Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Research Paper

Association of non-tuberculous mycobacteria with Mycobacterium leprae inenvironment of leprosy endemic regions in India

Ravindra P. Turankara,⁎, Vikram Singha, Hariom Guptaa, Vinay Kumar Pathaka, Madhvi Ahujaa,Itu Singha, Mallika Lavaniaa, Amit K. Dindab, Utpal Senguptaa

a The Leprosy Mission Trust India, Stanley Browne Laboratory, TLM community Hospital Nand Nagari, New Delhi 110093, IndiabDepartment of Pathology, Institute/University: All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110 029, India

A R T I C L E I N F O

Keywords:Mycobacterial species16S rRNA gene targetSequencingFITCPGL-1M. leprae

A B S T R A C T

Non-tuberculous mycobacteria (NTM) are environmental mycobacteria found ubiquitously in nature. The pre-sent study was conducted to find out the presence of various species of NTM in leprosy endemic region alongwith Mycobacterium (M) leprae. Water and wet soil samples from the periphery of ponds used by the communitywere collected from districts of Purulia of West Bengal and Champa of Chhattisgarh, India. Samples were pro-cessed and decontaminated followed by culturing on Lowenstein Jensen (LJ) media. Polymerase chain reaction(PCR) was performed using 16S rRNA gene target of mycobacteria and species was confirmed by sequencingmethod. Indirect immune-fluorescent staining of M. leprae from soil was performed using M. leprae-PGL-1 rabbitpolyclonal antibody. The phylogenetic tree was constructed by using MEGA-X software. From 380 soil samples86 NTM were isolated, out of which 34(40%) isolates were rapid growing mycobacteria (RGM) and 52(60%)isolates were slow growing mycobacteria (SGM). Seventy-seven NTM isolates were obtained from 250 watersamples, out of which 35(45%) were RGM and 42(55%) were SGM. Amongst all the RGM, we isolated M.porcinum, M. psychrotolerans, M. alsenase, M. arabiense and M. asiaticum from Indian environmental samples. M.fortuitum was the most commonly isolated species of all RGM. Out of all SGM, M. holsaticum, M. yongonense, M.seoulense, M. szulgai, M. europaeum, M. simiae and M. chimaera were isolated for the first time from Indianenvironment. M. intracellulare was the commonest of all isolated SGM. Presence of M. leprae was confirmed byindirect immunofluorescent microcopy and PCR method from the same environmental samples. Phylogenetictree was showing a close association between these NTMs and M. leprae in these samples. Several NTM species ofpathogenic and nonpathogenic in nature along with M. leprae were isolated from soil and pond water samplesfrom leprosy endemic regions and these might be playing a role in causing disease and maintaining leprosyendemicity in India.

1. Introduction

Nontuberculous mycobacteria (NTM), are ubiquitous environmentalopportunistic pathogens found in soil and water (Lavania et al., 2014;Parashar et al., 2004; Brook et al., 1984; Wang et al., 2004). Myco-bacterium (M.) species are acid fast bacilli (AFB) and aerobic in natureand include more than 196 different mycobacterial species (http://www.bacterio.net/mycobacterium.html, accessed on 21th April 2018;Euzbey, 1997).

Several species of environmental mycobacterial species are known

to be important human pathogens and from the recent past reportssuggest that there is an increasing trend in the incidence of NTM in-fections in human (Moore et al., 2010; Shojaei et al., 2011; Donohueet al., 2015). NTMs have been classified according to their growth rateand pigment formation (Runyon, 1959). Recently, major four groups ofhuman pathogens were recognized in mycobacterium genus such as 1.M. tuberculosis complex, 2. M. leprae, 3. slow growing mycobacteria(SGM) and rapid growing mycobacteria (RGM) (Porvaznik et al., 2017).SGM included M. avium complex and are known to cause disseminateddisease in immunodeficient subjects (Reichenbach et al., 2001;

https://doi.org/10.1016/j.meegid.2018.11.010Received 29 May 2018; Received in revised form 31 August 2018; Accepted 11 November 2018

Abbreviations: NTM, non-tuberculous mycobacteria; PCR, polymerase chain reaction; RGM, rapid growing mycobacteria; SGM, slow growing mycobacteria; PGL-1,phenol-glycolipid-1 antigen; AFB, acid fast bacilli; LJ, Lowenstein Jensen; ZN, Ziehl-Neelsen staining; FITC, fluorescein isothiocyanate; DNA, deoxyribonucleic acid;PBS, phosphate buffer saline; CTAB, cetyl trimethyl ammonium bromide; SDS, sodium dodecyl sulfate; NaOH, sodium hydroxide; Tris-EDTA, (T.E.) buffer; EDTA,ethylene diamine tetra acetic acid; NCBI, the National Center for Biotechnology Information

⁎ Corresponding author at: Stanley Browne Laboratory, TLM community Hospital Nand Nagari, Delhi 110093, India.E-mail addresses: ravindraturankar2012@gmail.com, turankarr83@gmail.com (R.P. Turankar).

Infection, Genetics and Evolution 72 (2019) 191–198

Available online 13 November 20181567-1348/ © 2018 Elsevier B.V. All rights reserved.

