel, A., et al., Inherited chromosomally integrated human herpesvirus 6 as a predisposing risk factor for the development of angina pectoris. Proc Natl Acad Sci U S A, 2015. 112(26): p. 8058-63.
108. Prusty, B.K., G. Krohne, and T. Rudel, Reactivation of chromosomally integrated human herpesvirus-6 by telomeric circle formation. PLoS Genet, 2013. 9(12): p. e1004033.
109. Endo, A., et al., Molecular and virological evidence of viral activation from chromosomally integrated human herpesvirus 6A in a patient with X-linked severe combined immunodeficiency. Clin Infect Dis, 2014. 59(4): p. 545-8.
110. Hill, J.A., et al., Prevalence of chromosomally integrated human herpesvirus 6 in patients with human herpesvirus 6-central nervous system dysfunction. Biol Blood Marrow Transplant, 2015. 21(2): p. 371-3.
111. Gravel, A., C.B. Hall, and L. Flamand, Sequence analysis of transplacentally acquired human herpesvirus 6 DNA is consistent with transmission of a chromosomally integrated reactivated virus. J Infect Dis, 2013. 207(10): p. 1585-9.
112. Huang, Y., et al., Human telomeres that carry an integrated copy of human herpesvirus 6 are often short and unstable, facilitating release of the viral genome from the chromosome, in Nucleic Acids Res. 2014: England. p. 315-27.
113. Arbuckle, J.H., et al., Mapping the telomere integrated genome of human herpesvirus 6A and 6B. Virology, 2013. 442(1): p. 3-11.
114. Zhang, J., et al., Ageing and the telomere connection: An intimate relationship with inflammation. Ageing Res Rev, 2016. 25: p. 55-69.
101
115. Ohye, T., et al., Dual roles for the telomeric repeats in chromosomally integrated human herpesvirus-6. Sci Rep, 2014. 4: p. 4559.
116. Wallaschek, N., et al., The Telomeric Repeats of Human Herpesvirus 6A (HHV-6A) Are Required for Efficient Virus Integration. PLoS Pathog, 2016. 12(5): p. e1005666.
117. Osterrieder, N., N. Wallaschek, and B.B. Kaufer, Herpesvirus Genome Integration into Telomeric Repeats of Host Cell Chromosomes. Annu Rev Virol, 2014. 1(1): p. 215-35.
118. Hall, C.B., et al., Congenital infections with human herpesvirus 6 (HHV6) and human herpesvirus 7 (HHV7). J Pediatr, 2004. 145(4): p. 472-7.
119. Trempe, F., et al., Characterization of human herpesvirus 6A/B U94 as ATPase, helicase, exonuclease and DNA-binding proteins. Nucleic Acids Res, 2015. 43(12): p. 6084-98.
120. Linden, R.M., et al., Site-specific integration by adeno-associated virus. Proc Natl Acad Sci U S A, 1996. 93(21): p. 11288-94.
121. Linden, R.M., E. Winocour, and K.I. Berns, The recombination signals for adeno-associated virus site-specific integration. Proc Natl Acad Sci U S A, 1996. 93(15): p. 7966-72.
122. Thomson, B.J., S. Efstathiou, and R.W. Honess, Acquisition of the human adeno-associated virus type-2 rep gene by human herpesvirus type-6. Nature, 1991. 351(6321): p. 78-80.
123. Thomson, B.J., et al., Human herpesvirus 6 (HHV-6) is a helper virus for adeno-associated virus type 2 (AAV-2) and the AAV-2 rep gene homologue in HHV-6 can mediate AAV-2 DNA replication and regulate gene expression. Virology, 1994. 204(1): p. 304-11.
124. Wallaschek, N., et al., The putative U94 integrase is dispensable for human herpesvirus 6 (HHV-6) chromosomal integration. J Gen Virol, 2016.
125. Takubo, K., et al., Changes of telomere length with aging. Geriatr Gerontol Int, 2010. 10 Suppl 1: p. S197-206.
126. Chai, W., J.W. Shay, and W.E. Wright, Human telomeres maintain their overhang length at senescence. Mol Cell Biol, 2005. 25(6): p. 2158-68.
127. Makarov, V.L., Y. Hirose, and J.P. Langmore, Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell, 1997. 88(5): p. 657-66.
128. McElligott, R. and R.J. Wellinger, The terminal DNA structure of mammalian chromosomes. Embo j, 1997. 16(12): p. 3705-14.
