Embed Size (px)
Citation preview
Caractérisation de la structure génétique de populations et évaluation de ses déterminismes environnementaux chez le grand brochet (Esox lucius) dans le système lac
Ontario – fleuve Saint-Laurent.
Mémoire
Geneviève OUELLET-CAUCHON
Maîtrise en biologie Maître ès sciences (M.Sc.)
Québec, Canada
© Geneviève Ouellet-Cauchon, 2013
iii
Résumé
Nous avons documenté la génétique du paysage du grand brochet (Esox lucius) en nous
basant sur l’analyse de 22 microsatellites, incluant 10 nouveaux marqueurs développés ici,
dans le système lac Ontario – fleuve Saint-Laurent. La structure génétique des populations
était globalement très faible mais spatialement variable ; le niveau moyen de différenciation
génétique dans la section amont (Ontario) de l’aire d’étude était trois fois plus important
que celui observé dans le secteur aval (Québec). Vingt variables environnementales furent
considérées et les différentes masses d’eau, la présence de barrages et la stabilité
interannuelle du niveau d’eau s’avérèrent positivement associées à l’intensité de la
différenciation génétique. Une importante variation du niveau d’eau influe sur la qualité et
la localisation annuelle des habitats de reproduction du grand brochet, l’instabilité locale de
l’habitat prenant la forme d’une variation interannuelle du niveau d’eau semble localement
inhiber la structure génétique de populations, probablement en empêchant la philopatrie.
Mots clés : Esox lucius, grand brochet, génétique du paysage, structure génétique de
populations, variation environnementale, stabilité de l’habitat, marqueurs microsatellites,
gestion, conservation.
v
Abstract
In this study, we documented the landscape genetics of northern pike (Esox lucius) based
on the analysis of 22 microsatellites, comprising 10 markers developed for the purpose of
this study, in the Lake Ontario – St. Lawrence River system. Population genetic structure
over the whole study area was globally very weak but spatially variable with mean level of
differentiation in the upstream (Ontario) section of the studied area being three-fold higher
than observed in the downstream (Québec) sector. Twenty environmental variables were
considered and different water masses, dams’ presence and inter-annual water level
stability were positively associated to the extent of genetic differentiation. Since high water
level variation impacts on yearly quality and localization of northern pike spawning
habitats, local habitat instability which is under the form of inter-annual water level
variation seems to locally impede population genetic structure, perhaps by inhibiting
philopatry behavior.
Keywords: Esox lucius, northern pike, landscape genetics, population genetic structure,
environmental variation, habitat stability, microsatellite markers, management,
conservation.
vii
Table des matières
Résumé ............................................................................................................................................................... iii
Abstract ............................................................................................................................................................... v
Table des matières ............................................................................................................................................. vii
Liste des tableaux .............................................................................................................................................. ix
Liste des figures ................................................................................................................................................. xi
Liste des abréviations et des sigles ................................................................................................................... xiii
Remerciements ................................................................................................................................................ xvii
Avant-propos ..................................................................................................................................................... xxi
Introduction générale .......................................................................................................................................... 1
Concepts ......................................................................................................................................................... 1
Conservation et diversité génétique ........................................................................................................... 1
Structure génétique des populations .......................................................................................................... 2
Génétique du paysage ............................................................................................................................... 3
Le grand brochet ............................................................................................................................................. 4
Biologie et écologie de l’espèce ................................................................................................................. 4
Bilan des connaissances en génétique des populations ............................................................................ 5
Système à l’étude ........................................................................................................................................... 6
Problématique ................................................................................................................................................. 6
Objectifs .......................................................................................................................................................... 7
Objectif 1. Développement de nouveaux marqueurs microsatellites pour le grand brochet et test sur les
autres ésocidés (chapitre 1) ....................................................................................................................... 8
Objectif 2. Mise au point de 22 marqueurs microsatellites pour le grand brochet (chapitre 1) ................... 8
Objectif 3. Étude de la structure de populations sur l’ensemble du système (chapitre 2) .......................... 8
Objectif 4. Caractérisation de l’habitat du système lac Ontario – fleuve Saint-Laurent (chapitre 2) ........... 9
Objectif 5. Analyse de génétique du paysage (chapitre 2) ......................................................................... 9
CHAPITRE 1 : Novel microsatellite markers for northern pike (Esox lucius) and cross-amplification across all
Esox species ..................................................................................................................................................... 11
Résumé ........................................................................................................................................................ 13
Abstract ......................................................................................................................................................... 14
Acknowledgements ....................................................................................................................................... 17
CHAPITRE 2 : Spatially variable extent of population structure in northern pike (Esox lucius) explained by
landscape features ............................................................................................................................................ 21
viii
Résumé ......................................................................................................................................................... 23
Abstract ......................................................................................................................................................... 25
Introduction ................................................................................................................................................... 26
Material and methods .................................................................................................................................... 29
Sample collection ...................................................................................................................................... 29
Genetic data ............................................................................................................................................. 29
Intra-population diversity and structure ..................................................................................................... 30
Population structure .................................................................................................................................. 30
Landscape genetics .................................................................................................................................. 31
Results .......................................................................................................................................................... 33
Intra-population diversity and structure ..................................................................................................... 33
Population structure .................................................................................................................................. 33
Landscape genetics .................................................................................................................................. 35
Discussion ..................................................................................................................................................... 36
Landscape genetics .................................................................................................................................. 36
Population structure and genetic diversity ................................................................................................ 39
Acknowledgements ....................................................................................................................................... 43
Conclusion générale .......................................................................................................................................... 59
Bibliographie ...................................................................................................................................................... 63
Annexe 1. .......................................................................................................................................................... 72
Annexe 2. .......................................................................................................................................................... 73
Annexe 3. .......................................................................................................................................................... 75
Annexe 4. .......................................................................................................................................................... 78
ix
Liste des tableaux
Table 1.1. Microsatellite markers amplification characteristics. Marker sets A and B were amplified
in multiplexes and sets 1-3 were amplified independently then pooled for electrophoresis ............... 18
Table 1.2. Microsatellite markers characteristics in Esox lucius from North America and other Esox
species .............................................................................................................................................................. 19
Table32.1. Sample statistics related to each sampling site and analyzed at 22 microsatellite loci.. . 44
Table42.2. Microsatellite loci characteristics. ........................................................................................... 47
Table52.3. Environmental variables included in landscape genetics analyses. Within description is
specified the treatment of variables to build distance matrices ............................................................... 49
Table62.4. Mantel tests results of pairwise Fst matrix coupled with environmental variables
matrices and identification of variables selected for subsequent multivariate analysis ....................... 51
Table72.5. Multiple regression on distance matrices (MRM) model on environmental variables
results with Pearson’s correlation coefficient and pairwise Fst matrix as a response variable. A) Full
model on selected variables by Mantel's tests (see Table 1). B) Final model with significant
variables from full model in (A). ................................................................................................................. 52
xi
Liste des figures
Figure 2.1. Sampling sites in St. Lawrence River and two of its tributaries (Ottawa River and
Richelieu River), as well as Lake Ontario and one of its tributary (Niagara River). ........................... 53
Figure 2.2. Isolation by distance relationships. ........................................................................................ 54
Figure 2.3. A) First 20 barriers in Ontario sector and in B) Quebec sector inferred by BARRIER.
Lines thickness is function of barriers’ relative strength (indicated in percentage) ............................. 55
Figure 2.4. Distribution of the 20 first barriers localization within Lake Ontario and St. Lawrence
River system as a function of their relative strength and waterway distance from the upstream
farthest point (Hamilton basin, site 2). ........................................................................................................ 56
Figure 2.5. Sliding windows of sites located in a 50 km window that moves following water flow
across system with a 25 km step. A) Mean inter-annual water level variation coefficients and B)
mean pairwise Fst values between sites as a function of middle downstream waterway distance from
the upstream farthest point (Hamilton basin, site 2) of each window. Mean pairwise Fst values
between sites as a function of mean inter-annual water level variation coefficients for C) above and
D) below Moses-Saunders regulation dam. ............................................................................................... 57
Figure 2.6. Modelled suitable spawning habitats for northern pike within Lake St. Pierre in lower
St. Lawrence River for two extreme water levels scenarios, A) in 1965 where water level was low
and B) in 1997 where water level was high. Blue lines and red lines illustrate flood plain upper limit
at maximum and minimum water levels, respectively. Green color indicates suitable spawning
habitats, from high quality habitats in dark from low quality habitats in light. C) Overlap of
spawning habitat surfaces from (A) and (B) considering quality ........................................................... 58
xiii
Liste des abréviations et des sigles
AMOVA Analyse de la variance moléculaire (analysis of molecular variance)
Apr Richesse allélique privée moyenne sur tous les loci standardisée pour la plus
petit taille d’échantillonnage (mean private allelic richness)
Ar Richesse allélique moyenne sur tous les loci standardisée pour la plus petit
taille d’échantillonnage (mean allelic richness)
b Coefficient standard de régression partielle du modèle MRM (standard partial
regression coefficient)
EST Marqueurs de séquences exprimées (expressed sequence tags)
F Valeur du pseudo-test de Fisher du modèle MRM (Fisher's pseudo-test value)
F Amorce « sens » (foward primer)
FDR « False discovery rate »
Fis Coefficient de consanguinité (inbreeding coefficient)
Fst Indice de différenciation (differentiation coefficient)
HE Hétérozygotie attendue (expected heterozygozity)
HO Hétérozygotie observée (observeded heterozygozity)
ρ Coefficient de corrélation de Spearman (Spearman’s correlation coefficient)
HWE Équilibre de Hardy-Weinberg (Hardy-Weinberg equilibrium)
IBD Isolation par la distance (isolation-by-distance)
LD Déséquilibre de liaison (linkage disequilibrium)
MRM Régression multiple sur matrices de distance (multiple regression on distance
matrices)
NA Nombre d’allèles par locus (number of alleles)
PCR Réaction de polymérase en chaîne (polymerase chain reaction)
r Coefficient de corrélation du test de Mantel (Mantel’s correlation coefficient)
R Amorce « anti-sens » (reverse primer)
R2 Coefficient de détermination multiple du modèle MRM (coefficient of
multiple determination)
Ta Température d’hybridation en degrés Celsius (annealing temperature)
xv
À mes parents, Françoise et Bernard
xvii
Remerciements
En premier lieu, je tiens à remercier Louis Bernatchez, mon directeur, pour la confiance
qu’il m’a démontrée en me laissant mener à terme ce magnifique projet. Il a m’a procuré un
soutien constant en démontrant de la compréhension et de la patience tout au long de mon
cheminement d’apprentissage. Je remercie aussi Marc Mingelbier, mon co-directeur, qui
travaille au sein du Ministère du Développement durable, de l’Environnement, de la Faune
et des Parcs du Québec (MDDEFP). Il m’a donné l’opportunité de collaborer avec le
Ministère sur un projet de grande envergure. Je lui suis très reconnaissante pour tout son
travail de coordination de la campagne d’échantillonnage. Je remercie également Frédéric
Lecomte, du MDDEFP, pour son assistance dans mon apprentissage des méthodes de
travail efficaces et pour son implication dans nos brainstorms d’idées. Je remercie Charles
Perrier, candidat post-doctoral au laboratoire Bernatchez, pour son temps donné avec
générosité, sa passion scientifique et sa vision originale qui m’ont permis de mieux
comprendre et d’enrichir ce projet. Je remercie chaleureusement Guillaume Côté,
professionnel de recherche au laboratoire Bernatchez, pour sa patience sans limites et son
soutien apporté dans mon apprentissage au laboratoire et pour son support moral auquel je
dois beaucoup. Merci à Lucie Papillon pour son aide et ses conseils techniques sans failles.