T

Newport et al., 1996). RGM included species from M. abscessus complexwhich are known to cause chronic lung infections and skin and softtissue infections. NTMs were isolated and identified from different partsof India such as Chennai (Paramasivan et al., 1985; Kamala et al.,1994), Maharashtra (Hardas and Jayaraman, 1984), Gujarat (Trivediet al., 1986), Bangalore (Chauhan, 1993), Amritsar (Aggarwal et al.,1993), Agra (Parashar et al., 2009), Sevagram (Narang et al., 2009), butaccurate picture of their geographical distribution is still not known.NTM caused diseases are not considered as serious diseases in mostcountries because of lacking evidence of human-to-human transmissionand therefore, they are not considered as a public health problem.However, the organisms are ubiquitous in the environment, and sub-stantial evidence shows that the most common pulmonary, skin andsubcutaneous infections and lymphadenitis can be caused by M. in-tracllulare (Falkinham et al., 2001), M. fortuitum (Petrini, 2006) and M.scrofulaceum (Wolinsky, 1995) respectively isolated from lining sub-urban water pipes.

M. leprae is a slow growing obligate intracellular pathogen, thecausative agent of leprosy disease. It is an uncultivable mycobacteriumbut it can grow in mouse foot pad and armadillo (Walsh et al., 1975,1981). Recently, several reports have shown isolation of M. leprae16SrRNA from soil and water collected from the habitation of endemicregions of leprosy (Turankar et al., 2012, 2016; Lavania et al., 2008;Mohanty et al., 2016) indicating its viability and led us to find out therole played by the environmental M. leprae in transmission of the dis-ease.

The sugar epitopes of phenolic glycolipid eI (PGLeI), located on theoutermost surface of M. leprae act as a specific antigen and represent akey molecule in penetration to nerve (Harboe et al., 2005) and recentlyPGL-1 has been shown to induce Schwann cells to liberate nitric oxideleading to demyelation and nerve damage (Madigan et al., 2017). Incontrast, the lipid core, called phenolphthiocerol dimycocerosates, isconserved like other mycobacterial species and linked to differentspecies-specific saccharide groups (Spencer and Brennan, 2011; Dafféand Laneelle, 1988).

Modern molecular biology methods are very useful for the identi-fication of NTMs using 16S rRNA gene target by PCR sequencing,providing a faster and better ability to their accurate identification. Itcontinues to serve as an important tool as an alternative to phenotypicidentification methods. The direct sequencing of amplified deoxyr-ibonucleic acid (DNA) from the 16S rRNA gene of Mycobacterium spe-cies is well described (Turenne et al., 2001).

Considering the above our attempts have been made to isolate theNTM species from the environment of leprosy endemic regions.Environmental M. leprae was detected by molecular method and im-munofluorescent staining using PGL-1 antibody and PCR specificprimer 16S rRNA. Isolation of NTMs from pond water and soil by in vitroculture on Lowenstein Jensen (LJ) medium and further confirmed byPCR containing specific primers of 16S rRNA gene targets followed byfinal confirmation by sequencing method. The neighbour-joining phy-logenetic tree was constructed using DNA sequencing of M. leprae anddifferent mycobacterial species by MEGA-X software.

2. Materials

2.1. Site of samples collection

Prevalence rate (PR) of leprosy at Purulia was recorded as 3.55/10,000 in the year 2010 and that of Champa was recorded as 1.54/10,000 population. (http://www.districthealthstat.com and http://rltrird.cg.gov.in). We selected these sites because leprosy patients andtheir contacts are sharing the same pond and environment for theirdaily routine activities of washing and bathing.

2.2. Sample collection

Three hundred and eighty soils and 250 pond water samples werecollected from 100 leprosy patients' area. Ground soil was collectedfrom the banks of bathing area of ponds by digging 2–5-in.-deep withthe help of “hand trowel”. Water samples (50ml) from the periphery ofthe pond of bathing area were collected in clean plastic containers andall samples were labeled with site code and the village name. Thecollected samples were transported to the laboratory at room tem-perature (within 2 days) and stored at 4–8 °C till further use.

3. Methods

3.1. Ziehl-Neelsen staining of environmental samples

Five grams of soil was dissolved in 50ml distilled water and 50mlwater samples were centrifuged at 400×g for 5min. The supernatantswere collected in 50ml sterile tubes and centrifuged again at 8000×gfor 15min. Pellets were suspended in 0.1ml of distilled water. Smearswere prepared and subjected to Ziehl-Neelsen (ZN) staining for AFBfrom all samples and were observed under binocular microscope(Olympus, Japan).

3.2. Staining method for fluorescence microscopy

Smears from environmental mycobacteria were subjected to fluor-escent staining and were observed under fluorescent microscope(Olympus DP72). Smears were made on glass slides, kept at 37 °C for30min for drying and fixing. The slides containing the fixed myco-bacteria were washed twice with phosphate buffer saline (PBS).Primary rabbit polyclonal antibody against PGL-I (1:100) was added onsmears and incubated at 37 °C for 1 h in dark humidified chamber fol-lowed by washing smears two times with PBS. FITC conjugated goatanti-rabbit IgG antibody (Catalog No. F0382, Sigma-Aldrich, USA)(1:10000) was added on smears and incubated at 37 °C for 1 h in darkhumidified chamber followed by rinsing smears two times with PBS.The stained slides were observed immediately under oil immersion(X1000) in a fluorescent microscope (Olympus DP72 Japan).

