ORIGINAL ARTICLE

Detection of antibodies specific for foot-and-mouth disease virusinfection using indirect ELISA based on recombinantnonstructural protein 2B

Jitendra K. Biswal • Sarita Jena • Jajati K. Mohapatra •

Punam Bisht • Bramhadev Pattnaik

Received: 7 October 2013 / Accepted: 29 December 2013

� Springer-Verlag Wien 2014

Abstract Foot-and-mouth disease (FMD) is a highly

contagious viral disease of transboundary importance. In

India, since the launch of the FMD control programme,

there has been a substantial increase in the vaccinated

bovine population. In this scenario, there is a need for

additional locally developed non-structural protein (NSP)-

based immnoassays for efficient identification of FMD virus

(FMDV)-infected animals in the vaccinated population. The

2B NSP of FMDV, lacking the transmembrane domain

(D2B), was expressed successfully in a prokaryotic system,

and an indirect ELISA (I-ELISA) was developed and vali-

dated in this study. The diagnostic sensitivity and specificity

of the D2B I-ELISA were found to be 95.3 % and 94.6 %,

respectively. In experimentally infected cattle, the assay

could consistently detect D2B-NSP-specific antibodies

from 10 to approximately 400 days postinfection. The assay

was further validated with bovine serum samples collected

randomly from different parts of the country. The perfor-

mance of the D2B I-ELISA was compared with the in-house

r3AB3 I-ELISA, and the overall concordance in test results

was found to be 86.49 %. The D2B I-ELISA could be useful

as a screening or confirmatory assay in the surveillance of

FMD irrespective of vaccination.

Introduction

Foot-and-mouth disease is a highly contagious viral disease

of both domesticated and wild ruminants as well as pigs.

Owing to its contagiousness and potential for rapid spread

among susceptible animals, the disease poses a serious

threat to the international trade of animals and animal

products. Culling of infected and in-contact animals is the

favoured method of control of FMD in many parts of the

world that are free from FMD. However, prophylactic

biannual vaccination with extensive serosurveillance has

been preferred over culling in India. Nevertheless, the

strategy of vaccination has its own problems, and the most

important one is that vaccinated animals may sometimes be

infected with FMD virus (FMDV) with or without showing

overt clinical signs [12]. Therefore, identification of

FMDV-infected individuals among vaccinated animals is

of utmost importance, especially in ruminants, which may

act as carriers of the virus and can potentially become the

source for new outbreaks. In this respect, it is imperative to

develop highly sensitive and specific discriminatory assays

to detect infection regardless of vaccination status.

Detection of serum antibodies against FMDV non-

structural protein (NSP) in FMD-vaccinated and subse-

quently infected animals is used as a differential marker of

infection, since vaccination with purified vaccine elicits

antibodies only against the structural protein (SP) of

FMDV [7]. A range of different ELISAs have been

developed to detect antibodies against NSP of FMDV [16],

and these assays have a further advantage over the con-

ventional tests in that they are not serotype specific.

However, the current NSP-based assays are not able to

detect infection reliably in a vaccinated population [5].

During the validation of various NSP ELISAs in an inter-

national workshop at Brescia, Italy, it was found that none

of the assays could provide a categorical assurance of

detecting infection [5]. Therefore, it was suggested to use

more than one NSP assay in order to enhance the overall

sensitivity and specificity of determination of infection

J. K. Biswal � S. Jena � J. K. Mohapatra � P. Bisht �B. Pattnaik (&)

Project Directorate on Foot-and-Mouth Disease (ICAR),

Mukteswar, Nainital 263138, Uttarakhand, India

e-mail: pattnaikb@gmail.com

123

Arch Virol

DOI 10.1007/s00705-013-1973-3

status. Considering that recommendation, there is a need to

produce a new NSP-based ELISA that can be used either as

the screening or confirmatory method along with existing

NSP tests or one that can be used in a multiple NSP-anti-

gen-based assay [24] to enhance the confidence of detec-

tion of infection.

Based on a series of experiments, Berger et al. [4]

suggested to use NSP 2B along with other NSPs (2C, 3AB1

and/or 3C) for identification of FMDV replication in vac-

cinated cattle. Infection-related linear B-cell epitopes on

the 2B NSP of FMDV have been mapped by analyzing

synthetic peptides in an indirect ELISA [9]. Although the

ELISA based on synthetic 2B peptides had shown some

promising results [21] and was comparable to the Prio

CHECK-NSP assay [10], these peptides were thought to be

too expensive and poorly antigenic for use in ELISA [8].

Therefore, test systems based on recombinant NSP could

be designed as a relatively cost-effective alternative. In this

study, we report the expression in Escherichia coli of

recombinant truncated 2B NSP lacking the transmembrane

domain (D2B) and the development of a differential indi-

rect ELISA (I-ELISA) for serosurveillance of FMD.

Materials and methods

Serum samples

Serum samples used in this study were collected either from

cattle or buffalo, and the term ‘bovine’ in this manuscript

implies both of them. Serum samples collected from naı̈ve,

infected (both experimentally and naturally) and uninfected

vaccinated animals were obtained from the serum reposi-

tory maintained at Project Directorate on Foot and Mouth

Disease (PDFMD), Mukteswar, India. This study complied

with international standards for animal welfare.