Je remercie également Émilie Leclerc, diplômée à la maîtrise du laboratoire Bernatchez,
pour le généreux partage de son savoir. Un grand merci à Mélanie Dionne du MDDEFP
pour ses judicieux conseils et son enthousiasme face au projet.
Pour leur support dans l’obtention des échantillons de grand brochet du système lac Ontario
– fleuve Saint-Laurent, merci à Philippe Brodeur, Yves Mailhot, Chantal Côté, Pierre
Dumont, Daniel Hatin, Mélissa Larochelle et à l'essentielle équipe des techniciens (William
Cayer-Blais, Yanick Soulard, Geneviève Richard, Nicolas Harnois, Vanessa Cauchon),
tous du MDDEFP. Merci à John M. Farrell et Chris Barry du SUNY College of
Environmental Science and Forestry, Gavin Christie, Alastair Mathers, Chris Wilson et Jim
Hoyle du Ontario Ministry of Natural Resources (OMNR), Ian Kelsey et Jeff McNiece du
Central Lake Ontario Conservation Authority (CLOCA), Susan Doka et Nicholas Mandrak
du Departement of Fisheries and Oceans Canada (DFO), Rodger Klindt du New York State
Department of Environmental Conservation (NYS DEC) ainsi qu’aux pêcheurs
xviii
commerciaux et aux pourvoyeurs qui ont généreusement collaboré dans la campagne
d’échantillonnage. Merci à tous les autres qui ont mis la main à la pâte au cours de la
campagne d’échantillonnage; vous êtes si nombreux que je ne peux tous vous nommer.
Pour le partage d’échantillons de tissus des espèces d’ésociés, je remercie grandement
Julien April du laboratoire Bernatchez, Michael Hansen (Aarhus University), Chenghui
Wang (Shanghai Ocean University), Gregory Maes (KU Leuven) et Andres Lopez
(University of Alaska Museum).
Pour la partie préliminaire du développement des amorces et l’annotation des marqueurs,
un grand merci à Eric Normandeau, professionnel de recherche au laboratoire Bernatchez.
Je remercie chaleureusement Marie-Hélène Perreault pour son enrichissante collaboration
dans le travail de laboratoire. Je suis reconnaissante envers sa contagieuse bonne humeur et
son travail acharné et impeccable duquel j’ai énormément appris. Merci Marie-Hélène, ce
fut un immense plaisir. Je remercie également Amélie Gilbert, stagiaire technicienne
finissante, pour son aide apportée au travail de laboratoire. Je remercie Geneviève Richard,
technicienne au MDDEFP, pour la production de cartes de la localisation des habitats de
fraie du grand brochet (Figure 6 au chapitre 2). Je remercie Sébastien Boutin, étudiant au
doctorat du laboratoire de Nicolas Derome, pour son assistance statistique et son soutien
d’analyse informatique en plus de ses commentaires sur ce mémoire. Merci à Glenn
Yannick, stagiaire post-doctoral au laboratoire Bernatchez et à Antoine Bernatchez pour
l’aide à la programmation informatique. Merci à Vicky Albert du MDDEFP pour ses
conseils sur la standardisation du génotypage. Je remercie Eliane Valiquette, Vincent
Bourret, Pierre-Alexandre Gagnaire, Caroline Côté, Bérénice Bougas, Scott Pavey, Anne-
Marie Dion-Côté, Fabien Lamaze et tous les autres membres rencontrés au laboratoire
Bernatchez pour les échanges enrichissants. Je remercie Julie Turgeon, Julian Dodson et
Nadia Aubin-Horth pour leur participation à mes comités d’évaluation et pour leurs
précieux commentaires sur le projet.
Finalement, je remercie les sources de financement de ce projet, soit le Conseil de
Recherches en Sciences Naturelles et en Génie du Canada (CRSNG) et le MDDEFP. Je
remercie également mes sources de financement personnelles : le CRSNG, le Fonds de
xix
Recherche du Québec Nature et Technologies (FQRNT), le Fonds de soutien à la Maîtrise
du Département de Biologie de l’Université Laval et Québec-Océan.
Sur une note plus personnelle, je remercie mes parents Françoise et Bernard pour leur
support inconditionnel apporté tout au long de cette aventure. Vous formez la meilleure
équipe! Enfin, je remercie mes amis et amies passionnés qui se sont intéressés au
déroulement de ce projet. Merci pour votre énergie positive !
Bonne lecture !
xxi
Avant-propos
Cette aventure a pris racine dans ma participation au travail de terrain du projet de la truite
arc-en-ciel au Québec mené par Isabel Thibault au sein du laboratoire du Dr Julian Dodson
à l’Université Laval. C’est au cours de cet été que j’ai été piquée d’un amour pour les
poissons et que j’ai décidé de m’investir dans la protection de la faune aquatique. Ainsi,
après avoir travaillé quelques mois dans l’environnement du laboratoire du Dr Louis
Bernatchez, je me suis résolue à demander à ce dernier s’il était prêt à me confier un projet
de maîtrise appliqué à la conservation dans son laboratoire. C’est à mon grand plaisir qu’il
m’a proposé de réaliser ce projet de recherche en collaboration avec le Ministère des
Ressources Naturelles et de la Faune du Québec (MRNF), maintenant actif sous le nom de
Ministère du Développement durable, de l’Environnement, de la Faune et des Parcs du
Québec (MDDEFP).
Ce mémoire est l’aboutissement de trois enrichissantes années d’apprentissage de méthodes
de travail efficaces et d’organisation et de gestion de temps, en plus de l’accroissement
d’une maturité scientifique et de l’acquisition de connaissances variées. Ce document inclut
deux chapitres présentés sous la forme d’articles scientifiques (en anglais) dont je suis
l’auteure principale. Cette étude porte sur la caractérisation génétique des populations de
grand brochet (Esox lucius) du système du lac Ontario et du fleuve Saint-Laurent situé au
nord-est de l’Amérique du Nord.
Dans le contexte du premier chapitre, de nouveaux marqueurs microsatellites pour le grand
brochet furent développés à l’aide de marqueurs de séquences exprimées (Expressed
Sequence Tags, EST) et des tests d’amplification croisée de ces marqueurs furent appliqués
sur les autres espèces d’ésocidés (genre Esox). Cet article scientifique a été co-écrit avec
mon directeur Louis Bernatchez, Eric Normandeau qui est professionnel de recherche au
laboratoire Bernatchez et mon co-directeur Marc Mingelbier du Ministère du
Développement durable, de l’Environnement, de la Faune et des Parcs (MDDEFP). Eric
Normandeau a effectué les analyses informatiques du développement de 28 nouvelles
paires d’amorces et il a accompli les tests préliminaires d’amplification sur le grand brochet
et dirigé l’annotation de ces marqueurs. J’ai ensuite réalisé des tests approfondis
d’amplification de ces 28 marqueurs sur le grand brochet et les autres espèces d’ésocidés.
xxii
Par la suite, j’ai effectué le génotypage de ces marqueurs et les analyses statistiques
correspondantes. Enfin, j’ai rédigé l’article scientifique avec la collaboration des co-
auteurs, lequel sera soumis sous peu au journal Conservation Genetics Resources.
Ces microsatellites ont été ajoutés aux marqueurs préexistants dans la littérature pour
former une banque dans laquelle nous avons sélectionné les marqueurs les plus appropriés
pour réaliser les analyses du deuxième chapitre. À proprement parler, ce chapitre porte sur
la caractérisation génétique des populations de grand brochet (Esox lucius) et l’étude de ses
déterminismes environnementaux dans le système du lac Ontario et du fleuve Saint-
Laurent. Cet article scientifique a été co-écrit avec mon directeur Louis Bernatchez, mon
co-directeur Marc Mingelbier et Frédéric Lecomte du MDDEFP. Dans un premier temps,
avec la concertation du MDDEFP et de mon directeur, j’ai élaboré les objectifs du projet.
Ensuite j’ai établi des hypothèses de recherche en accord avec ma recherche
bibliographique. Marc Mingelbier a planifié et coordonné la majeure partie de la campagne
d’échantillonnage et j’ai coordonné et exécuté une petite partie de cette dernière. J’ai
effectué le travail de laboratoire avec l’assistance de Marie-Hélène Perrault et Amélie
Gilbert. J’ai effectué la totalité des analyses statistiques et j’ai rédigé l’article scientifique
avec la collaboration des co-auteurs, lequel sera soumis prochainement au journal
Transactions of the American Fisheries Society.
En résumé, dans ce mémoire sont insérés deux chapitres qui présentent le format typique
d’articles scientifiques en langue anglaise. Ces chapitres sont précédés d’une introduction et
ils sont suivis d’une conclusion en langue française pour former le corps du mémoire.