3.3. Growth of mycobacteria from environmental samples

Environmental samples were processed and decontaminated as de-scribed by the earlier published protocol (Parashar et al., 2004). Briefly,environmental samples were treated with 3% sodium dodecyl sulfate(SDS), 4% sodium hydroxide (NaOH) and 2% cetrimide. Soil and watersamples were centrifuged for 8000×g for 15min at 4 °C. Pellets wereresuspended in 20ml of treatment solution (3% SDS+4% NaOH) anddivided into two parts: A and B. Part A was incubated for 15min and Bwas incubated for 30min at room temperature to obtain the growth ofrapid and slow growers, respectively. Both the suspensions were cen-trifuged for 15min after incubation at 8000×g. Pellets were treatedwith 2% cetrimide and incubated for 5 and 15min for rapid and slowgrowers, respectively. After incubation sediments were washed twicewith sterile water. 100 μl of decontaminated suspension from each wasinoculated on LJ medium. Slants were incubated at 37 °C for 3 to4 weeks. Primary colonies were subcultured on LJ medium again. Eachsample was processed two times. Identification of growth was de-termined by growth rate and morphology of colonies. AFB staining wasperformed for phenotypic confirmation of mycobacteria.

3.4. Genomic DNA isolation

DNA was isolated from the mycobacterial growth in culture as de-scribed earlier (Somerville et al., 2005) with some modification.Growth from culture was collected in tube containing 400 μl 1× Tris-EDTA (T.E.) buffer, pH 8.0, and was heated in water bath for 15min at

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

192

95 °C, followed by exposure of the sample to 80 °C for 10min. Lysozymewas added to each tube (final concentration, 1mg/ml), followed byincubation at 37 °C for 2 h. SDS (10%) (final concentration, 1.1%) andproteinase k (final concentration, 1mg/ml) were added, and the tubewas vortexed gently followed by incubation at 60 °C for 60min. Amixture of cetyltrimethylammoniumammonium bromide (CTAB) and5M NaCl (final concentration, 0.6 M) was added to each tube. The tubewas again vortexed until the suspension turned milky and was in-cubated at 60 °C for 20min. Chloroform-isoamyl alcohol (24:1) (645 μl)was added to each tube followed by vortexing and centrifugation in amicro centrifuge at 10,000 rpm for 10min at room temperature.

Aqueous phase was transferred into another clean centrifuge tubeand 600 μl of isopropanol was added for precipitation of DNA. Sampleswere incubated at -20 °C for overnight. Sample was centrifuged at10,000 rpm for 15min and supernatant was discarded. The pellet waswashed with 70% ethanol by centrifugation at 10,000 rpm for 15min.Supernatant was discarded and pellet was kept for drying at 37 °C for2–3 h. Pellet was finally suspended in 100 μl distilled water and storedat -20 °C for further downstream analysis.

3.5. PCR amplification of mycobacteria using RLEP and 16S rRNA gene

PCR amplification was performed using Veriti Thermal cycler(Applied Biosystems, Singapore). A total of 25 μl of reaction volumewas prepared containing 2 μl of template DNA and primers at finalconcentration of 0.5 μM (forward and reverse) and 1× Taq PCR masterMix (Qiagen). Mycobacterial specific universal primers were used (P1-AGAGTTTGATCCTGGCTCAG; P3 – CCTGCACCGCAAAAAGCTTTCC)for mycobacterial species and (16S rRNA-P2-TCGAACGGAAAGGTCTCTAAAAAATC; P3-CCTGCACCGCAAAAAGCTTTCC), repetitive element(RLEP-PS1TGCATGTCATGGCCTTGAGG PS2 CACCGATACCAGCGGAAGAA) for M. leprae gene primer as described. (Jadhav et al., 2005;Turankar et al., 2015). The amplification was carried out in a thermalcycler at 95 °C for 15min for initial denaturation and followed by37 cycles of denaturation (94 °C for 2min), annealing (58 °C for 2min)and extension (72 °C for 2min) with a final extension at 72 °C for10min. PCR product (227 bp for mycobacteria and 129 for M. leprae)containing amplified fragment of the target region and was electro-phoresed in a 2% agarose gel (Sigma) using Tris-Borate-ethylenedia-minetetraacetic acid (EDTA) buffer at 100 V' constant voltage.

3.6. Data analysis

PCR amplicons were outsourced for sequencing from EurofinsGenomics India Pvt. Ltd. The Finch TV software Version 1.4.0 was usedfor chromatogram analysis which was developed by Geospiza researchteam. The chromatograms generated upon sequencing were subjectedto BLAST analysis in NCBI GenBank and online 16S rRNA Based databases. A stringent similarity index of 99–100% was kept with the typestrain in GenBank.

4. Results

4.1. Ziehl-Neelsen and fluorescent staining method

AFB were observed in all soil and water samples (Fig.1a). ZNstaining was also performed from the growth in culture to confirmpresence of mycobacterial species in these samples. Indirect fluorescentstaining of mycobacterial smear from soil and water samples showedpresence of fluorescent stained M. leprae (Fig. 1b).

4.2. Mycobacterial growth on Lowenstein Jensen slant from environmentalsamples

4.2.1. Nontuberculous mycobacteria isolate from PuruliaTwo hundred thirty soils and 160 water samples were processed for

growth on LJ media, out of which 55(24%) isolates from soil and 51(32%) isolates from water were obtained. Out of these 106 isolates23(42%) RGM were from soil and 25(49%) from water. With regard toSGM 32(58%) were from soil and 26(51%) from water samples.Interestingly, slow grower isolates were obtained more in number fromsoil than that of water samples but rapid grower isolates were morefrom water than soil samples (Table 1).

4.2.2. Nontuberculous mycobacteria isolate from ChampaOne hundred and fifty soils and 90 water samples were processed

for growth on LJ media, out of which 31(21%) isolates from soil and 26(29%) isolates from water were obtained. From soil and water samples11(35%) and 10(39%) RGM were respectively isolated. On the otherhand, 20(65%) and 16(61%) SGM were isolated from soil and waterrespectively. Here also slow growers were isolated more from soilcompared to that of water and rapid grower's isolates were more fromwater than that of soil (Table 1).