Serum samples from a naı̈ve bovine population

A total of 196 serum samples collected from clinically

healthy animals and found negative for anti-FMDV struc-

tural protein antibodies in liquid-phase blocking ELISA

were used in this study. These samples included 131 serum

samples derived from an unvaccinated, clinically healthy

bovine population without any history of FMDV infection

for at least 10 years, 60 serum samples collected at day

‘zero’ from cattle used in FMD vaccine potency studies,

and five commercial healthy bovine sera.

Serum samples from uninfected, vaccinated bovines

Serum samples (n = 144, from 72 cattle) were collected

from an FMD-free dairy cattle herd that was vaccinated

routinely at six-month intervals with a trivalent inactivated

vaccine. These samples were collected at 28 and 180 days

post-vaccination (dpv). Serum samples (n = 312) from

FMD control programme (FMD-CP) areas without any

report of FMD for the last five years were also included in

the study. The majority of the adult bovines in the FMD-CP

areas had received at least 8 rounds of prophylactic bian-

nual vaccination. Samples (n = 60) were also collected at

21 dpv from cattle that were used in FMD vaccine potency

studies. All of these 516 serum samples collected from

vaccinated, uninfected animals along with the serum

samples from naı̈ve bovines (n = 196) were used for the

determination of the cutoff value and diagnostic specificity

of D2B I-ELISA.

Serum samples from infected bovines

A total of 178 serum samples that were collected sequen-

tially between 10 and 1000 days postinfection (dpi) from

four unvaccinated bull calves were obtained from the

serum repository of PDFMD. Two of them were inoculated

intradermolingually with either FMDV A IND 40/2000 or

Asia 1 IND 63/1972, while the other two calves were

contact infected after being co-housed separately with each

of the inoculated animals [19]. 120 out of these 178 serum

samples (from 10-400 dpi) were used for the estimation of

the cutoff value and diagnostic sensitivity of the D2B

I-ELISA. Bovine serum samples (n = 1259) from clinical

cases of FMD field outbreaks were also included in this

study. These samples were collected at different time

points during the outbreaks, ranging from the acute phase

to nearly one year post-outbreak.

Bovine serum samples collected at random

Serum samples (n = 3500) that had been collected at

random from different parts of the country were also ana-

lysed in D2B I-ELISA in order to determine the prevalence

of 2B antibodies in bovines.

Molecular cloning, expression and purification

of recombinant 2B non-structural protein

Construction of recombinant 2B gene expression vectors

Total RNA was extracted using a QIAamp Viral RNA Mini

Kit (QIAGEN, Hilden, Germany) from baby hamster kid-

ney cells (BHK-21) infected with FMDV isolate O IND

R2/1975. The extracted RNA was reverse transcribed using

oligo (dT)20 primer (Invitrogen, USA) and Thermo-

ScriptTM reverse transcriptase enzyme (Invitrogen, USA).

The full-length coding sequence of 2B NSP was amplified

by PCR using upstream primer 2BF (GATCGGATCC

J. K. Biswal et al.

123

CCCTTCTTCTTC), which has a BamHI site (bold

and underlined), and downstream primer 2BR

(GATCAAGCTTCTGTTTTTCTG), which has a HindIII

site (bold and underlined).

The 2B NSP gene without the sequence encoding the

transmembrane region (D2B) was amplified by an overlap

extension PCR (OEP) in which two rounds of PCR were

carried out to amplify two DNA fragments, F1 and F2 (F1,

nucleotides 1-339; F2, nucleotides 412 to 462), of the 2B

NSP gene with an overlap of 15 nucleotides. These frag-

ments were combined in a subsequent fusion reaction in

which the overlapping ends served as primers for the

extension of complementary strands. The entire experiment

was carried out as per the protocol developed by Urban

et al. [27]. All of the PCRs were carried out using a KOD

Hot Start DNA polymerase kit (Novagen, Germany).

Subsequently the agarose gel purified 2B and D2B

amplicons were ligated into the Bam HI and Hind III sites

of bacterial expression vector pMAL-c5X (NEB, USA) to

generate the recombinant plasmids pMAL-2B and pMAL-

D2B. In these plasmids, the 2B and D2B genes were ligated

in frame with the malE gene, which encodes the maltose

binding protein (MBP). The ligated products were used to

transform chemically competent E. coli JM109 cells

(Promega, Madison, USA). The resultant recombinant

clones were selected on ampicillin plates and screened by

restriction enzyme digestion analysis. The nucleotide

sequences of the inserts were confirmed using gene-specific

primers in an ABI 3130 DNA automated sequencer

(Applied Biosystems, CA, USA). Positive clones were

subsequently subjected to protein expression screening.