129. Olovnikov, A.M., A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Biol, 1973. 41(1): p. 181-90.
130. de Lange, T., How telomeres solve the end-protection problem. Science, 2009. 326(5955): p. 948-52. 131. Allsopp, R.C., et al., Telomere length predicts replicative capacity of human fibroblasts. Proc Natl
Acad Sci U S A, 1992. 89(21): p. 10114-8. 132. Capper, R., et al., The nature of telomere fusion and a definition of the critical telomere length in
human cells. Genes Dev, 2007. 21(19): p. 2495-508. 133. Harley, C.B., A.B. Futcher, and C.W. Greider, Telomeres shorten during ageing of human fibroblasts.
Nature, 1990. 345(6274): p. 458-60. 134. Hemann, M.T., et al., The shortest telomere, not average telomere length, is critical for cell viability
and chromosome stability. Cell, 2001. 107(1): p. 67-77. 135. Griffith, J.D., et al., Mammalian telomeres end in a large duplex loop. Cell, 1999. 97(4): p. 503-14. 136. Nikitina, T. and C.L. Woodcock, Closed chromatin loops at the ends of chromosomes. J Cell Biol,
2004. 166(2): p. 161-5. 137. Rajavel, M., M.R. Mullins, and D.J. Taylor, Multiple facets of TPP1 in telomere maintenance. Biochim
Biophys Acta, 2014. 1844(9): p. 1550-9. 138. Court, R., et al., How the human telomeric proteins TRF1 and TRF2 recognize telomeric DNA: a view
from high-resolution crystal structures. EMBO Rep, 2005. 6(1): p. 39-45. 139. Bilaud, T., et al., Telomeric localization of TRF2, a novel human telobox protein. Nat Genet, 1997.
17(2): p. 236-9.
102
140. Zhong, Z., et al., A mammalian factor that binds telomeric TTAGGG repeats in vitro. Mol Cell Biol, 1992. 12(11): p. 4834-43.
141. Broccoli, D., et al., Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet, 1997. 17(2): p. 231-5.
142. Hanaoka, S., A. Nagadoi, and Y. Nishimura, Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities. Protein Sci, 2005. 14(1): p. 119-30.
143. Sfeir, A., et al., Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell, 2009. 138(1): p. 90-103.
144. van Steensel, B. and T. de Lange, Control of telomere length by the human telomeric protein TRF1. Nature, 1997. 385(6618): p. 740-3.
145. Lazzerini-Denchi, E. and A. Sfeir, Stop pulling my strings - what telomeres taught us about the DNA damage response. Nat Rev Mol Cell Biol, 2016. 17(6): p. 364-78.
146. Denchi, E.L. and T. de Lange, Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature, 2007. 448(7157): p. 1068-71.
147. Wang, R.C., A. Smogorzewska, and T. de Lange, Homologous recombination generates T-loop-sized deletions at human telomeres. Cell, 2004. 119(3): p. 355-68.
148. Hsu, H.L., et al., Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev, 2000. 14(22): p. 2807-12.
149. Karlseder, J., et al., p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science, 1999. 283(5406): p. 1321-5.
150. van Steensel, B., A. Smogorzewska, and T. de Lange, TRF2 protects human telomeres from end-to-end fusions. Cell, 1998. 92(3): p. 401-13.
151. Ancelin, K., C. Brun, and E. Gilson, Role of the telomeric DNA-binding protein TRF2 in the stability of human chromosome ends. Bioessays, 1998. 20(11): p. 879-83.
152. Lin, J., et al., Unraveling secrets of telomeres: one molecule at a time. DNA Repair (Amst), 2014. 20: p. 142-53.
153. Lei, M., E.R. Podell, and T.R. Cech, Structure of human POT1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat Struct Mol Biol, 2004. 11(12): p. 1223-9.
154. Loayza, D., et al., DNA binding features of human POT1: a nonamer 5'-TAGGGTTAG-3' minimal binding site, sequence specificity, and internal binding to multimeric sites. J Biol Chem, 2004. 279(13): p. 13241-8.
155. Baumann, P. and T.R. Cech, Pot1, the putative telomere end-binding protein in fission yeast and humans. Science, 2001. 292(5519): p. 1171-5.
156. Wang, F., et al., The POT1-TPP1 telomere complex is a telomerase processivity factor. Nature, 2007. 445(7127): p. 506-10.
157. Latrick, C.M. and T.R. Cech, POT1-TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation. Embo j, 2010. 29(5): p. 924-33.