4.3. PCR amplification of mycobacteria and sequencing

A total 106 isolates were obtained from environmental samples.PCR amplification was performed using universal primer 16S rRNAgene of mycobacteria (Fig.2). Amplicons containing NTMs' specific PCRproducts were sent to Eurofins Genomics India Pvt. Ltd. for commercialsequencing. Sequences were blasted on the National Center for Bio-technology Information (NCBI) nucleotide Blast http://blast.ncbi.nlm.nih.gov/Blast.cgi to confirm the sequences of the mycobacterialstrains with the ones in the databases (Fig.3).

Out of 106 isolates from Purulia, 23(42%) were RGM and includedM. porcinum 1(4%) M. psychrotolerans 1(4%) first time isolated from soilof Indian samples followed by isolation ofM. vaccae 2(9%)M. smegmatis3(13%), M. gilvum 5(22%). M. fortuitum was most common speciesisolated from both soil 11(48%) and water 15(60%). Likewise, 25(49%)RGM species like M. smegmatis 6(24%), M. gilvum 4(16%) were isolatedfrom water samples.

On the other hand, 32(58%) SGM isolated from soil samples. Thespecies belonged to M. holsaticum 1(3%), M. yongonense 2(6%) whichwere first time isolated from soil samples of Purulia district of Indiafollowed by isolation of M. scrofulaceum 5(16%), M. parascrofulaceum4(12%), M. szulgai 2(6%), M. europaeum 3(9%), M. simiae 3(9%). M.intracellulare species was commonest SGM isolated from both soil10(31%) and water 6(23%) samples. Other species of SGM 26(51%)were also noted to be present in water samples such as M. scrofulaceum5(19%), M. parascrofulaceum 5(19%), M. szulgai 2(7%), M. europaeum4(15%), M. simiae 1(4`%) and M. spp. 3(11%) (Table 2).

Out of 57 isolates from Champa 11(35%) belonged to RGM whichincluded M. asiaticum 1(9%), M. arabiense 1(9%) and M. alsense 1(9%),first time isolated from soil samples of India in addition to isolation ofM. smegmatis 1(9%), M. gilvum 1(9%). M. fortuitum was most commonspecies isolated from both soil 6(45%) and water 6(60%) samples.Other species of RGM 10(39%) which were isolated from water sam-ples, such as M. smegmatis 2(20%) and M. gilvum 2(20%).

Similarly, 20(65%) SGM were isolated from soil samples. For thefirst timeM. chimaera 2(10%), M. yongonense 1(5%), M.seoulense 1(5%),M. szulgai 1(5%), M. europaeum 2(10%), have been isolated from soilsamples in India. In addition, M. scrofulaceum 2 (10%), M. para-scrofulaceum 2(10%), M. spp 3 (9%), were also isolated. M. intracellularewas most commonly isolated SGM from both soil 4(20%) and water5(31%) samples. In water samples, 26(51%) SGM noted as NTM specieswere M. scrofulaceum 2(12%), M. parascrofulaceum 3(19%), M. chimaera2(12%), M. spp. 4(25%) (Table 2).

4.4. PCR amplification of Mycobacterium leprae DNA

M. leprae DNA PCR was performed using RLEP and 16S rRNA geneand visualized on 2% agarose gel (Fig.4). We could detect 118 (31%) of

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

193

M. leprae DNA from soil samples and 48(19%) from water samples.Further, we could detect viable M. leprae 16S rRNA, 53 (14%) from soiland 30(12%) from water samples.

4.5. The neighbour-joining phylogenetic tree

The phylogenetic tree was constructed with different mycobacterialfasta sequences and distance percent identity matrix was calculated byMEGA-X software. It was noted that M. leprae was in close associationwith M. simiae and M. smegmatis (Fig.5).

5. Discussion

Leprosy is endemic in certain pockets of India and the countryhouses 63% of world population (WHO, 2017). PR of leprosy at Puruliaand Champa are much higher than the elimination figure of less than 1per 10,000 and were recorded as 3.55/10,000 and 1.54/10,000 popu-lation respectively. (http://www.districthealthstat.com and http://rltrird.cg.gov.in). In our laboratory, we observed presence of viableM. leprae (RT-PCR) using 16S rRNA gene target from soil and watersamples from these areas which were also reported earlier by our group(Turankar et al., 2012). Healthy individuals and leprosy patients inthese villages are using pond water for their routine bathing andwashing purposes and hence their environmental conditions or sanita-tion of the ponds are in a very poor state. In recent decades, NTM arealso increasingly being recognized as pathogenic to human. Althoughthe exact mechanism of pathogenesis of NTM in human infection is notknown but these are causing localized or disseminated disease de-pending on their local predisposition and degree of immune deficit inthe host (Pinner, 1935; Wolinsky, 1979; Wallace Jr. et al., 1990).Paramasivan et al. (1985) described in his study from Chennai that M.avium intracellulare (MAI) to be the most frequently isolated species(22.6% of all NTM) followed by M. terrae (12.5%) and M. scrofulaceum(10.5%). Later, Kamala et al. (1994) demonstrated that MAI and M.scrofulaceum in water and dust and later isolated this mycobacteriumfrom the sputum samples of individuals in that area. Further, Parasharet al. (2004) have demonstrated the presence of M. fortuitum, M. avium,M. kansasii, M. terrae, and M. chelonae in water and M. avium, M. terraeand M. chelonae in soil samples of Agra region of Uttar Pradesh, India.