Purification and immunological characterisation

of recombinant D2B NSP

Expression and affinity purification of the recombinant

MBP-D2B fusion protein was performed according to the

manufacturer’s instructions (NEB, USA). Briefly, 25 ml of

an overnight culture of a JM109 clone harbouring the

MBP-D2B construct was inoculated into 250 ml of LB

medium and grown at 37 �C until the optical density (O.D.)

at 600 nm reached 0.6-0.7. Following addition of IPTG to a

final concentration of 0.5 mM, the bacterial culture was

incubated further at 28 �C for 5 hours. Bacterial cells were

harvested by centrifugation at 4000 g for 20 minutes and

then resuspended in 20 ml of column buffer (20 mM Tris-

Cl [pH 7.4], 200 mM NaCl, 1 mM EDTA, and 1 mM

dithiothreitol). The bacterial suspension was subjected to

one freeze-thaw cycle and sonicated. The clarified super-

natant was loaded onto a column containing amylase resin.

The resin was washed four times with column buffer, and

the fusion protein was eluted with column buffer contain-

ing 10 mM maltose. Fractions were collected, pooled, and

dialyzed against PBS. The purity of recombinant D2B NSP

was assessed by SDS-PAGE [14]. The immunoreactivity of

recombinant D2B protein was analysed by western blot

using anti-MBP monoclonal antibody and rabbit anti-

mouse HRP-conjugated secondary antibody. Differential

reactivity of the recombinant NSP protein was also verified

by western blot using FMDV-infected bovine serum (28

dpi) and naı̈ve serum diluted 1:100 in blocking buffer.

Development of recombinant D2B I-ELISA

During the development of the D2B I-ELISA, the con-

centrations of various components of the assay were opti-

mised by the checkerboard titration method. Briefly,

96-well, flat-bottom polystyrene plates (Nunc, Roskilde,

Denmark) were coated with recombinant purified MBP-

D2B protein diluted in carbonate-bicarbonate buffer and

incubated at 4 �C overnight. The coated plates were

washed four times with PBS and blocked with a buffer

containing 10 g of fraction V bovine serum albumin, 15 g

of glycine, and 40 g of sucrose in one litre of PBS. Serum

samples were diluted (1:15 dilution) and pre-absorbed for

one hour with purified MBP in a serum dilution buffer

containing 10 g of BSA per litre of PBS. The D2B-NSP-

coated ELISA plates were washed three times with PBS,

and diluted serum (100 ll/well) was transferred to dupli-

cate wells of the ELISA plate and incubated at 37 �C for

one hour. The positive and negative sera were included as

internal controls, while serum dilution buffer without any

serum was included as conjugate control to determine any

background activity. Subsequently, after washing, rabbit

anti-cow immunoglobulin/HRP conjugate (DAKO, Den-

mark) diluted 1:2000 in dilution buffer was added and

incubated for 1 hour. Finally, substrate solution containing

o-phenylenediamine dihydrochloride (OPD)/H2O2 was

added, and the reaction was stopped after 12 minutes of

incubation by adding 1 M H2SO4. The optical density (OD)

values were measured at 492 nm.

The corrected mean OD values of the positive control

(mODPOS), the negative control (mODNEG), and the test

samples (mODsample) were determined after subtracting

the mean OD value of the background control wells

(mODBG). The OD for each test serum sample was

expressed as a percentage of the positive control using the

following formula:

Percent of positive control (PP) = [mODsample] 9 100

/ [mODPOS]

Determination of the precision of D2B I-ELISA

For the precision analysis, coefficients of variation (CVs)

were calculated based on the PP values from intra-plate

replicates (four replicates per sample), inter-plate replicates

ELISA for detection of antibodies against FMDV 2B protein

123

(three plates per day), and inter-day replicates (between

five different days) of five selected serum samples

(Table 1) in D2B I-ELISA. The precision estimation of the

D2B I-ELISA was carried out as described by Jaworski

et al. [11].

r3AB3 I-ELISA

In order to determine the concordance between D2B

I-ELISA and the in-house r3AB3 I-ELISA, a selected set of

serum samples (n = 2500) were also tested by r3AB3

I-ELISA as described earlier [19].

Bioinformatics and statistical analysis

The prediction of transmembrane helices of FMDV 2B

protein was carried out using various methods, including

DAS (http://www.sbc.su.se/*miklos/DAS), PHDtm

(http://www.predictprotein.org/), TMHMM (http://www.

cbs.dtu.dk/services/TMHMM), and TMpred (http://www.

ch.embnet.org/software/TMPRED_form.htm).

Estimation of the cutoff value and other assay parame-

ters were performed by receiver operating characteristic

(ROC) curve analysis using XLstat software (Addinsoft,

http://www.xlstat.com/en/home/).