158. Loayza, D. and T. De Lange, POT1 as a terminal transducer of TRF1 telomere length control. Nature, 2003. 423(6943): p. 1013-8.
159. Lundblad, V., Telomeres: taking the measure, in Nature. 2003: England. p. 926-7. 160. Kim, S.H., P. Kaminker, and J. Campisi, TIN2, a new regulator of telomere length in human cells. Nat
Genet, 1999. 23(4): p. 405-12. 161. Kim, S.H., et al., The human telomere-associated protein TIN2 stimulates interactions between
telomeric DNA tracts in vitro. EMBO Rep, 2003. 4(7): p. 685-91. 162. Kim, S.H., et al., TIN2 mediates functions of TRF2 at human telomeres. J Biol Chem, 2004. 279(42):
p. 43799-804. 163. Stewart, J.A., et al., Maintaining the end: roles of telomere proteins in end-protection, telomere
replication and length regulation. Mutat Res, 2012. 730(1-2): p. 12-9. 164. Kabir, S., A. Sfeir, and T. de Lange, Taking apart Rap1: an adaptor protein with telomeric and non-
telomeric functions. Cell Cycle, 2010. 9(20): p. 4061-7.
103
165. Sarthy, J., et al., Human RAP1 inhibits non-homologous end joining at telomeres. Embo j, 2009. 28(21): p. 3390-9.
166. Sfeir, A., et al., Loss of Rap1 induces telomere recombination in the absence of NHEJ or a DNA damage signal. Science, 2010. 327(5973): p. 1657-61.
167. Arat, N.O. and J.D. Griffith, Human Rap1 interacts directly with telomeric DNA and regulates TRF2 localization at the telomere. J Biol Chem, 2012. 287(50): p. 41583-94.
168. Miyake, Y., et al., RPA-like mammalian Ctc1-Stn1-Ten1 complex binds to single-stranded DNA and protects telomeres independently of the Pot1 pathway. Mol Cell, 2009. 36(2): p. 193-206.
169. Chen, L.Y., S. Redon, and J. Lingner, The human CST complex is a terminator of telomerase activity. Nature, 2012. 488(7412): p. 540-4.
170. Lieber, M.R., et al., Mechanism and regulation of human non-homologous DNA end-joining. Nat Rev Mol Cell Biol, 2003. 4(9): p. 712-20.
171. Palm, W. and T. de Lange, How shelterin protects mammalian telomeres. Annu Rev Genet, 2008. 42: p. 301-34.
172. Sen, D. and W. Gilbert, Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature, 1988. 334(6180): p. 364-6.
173. Parkinson, G.N., M.P. Lee, and S. Neidle, Crystal structure of parallel quadruplexes from human telomeric DNA. Nature, 2002. 417(6891): p. 876-80.
174. Gellert, M., M.N. Lipsett, and D.R. Davies, Helix formation by guanylic acid. Proc Natl Acad Sci U S A, 1962. 48: p. 2013-8.
175. Zhang, S., Y. Wu, and W. Zhang, G-quadruplex structures and their interaction diversity with ligands. ChemMedChem, 2014. 9(5): p. 899-911.
176. Tarsounas, M. and M. Tijsterman, Genomes and G-quadruplexes: for better or for worse. J Mol Biol, 2013. 425(23): p. 4782-9.
177. van Kregten, M. and M. Tijsterman, The repair of G-quadruplex-induced DNA damage. Exp Cell Res, 2014. 329(1): p. 178-83.
178. Zahler, A.M., et al., Inhibition of telomerase by G-quartet DNA structures. Nature, 1991. 350(6320): p. 718-20.
179. Giraldo, R. and D. Rhodes, The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA. Embo j, 1994. 13(10): p. 2411-20.
180. Huppert, J.L. and S. Balasubramanian, G-quadruplexes in promoters throughout the human genome. Nucleic Acids Res, 2007. 35(2): p. 406-13.
181. Brazda, V., et al., DNA and RNA quadruplex-binding proteins. Int J Mol Sci, 2014. 15(10): p. 17493-517.
182. Haider, S.M., S. Neidle, and G.N. Parkinson, A structural analysis of G-quadruplex/ligand interactions. Biochimie, 2011. 93(8): p. 1239-51.
183. Parkinson, G.N., F. Cuenca, and S. Neidle, Topology conservation and loop flexibility in quadruplex-drug recognition: crystal structures of inter- and intramolecular telomeric DNA quadruplex-drug complexes. J Mol Biol, 2008. 381(5): p. 1145-56.