The present study was conducted in two leprosy endemic districts of

Fig. 1. a- Ziehl-Neelsen staining of Mycobacterium species from environmental samples (Pink colour rod shaped mycobacteria) (X1000). b- Fluorescent staining ofMycobacterium leprae from environmental samples (X1000). (For interpretation of the references to colour in this figure legend, the reader is referred to the webversion of this article.)

Table 1Non-tuberculous mycobacteria isolated from environmental samples fromPurulia and Champa.

Sample No. ofsamples

No. ofisolatesobtained

Rapid growingmycobacteria(RGM) (%)

Slow growingmycobacteria(SGM) (%)

Purulia district of West BengalSoil 230 55 (24%) 23 (42%) 32 (58%)Water 160 51 (32%) 25 (49%) 26 (51%)

Champa district of ChhattisgarhSoil 150 31 (21%) 11 (35%) 20 (65%)Water 90 26 (29%) 10 (39%) 16 (61%)

Fig. 2. PCR Amplification of mycobacterial species using 16S rRNA gene target.

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

194

India and identified the presence of a variety of NTM species along withM. leprae from the same source of soil and water. We detected alsopresence of M. leprae by indirect immunofluorescent staining usingFITC conjugated anti-rabbit IgG and rabbit polyclonal anti-PGL-1

antibody in these samples. (Fig.1b). and by RLEP gene PCR of M. leprae.It was observed that 31% water and 19% soil samples were positive forM. leprae DNA. Presence of viable M. leprae was observed in soil andwater samples of endemic region which was also reported earlier by our

Fig. 3. Mycobacteria species confirmation by sequencing Method.

Table 2Comparison of Non-tuberculous mycobacteria isolated from Purulia and Champa.

Runyon classification of NTM Purulia region Soil (32) Water (26) Champa region Soil (20) Water (16)

Type I M.simiae 3 (9%) 1 (4%) M. simiae 1 (5%)Photochromogen (slow growers) M. holsaticum 1 (3%)

Type II M. europaeum 3 (9%) 4 (15%) M. parascrofulaceum 2 (10%) 3 (19%)Scotochromogen (slow growers) M. scrofulaceum 5 (16%) 5 (19%) M. szulgai 1 (5%)

M. parascrofulaceum 4 (12%) 5 (19%) M. europaeum 2 (10%)M. szulgai 2 (6%) 2 (7%) M. scrofulaceum 2 (10%) 2 (12%)M. spp. 2 (6%) 3 (11%) M. spp. 3 (9%) 4 (25%)

M. seoulense, 1 (5%)M. chimaera 2 (10%) 2 (12%)

2%

Type III M. yongonense 2 (6%) M. intracellulare 4 (20%) 5 (31%)Non-chromogen (slow growers) M. intracellulare 10 (31%) 6 (23%) M. yongonense 1 (5%)

Rapid growers −23 −25 −11 −10Type IV M. fortuitum 11 (48%) 15 (60%) M. fortuitum 6 (45%) 6 (60%)

Rapid growers M. smegmatis 3 (13%) 6 (24%) M. smegmatis 1 (9%) 2 (20%)M. gilvum 5 (22%) 4 (16%) M. gilvum 1 (9%) 2 (20%)M. porcinum 1 (4%) M. asiaticum, 1 (9%)M. psychrotolerans 1 (4%) M. arabiense, 1 (9%)M. vaccae 2 (9%) M. alsense 1 (9%)

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

195

group and others (Lavania et al., 2008; Turankar et al., 2012, 2016;Mohanty et al., 2016; Arraes et al., 2017). Similarly, in a recent study,(Baliga et al., 2018) has shown presence of M. tuberculosis complex andNTM in clinical samples by fluorescence in situ hybridization with DNAprobes. Further, Forbes et al. (2018) also emphasized on the practiceguidelines for identification of mycobacteria using culture and mole-cular methods. We earlier reported presence of RGM, M. gilvum inbathing places from Purulia region of West Bengal (Lavania et al.,2014). In continuation with this, the present study noted presence of ahuge number of NTM isolates (SGM and RGM) in both soil and watersamples from Purulia and Champa regions along with the presence ofviable M. leprae. There are many factors that may affect recovery ofmycobacteria from water and soil. These factors, including deconta-mination methods and climate conditions of the different regions, andpH of soil and water, temperature and presence of Ca and K ions in soilwhich play important role for the growth of mycobacteria. Soils withneutral pH have been shown to yield high frequency of NTM (Rahbaret al., 2010). The present study found more RGM in water than soil andthis may be due to higher multiplication rate of RGM in surface waterwhich contain high oxygen concentration at 37 °C temperature with

neutral pH. In contrast, as soil contain lesser concentration of oxygenthan surface water with low pH and lower temperature it might bepromoting the growth of SGM. M. fortuitum was the most common NTMwhich was isolated from soil (50%) and water (60%). NTM were con-firmed by PCR method using 16S rRNA gene followed by sequenceanalysis of 16S rRNA allowing their rapid classification of prokaryotesusing universally distributed mycobacterial species (Woese, 1987).