1
Introduction générale
Concepts
Conservation et diversité génétique
La biologie de la conservation fait la promotion du maintien de la biodiversité à plusieurs
niveaux, de la diversité des écosystèmes jusqu’à la diversité génétique (Primack 2006). La
diversité génétique est ainsi perçue comme le matériel brut de l’évolution adaptative
(McNeely et al. 1990). La conservation de la diversité génétique d’une espèce ou d’une
population lui confère l’opportunité de maintenir son potentiel évolutif, i.e. sa capacité à
persister par adaptation en réponse aux variations environnementales de son milieu
(Frankham et al. 2010), telles que les changements climatiques ou des modifications
anthropogéniques apportées à l’habitat. Ainsi, dans le domaine de la conservation
biologique, la variation génétique a été élevée à un statut prioritaire et a été reconnue par
l’IUCN (World Conservation Union) comme l’une des trois composantes de la diversité
biologique à conserver (McNeely et al. 1990).
Dans le but de préserver la biodiversité et de diminuer le taux d’extinction actuel, la
conservation de la diversité génétique utilise des outils moléculaires pour mettre en œuvre
des plans de gestion permettant aux espèces ou aux populations, qui se comportent comme
des entités dynamiques et distinctes, de s’adapter aux changements environnementaux
(Frankham et al. 2010). La démarche globale consiste à estimer l’ampleur de la divergence
entre les populations en quantifiant la diversité génétique intra- et inter-populationnelle
dans l’optique de déterminer l’organisation hiérarchique de la diversité génétique des
populations d’une espèce. Ce processus permet d’identifier et de localiser les unités
évolutives significatives (ESU : evolutionary significative units, Ryder, 1986) et/ou les
unités de gestion (MU : management units, Palsbøll et al., 2007). Dans un contexte
d’exploitation durable des espèces, comme par exemple dans le contexte des pêcheries, un
des principaux enjeux de gestion est l’identification des populations locales (Carvalho &
Hauser 1995) et la compréhension de l’influence des processus génétiques et écologiques
sur cette structure (Manel et al. 2003). Idéalement, dans un système donné pour une espèce
donnée, les unités populationnelles devraient correspondre aux unités de gestion
(dénommées « unités de stock » en gestion des pêcheries) qui correspondent aux groupes
2
de poissons exploités dans une région spécifique ou alors par une méthode spécifique
(Carvalho & Hauser 1995; Reiss et al. 2009). Dans l’élaboration des plans de gestion,
l’étude de la structure génétique des populations permet donc la définition de ces unités qui
sont utilisées dans l’établissement des priorités des mesures de préservation de la diversité
génétique entre les populations (Lande 1988; Waples 1989; Moritz 1994; Fraser &
Bernatchez 2001). Cette étape est primordiale dans le cas des populations exploitées, car
elle permet de mieux prévoir les conséquences des interventions humaines sur la diversité
génétique.
Structure génétique des populations
Les individus d’une espèce sont généralement regroupés en populations locales par un
processus d’isolement reproducteur partiel où ces populations sont soumises aux quatre
forces évolutives ayant une influence sur leur composition génétique de façon
indépendante. La mutation, la dérive génique et la sélection directionnelle naturelle (qui
favorise l’adaptation locale aux conditions environnementales) mènent à la différenciation
génétique des populations locales tandis que le flux génique (causé par la migration) et la
sélection balancée s’opposent à cette différenciation (Slatkin 1987). Notamment, le flux
génique tend à homogénéiser les fréquences alléliques entre les populations et son intensité
détermine les effets relatifs de la sélection et de la dérive génique (Balloux & Lugon-
Moulin 2002). Ces forces exercent des pressions de différentes intensités entre les groupes
reproductifs et elles engendrent ainsi des compositions génétiques distinctes pour chacune
des populations. Lors d’une étude de structure génétique de populations, c’est cette
variation génétique entre les groupes qui permet de discriminer les différentes populations,
qui, par définition, présentent une connectivité limitée entre elles.
La connectivité entre les populations est déterminée par la dispersion (le mouvement
d’individus entre l’aire natale et l’aire ou prend place la première reproduction ou le
mouvement entre deux aires de reproduction successives) des individus émigrants et
immigrants. Les barrières environnementales, les processus historiques et les traits
d’histoire de vie (ex : stratégies de reproduction) peuvent moduler l’intensité du flux
génique (transfert de matériel génétique entre les populations par la reproduction
d’individus immigrants avec les individus résidents) entre les populations et influer sur le
3
patron et la magnitude de la structure génétique des populations (Balloux & Lugon-Moulin
2002). Également, les populations sont souvent génétiquement différenciées selon le
principe d’isolation par la distance, car l’étendue de la répartition des espèces est
généralement plus large que la capacité de dispersion d’un individu. Les populations à
proximité sont génétiquement davantage similaires que les populations plus distantes
(Balloux & Lugon-Moulin 2002), comme par exemple selon le modèle stepping-stone
(Kimura & Weiss 1964).
Génétique du paysage
L’étude classique de la structure génétique des populations soulève un questionnement sur
les mécanismes de structuration de la diversité génétique des populations. La « génétique
du paysage », ou landscape genetics (Manel et al. 2003), permet de déterminer l’ampleur et
les causes de la distribution de la variation génétique spatio-temporelle et d’effectuer la
correspondance entre la structure génétique des populations et l’hétérogénéité
environnementale. La génétique du paysage est une discipline née d’un amalgame entre la
structure génétique des populations, l’écologie du paysage (étude des interactions entre les
patrons spatiaux et les processus écologiques) et des analyses spatiales (Manel et al. 2003;
Storfer et al. 2007). Cette nouvelle aire de recherche permet de tester l’influence relative
des variations biotiques et abiotiques des conditions environnementales du milieu sur le
flux génique, les discontinuités génétiques (Guillot et al. 2005) et la structure génétique des
populations (Manel et al. 2003; Holderegger & Wagner 2006, 2008) et de déterminer
l’échelle à laquelle ils agissent (Gaggiotti et al. 2009).
La génétique du paysage est devenue un outil d’investigation dans l’étude des processus
biologiques évolutifs fondamentaux tels la dynamique des métapopulations et les éléments
écologiques sous-jacents à la divergence des populations (Storfer et al. 2007). En outre, la
génétique du paysage peut s’appliquer à l’identification des barrières anthropogéniques qui
diminuent le flux génique ou la diversité génétique, à prédire les conséquences des
alternatives de gestion proposées sur la variation génétique et la connectivité des
populations et à identifier les corridors biologiques potentiels pour l’implantation de
réserves écologiques (Storfer et al. 2007). Les études de génétique du paysage en milieu
aquatique sont de plus en plus nombreuses mais demeurent cependant davantage centrées
4
sur de petits réseaux ramifiés de ruisseaux avec leurs tributaires. Par conséquent, le projet
présenté ici, appliquant l’approche de la génétique du paysage à l’étude du grand brochet
(Esox lucius) dans le système lac Ontario – fleuve Saint-Laurent, représentera une des plus
importantes études de structuration génétique chez le grand brochet réalisée à ce jour et une
des études les plus élaborées de la génétique du paysage en milieu aquatique d’eau douce.
Le grand brochet
Le grand brochet, Esox lucius Linnaeus 1758, est une espèce de poisson d’eau douce
appartenant à la famille des ésocidés qui présente une répartition circumpolaire dans
l’hémisphère Nord (Craig 1996). Le grand brochet se retrouve dans 45% des eaux douces
d’Amérique du Nord (Carlander et al. 1978) et est ainsi considéré comme ubiquitaire sur le
continent (Craig 1996). Dans la plupart des pays, le grand brochet a une valeur
commerciale et récréative (Crossman & Casselman 1987; Raat 1988).
Biologie et écologie de l’espèce
Le grand brochet est un prédateur-clé piscivore commun des eaux peu profondes des
systèmes d’eau douce (Craig 1996, 2008). Les principaux critères de sélection de l’habitat
du grand brochet sont la température de l’eau (modérément élevée), la densité de végétation
(modérément dense), la concentration en oxygène dissous (élevée pour température), la
profondeur de l’eau (modérément faible) et la turbidité (faible) (Casselman & Lewis 1996).
Cependant, l’espèce peut tolérer une grande diversité de conditions environnementales. En
effet, elle présente une grande variation en ce qui a trait aux traits d’histoire de vie, ce qui
pourrait témoigner d’adaptations locales. Le grand brochet tient un rôle important dans la
structuration des communautés aquatiques ; entre autres, il régule fortement la composition,
l’abondance et la distribution de plusieurs espèces de poissons, incluant ses conspécifiques,
par la prédation, la compétition et le cannibalisme (revu par Craig 2008).
Le grand brochet atteint la maturité sexuelle entre deux et six ans, à une taille se situant
entre 26 et 51 cm (Craig 1996). Cette espèce fraye hâtivement au printemps (vers le mois
d’avril (Craig 1996), pendant la période de crue, dans les milieux humides inondés. La
période de fraye s’étale sur approximativement deux semaines, avec un pic de fraye de un à
deux jours. Le brochet montre une préférence de fraye dans les eaux peu profondes à faible
5
courant, où la température augmente plus rapidement qu’ailleurs dans le fleuve et où la
végétation est prépondérante (Mingelbier et al. 2008).
Des évidences pointent vers une certaine fidélité du brochet au site natal (philopatrie) et au
site de reproduction selon des études de génétique des populations (Miller et al. 2001), de
travaux de télémétrie (Koed et al. 2006) et de capture-marquage-recapture (Karås &
Lehtonen 1993; revu par Craig 2008). Bosworth et Farrell (2006) ont cependant soulevé
que le degré de fidélité au site natal de fraye demeure indéfini, mais ils ont identifié une
divergence génétique significative entre des sites de forte proximité. De plus, le grand
brochet ne semble pas se disperser à grande échelle et semble plutôt utiliser le site de
reproduction adéquat le plus près (revu par Craig 2008). Des études en rivière sur le
mouvement des individus supportent l’hypothèse que le brochet serait principalement
sédentaire (mais non exclusivement) et n’effectue pas de mouvements sur de grandes
distances (Craig 1996, 2008; Rosell & MacOscar 2002; Koed et al. 2006; Vehanen et al.