184. Parkinson, G.N., R. Ghosh, and S. Neidle, Structural basis for binding of porphyrin to human telomeres. Biochemistry, 2007. 46(9): p. 2390-7.
185. Read, M., et al., Structure-based design of selective and potent G quadruplex-mediated telomerase inhibitors. Proc Natl Acad Sci U S A, 2001. 98(9): p. 4844-9.
186. Campbell, N.H., et al., Structural basis of DNA quadruplex recognition by an acridine drug. J Am Chem Soc, 2008. 130(21): p. 6722-4.
187. Incles, C.M., et al., A G-quadruplex telomere targeting agent produces p16-associated senescence and chromosomal fusions in human prostate cancer cells. Mol Cancer Ther, 2004. 3(10): p. 1201-6.
188. Greider, C.W. and E.H. Blackburn, A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature, 1989. 337(6205): p. 331-7.
189. Greider, C.W. and E.H. Blackburn, Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell, 1985. 43(2 Pt 1): p. 405-13.
104
190. Osterhage, J.L. and K.L. Friedman, Chromosome end maintenance by telomerase. J Biol Chem, 2009. 284(24): p. 16061-5.
191. Aubert, G. and P.M. Lansdorp, Telomeres and aging. Physiol Rev, 2008. 88(2): p. 557-79. 192. Bekaert, S., H. Derradji, and S. Baatout, Telomere biology in mammalian germ cells and during
development. Dev Biol, 2004. 274(1): p. 15-30. 193. Liu, T., X. Yuan, and D. Xu, Cancer-Specific Telomerase Reverse Transcriptase (TERT) Promoter
Mutations: Biological and Clinical Implications. Genes (Basel), 2016. 7(7). 194. Cesare, A.J. and R.R. Reddel, Alternative lengthening of telomeres: models, mechanisms and
implications. Nat Rev Genet, 2010. 11(5): p. 319-30. 195. de Lange, T., Shelterin: the protein complex that shapes and safeguards human telomeres. Genes
Dev, 2005. 19(18): p. 2100-10. 196. Ford, L.P., et al., Telomerase can inhibit the recombination-based pathway of telomere maintenance
in human cells. J Biol Chem, 2001. 276(34): p. 32198-203. 197. Tokutake, Y., et al., Extra-chromosomal telomere repeat DNA in telomerase-negative immortalized
cell lines. Biochem Biophys Res Commun, 1998. 247(3): p. 765-72. 198. Dunham, M.A., et al., Telomere maintenance by recombination in human cells. Nat Genet, 2000.
26(4): p. 447-50. 199. Murnane, J.P., et al., Telomere dynamics in an immortal human cell line. Embo j, 1994. 13(20): p.
4953-62. 200. Yeager, T.R., et al., Telomerase-negative immortalized human cells contain a novel type of
promyelocytic leukemia (PML) body. Cancer Res, 1999. 59(17): p. 4175-9. 201. Liu, Y., Y. Li, and X. Lu, Regulators in the DNA damage response. Arch Biochem Biophys, 2016. 594:
p. 18-25. 202. Cimprich, K.A. and D. Cortez, ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol,
2008. 9(8): p. 616-27. 203. Lee, J.H. and T.T. Paull, ATM activation by DNA double-strand breaks through the Mre11-Rad50-
Nbs1 complex. Science, 2005. 308(5721): p. 551-4. 204. Pardo, B., B. Gomez-Gonzalez, and A. Aguilera, DNA repair in mammalian cells: DNA double-strand
break repair: how to fix a broken relationship. Cell Mol Life Sci, 2009. 66(6): p. 1039-56. 205. Dimitrova, N., et al., 53BP1 promotes non-homologous end joining of telomeres by increasing
chromatin mobility. Nature, 2008. 456(7221): p. 524-8. 206. Delacroix, S., et al., The Rad9-Hus1-Rad1 (9-1-1) clamp activates checkpoint signaling via TopBP1.
Genes Dev, 2007. 21(12): p. 1472-7. 207. Zou, L., D. Liu, and S.J. Elledge, Replication protein A-mediated recruitment and activation of Rad17
complexes. Proc Natl Acad Sci U S A, 2003. 100(24): p. 13827-32. 208. Awasthi, P., M. Foiani, and A. Kumar, ATM and ATR signaling at a glance. J Cell Sci, 2015. 128(23):
p. 4255-62. 209. Daley, J.M., et al., Nonhomologous end joining in yeast. Annu Rev Genet, 2005. 39: p. 431-51. 210. Krogh, B.O. and L.S. Symington, Recombination proteins in yeast. Annu Rev Genet, 2004. 38: p.