Results

Cloning, expression, purification and immunoreactivity of

MBP-D2B protein

Even after cloning the full-length 2B gene in various

expression vectors (pMAL-c5X, pQE30Xa, pET-45, pET-

28) and transformation of different E. coli host cells, it

was not possible to express the recombinant 2B NSP (data

not shown). Interestingly, the O.D of E. coli culture

medium containing the expression vector (pMAL-2B) was

found to drop significantly after induction (Fig. 1). How-

ever, D2B protein lacking its transmembrane domain

(amino acid residues 114-137) could be cloned and

expressed successfully, mostly in soluble form. SDS-

PAGE analysis revealed a protein band of approximately

60 kDa (Fig. 2), which corresponds to the calculated

molecular weight of MBP-D2B NSP. The immunoreac-

tivity of recombinant MBP-D2B was confirmed by wes-

tern blotting with an MBP-tag-specific monoclonal

antibody (Fig. 3a). Further, D2B protein readily reacted

with 28 dpi bovine serum in western blot, whereas no

visible reactivity was observed with naı̈ve serum (Fig. 3b

and c). The purified recombinant D2B protein also showed

differential immunoreactivity in I-ELISA with serum

samples (n = 5) collected from experimentally infected

calves and serum samples (n = 5) collected from naı̈ve

calves, confirming the suitability of recombinant D2B

protein as an ELISA antigen.

Development of recombinant D2B I-ELISA

For the standardisation of the I-ELISA protocol, the opti-

mum concentration of recombinant antigen and test serum

dilutions were fixed after conducting a checkerboard

titration. The serum dilution was selected to attain an

acceptable signal-to-noise ratio at the minimum concen-

tration of recombinant antigen. The optimal coating anti-

gen concentration and serum dilution were finalized at

0.350 lg per well of the ELISA plate and 1:15,

Table 1 Estimate of the precision of the D2B I-ELISA based on a set

of five serum samples

Serum sample*

1 2 3 4 5

Mean PP 134.63 168.82 72.95 34.8 21.83

Intra-plate CV 2.87 3.91 12.12 6.29 11.11

Inter-plate CV 2.4 5.07 4.71 7.97 8.4

Inter-day CV 2.07 2.06 1.529 11.17 7.727

Global CV 5.34 3.61 4.526 11.78 11.46

* 1 51 dpi serum sample from A IND 40/2000 intradermolingually

infected calf; 2 serum sample collected from a FMDV infected bull at

approximately two months post infection, 3 135 dpi serum sample

from A IND 40/2000 contact infected calf; 4 serum sample from a

calf at 21 dpv with a single dose of FMD monovalent vaccine, 5

serum sample from a naı̈ve calf used in a vaccine potency experiment

CV: coefficient of variation

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

0 30 60 90 120 150 180 210

WT 2B - IPTG

WT 2B + IPTG

Δ2B + IPTG

Minutes post induction

O.D

at 6

00 n

m

Fig. 1 Cytotoxic activity of FMDV 2B protein in E. coli. The optical

density at 600 nm of uninduced (diamonds), full-length 2B (squares)

and D2B-expressing cultures (triangles) was determined at 30-minute

intervals for 3.5 hours. The optical density of E. coli culture medium

containing the full-length 2B protein was found to decrease signif-

icantly after induction

J. K. Biswal et al.

123

respectively (Fig. 4). To ensure the validity of the assay,

the following criteria were chosen:

(i) The corrected mean absorbance of the positive con-

trol should be between 1.0 to 1.4.

(ii) The PP values of the negative and conjugate control

should not exceed 20 % and 10 %, respectively

Determination of the cutoff value, diagnostic

specificity, and sensitivity of recombinant D2B

I-ELISA

Normalised PP values of serum samples (n = 2091), con-

sisting of samples from known naı̈ve (n = 196), uninfected

76 kDa

52 kDa

38 kDa

31 kDa

24 kDa

M 1 2 3

Induced Δ2B protein (~60 kDa)

Fig. 2 SDS-PAGE profile of

expressed D2B protein. Lane M,

protein marker (NEB); lane 1,

uninduced JM109 E. coli lysate;

lane 2, IPTG-induced purified

D2B protein; lane 3, IPTG-

induced purified MBP

76kDa

55kDa

38kDa

31kDa

24kDa

17kDa

M 2 3

76kDa

55kDa

38kDa

31kDa

24kDa

17kDa

12kDa

3 2 1 M M 1 2 3a b c

Fig. 3 Western blot analysis of expressed D2B protein to determine its reactivity with (a) anti-MBP monoclonal antibody, (b) FMD-infected

serum and (c) naı̈ve serum. Lane M, protein marker; lane 1, uninduced E. coli lysate; lane 2, purified MBP; lane 3, purified D2B protein

ELISA for detection of antibodies against FMDV 2B protein

123

vaccinated (n = 516), and infected (n = 1379) animals,

were used for the determination of the cutoff value of D2B

I-ELISA by ROC and TG-ROC analysis (Fig. 5a and b). At

a cutoff value of 50 PP, a diagnostic specificity of 94.6 %

(95 % confidence interval, 93.4–96.6) and a diagnostic

sensitivity of 95.3 % (95 % confidence interval, 90.9–96.9)

were achieved. A detailed analysis of assay parameters at

different cutoff values is shown in Table 2.

Antibody response to 2B protein in vaccinated animals

In an FMD-free dairy cattle herd that had undergone reg-

ular biannual vaccination, an antibody response to the 2B

protein was detected in 15 out of 72 serum samples

(20.83 %) at 28 dpv. However, this antibody response was

of low titre and waned to 5.5 % (4 out of 72) at 180 dpv. In

serum samples collected at random from FMD-CP areas

with no history of an FMD outbreak for the last five years

where animals underwent intensive biannual vaccination,

the 2B antibody seroconversion rate was 6.08 % (19 out of

312 animals). In addition, in serum samples collected from

various vaccine potency experiments at 21 dpv, only 2 out

of the 60 primo-vaccinated animals (3.34 %) were found

positive in D2B I-ELISA.