RGM such as M. porcinum, M. psychrotolerans, M. vaccae were iso-lated for the first time from leprosy endemic soil of India. M. vaccae wasoriginally isolated from soil in an area of Uganda and has been reportedto play an immunomodulating role for the host susceptibility to leprosy.M. psychrotolerans, an RGM, first isolated from pond water near aur-anium mine in Spain (Trujillo et al., 2004) has also been isolated in thepresent study. M. porcinum is the causative agent of submandibularlymphadenitis in swine and having similar characteristics of M. for-tuitum but it is different at species level (Wallace Jr et al., 2004). M.yongonense causing pulmonary disease and M. holsaticum causing var-ious extra-pulmonary diseases were reported from Saudi Arabia(Varghese et al., 2017). Other NTMs were M. scrofulaceum, M. para-scrofulaceum, M. szulgai, M. europaeum, M. simiae isolated in the presentstudy are pathogenic in nature and were reported earlier in clinicalspecimens. In the present study, M. europaeum which was reportedearlier from clinical samples in Europe (Tortoli et al., 2011) has beenisolated from the soil samples.

Similarly, in water samples noted, M. fortuitum was the mostcommon RGM and other species were M. smegmatis, M. gilvum. On theother hand, M. intracellulare was the most common SGM and otherspecies were M. scrofulaceum, M. parascrofulaceum, M. szulgai, M.europaeum, M. simiae and M. spp were noted. M. fortuitum was firstcharacterized in 1991, is known for respiratory infections, a spectrumof soft tissue and skeletal infections, bacteraemia and disseminateddisease in humans. M. szulgai is a slow-growing unusual pathogen forhumans. Pulmonary disease is the most common manifestation of M.szulgai infection with clinical and radiological resemblance to tu-berculosis (Marks et al., 1972).

Larger number (65%) NTM species were obtained from soils ofChampa region as compared to that 58% isolates of Purulia region.

Fig. 4. PCR amplification of RLEP gene region of Mycobacterium leprae obtainedfrom environmental samples from Purulia (WB).

Fig. 5. Phylogenetic tree of Non-tuberculous mycobacteria and Mycobacterium leprae.

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

196

NTM speciesM. asiaticum,M. arabiense,M. alsense andM. seoulense fromChampa region were isolated for the first time in India. Phylogeneticanalysis showed that M. leprae was having close association with RGM,M. smegmatis and SGM, M. simiae, which are known to be pathogenic tohumans.

6. Conclusion

The present study showed presence of more number of SGM speciesin soil compared to water and conversely water samples showed pre-sence more number of RGM species compared to the soil samples.Several pathogenic NTM were first time isolated from leprosy endemicarea which are known to cause a variety of infections to human alongwith M. leprae. Environmental mycobacterial species may sensitizedifferently in different population and may pre-sensitize the populationfor development of a proper acquired immunity or susceptibility totuberculosis or leprosy (Rook and Stanford, 1981). Whether such a roleis being played by these NTMs in these endemic regions is difficult toexplain from the present study. In conclusion, identification of differentspecies of NTMs by molecular PCR sequencing method is thus urgentlyneeded for epidemiological and clinical purposes for adequate treat-ment and management of patients. A future study will have to be car-ried out to understand the role of these NTMs in susceptibility to le-prosy.

Competing interests

All authors declare that there are no competing interests.

Acknowledgements

We acknowledge the financial support rendered by Effect: Hope(The leprosy Mission Canada), grant number 205 and infrastructuralsupport granted by the host institution - The Leprosy Mission TrustIndia to carry out this research work at Stanley Browne ResearchLaboratory – The Leprosy Mission Community Hospital, Shahdara –New Delhi. We also acknowledge Dr. Mary Verghis, Director - TLMIndia, Dr.Joydeepa Darlong Head, Knowledge and management TLM -India for their guidance and encouragement. We also wish to ac-knowledge support of the Superintendent and staff of TLM Hospital,Purulia. We are likewise grateful to Mr. Manish Gardia and Mr.Atul Royfor assisting in the sample collection.

References

Aggarwal, M., Jindal, N., Arora, R., Aggarwal, N.P., Arora, S., 1993. Non-tuberculousmycobacteria: the changing scenario at Amritsar. Indian J. Tuberc. 40, 25–27.

Arraes, M.L.B.M., Holanda, M.V., Lima, L.N.G.C., Sabadia, J.A.B., Duarte, C.R., Almeida,R.L.F., Kendall, C., Kerr, L.R.S., Frota, C.C., 2017. Natural environmental watersources in endemic regions of northeastern Brazil are potential reservoirs of viableMycobacterium leprae. Mem. Inst. Oswaldo Cruz 112, 805–811.

Baliga, S., Murphy, C., Sharon, L., Shenoy, S., Biranthabail, D., Weltman, H., Miller, S.,Ramasamy, R., Shah, J., 2018. Rapid method for detecting and differentiatingMycobacterium tuberculosis complex and non-tuberculous mycobacteria in sputum byfluorescence in situ hybridization with DNA probes. Int. J. Infect. Dis. https://doi.org/10.1016/j.ijid.2018.07.011.

Brook, R.W., Parker, B. C., Gruft, H., Falkinham, J, O., 1984. Epidemiology of infectionsby nontuberculous mycobacteria Numbers in eastern United States soils and corre-lation with soil characteristics. Am. Rev. Resp. Dis. 130, 630–633.

Chauhan, M.M., 1993. Nontuberculous mycobacteria isolated from an epidemiologicalsurvey in rural population of Bangalore district. Indian J. Tuberc. 40, 195–197.

Daffé, M., Laneelle, M,.A., 1988. Distribution of phthiocerol diester, phenolic mycosidesand related compounds in mycobacteria. J. Gen. Microbiol. 134, 2049–2055.