2006). Koed et ses collaborateurs (2006) ont rapporté que les femelles et les individus de
plus grande taille parcourent les plus grandes distances. La dispersion des larves pourrait
être considérée comme négligeable, puisque les larves se fixent généralement à la
végétation des sites de fraye (revu par Craig 1996). À une taille d’environ 20 mm
seulement, les jeunes brochets migrent de l’aire de ponte vers des milieux à végétation plus
éparse (Franklin & Jr 1963; Massé & Dumont 1991; revu par Craig 1996) et quittent les
aires de fraye qui commencent à s’assécher. Ainsi, les jeunes de l’année peuvent se
disperser à petite échelle (Cucherousset et al. 2009). Cependant, aucune étude n’a
directement investigué leurs déplacements sur une période s’étalant sur plus de quelques
semaines. En somme, certaines évidences d’un comportement de philopatrie ainsi qu’une
faible dispersion apparente témoignent d’une probable connectivité limitée entre les
populations et ceci indiquerait donc la nécessité de planifier la gestion du brochet en
considérant les stocks distincts (Craig 2008).
Bilan des connaissances en génétique des populations
Le grand brochet présente une forte différenciation génétique entre les populations à grande
échelle géographique, mais, parallèlement, présente de faibles niveaux de polymorphisme,
même à des loci microsatellites (Senanan & Kapuscinski 2000; revu par Miller & Senanan
6
2003). La forte différenciation génétique et la faible variabilité génétique au sein de
l’espèce a été attribuée à 3 éléments non mutuellement exclusifs : 1) le flux génique
restreint entre les populations de différentes masses d’eau ; 2) de faibles tailles effectives de
population (dues à son statut de grand prédateur) combinées à de faibles ratios de taille
effective par rapport à la taille réelle des populations (Ne/N) ; 3) des goulots d’étranglement
survenus durant la dernière glaciation et des effets fondateurs associés à la recolonisation
postglaciaire, surtout en Amérique du Nord (Miller & Kapuscinski 1997; Senanan &
Kapuscinski 2000; Miller & Senanan 2003; Maes et al. 2003; revu par Jacobsen et al.
2005).
Système à l’étude
L’aire d’étude correspond à la portion nord du lac Ontario et au Saint-Laurent fluvial. Le
système présente des variations interannuelles du débit en fonction des conditions
climatiques (Mingelbier et al. 2004). La plaine inondable du système est sensible aux
variations du débit et donc aux variations du niveau d’eau (Mingelbier et al. 2004). La
répartition géographique des sites potentiels de fraye du grand brochet dans le système
correspond de manière globale à la surface de la plaine d’inondation (Mingelbier et al.
2004, 2008). Il y a coïncidence de la période de reproduction du grand brochet avec la crue
printanière du système, ce qui permet au brochet d’utiliser la plaine d’inondation comme
habitat de fraye (Jude & Pappas 1992; Mingelbier et al. 2004). Le niveau d’eau du système
en période de crue contrôle l’accès des individus reproducteurs aux frayères de la plaine
inondable et module la superficie disponible des habitats de reproduction du grand brochet
(Mingelbier & Morin 2005). Également, après la fraye, le niveau de l’eau module le degré
d’immersion des œufs et des larves (Mingelbier et al. 2008), donc détermine la survie des
premiers stades de vie. Le retrait printanier des eaux peut donc causer une forte mortalité
quand les embryons et les larves se retrouvent en milieu asséché (Dumont & Fortin 1977;
Fortin et al. 1982)
Problématique
Depuis le milieu du XIXe siècle, le long du fleuve Saint-Laurent et des Grands Lacs, les
activités anthropiques ainsi que la diminution du niveau d’eau du fleuve ont causé la
destruction de plus de 70% des milieux humides (Höök et al. 2001) qui correspondent à
7
l’habitat de reproduction du grand brochet. Également, le régime hydrologique du fleuve
subit des variations spatio-temporelles, selon ses différents secteurs et suivant le climat
(Mingelbier et al. 2004). Lors des événements de faible hydraulicité suivant plusieurs
années consécutives, on dénote une perte notable de superficie des habitats printaniers du
grand brochet (jusqu’à 17% par année dans le fleuve Saint-Laurent, Mingelbier et al. 2004)
et les impacts associés sont cumulatifs. Cette perte d’habitat peut devenir limitante pour la
fraye du grand brochet dans les secteurs plus sensibles aux variations du débit (Mingelbier
et al. 2004) qui sont davantage sujets à une plus forte variation interannuelle du niveau
d’eau. Pour mieux comprendre les conséquences de cette fluctuation spatio-temporelle de
l’habitat de reproduction sur les populations de grand brochet dans le système, l’étude de
l’impact de la variation du niveau d’eau sur la structure des populations de grand brochet
devient pertinente relativement à d’autres facteurs environnementaux susceptibles
d’affecter cette structure. Aucun plan de gestion spécifique n’existe actuellement pour le
grand brochet dans le fleuve Saint-Laurent et le lac Ontario. Une étude précédente a révélé
que la structure de populations de la perchaude (Perca flavescens) du fleuve Saint-Laurent
ne correspondait pas exactement au découpage hydrologique utilisé dans le cadre de gestion
de celle-ci (Leclerc et al. 2008). Conséquemment, il était important de délimiter les
populations du grand brochet du système lac Ontario – fleuve Saint-Laurent et de
caractériser leur connectivité en vue de mettre en pratique une meilleure gestion de l’espèce
dans le système.
Objectifs
L’objectif général du projet consistait en une analyse génétique du grand brochet (Esox
lucius) à l'échelle du paysage dans le système lac Ontario – fleuve Saint-Laurent dans le
dessein de déterminer l'extension des différentes populations de cette espèce ainsi que
l’ampleur de la connectivité entre celles-ci, en plus de viser à comprendre l’influence de
l’hétérogénéité environnementale sur la structure génétique observée en utilisant une
approche de génétique du paysage. Le but ultime de l’étude était de permettre la
planification de la gestion des populations de grand brochet en considérant les secteurs du
système limitants pour la reproduction à l’aide d’unités de gestion pertinentes.
8
Objectif 1. Développement de nouveaux marqueurs microsatellites pour le grand
brochet et test sur les autres ésocidés (chapitre 1)
Comme le grand brochet démontre une faible variation génétique aux marqueurs
microsatellites préexistants dans la littérature (revu dans Miller & Senanan 2003), nous
visions dans un premier temps à développer de nouveaux marqueurs dans le but d’enrichir
la banque actuelle. Afin de déterminer si ces marqueurs étaient potentiellement utilisables
lors de futures études génétiques des autres espèces d’ésocidés, ces marqueurs furent testés
chez les cinq autres espèces du genre Esox, soit le brochet de l’Amur (E. reichertii)
d’Eurasie, le brochet d’Amérique (E. americanus americanus), le brochet vermiculé (E.
americanus vermiculatus), le maskinongé (E. masquinongy) et le brochet maillé (E. niger)
d’Amérique du Nord. Également, ces marqueurs furent testés chez le grand brochet
d’Europe.
Objectif 2. Mise au point de 22 marqueurs microsatellites pour le grand brochet
(chapitre 1)
À partir de la banque de marqueurs bonifiée lors de la réalisation du premier objectif, ce
second objectif visait la mise au point le développement et l’optimisation de kits de
marqueurs microsatellites polymorphes pour le grand brochet dans le but de les utiliser
dans cette étude comme unité de base de la mesure de la variation génétique. L’utilisation
de marqueurs microsatellites fut préconisée pour leur neutralité et leur degré relativement
élevé de polymorphisme (par rapport à l’ensemble des marqueurs disponibles ; Wan et al.
2004) et leur caractérisation selon un protocole d’analyse fiable et rapide (Chistiakov et al.
2006). Également, puisque le grand brochet est une espèce présentant un faible niveau de
polymorphisme (revu dans Miller & Senanan 2003), l’utilisation d’un grand nombre de
marqueurs a été privilégiée pour l’obtention d’un bon pouvoir de résolution dans les
analyses statistiques.
Objectif 3. Étude de la structure de populations sur l’ensemble du système
(chapitre 2)
Le troisième objectif était de documenter la structure de populations du grand brochet sur
l’ensemble du système lac Ontario – fleuve Saint-Laurent en réalisant une analyse de la
variation génétique observée au niveau des 22 marqueurs microsatellites. La diversité
génétique du grand brochet dans le système a été caractérisée et l’importance de l’isolation
9
par la distance a été évaluée. La détermination de la localisation spatiale de potentielles
barrières au flux génique fut effectuée afin de définir la connectivité des populations.
L’ampleur de la différenciation génétique des différentes localités du système a été
comparée à celle de sites externes géographiquement connectés, incluant certains tributaires
du fleuve Saint-Laurent (rivière Richelieu et rivière des Outaouais) et du lac Ontario
(Rivière Niagara). Notre prédiction stipulait une faible différenciation génétique retrouvée
dans le système à l’instar de celle retrouvée chez le grand brochet dans des systèmes
hautement connectés.
Objectif 4. Caractérisation de l’habitat du système lac Ontario – fleuve Saint-
Laurent (chapitre 2)
L’objectif suivant consistait à construire une base de données géospatiales détaillée des
caractéristiques abiotiques de l’environnement sélectionnées pour l’étude de génétique du
paysage du grand brochet dans la section aval du fleuve Saint-Laurent (secteur du Québec),
de l’extrémité ouest du lac Saint-François jusqu’aux environs de Trois-Rivières.
Objectif 5. Analyse de génétique du paysage (chapitre 2)
Le dernier objectif consistait à identifier les facteurs environnementaux qui interagissent
pour façonner le patron et la magnitude de la structure génétique du grand brochet dans le
fleuve Saint-Laurent dans le but de vérifier l’importance relative de la variation du niveau
d’eau dans l’explication de la structure de populations en lien avec les autres facteurs. Cette
analyse a été réalisée à l’échelle de la section aval du fleuve Saint-Laurent (secteur du
Québec) seulement puisque les données environnementales disponibles n’étaient pas aussi
détaillées pour le lac Ontario que pour cette région, et aussi à cause de la présence d’un
grand trou d’échantillonnage entre la section amont et la section aval du fleuve Saint-
Laurent, ce qui est inapproprié pour les analyses de génétique du paysage (Manel et al.
2003). Selon nos prédictions, notamment, l’hypothèse centrale impliquait dans les secteurs
davantage sujets à de fortes variations interannuelles du niveau une plus faible
différentiation génétique causée par la perturbation de la dynamique de reproduction.