Postinfection kinetics of 2B antibody response

The postinfection kinetics of the 2B antibody response was

studied using four sets of serum samples collected

sequentially from four bull calves following experimental

infection. By 10 dpi, all four calves had seroconverted

against D2B NSP (Fig. 6). However, the duration of per-

sistence of the 2B antibody response varied widely among

the infected calves. Consistent positivity was observed

until 306 to 900 dpi in the individual calves, followed by a

pattern of intermittent positivity varying from 530 to 1000

dpi (Fig. 6).

Performance of D2B I-ELISA as compared to 3AB3

I-ELISA

The in-house r3AB3 I-ELISA has been used extensively

throughout the country for differentiation of the FMDV-

infected from the vaccinated bovine population for the last

four years [3]. Therefore, it was necessary to compare the

newly developed D2B I-ELISA with that of the r3AB3

I-ELISA. For making this comparison, serum samples were

selected arbitrarily, representing various epidemiological

situations. The highest level of concordance was observed

0

0.5

1

1.5

2

2.5

3

3.5

4

22.4 11.2 5.6 2.8 1.4 0.7 0.35 0.175 0.087

P 1:5

P1:10

P1:15

P1:20

P1:30

Recombinant 2B antigen in µg/well

O.D

. @49

2nm

Optimal Δ2B antigen concentration and serum dilution

Fig. 4 Checkerboard titration to optimise D2B protein concentration

and serum dilution. Twofold dilutions of positive control serum

indicated by different markers are shown at one side of the plot

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0 100 200 300 400 500

Sen

siti

vity

/ S

pec

ific

ity

PP values

Sensitivity Specificity

a b

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

0 0.2 0.4 0.6 0.8 1

Tru

e p

osi

tive

rat

e (S

ensi

tivi

ty)

False negative rate (1 - Specificity)

AUC=0.973

Fig. 5 ROC and TG-ROC analysis for determination of the cutoff

value of the D2B I-ELISA. (a) Sensitivity over 1 and specificity at

different cutoff values. Each point on the ROC plot represents a pair

of sensitivity and specificity values for a particular cutoff value.

(b) Curves of the relative sensitivity and specificity of D2B I-ELISA

produced by TG-ROC analysis

J. K. Biswal et al.

123

for naı̈ve serum samples (98.4 %), while the lowest level of

concordance was observed for serum samples collected at

random (84.48 %). The overall concordance between these

two I-ELISAs was found to be 86.49 % (Table 3).

Discussion

NSP ELISAs have become an essential part of the vacci-

nation-based control and serosurveillance policy in many

FMD-endemic countries. Furthermore, non-endemic

countries are seriously debating in favour of vaccinating

animals in order to obviate the need for stamping out

susceptible in-contact animals under a ‘vaccinate-to-live’

policy [2]. In India, vaccination-based FMD-CP was

launched in 2003-04 with the aim of creating disease-free

zones. In this context, it is imperative to have information

on the level of FMDV exposure in domesticated large

ruminants irrespective of vaccination status. For this pur-

pose, national FMD serosurveillance is being carried out in

India by determining seroconversion against 3AB3 NSP

using an in-house r3AB3 I-ELISA [19]. However, as per

the suggestions made at an international NSP test valida-

tion workshop at Brescia, Italy, there is a need to use more

than one NSP assay to increase the efficiency of detection

[22]. Further, when the epidemiological picture does not

correlate with the screening test results, in particular

because of vaccinal NSP response, it is important to

establish the reliability of the screening test results through

the profiling of multiple NSP antibodies in the serum

samples [20]. Therefore, the availability of a locally pro-

duced efficient diagnostic assay making use of an NSP

Table 2 Diagnostic sensitivity and diagnostic specificity of the recombinant D2B I-ELISA at different cutoff points as determined by ROC

analysis. The cutoff points are given as percentage of positivity. The selected cutoff point (50 PP) is highlighted

Cutoff values Sensitivity 95 % confidence interval Specificity 95 % confidence interval LR? LR-

Lower limit Upper limit Lower limit Upper limit

10.0 1.000 0.993 1.000 0.054 0.031 0.091 1.057 0.000

20.0 0.999 0.991 1.000 0.286 0.233 0.347 1.399 0.005

30.0 0.997 0.989 1.000 0.564 0.501 0.625 2.289 0.005

40.1 0.983 0.970 0.991 0.788 0.732 0.835 4.646 0.021

50.0 0.953 0.934 0.966 0.946 0.909 0.969 17.658 0.050

60.0 0.771 0.739 0.800 0.967 0.934 0.984 23.225 0.237

70.1 0.589 0.553 0.625 0.975 0.945 0.990 23.674 0.421

80.2 0.453 0.416 0.489 0.988 0.962 0.997 36.352 0.554

90.1 0.370 0.336 0.406 0.992 0.968 1.000 44.598 0.635

100.2 0.306 0.273 0.341 0.992 0.968 1.000 36.857 0.700

LR? Likelihood-ratio for a positive test result; LR- Likelihood-ratio for a negative test result

0

20

40

60

80

100

120

140

160

12 28 37 51 64 78 94 106 121 135 149 163 171 191 219 304 389 451 524 555 604 755 816 878 939 998

Type A intradermolingual infection

Type A contact infection

Type Asia 1 intradermolingual infection

Type Asia 1 contact infection

Days post infection

PP

val

ue

Fig. 6 Postinfection kinetics of

the anti-2B antibody response in

experimentally infected calves.