Donohue, M.J., Mistry, J.H., Donohue, J.M., O'Connell, K., King, D., Byran, J., Covert, T.,Pfaller, S., 2015. Increased frequency of nontuberculous mycobacteria detection atpotable water taps within the United States. Environ. Sci. Technol. 49, 6127–6133.

Euzbey, J.P., 1997. List of bacterial names with standing in nomenclature genusMycobacterium. Int. J. Syst. Bacteriol. 47, 590–592. Available: from. http://www.bacterio.net/mycobacterium.html (accessed 26.04.18).

Falkinham, J.O.I.I.I., Norton, C.D., LeChevallier, M.W., 2001. Factors influencing num-bers of Mycobacterium avium, Mycobacterium intracellulare and other mycobacteria indrinking water distribution systems. Appl. Environ. Microbiol. 67, 1225–1231.

Forbes, B.A., Hall, G.S., Miller, M.B., Novak, S.M., Rowlinson, M.C., Salfinger, M.,Somoskövi, A., Warshauer, D.M., Wilson, M.L., 2018. Practice guidelines for clinicalmicrobiology laboratories: mycobacteria. Clin. Microbiol. Rev. 31, e00038–e00047.

Harboe, M., Aseffa, A., Leekassa, R., 2005. Challenges presented by nerve damage inleprosy. Lepr. Rev. 76, 5–13.

Hardas, U.D., Jayaraman, V.S., 1984. Differential identification of mycobacteria. Ind. J.Tub. 31, 11–12.

Jadhav, R.s, Kamble, R.R., Shinde, V.S., Edward, S., Edward, V.K., 2005. Use of reversetranscription polymerase chain reaction for the detection of Mycobacterium leprae inthe slit-skin smears of leprosy patients. Ind. J. Lepr. 77, 116–127.

Kamala, T., Paramasivan, C.N., Herbert, D., Venkatesan, P., Prabhakar, R., 1994.Evaluation of procedures for isolation mycobacteria from soil and water. Appl.Environ. Microbial. 60, 1021–1024.

Lavania, M., Katoch, K., Katoch, V.M., et al., 2008. Detection of viable Mycobacteriumleprae in soil samples: insights into possible sources of transmission of leprosy. Infect.Genet. Evol. 8, 627–631.

Lavania, M., Turankar, R.P., Singh, I., Nigam, A., Sengupta, U., 2014. Detection ofMycobacterium Gilvum first time from the bathing water of leprosy patient fromPurulia, West Bengal. Int. J. Mycobacteriol. (4), 286–289.

Madigan, C.A., Cambier, C.J., Kelly-Scumpia, K.M., et al., 2017. A macrophage responseto mycobacterium leprae phenolic glycolipid initiates nerve damage in leprosy. Cell170, 973–985.

Marks, J., Jenkins, P.A., Tsukamura, M., 1972. Mycobacterium szulgai a new pathogen.Tubercle 53, 210–214.

Mohanty, P.S., Naaz, F., Katara, D., Misba, L., Kumar, D., Dwivedi, D.K., Tiwari, A.K.,Chauhan, D.S., Bansal, A.K., Tripathy, S.P., Katoch, K., 2016. Viability ofMycobacterium leprae in the environment and its role in leprosy dissemination. Ind. J.Dermatol. Venereol. Leprol. 82, 23–27.

Moore, J.E., Kruijshaar, M.E., Ormerod, L.P., Drobniewski, F., Abubakar, I., 2010.Increasing reports of non-tuberculous mycobacteria in England, Wales and NorthernIreland, 1995-2006. BMC Public Health 10, 612.

Narang, R., Narang, P., Mendiratta, D.K., 2009. Isolation and identification of non-tuberculous mycobacteria from water and soil in central India. Indian J. Med.Microbiol. 27, 247–250.

Newport, M.J., Huxley, C.M., Huston, S., Hawrylowicz, C.M., Oostra, B.A., Williamson,R., et al., 1996. A mutation in the interferon- gamma-receptor gene and susceptibilityto mycobacterial infection. N. Engl. J. Med. 335, 1941–1949.

Paramasivan, C.N., Govindan, D., Prabhakar, R., Somasundaram, P.R., Subbammal, S.,Tripathy, S., 1985. Species level identification of non-tuberculous mycobacteria fromsouth Indian BCG trial area during 1981. Tubercle 66, 69.

Parashar, D., Chauhan, D.S., Sharma, V.D., Chauhan, A., Chauhan, S.V.S., Katoch, V.M.,2004. Optimization of procedures for isolation of mycobacteria from soil and watersamples obtained in northern India. Appl. Environ. Microbiol. 70, 3751–3753.

Parashar, D., Das, R., Chauhan, D.S., Sharma, V.D., Lavania, M., Yadav, V.S., Chauhan,S.V., Katoch, V.M., 2009. Identification of environmental mycobacteria isolated fromAgra, north India by conventional & molecular approaches. Indian. J. Med. Res. 129,424–431.

Petrini, B., 2006. Non-tuberculous mycobacterial infections. Scand. J. Infect. Dis. 38,246–255.

Pinner, M., 1935. Atypical acid-fast microorganisms. Am. Rev.Tuberc. 32, 424–445.Porvaznik, I., Solovič, I., Mokrý, J., 2017. Non-tuberculous mycobacteria: classification,

diagnostics, and therapy. In: Pokorski, M. (Ed.), Respiratory Treatment andPrevention. Adv Exp Med Biol. 944. pp. 19–25.

Rahbar, M., Lamei, A., Babazadeh, H., Yavari, S.A., 2010. Isolation of rapid growingmycobacteria from soil and water in Iran. Afr. J. Biotechnol. 9, 3618–3621.