Également, il était attendu que la différentiation génétique soit plus élevée de part et d’autre
des différents barrages présents dans le système. Finalement, on s’attendait à ce que la
10
présence de différentes masses d’eau aux caractéristiques physicochimiques divergentes
coïncide avec une différenciation génétique plus élevée.
11
CHAPITRE 1 : Novel microsatellite markers for
northern pike (Esox lucius) and cross-amplification
across all Esox species
Geneviève Ouellet-Cauchon1*, Eric Normandeau1, Marc Mingelbier2 and Louis Bernatchez1
1 Université Laval, Institut de Biologie Intégrative et des Systèmes (IBIS), 1030 Avenue de la
Médecine, Québec (Québec), G1V 0A6, Canada
2 Ministère du Développement durable, de l’Environnement, de la Faune et des Parcs du Québec
(MDDEFP), Service de la Faune Aquatique, 880 chemin Sainte-Foy, Québec (Québec), G1S 4X4,
Canada
* Corresponding author: Geneviève Ouellet-Cauchon, [email protected]
13
Résumé
Dans le cadre de l’investigation de la génétique du paysage de l’espèce, nous avons
développé 17 nouveaux microsatellites dérivés de marqueurs de séquences exprimées
(« EST sequences ») chez le grand rochet de l’Amérique du Nord, Esox lucius. Nous avons
également testé l’amplification croisée chez les populations européennes de la même
espèce de même que chez cinq autres espèces du genre Esox. Sur 30 individus des trois
populations nord américaines, une déviation significative de l’équilibre d’Hardy-Weinberg
a été détectée mais aucun déséquilibre de liaison entre toutes les paires de loci n’a été
observé. Une moyenne de 6,88 allèles par locus a été détectée et une hétérozygotie attendue
moyenne de 0,49 a été obtenue, mais la diversité génétique était fortement variable selon
les loci (NA s’échelonnait entre deux et 23 allèles et HE variait entre 0,033 and 0,950). Tous
les loci furent amplifiés avec succès pour E. lucius d’Amérique du Nord et d’Europe, de
même que dans le cas du brochet de l’Amur, E. reichertii. Entre huit et 11 loci furent
amplifiés avec succès pour toutes les espèces d’ésocidés et, d’un point de vue général,
quatre des 17 loci furent amplifiés avec succès sur toutes les espèces.
Mots-clés : Esox lucius, grand brochet, microsatellites liés aux marqueurs de séquence
exprimés, amorces, PCR.
14
Abstract
We developed 17 novel microsatellite markers derived from EST sequences in North
American northern pike, Esox lucius, in order to investigate the species’ landscape genetics.
We also tested cross-amplification on European populations of the same species as well as
other (N = 5) Esox species. One significant deviation from Hardy-Weinberg equilibrium
was detected out of 30 individuals from three North American populations. However, no
linkage disequilibrium among all loci pairs was observed. A mean of 6.88 alleles per locus
was detected, with a mean expected heterozygozity of 0.49, and allelic genetic diversity
was highly variable across loci (NA ranging between two and 23 alleles and HE between
0.033 and 0.950). All loci were successfully amplified on E. lucius from North America
and Europe, as well as in the Amur pike, E. reichertii. Between eight and 11 loci were
successfully amplified in other Esox species and, overall, four out of 17 loci were
successfully cross-amplified on all species.
Keywords: Esox lucius, northern pike, EST-linked microsatellite, primers, PCR.
15
Northern pike (Esox lucius) is a nearly ubiquitous fish established in most of the northern
hemisphere’s freshwater bodies and presents a “least concern” status according to UICN
(Freyhof & Kottelat 2008). Nevertheless, this species is heavily exploited by recreational
and commercial fisheries in most regions (Craig 1996) and suffers from habitat alterations
(Casselman & Lewis 1996). Northern pike populations have been shown to go through a
global decline (Casselman & Lewis 1996; Lorenzoni et al. 2002; Westin & Limburg 2002;
Launey et al. 2003; Jacobsen et al. 2005; Lucentini et al. 2006, 2009; Smith et al. 2007). To
achieve proper conservation and management of that resource, better knowledge of the
species’ population genetic diversity and structure must be acquired.
Compared to other fish species, including the European northern pike, North American
northern pike presents a distinctly lower level of genetic diversity and polymorphism
(DeWoody & Avise 2000). Hence, most microsatellite markers previously developed for
Esox lucius lacked polymorphism when used on North American northern pike (Miller &
Senanan 2003). To overcome this problem, we developed 17 novel polymorphic
microsatellite markers for North American northern pike.
We first developed 17 pairs of primers derived from EST sequences found within the
cGRASP EST database (Table 1). Based on blast searches done in the Blast2Go software
(Conesa et al. 2005) using the nr blast database, only EL21 had known annotation, which
corresponded to the Danio rerio solute carrier organic anion transporter family member
2b1 gene. Microsatellite markers were amplified on 30 E. lucius individuals captured from
three locations in St. Lawrence River in North America (Gentilly, 46°24'2"°N, -
72°22'8"°W; St-Jean stream, 45°22'11"°N, -73°46'19"°W; Thousand Islands, 44°25'16"°N,
-75°51'55"°W). Cross-amplification was tested on all five Esox species (northern pike from
Europe [E. lucius, N = 20], Amur pike [E. reichertii, N = 17] from Eurasia, redfin pickerel
[E. americanus americanus, N = 10], grass pickerel [E. americanus vermiculatus, N = 10],
muskellunge [E. masquinongy, N = 10] and chain pickerel [E. niger, N = 10] from North
America). Two markers sets (A and B), which featured respectively six and four markers,
were designed and optimized in multiplexes with fluorescent forward primers (Table 1).
The 10 other markers (sets 1-2-3) were individually amplified using M13 universal primers
(Schuelke 2000) and subsequently pooled in three multiplexes (1 to 3, Table 1) for
16
genotyping. Multiplexed microsatellite markers were amplified using Bio-Rad IQ
Supermix and individual M13 markers were amplified using GoTaq Flexi DNA
Polymerase. PCR cycles started with a 3 min denaturation step at 95°C, followed by 35
cycles with 30s of denaturation at 95°C, 30s of hybridization at 56 °C or 60°C and 30s of
elongation at 72°C, and were completed with a final 30 min elongation step at 60°C. PCR
products were pooled with formamide and ROX size standards from Applied Biosystems.
The electrophoresis of amplified loci was completed using an Applied Biosystems 3130xl
Genetic Analyzer and the raw data were treated with DATA COLLECTION v3.1.1.
Genotypes were resolved using GENEMAPPER v.4.1 and automated scoring manual
verification. Number of alleles per locus (NA), observed and expected heterozygozity (HE,
HO), allele range size, Fis values, linkage disequilibrium (LD) tests and Hardy-Weinberg
equilibrium (HWE) tests (both on all the three northern pike populations and over each of
them), were computed with GENEPOP v.4.2 (Raymond & Rousset 1995). For multiple
tests, Bonferroni corrections were applied (Rice 1989).
For North American E. lucius, allele sizes ranged between 111 and 376 bp (Table 2). Only
one significant deviation from HWE (Table 2) was observed for EL16 among the three
populations. No significant deviations from HWE or from LD were observed in individual
populations. The average level of genetic variation was moderate (mean NA = 6.88, mean
HE = 0.49, mean HO = 0.51; Table 2) and highly variable across loci (NA ranged between
two and 23 alleles, HE and HO ranged between 0.033 and 0.950 and 0.033 and 0.967,
respectively (Table 2). Fis values varied between -0.06 and 0.13, except for EL16 which
revealed a strong deficit in heterozygotes with a value of 0.65 (Table 2) and most likely
presents null alleles. All loci were successfully amplified in both E. lucius from North
America and Europe and E. reichertii from Eurasia (Table 2). Among the other species, the
number of successfully amplified loci varied between eight and 11. Moreover the quality of
amplification was generally lower than observed in E. lucius and E. reichertii. Overall, four
out of 17 loci were successfully cross-amplified on all Esox species for the tested PCR
conditions (Table 2). Given the scarcity of microsatellite markers currently available for
members of the genus Esox, these new polymorphic microsatellite markers should be very
useful to assist the study of lowly polymorphic E. lucius populations in North America and
17
in other regions of the world. These markers could also benefit studies of other Esox
species.
Acknowledgements
Funding for this project was provided by the Natural Sciences and Engineering Research
Council of Canada (NSERC) collaborative project grant accorded to Louis Bernatchez and
from the Ministère du Développement durable, de l’Environnement, de la Faune et des
Parcs du Québec (MDDEFP). Funding from NSERC, Fonds de Recherche du Québec
Nature et Technologies (FQRNT), Fonds de soutien à la Maîtrise from Département de
Biologie of Université Laval and Québec-Océan (QO) financially supported Geneviève
Ouellet-Cauchon during her M.Sc. This project is a contribution to the research program of
QO. We thank John M. Farrell (SUNY College of Environmental Science and Forestry),
Michael M. Hansen (Aarhus University), Julien April (Université Laval), Erling Holm
(Royal Ontario Museum), Mike Douglas (Prairie Research Institute), Philippe Brodeur and
Suzanne Lepage (MDDEFP), Chenghui Wang (Shanghai Ocean University), Gregory Maes
(KU Leuven) and Andres Lopez (University of Alaska Museum) for providing tissue
samples. We thank Guillaume Côté, Lucie Papillon, Marie-Hélène Perrault and Amélie
Gilbert from Université Laval for laboratory assistance.
18
Table 1.1. Microsatellite markers amplification characteristics. Marker sets A and B were
amplified in multiplexes and sets 1-3 were amplified independently then pooled for
electrophoresis. TA: annealing temperature.