The infection status of each calf

is indicated

ELISA for detection of antibodies against FMDV 2B protein

123

other than 3AB3 could be a suitable alternative to the

expensive kits available commercially.

In that respect, an attempt was initially made to express

the full-length 2B protein in prokaryotic cells. However, it

was not possible to express the full-length 2B NSP. Inter-

estingly, the optical density of the E. coli cells containing

the prokaryotic expression vector pMAL-2B started to

decline following induction with IPTG, which might be

attributed to the cytotoxicity of the heterologous recom-

binant protein to E. coli. Similar observations have been

reported for the expression of the 2B protein of poliovirus

in prokaryotic cells [15], which were attributed to viropo-

rin-mediated permeabilization of the cell membrane [1,

17]. Owing to the cytotoxic nature of the FMDV 2B protein

to E. coli cells, the 2B NSP of FMD virus may be con-

sidered as a putative viroporin. However, further experi-

mental analysis needs to be conducted in order to confirm

the viroporin activity of FMDV 2B. A typical feature

exhibited by viroporins is the presence of at least one

transmembrane sequence. In the present study, a trans-

membrane domain was predicted between amino acid

residues 114 and 137. It was decided to express the 2B

region lacking the transmembrane domain. D2B could be

expressed successfully as a recombinant MBP-tagged

protein of *60 kDa (43 kDa from MBP and 16 kDa from

2B) in soluble form. In a western blot assay, the recom-

binant D2B demonstrated differential reactivity with FMD

convalescent and naı̈ve serum.

While developing and validating the MBP tagged

recombinant D2B I-ELISA, attention was paid to reducing

the nonspecific reactivity of the serum antibodies with the

large MBP tag by pre-adsorbing the serum samples with

the purified MBP protein, as described by others [13, 26].

However, the possibility of residual anti-MBP antibodies

leading to some nonspecific reaction, as evidenced by the

false-positive reactions with naı̈ve and vaccinated unin-

fected serum samples, cannot be ruled out completely. In

serum samples from multiply vaccinated, uninfected ani-

mals, the 2B-antibody response declined from 20.83 % (at

28 dpv) to 5.5 % (at 180 dpv). Further, 6.08 % false pos-

itivity was observed in serum samples collected from

FMDCP areas where there had been no reported outbreaks

or cases for five years. This response could be explained

either by nonspecific binding or by the residual anti-NSP

response from unreported past infections.

At the fixed cutoff value of 50 PP, a sensitivity of

95.3 % and specificity of 94.3 % were determined for the

D2B I-ELISA. Also, preliminary precision studies based on

PP values from intra-plate, inter-plate and inter-day repli-

cates showed the CV values to be within the acceptable

limits, in support of the repeatability of the optimised assay

(Table 1). The diagnostic sensitivity and diagnostic speci-

ficity of indirect r3AB3 I-ELISA for bovines were found to

be 96 % and 96.4 %, respectively [19]. As the performance

of the recently developed recombinant D2B I-ELISA is

comparable to that of the r3AB3 I-ELISA, the D2B assay

has the potential to be used as either a screening or con-

firmatory assay in conjunction with the r3AB3 I-ELISA.

Further, it is also preferable to have the second test, which

uses a different NSP, than the first test to confirm the

presence of infection. This was shown in a study [23] in

which, to confirm the FMD infection in sheep, a 2B-pep-

tide-based indirect ELISA was used to confirm the result of

the PrioCHECK-NSP assay. During the current analysis, a

good overall concordance was observed between the 3AB3

and D2B I-ELISAs. Considering that there are no assays

with absolute sensitivity and specificity, no surveillance

plan can provide an absolute guarantee of freedom from

infection. Therefore, serosurveillance should be seen as a

part of a package of risk-mitigation measures that will

include movement restriction, epidemiological tracing, and

clinical surveillance [22].