Reichenbach, J., Rosenzweig, S., Doffinger, R., Dupuis, S., Holland, S.M., Casanova, J.L.,2001. Mycobacterial diseases in primary immunodeficiencies. Curr.Opin. Allergy.Clin. Immunol. 1, 503–511.

Rook, G.A.W., Stanford, J.L., 1981. The heterogeneity of immune response to myco-bacterial and the relevance of the common antigens to their pathogenicity. Ann.Immunol. (Paris) 132D, 155–164.

Runyon, E.H., 1959. Anonymous mycobacteria in pulmonary disease. Med. Clin. NorthAm. 43, 273–290.

Shojaei, H., Heidarieh, P., Hashemi, A., Feizabadi, M. M., Daei, Naser, A., 2011. Speciesidentification of neglected nontuberculous mycobacteria in a developing country.Jpn. J. Infect. Dis. 64, 265–271.

Somerville, W., Thibert, L., Schwartzman, K., Behr, M.A., 2005. Extraction ofMycobacterium tuberculosis DNA: a question of containment. J. Clin. Microbiol. 43,2996–2997.

Spencer, J.S., Brennan, P.J., 2011. The role of Mycobacterium leprae phenolic glycolipid I(PGL-I) in serodiagnosis and in the pathogenesis of leprosy. Lepr. Rev. 82, 344–357.

Tortoli, E., Böttger, E.C., Fabio, A., Falsen, E., Gitti, Z., Grottola, A., Klenk, H.P., Mannino,Mariottini, A., Messinò, M., Pecorari, M., Rumpianesi, 2011. Mycobacterium euro-paeum sp. nov., a scotochromogenic species related to the Mycobacterium simiaecomplex. Int. J. Syst. Evol. Microbiol. 61, 1606–1611.

Trivedi, S.S., Desai, S.G., Trivedi, S.B., 1986. Non-tuberculous lung mycobacteriosis inGujarat. Ind. J. Tub. 33, 175–178.

Trujillo, M.E., Velázquez, E., Kroppenstedt, R.M., Schumann, P., Rivas, R., Mateos, P.F.,Martínez-Molina, E., 2004.Mycobacterium psychrotolerans sp. Nov. isolated from pondwater near a uranium mine. Int. J. Syst. Evol. Microbiol. 54, 1459–1463.

Turankar, R.P., Lavania, M., Singh, M., et al., 2012. Dynamics of Mycobacterium leprae-transmission in environmental context: deciphering the role of environment as apotential reservoir. Infect. Genet. Evol. 12, 121–126.

Turankar, R.P., Pandey, S., Lavania, M., Singh, I., Nigam, A., Darlong, J., Darlong, F.,Sengupta, U., 2015. Comparative evaluation of PCR amplification of RLEP, 16S rRNA,rpoT and Sod a gene targets for detection of M. leprae DNA from clinical and

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

197

environmental samples. Int. J. Mycobacteriol. 4, 54–59.Turankar, R.P., Lavania, M., Singh, M., Sengupta, U., Siva Sai, K., Jadhav, R.S., 2016.

Presence of viable Mycobacterium leprae in environmental specimens around housesof leprosy patients. Indian J. Med. Microbiol. 34, 315–321.

Turenne, C.Y., Tschetter, L., Wolfe, J., Kabani, A., 2001. Necessity of quality controlled16S rRNA gene sequence databases: identifying nontuberculous Mycobacteriumspecies. J. Clin. Microbiol. 39, 3637–3648.

Varghese, B., Enani, M., Shoukri, M., Althawadi, S., Aljohani, S., Al- Hajoj, S., 2017.Emergence of rare species of nontuberculous mycobacteria as potential pathogens inSaudi Arabian Clinical setting. PLoS Negl. Trop. Dis. 11, e0005288.

Wallace Jr., R.J., Brown-Elliott, B.A., Wilson, R.W., et al., 2004. Clinical and laboratoryfeatures of Mycobacterium porcinum. J. Clin. Microbiol. 42, 5689–5697.

Wallace Jr., R.J., O'Brein, R., Glassroth, J., Raleigh, J., Dutta, A., 1990. Diagnosis andtreatment of disease caused by nontuberculous mycobacteria. Am. Rev. Respir. Dis.142, 940–953.

Walsh, G.P., Storrs, E.E., Burchfield, H.P., et al., 1975. Leprosy-like disease occurringnaturally in armadillos. J. Reticuloendotheliol. Soc. 18, 347s–351.

Walsh, G.P., Meyers, W.M., Binford, C.H., et al., 1981. Leprosy – a zoonosis. Lepr. Rev. 52,77–83.

Wang, Y., Ogawa, M., Fukuda, K., Miyamoto, H., Taniguchi, H., 2004. Isolation andidentification of Mycobacteria from soil at an illegal dumping site and landfills inJapan. Microbiol. Immunol. 50, 513–524.

WHO, 2017.Global Leprosy Update 2017. Avaiable from http://www.who.int/wer. 92,501–520. (Accessed on 21.04.18).

Woese, C.R., 1987. Bacterial evolution. Microbiol. Rev. 51, 221–227.Wolinsky, E., 1979. Nontuberculous mycobacteria and associated disease. Am. Rev.

Respir. Dis. 119, 10759.Wolinsky, E., 1995. Mycobacterial lymphadenitis in children: a prospective study of 105

nontuberculous cases with long-term follow-up. Clin. Infect. Dis. 20, 954–963.

R.P. Turankar et al. Infection, Genetics and Evolution 72 (2019) 191–198

198