Locus Marker
set
Repeat
motif Primer sequence 5'-3'
Fluorescent
color
TA
(°C)
Concentration
in PCR reaction
(pg/ul)
EL01 3 AG F: CAGCACTATCCAAAGGCGTAG VIC 60 0.18
R: TCTTCCACCGTTATCATCACA
EL02 A AC F: ACACATGCGTCTACAAGCACA VIC 60 0.18
R: CCTCCCTGGCATACGTCTTAC
EL03 A CA F: GGCGAGTTAGGAGCTCAGGTA VIC 60 0.12
R: TGGGGAGCGATGTGTATGTA
EL05 A AC F: GGAAATGGGGAGTCTCCTGTA NED 60 0.08
R: TGCAAACAGTCCTTTTGGAAG
EL09 2 CA F: TTTAATGACAATGCCCACTGC 6-FAM 60 0.18
R: ACTCCGCATGAGAGAGACAGA
EL10 2 AC F: CACCTGTCCTCACTTTGATTG NED 60 0.18
R: GTGGTTCCATGTGTGTCTCAG
EL12 A CA F: TGGGGTTGTACACAAACTTTCTC 6-FAM 60 0.18
R: TAGCCCAATCATTACCCTTGG
EL15 B CGCA F: TGAAAAGCAGTGTTGCATCTG NED 60 0.11
R: TTCTGTCCATCCATCTCCATC
EL16 3 TATG F: GGGTGAAGATTCCCATAAAGC 6-FAM 60 0.18
R: AGTGTTGGTGACGTTGACTCC
EL17 B AC F: GTGCTTTTGGGTACAATCAATG NED 60 0.23
R: TTTCACCAAATACCTGGTCTCA
EL19 3 GT F: GAGGTTCAAAAGGAAGGGTTG NED 60 0.18
R: AAGAACACTTCACCGCCATAA
EL20 A AC F: CCAAAGCCAGTTGATGCTAAG 6-FAM 60 0.18
R: CTCAAACTGTGCCTCACACAA
EL21 2 AG F: GAGGAGTGCACAGAGAACAGG VIC 60 0.18
R: CCAAAACTGGTGAACACAACC
EL22 B CT F: ACATTCATTCGGAGCAGTCAG 6-FAM 60 0.33
R: CCCATGCCAATGAAGATATTG
EL23 A GA F: GTGCGTTCGTCTCTCATCTTC VIC 60 0.14
R: GATCTGTCCATCCTTCCTGTG
EL26 1 AG F: ACAGGGATATGTCATGGTGGA 6-FAM 60 0.18
R: CCAAAACTGGTGAACACAACC
EL27 B TAC F: AATGCTTCTGAATGCTTGCAC 6-FAM 60 0.08
R: CAAAGGATAGACAGCAAAGCAA
EL28 1 CT F: TGTAGGTGCACTGTGGAGATG VIC 60 0.18
R: ACGCACACAAAGGGAATAGTG
19
Table 1.2. Microsatellite markers characteristics in Esox lucius from North America and other Esox species. NA: Number of alleles;
HO/HE: Observed/expected heterozygozity; Quality (of amplification): +++ 100% success, ++ ≥50% success, + <50% success, - no
amplification.
Locus
E. lucius (North America, N = 30)
Cross-amplification
E. lucius (Europe, N = 20) E. americanus americanus
(N = 10)
E. americanus vermiculatus
(N = 10)
Quality
Allele
size
range
(bp)
NA HE HO Fis P-
HWE Quality NA HE
Allele
size
range
(bp)
Quality NA HE
Allele
size
range
(bp)
Quality NA HE
Allele
size
range
(bp)
EL01 +++ 317-327 5 0.6283 0.6333 -0.01 0.4444 ++ 3 0.3778 335-343 - - - - - - - -
EL02 +++ 197-211 6 0.5113 0.5000 0.02 0.3771 +++ 7 0.8256 183-207 +++ 2 0.1895 176-182 +++ 3 0.5316 180-184
EL03 +++ 126-142 7 0.4763 0.5000 -0.05 0.5985 +++ 6 0.6308 118-134 +++ 1 0 120 +++ 1 0 118
EL05 +++ 176-192 7 0.6090 0.6000 0.02 0.7941 +++ 6 0.7026 164-192 + 4 0.2600 178-190 - - - -
EL09 +++ 120-134 11 0.8576 0.8333 0.03 0.8118 +++ 8 0.7013 134-150 +++ 2 0.3462 114-115 ++ 3 0.4059 114-116
EL10 +++ 188-192 2 0.0333 0.0333 0.00 NA +++ 5 0.5030 202-214 ++ 1 0 164 - - - -
EL12 +++ 148-162 6 0.4215 0.4000 0.05 0.7208 +++ 3 0.1845 144-166 + 3 0.2429 154-158 + 4 0.2000 150-160
EL15 +++ 111-131 6 0.4503 0.4000 0.11 0.2235 +++ 2 0.4662 115-123 ++ 3 0.2556 115-123 + 1 0 123
EL16 +++ 317-341 5 0.5921 0.9667 -0.65 0.0000 +++ 2 0.4824 347-351 - - - - - - - -
EL17 +++ 329-341 4 0.3452 0.3333 0.03 0.7253 +++ 8 0.7905 329-249 + 1 0 337 + 1 0 337
EL19 +++ 178-186 4 0.2678 0.2333 0.13 0.4944 +++ 4 0.4526 180-192 - - - - - - - -
EL20 +++ 308-376 23 0.9503 0.9667 -0.02 0.7249 +++ 13 0.9282 320-360 - - - - + 2 NA 345-347
EL21 +++ 227-253 7 0.3537 0.3667 -0.04 0.6268 +++ 5 0.6081 241-257 - - - - - - - -
EL22 +++ 295-303 4 0.4311 0.5000 -0.16 0.7637 +++ 5 0.6654 267-297 ++ 7 0.5364 259-301 +++ 2 0.1000 265-285
EL23 +++ 246-267 8 0.6616 0.7000 -0.06 0.4514 +++ 7 0.6814 275-290 - - - - - - - -
EL27 +++ 152-173 7 0.4746 0.4667 0.02 0.7074 +++ 6 0.6689 158-173 +++ 2 0.3368 155-167 +++ 3 0.5684 161-167
EL28 +++ 256-270 5 0.1898 0.1667 0.12 0.2208 +++ 9 0.7859 282-326 +++ 1 0 260 +++ 1 0 250
20
Table 1.2. Microsatellite markers characteristics in Esox lucius from North America and other Esox species. NA: Number of alleles;
HO/HE: Observed/expected heterozygozity; Quality (of amplification): +++ 100% success, ++ ≥50% success, + <50% success, - no
amplification.
Locus
Cross-amplification
E. masquinongy (N = 10) E. niger (N = 10) E. reichertii (N = 17)
Qualit
y
N
A HE
Allele
size
range
(bp)
Quality NA HE
Allele
size
range
(bp)
Quality NA HE
Allele
size
range
(bp)
EL01 - - - - - - - - ++ 1 0 329
EL02 - - - - + 1 0 164 + 1 0 171
EL03 +++ 11 0.8737 145-175 ++ 2 0.4765 112-114 + 2 0.0588 114-116
EL05 + 1 0 190 - - - - + 5 0.2017 170-190
EL09 - - - - ++ 5 0.5667 114-168 +++ 5 0.6863 114-122
EL10 - - - - ++ 1 0 164 +++ 1 0 190
EL12 - - - - + 2 NA 158-160 + 3 0.1597 140-150
EL15 - - - - - - - - + 2 0.1711 111-115
EL16 - - - - - - - - ++ 2 0.2125 285-351
EL17 + 3 0.2857 337-343 - - - - +++ 1 0 303
EL19 ++ 4 0.5882 170-186 - - - - ++ 6 0.6836 192-212
EL20 - - - - - - - - + 2 0.1261 315-317
EL21 ++ 2 0.1000 221-223 - - - - +++ 1 0 239
EL22 ++ 3 0.5533 297-301 ++ 5 0.4455 259-301 ++ 1 0 289
EL23 - - - - - - - - + 1 0 250
EL27 +++ 2 0.1895 148-151 ++ 3 0.5333 141-158 +++ 2 0.2585 130-136
EL28 + 3 0.2857 302-308 + 2 0.1714 252-256 ++ 1 0 264
21
CHAPITRE 2 : Spatially variable extent of
population structure in northern pike (Esox lucius)
explained by landscape features
Geneviève Ouellet-Cauchon1*, Marc Mingelbier2, Frédéric Lecomte2 and Louis Bernatchez1
1 Université Laval, Institut de Biologie Intégrative et des Systèmes (IBIS), 1030 Avenue de la Médecine,
Québec (Québec), G1V 0A6, Canada
2 Ministère du Développement durable, de l’Environnement, de la Faune et des Parcs du Québec (MDDEFP),
Service de la Faune Aquatique, 880 chemin Sainte-Foy, Québec (Québec), G1S 4X4, Canada
* Corresponding author: Geneviève Ouellet-Cauchon, [email protected]
23
Résumé
Un nombre croissant d’études ont investigué l’influence de facteurs environnementaux
contemporains sur la structure génétique de populations, mais un facteur qui jusqu’à
maintenant est demeuré peu étudié est la stabilité de l’habitat. A cette fin, un modèle d’aire
d’étude approprié est le système lac Ontario – fleuve Saint-Laurent qui présente localement
divers degrés de variation interannuelle du niveau d’eau. Dans cet article, nous
documentons la génétique du paysage du grand brochet (Esox lucius), un poisson fortement
exploité qui fraie dans les plaines d’inondation, en se basant sur l’analyse de près de 3000
individus provenant de 40 sites d’échantillonnage en utilisant 22 marqueurs microsatellites
dans le système lac Ontario – fleuve Saint-Laurent. La structure génétique sur l’ensemble
de l’aire d’étude était globalement très faible (Fst = 0.0208) mais spatialement variable avec
un niveau moyen de différenciation dans la section amont (Ontario) de l’aire d’étude étant
trois fois plus importante (Fst = 0.0297) que dans le secteur aval (Québec, Fst = 0.0100).
Vingt variables environnementales furent considérées et un modèle de régression multiple
sur matrices de distances (R2 = 0.6397, P < 0.001) a révélé que les masses d’eau (b =
0.3617, P < 0.001) et la présence de barrages (b = 0.4852, P < 0.005) ont réduit la
connectivité et conséquemment augmenté la structure génétique de populations. De plus, la
stabilité interannuelle du niveau d’eau était positivement associée à l’intensité de la
différenciation génétique (b = 0.3499, P < 0.05). Comme une importante variation du
niveau d’eau influe sur la qualité et la localisation annuelle des habitats de reproduction de
grand brochet, l’instabilité locale de l’habitat sous la forme de la variation interannuelle du
niveau d’eau semble localement empêcher la structure génétique de populations,
probablement en empêchant le comportement de philopatrie. La gestion du grand brochet
devrait être conséquemment reconsidérée dans une perspective de métapopulation,
particulièrement dans les régions qui présentent une importante variation du niveau d’eau.