The earliest possible detection of FMD post-exposure by

anti-NSP antibody assay is of paramount importance for

adopting control measures. However, there has been vari-

ation in the time at which early detection of antibodies

against various NSPs is possible [25]. Although the precise

time of onset of 2B antibodies could not be deduced in this

study, seroconversion to 2B protein was evident at 10 dpi

in the serum samples collected from four experimentally

infected calves. While studying the post-infection kinetics

of 2B antibodies in serum samples collected from four

experimentally infected calves, a variation in the persis-

tence of 2B antibodies was observed. This variation in

antibody response could be attributed to a difference in the

route of infection or load of virus challenge. Although the

Table 3 Comparison of the performance of 2B I-ELISA with that of r3AB3 I-ELISA

Sera Total number tested r2BL ELISA 3AB3 ELISA (no. concordance) Concordance rate

Positive Negative Positive Negative

Unvaccinated naı̈ve samples 130 2 128 0 130 (128) 98.4 % (128/130)

Vaccinated uninfected samples 240 18 222 15 (12) 225 (213) 93.75 % (225/240)

Samples from field outbreak 500 465 35 482 (440) 18 (10) 90.0 % (450/500)

Random samples 2500 730 1770 605 (515) 1895 (1597) 84.48 % (2112/2500)

J. K. Biswal et al.

123

relationship between the persistence of 2B antibody and

identification of known FMD carrier animals was not

determined in the current study, from earlier findings of

others [10, 21] it can be proposed that recombinant-D2B-

NSP-based I-ELISA could be used for the identification of

persistently infected animals.

Testing of random bovine serum samples collected from

different parts of the country in D2B I-ELISA suggested an

overall seroconversion rate of 29.2 %. The apparent prev-

alence of 2B NSP antibody estimated in the current work is

similar to that against 3AB3 NSP (26.41 %), which was

determined under the national FMD serosurveillance pro-

gramme [3]. As the amino acid sequence of the 2B NSP

region is known to be highly conserved among the different

serotypes of FMDV [6], the recombinant 2B protein assay

is expected to detect infection-specific antibodies against

all seven serotypes of FMDV. At the same time, it should

be emphasised that there is a significant difference between

the 2B protein sequences of members of various genera of

the family Picornaviridae [18]. Therefore, it could be

presumed that there may be less chance of cross-reaction of

FMDV 2B protein with antibodies against other related

picornaviruses that cause clinically indistinguishable

vesicular diseases in cattle. Although analytical specificity

is an important parameter for any newly developed assay

system, it could not be determined for D2B I-ELISA due to

the unavailability of known serum samples derived from

other clinically similar diseases because most of these

diseases are exotic to India at present.

In conclusion, an I-ELISA based on recombinant D2B

NSP, which has been developed for the first time, could be

used for the serological detection of FMDV circulation. A

situation of controlled FMD incidence due to extensive

vaccination is expected in India after a few years of suc-

cessful FMD-CP. In that case, the use of more than one NSP

ELISA would be helpful in increasing the efficiency of

detection of infection. It would also be useful to evaluate the

D2B NSP I-ELISA using serum samples from FMD-vacci-

nated and/or infected small ruminants and pigs in the future.

Acknowledgement This work was supported by Indian Council of

Agricultural Research under the project IXX08487. The assistance of

Mr. N. S. Singh in sorting the serum samples is appreciated.

References

1. Agirre A, Barco A, Carrasco L, Nieva JL (2002) Viroporin-

mediated membrane permeabilization. Pore formation by non-

structural poliovirus 2B protein. J Biol Chem 277:40434–40441

2. Anonymous (2003) Council Directive 2003/85/EC on Commu-

nity measures for the control of foot-and-mouth disease repealing

Directive 85/511/EEC and Decisions 89/531/EEC and 96/665/

EEC and amending Directive 92/46/EEC. Off J Eur Union L

306:46

3. Anonymous (2012) PD-FMD annual report, 2011–12. In: Project

Directorate on foot and mouth disease, Mukteswar

4. Berger HG, Straub OC, Ahl R, Tesar M, Marquardt O (1990)

Identification of foot-and-mouth disease virus replication in

vaccinated cattle by antibodies to non-structural virus proteins.

Vaccine 8:213–216

5. Brocchi E, Bergmann IE, Dekker A, Paton DJ, Sammin DJ,

Greiner M, Grazioli S, De Simone F, Yadin H, Haas B, Bulut N,

Malirat V, Neitzert E, Goris N, Parida S, Sorensen K, De Clercq

K (2006) Comparative evaluation of six ELISAs for the detection

of antibodies to the non-structural proteins of foot-and-mouth

disease virus. Vaccine 24:6966–6979

6. Carrillo C, Tulman ER, Delhon G, Lu Z, Carreno A, Vagnozzi A,

Kutish GF, Rock DL (2005) Comparative genomics of foot-and-

mouth disease virus. J Virol 79:6487–6504

7. Clavijo A, Wright P, Kitching P (2004) Developments in diag-

nostic techniques for differentiating infection from vaccination in

foot-and-mouth disease. Vet J 167:9–22

8. Hema M, Nagendrakumar SB, Yamini R, Chandran D, Rajendra

L, Thiagarajan D, Parida S, Paton DJ, Srinivasan VA (2007)