233-71. 211. White, C.I. and J.E. Haber, Intermediates of recombination during mating type switching in
Saccharomyces cerevisiae. Embo j, 1990. 9(3): p. 663-73. 212. Sun, H., D. Treco, and J.W. Szostak, Extensive 3'-overhanging, single-stranded DNA associated with
the meiosis-specific double-strand breaks at the ARG4 recombination initiation site. Cell, 1991. 64(6): p. 1155-61.
213. Li, X. and W.D. Heyer, Homologous recombination in DNA repair and DNA damage tolerance. Cell Res, 2008. 18(1): p. 99-113.
214. Song, B. and P. Sung, Functional interactions among yeast Rad51 recombinase, Rad52 mediator, and replication protein A in DNA strand exchange. J Biol Chem, 2000. 275(21): p. 15895-904.
215. Ristic, D., et al., Human Rad51 filaments on double- and single-stranded DNA: correlating regular and irregular forms with recombination function. Nucleic Acids Res, 2005. 33(10): p. 3292-302.
105
216. Malkova, A. and G. Ira, Break-induced replication: functions and molecular mechanism. Curr Opin Genet Dev, 2013. 23(3): p. 271-9.
217. Weitzman, M.D., C.E. Lilley, and M.S. Chaurushiya, Genomes in conflict: maintaining genome integrity during virus infection. Annu Rev Microbiol, 2010. 64: p. 61-81.
218. Shirata, N., et al., Activation of ataxia telangiectasia-mutated DNA damage checkpoint signal transduction elicited by herpes simplex virus infection. J Biol Chem, 2005. 280(34): p. 30336-41.
219. Wilkinson, D.E. and S.K. Weller, Herpes simplex virus type I disrupts the ATR-dependent DNA-damage response during lytic infection. J Cell Sci, 2006. 119(Pt 13): p. 2695-703.
220. Lilley, C.E., et al., DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc Natl Acad Sci U S A, 2005. 102(16): p. 5844-9.
221. Luo, M.H., et al., Human cytomegalovirus disrupts both ataxia telangiectasia mutated protein (ATM)- and ATM-Rad3-related kinase-mediated DNA damage responses during lytic infection. J Virol, 2007. 81(4): p. 1934-50.
222. Kudoh, A., et al., Homologous recombinational repair factors are recruited and loaded onto the viral DNA genome in Epstein-Barr virus replication compartments. J Virol, 2009. 83(13): p. 6641-51.
223. Kudoh, A., et al., Epstein-Barr virus lytic replication elicits ATM checkpoint signal transduction while providing an S-phase-like cellular environment. J Biol Chem, 2005. 280(9): p. 8156-63.
224. Daya, S., N. Cortez, and K.I. Berns, Adeno-associated virus site-specific integration is mediated by proteins of the nonhomologous end-joining pathway. J Virol, 2009. 83(22): p. 11655-64.
225. Kofod-Olsen, E., et al., Inhibition of p53-dependent, but not p53-independent, cell death by U19 protein from human herpesvirus 6B. PLoS One, 2013. 8(3): p. e59223.
226. Frenkel, N., E. Sharon, and H. Zeigerman, Roseoloviruses manipulate host cell cycle. Curr Opin Virol, 2014. 9: p. 162-6.
227. Deng, Z., et al., Telomeric proteins regulate episomal maintenance of Epstein-Barr virus origin of plasmid replication. Mol Cell, 2002. 9(3): p. 493-503.
228. Kamranvar, S.A., X. Chen, and M.G. Masucci, Telomere dysfunction and activation of alternative lengthening of telomeres in B-lymphocytes infected by Epstein-Barr virus. Oncogene, 2013. 32(49): p. 5522-30.
229. Endo, A., et al., Molecular and Virological Evidence of Viral Activation From Chromosomally Integrated Human Herpesvirus 6A in a Patient With X-Linked Severe Combined Immunodeficiency. Clin Infect Dis, 2014. 59(4): p. 545-8.
230. Zhou, G., et al., Telomere targeting with a novel G-quadruplex-interactive ligand BRACO-19 induces T-loop disassembly and telomerase displacement in human glioblastoma cells. Oncotarget, 2016. 7(12): p. 14925-39.
Recommended