24
Mots-clés : structure génétique de populations, Esox lucius, variation environnementale,
stabilité de l’habitat, gestion, conservation, génétique du paysage.
25
Abstract
A growing number of studies have been investigating the influence of contemporary
environmental factors on population genetic structure, yet one factor that has been poorly
studied is habitat stability. To this end, an appropriate model study area is Lake Ontario –
St. Lawrence River system that locally presents diverse degrees of inter-annual water level
variation. In this paper, we document the landscape genetics of northern pike (Esox lucius),
a heavily exploited fish that spawns in flood plains, based on the analysis of nearly 3000
individuals from 40 sampling sites using 22 microsatellite markers in the Lake Ontario – St.
Lawrence River system. Genetic structure over whole study area was globally very weak
(Fst = 0.0208) but spatially variable with mean level of differentiation in the upstream
(Ontario) section of the studied area being three-fold higher (Fst = 0.0297) than observed in
the downstream (Québec) sector (Fst = 0.0100). Twenty environmental variables were
considered and a multiple regression on distance matrices model (R2 = 0.6397, P < 0.001)
revealed that water masses (b = 0.3617, P < 0.001) and the presence of man-made dams (b
= 0.4852, P < 0.005) reduced connectivity, thus enhancing population genetic structure.
Moreover, inter-annual water level stability was positively associated to the extent of
genetic differentiation (b = 0.3499, P < 0.05). Since high water level variation impacts on
yearly quality and localization of northern pike spawning habitats, local habitat instability
which is under the form of inter-annual water level variation seems to locally impede
population genetic structure, perhaps by inhibiting philopatry behavior. Thus, northern pike
management should be carefully reconsidered in a metapopulation perspective, especially
within sensitive areas that present high water level variation.
Keywords: population genetic structure, Esox lucius, environmental variation, habitat
stability, management, conservation, landscape genetics.
26
Introduction
Landscape genetic studies have mostly focused on long-term processes that structure
populations. Recently, a growing number of studies have been focusing on quantifying the
influence of natural and anthropic contemporary environmental changes that may alter
population genetic structure. Since landscapes are dynamic, environmental features may be
continuously altered by different levels of temporal landscape fluctuations. Environment
temporal instability has been previously suggested to impact on biological diversity
(reviewed in Fjeldså & Lovett 1997), population size and persistence (Nelson et al. 1987;
Ostergaard et al. 2003), reproductive success (Titus & Mosegaard 1992) and dispersal
(Baggiano et al. 2011; Messier et al. 2012). Since habitat stability level influence various
aspects of population dynamics, its impact should be integrated in conservation strategies
and in management plans of exploited species (Ostergaard et al. 2003).
Temporal landscape unsteadiness has also been shown to affect the temporal stability of
population genetic structure, namely in insects (Baggiano et al. 2011), amphibians
(Fitzpatrick et al. 2009), mammals (Messier et al. 2012) and freshwater fishes (Garant et al.
2000; Ostergaard et al. 2003). Most of these studies assessed temporal stability of genetic
structure in a uniformly unstable habitat over the studied range of the species. In contrast,
to our knowledge, for one species and in a single connected system, no study has
investigated the consequences on population genetic structure of a range of different levels
of habitat stability in relation to other environmental factors.
Due to its two components that greatly differ from their stability dynamic, Lake Ontario –
St. Lawrence River system from the Great Lakes basin in north eastern North America
represent a particularly relevant study site to investigate the impact of spatially variable
habitat stability on freshwater fish population genetic structure (Figure 2.1). More
specifically, Lake Ontario, the easternmost and the smallest of the Great Lakes, with a
length of 311 km and a width of 85 km and totalling 19 000 km2 (Rukavina & Boyce
2012), receive most of its water from Great Lakes via the Niagara River and discharges into
the St. Lawrence River. The St. Lawrence River, with a mean stream flow of about 12
600 m3/s near Quebec city (Gingras 1997), stretches on 1197 km (Marsh 2012) comprising
three fluvial lakes (from west to east, Lake St. Francis, Lake St. Louis and Lake St. Pierre).
27
The two major tributaries of the St. Lawrence River are the Ottawa River and Richelieu
River whose inflow seasonally varies, with an annual average at their mouth of 1937 and
374 m3/s, respectively (Gingras 1997). Ottawa River discharges in Lake Des Deux
Montagnes, itself discharging into Lake St. Louis whereas the Richelieu River discharges
about 20 km upstream Lake St. Pierre.
The Lake Ontario – St. Lawrence River system is also characterised by two main water
masses with distinct physicochemical properties (Annexe 1) : the so-called “green waters”
from Lake Ontario and the “brown waters” from Ottawa River (Centre Saint-Laurent 1996 ;
Leclerc et al. 2008). They flow in parallel in St. Lawrence River corridor with limited
mixing (Centre Saint-Laurent 1996). Moreover, several hydroelectric dams and water
regulation dams were built between 1914 and 1980 (Gingras 1997) throughout the St.
Lawrence River (Figure 2.1). Climatic conditions, by driving water flow fluctuations in the
system, naturally cause inter-annual water level variations (Mingelbier et al. 2004). One
major water regulation dam was built in 1960 in the upstream part of St. Lawrence River
corridor (Moses-Saunders dam, Figure 2.1) to seasonally and inter-annually control water
level, a role that is also completed by other hydroelectric dams (Gingras 1997).
Consequently, water levels of the “Ontario sector”, comprising Lake Ontario and upper St.
Lawrence River, remain considerably stable on an inter-annual basis, in contrast to
downstream dam complex in the “Quebec sector”, represented by the lower St. Lawrence
River, where water level increasingly inter-annually fluctuate towards Quebec city
(Ministère du Développement durable, de l’Environnement, de la Faune et des Parcs du
Québec, unpubl. data).
Such water level variation may considerably shape fish spawning habitat by influencing
local water depth that in turn influences vegetation location and density, water temperature
and water velocity (Mingelbier et al. 2008). Furthermore, for fish species spawning in flood
plains, water level variation influences young-of-the-year survival and year-class strength
since premature spring water retrieval can cause massive mortality of eggs and larvae
(Dumont & Fortin 1977; Fortin et al. 1982; Mingelbier et al. 2008). However, the impacts
of these events on fish species population structure have not been investigated.
28
Being one of the most widely distributed and a heavily exploited fish by recreational
fishing in this system, northern pike (Esox lucius) is particularly appropriate for studying
the impact of habitat stability in relation to other environmental features on population
genetic structure. Northern pike is mainly sedentary (reviewed by Craig 1996; Rosell &
MacOscar 2002; Koed et al. 2006; Vehanen et al. 2006; Bosworth & Farrell 2006). There is
also some evidence of a certain level of natal-site spawning fidelity (Miller et al. 2001;
reviewed by Craig 2008), but philopatry rate still remains undefined. In the Lake Ontario –
St. Lawrence River system, northern pike spawns in early spring during spring flood in
shallow and lentic warmer waters of wetlands where dense vegetation occurs (Jude &
Pappas 1992; Mingelbier et al. 2004, 2008) and thus could be extensively influenced by
water level variation. In this context, our general objective was to investigate the possible
consequences of the extent of habitat temporal stability on the population genetic structure
pattern of northern pike (Esox lucius), and relative to others landscape features that could
putatively affect connectivity in the system. We thus first documented the number of
genetically distinct populations in the system, as well as their spatial distribution and level
of connectivity. Secondly, we statistically assessed which environmental factors best
explain the observed pattern of population genetic structure by means of a landscape
genetics approach.
29
Material and methods
Sample collection
Between 20 and 162 individuals per locality were sampled at 40 sites in 2007, 2009 and
2010 (Figure 2.1 and Table 2.1), totalling 2913 northern pikes. The 750-km long study area
was subdivided in two regions on the basis of the occurrence of a 150 km sampling gap in
the middle St. Lawrence River due to lack of suitable northern pike habitat and thus low
abundance of the species. These two regions (upstream Ontario sector including Lake
Ontario and upper St. Lawrence River and downstream Quebec sector comprising lower St.
Lawrence River) are also separated by the Moses-Saunders regulation dam. Four sampling
sites were geographically partially isolated from the main study system as they were either
tributaries or isolated basins and hence they were considered lake or fluvial “annexes”
(Niagara River, site 1; Hamilton basin, site 2; and Richelieu and Ottawa Rivers, sites 22-
23; Table 2.1 and Figure 2.1). Sampling mainly occurred during the spawning period from
mid-March to the end of May (Farrell et al. 2006), although several samples were collected
slightly before or after spawning (Table 2.1). Angled northern pike were sampled during
the ice fishing season before spawning time and trap nets were used to sample individuals
during and after spawning.
Genetic data
Genomic DNA was extracted from fins clips preserved in 95% ethanol using a salt
extraction method (Aljanabi & Martinez 1997). Twenty-two microsatellite markers (Table
2.2) were amplified with multiplex PCR reactions using Bio-Rad IQ Supermix. Twelve of
these were previously published (Miller & Kapuscinski 1997; Genetic Identification
Service Inc. 2000; Hansen & Nielsen 2000; Aguilar et al. 2005) whereas the other ten
markers were developed by us (see Chapter 1 ; Ouellet-Cauchon et al. in prep.). PCR
cycles started with a 3 min denaturation step at 95°C, followed by 35 cycles of 30s of
denaturation at 95°C, 30s of hybridization at 56 °C or 60°C and 30s of elongation at 72°C,
and completed with a 30 min final elongation at 60°C. PCR products were pooled with
formamide and LIZ (multiplex 1) or ROX (multiplexes 2-3-4) size standards from Applied
Biosystems. Electrophoresis of the amplified loci was completed using an Applied
Biosystems 3130xl Genetic Analyzer and the raw data were treated with DATA
30
COLLECTION v3.1.1. Genotypes were resolved using GENEMAPPER v.4.1 and
automated scoring manual verification.