Chimeric tymovirus-like particles displaying foot-and-mouth

disease virus non-structural protein epitopes and its use for

detection of FMDV-NSP antibodies. Vaccine 25:4784–4794

9. Hohlich BJ, Wiesmuller KH, Schlapp T, Haas B, Pfaff E, Saal-

muller A (2003) Identification of foot-and-mouth disease virus-

specific linear B-cell epitopes to differentiate between infected

and vaccinated cattle. J Virol 77:8633–8639

10. Inoue T, Parida S, Paton DJ, Linchongsubongkoch W, Mackay D,

Oh Y, Aunpomma D, Gubbins S, Saeki T (2006) Development

and evaluation of an indirect enzyme-linked immunosorbent

assay for detection of foot-and-mouth disease virus nonstructural

protein antibody using a chemically synthesized 2B peptide as

antigen. J Vet Diagn Investig Off Publ Am Assoc Vet Lab Diagn

Inc 18:545–552

11. Jaworski JP, Compaired D, Trotta M, Perez M, Trono K, Fon-

devila N (2011) Validation of an r3AB1-FMDV-NSP ELISA to

distinguish between cattle infected and vaccinated with foot-and-

mouth disease virus. J Virol Methods 178:191–200

12. Kitching RP (2002) Identification of foot and mouth disease virus

carrier and subclinically infected animals and differentiation from

vaccinated animals. Revue Scientifique et Technique 21:531–538

13. Knowles D, Torioni de Echaide S, Palmer G, McGuire T, Stiller

D, McElwain T (1996) Antibody against an anaplasma marginale

MSP5 epitope common to tick and erythrocyte stages identifies

persistently infected cattle. J Clin Microbiol 34:2225–2230

14. Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:680–685

15. Lama J, Carrasco L (1992) Expression of poliovirus nonstructural

proteins in Escherichia coli cells. Modification of membrane

permeability induced by 2B and 3A. J Biol Chem 267:

15932–15937

16. Ma LN, Zhang J, Chen HT, Zhou JH, Ding YZ, Liu YS (2011)

An overview on ELISA techniques for FMD. Virol J 8:419

17. Madan V, Sanchez-Martinez S, Vedovato N, Rispoli G, Carrasco

L, Nieva JL (2007) Plasma membrane-porating domain in

poliovirus 2B protein. A short peptide mimics viroporin activity.

J Mol Biol 374:951–964

18. Moffat K, Howell G, Knox C, Belsham GJ, Monaghan P, Ryan

MD, Wileman T (2005) Effects of foot-and-mouth disease virus

nonstructural proteins on the structure and function of the early

secretory pathway: 2BC but not 3A blocks endoplasmic reticu-

lum-to-Golgi transport. J Virol 79:4382–4395

19. Mohapatra JK, Pandey LK, Sanyal A, Pattnaik B (2011)

Recombinant non-structural polyprotein 3AB-based serodiag-

nostic strategy for FMD surveillance in bovines irrespective of

vaccination. J Virol Methods 177:184–192

ELISA for detection of antibodies against FMDV 2B protein

123

20. OIE (2004) Foot and mouth disease. In: OIE Standards Com-

mission (ed). Manual of standards for diagnostic tests and vac-

cines, Office International des Epizooties (chapter 2.1.1), 5th edn.

Paris, France

21. Parida S, Cox SJ, Reid SM, Hamblin P, Barnett PV, Inoue T,

Anderson J, Paton DJ (2005) The application of new techniques

to the improved detection of persistently infected cattle after

vaccination and contact exposure to foot-and-mouth disease.

Vaccine 23:5186–5195

22. Paton DJ, de Clercq K, Greiner M, Dekker A, Brocchi E, Berg-

mann I, Sammin DJ, Gubbins S, Parida S (2006) Application of

non-structural protein antibody tests in substantiating freedom

from foot-and-mouth disease virus infection after emergency

vaccination of cattle. Vaccine 24:6503–6512

23. Paton DJ, Ferris NP, Hutchings GH, Li Y, Swabey K, Keel P,

Hamblin P, King DP, Reid SM, Ebert K, Parida S, Savva S,

Georgiou K, Kakoyiannis C (2009) Investigations into the cause

of foot-and-mouth disease virus seropositive small ruminants in

Cyprus during 2007. Transboundary Emerg Dis 56:321–328

24. Perkins J, Clavijo A, Hindson BJ, Lenhoff RJ, McBride MT

(2006) Multiplexed detection of antibodies to nonstructural pro-

teins of foot-and-mouth disease virus. Anal Chem 78:5462–5468

25. Sorensen KJ, Madsen KG, Madsen ES, Salt JS, Nqindi J, Mackay

DK (1998) Differentiation of infection from vaccination in foot-

and-mouth disease by the detection of antibodies to the non-

structural proteins 3D, 3AB and 3ABC in ELISA using antigens

expressed in baculovirus. Arch Virol 143:1461–1476

26. Torioni de Echaide S, Knowles DP, McGuire TC, Palmer GH,

Suarez CE, McElwain TF (1998) Detection of cattle naturally

infected with Anaplasma marginale in a region of endemicity by

nested PCR and a competitive enzyme-linked immunosorbent

assay using recombinant major surface protein 5. J Clin Micro-

biol 36:777–782

27. Urban A, Neukirchen S, Jaeger KE (1997) A rapid and efficient

method for site-directed mutagenesis using one-step overlap

extension PCR. Nucl Acids Res 25:2227–2228

J. K. Biswal et al.

123