Intra-population diversity and structure
For each sampling site, Fis values were calculated and exact tests for deviations from
Hardy-Weinberg proportions and linkage equilibrium were computed using GENEPOP
(Raymond & Rousset 1995) and Bonferroni corrections were applied (α = 0.05 ; Rice
1989). We evaluated expected (HE) and observed (HO) heterozygosity with GENETIX
v.4.05.2 (Belkhir et al. 2004), allelic richness (Ar) and private allelic richness (Apr) over all
loci both standardized for smallest sample size (N = 20) with HP-RARE (Kalinowski
2005). Temporal stability of genetic structure between 2009 and 2010 samples was
assessed with an analysis of molecular variance (AMOVA, ARLEQUIN v.3.1, Excoffier et
al. 2005) with selection of sites of minimum 20 samples each year. This revealed a very
weak, albeit significant variation between years which was 10 times smaller than the extent
of spatial genetic structure (0.12% vs. 1.38%, P < 0.01 ; Annexe 2). In the same way, we
also assessed the stability of genetic structure as a function of sampling period (prior and
during spawning period), and again a significant but very weak variation was found
between sampling periods relative to spatial structuring (0.13% vs. 1.22%, P < 0.05;
Annexe 2). Percentage of spatial genetic variation differed in these two tests since two
different sets of sampling sites were used for these analyses. Given that these analyses
revealed no major effect of the sampling period, temporal samples were pooled for
subsequent analyses.
Population structure
Pairwise Fst values were computed with GENETIX v.4.05.2 (Belkhir et al. 2004) and a
False Discovery Rate (FDR) correction for multiple testing at P < 0.05 was applied
(Benjamini & Hochberg 1995). Isolation by distance (IBD) was tested with Mantel tests
(Mantel 1967) using ecodist R package (R Development Core Team 2007) and pairwise Fst
/(1-pairwise Fst) were plotted as a function of the shortest waterway geographic distance
between sites (Rousset 1997). Mantel’s tests were computed for the whole study area and
for comparisons within the Ontario sector and within the Quebec sector excluding the four
31
annexes. Genetic population structure was unsuccessfully assessed with STRUCTURE
software (Pritchard et al. 2000), that is incongruous clusters were obtained because of weak
global level of genetic differentiation (see Results below ; Latch et al. 2006 ; Jones &
Wang 2012). Consequently, we alternatively used the BARRIER software v.2.2 to identify
putative barriers to dispersal between all sampling sites and the 20 strongest barriers in
terms of relative strength were first retained (Manni et al. 2004). Barrier relative strength is
an index of a given barrier’s relative force in the system and it was evaluated by calculating
ratio of mean pairwise Fst value over all crossed edges from every pair of sites of a given
barrier and maximum pairwise Fst value observed, and then converted into percentage
(Manni et al. 2004). Barriers strength was plotted as a function of downstream waterway
distance, the starting point being western Lake Ontario (site 2), and correlation was
assessed using the Spearman’s correlation coefficient. Barriers isolating St. Lawrence River
tributaries were not considered here. Barriers boundaries were used to delimit population
groupings which were subsequently evaluated using AMOVA (ARLEQUIN v.3.1,
Excoffier et al. 2005) and, in parallel, mean pairwise Fst were assessed between groupings.
To assess the relative extent of genetic structure across the system, global Fst values were
computed for the whole study area, for the Ontario and Quebec sectors separately, both
with and without the four annexes, with GENETIX v.4.05.2 (Belkhir et al. 2004).
Landscape genetics
Landscape genetic analysis was performed on the Quebec sector only (lower St. Lawrence
River) since available environmental data were not as detailed for Lake Ontario region, and
also because of the large sampling gap of 150 km between the upper and lower St.
Lawrence River which is inappropriate for landscape genetics analysis (Manel et al. 2003).
Pairwise environmental distance matrices for values at sampling sites were built for 20
environmental variables (Table 2.3). To select variables most explicative of the observed
pattern of genetic structuring and to avoid including too many variables in the same
multivariate model, Mantel tests were done (Mantel 1967) for pairwise Fst matrix coupled
to each pairwise environmental distance matrices (ecodist R package, R Development Core
Team 2007). Six environmental variables were thus selected (Table 2.4, five variables with
Mantel’s r2 > 0.10 and P < 0.05, in addition to waterway geographic distance). Secondly,
32
collinearity between environmental variables was assessed by Mantel tests (Mantel 1967;
ecodist R package, R Development Core Team 2007), which led to removal of the pH
variable which was highly correlated with spring water conductivity (Mantel’s r = 0.86, P <
0.05; e.g. Martiny et al. 2011). Thirdly, to assess the relative contribution of the retained
variables to the model, a multiple regression on distance matrices model (MRM; Legendre
et al. 1994) was computed on selected variables with the ecodist R package (R
Development Core Team 2007). A full model was run with all six standardized
environmental variables, and the following final model only included the three significant
variables from full model. For each model, Pearson’s correlation coefficient was computed
and 9999 permutations were used to assess significance.
Finally, because we were particularly interested in the relationship of inter-annual water
level variation, the relationship of that variable with genetic structure was further evaluated
over the whole study area. We divided the sampling area in windows of 50 km width a 25
km sliding. We then computed mean pairwise Fst values between sites within each window
and mean of inter-annual water level variation coefficients calculated for each sampling site
within each window. Mean pairwise Fst values and mean inter-annual water level variation
coefficients were plotted as a function of downstream waterway distance (from site 2) for
each window. Moreover, mean pairwise Fst values were plotted as a function of mean inter-
annual water level variation coefficients for each window for both upstream (Ontario
sector) and downstream (Quebec sector) of the Moses-Saunders regulation dam. Spearman
correlation coefficients were assessed for each of the four plots. When not mentioned
otherwise, analyses where computed with R software (R Development Core Team 2012).
33
Results
Intra-population diversity and structure
Genetic diversity was modest and comparable among sampling sites (mean HE = 0.63
[range = 0.57-0.66], mean HO = 0.63 [range = 0.54-0.68], mean Ar = 5.65 [range = 4.63-
5.99], mean Apr = 0.05 [range = 0.01-0.16]; Table 2.1). Still, the four annexes globally
presented a slightly lower genetic diversity (HE ranged between 0.57 and 0.64; Ar ranged
between 4.63 and 5.46; Table 2.1) than mean values for all sampling sites (Table 2.1).
Similarly, Greenstone Island East (site 16, HE = 0.59, Ar = 5.15) in the Thousand Islands
region within upper St. Lawrence River presented a lower genetic diversity than mean
values. Mean Fis on all loci was low (0.01 [range = -0.05-0.07]; Table 2.1). Hardy-
Weinberg equilibrium showed a random pattern of significant deviations among markers
and among populations and linkage disequilibrium tests revealed that no loci were strongly
linked since no consistent pattern was detected.
Population structure
Given its geographic scale, the global extent of genetic structure across the whole study
area (more than 750 km) was weak (global Fst = 0.0208, P < 0.001). Pairwise Fst values
ranged between -0.0037 to 0.1123 (Annexe 3). The four annexes were the most divergent
sites with a mean pairwise Fst values with all sites of 0.064 for Niagara River (site 1), 0.091
for Hamilton basin (site 2), 0.028 for Richelieu River (site 22) and 0.028 for Ottawa River
(site 23). IBD relationship was significant (Mantel’s r = 0.4812, P = 0.0001) and
moderately pronounced for the whole study area (slope = 6.17X10-5, P < 0.00001 ; Figure
2.2). However, genetic divergence increased more steeply with waterway geographic
distance within the Ontario sector (slope = 6.32X10-5, P < 0.00001) than within the Quebec
sector (slope = 2.06X10-5, P = 0.00308) and waterway distance explained a greater part of
genetic distance within the former sector (Mantel’s r = 0.4905, P = 0.0001) than the latter
sector (Mantel’s r = 0.2454, P = 0.0038).
The spatial variation in patterns of IBD was also reflected by the geographic distribution of
the first 20 barriers inferred by BARRIER (Figures 2.3 and 2.4). Thus, the majority of
barriers were stronger in the Ontario (Figure 2.3A) than in the Quebec sector (Figure 2.3B),
34
and the strength of barriers significantly decreased from upstream Lake Ontario to
downstream St. Lawrence River (Spearman's ρ = -0.6963, P = 0.0013; Figure 2.4).
Accordingly, global Fst values were three times higher in the Ontario sector with and
without annexes (Fst = 0.0297, P < 0.001 and Fst = 0.0186, P < 0.001, respectively) than in
Quebec sector with and without annexes (Fst = 0.0100, P < 0.001 and Fst = 0.0051, P <
0.001, respectively).
Barriers that were defined determined the occurrence of 12 putative populations within the
Ontario sector (Figure 2.3A) and 8 putative populations within the Quebec sector (Figure
2.3B). For the Ontario sector, from upstream to downstream, these were 1) west Lake
Ontario, 2) north-west Lake Ontario, 3) West Lake, 4) Bay of Quinte, 5) Cataraqui River,
6) west Thousand Islands, 7) center-south Thousand Islands and 8) center-north Thousand
Islands, 9) French Creek and 10) Crooked Creek and finally 11) Hamilton basin and 12)
Niagara River as lake annexes. For the Quebec sector, from upstream to downstream, these
putative populations were 1) west Lake St. Francis, 2) east Lake St. Francis, 3) Lake des
Deux Montagnes, 4) north Lake St. Louis, 5) south Lake St. Louis and St. Lawrence River
middle stretch up to west Lake St. Pierre, 6) east Lake St. Pierre, and lastly 7) Richelieu
River and 8) Ottawa River as fluvial tributaries. The AMOVA revealed that there was more
variation between these groupings than between sites within them for whole study area
(2.06% vs. 0.19%, P < 0.00001). There was stronger structuring between the 12 groupings
(putative populations) within the Ontario sector (2.77% vs. 0.31%, P < 0.001) than within
the 8 groupings of Quebec sector (1.05% vs. 0.15%, P < 0.00001). Thus, because the extent
of genetic variance between sample groupings defined by BARRIER was significant and
because it was about 10 times more pronounced than between sampling sites within them,
we consider these groupings as the most likely genetically distinct pike populations in the
study area. Given that these AMOVAs must be carefully interpreted since a few groupings
include only one sampling site, mean pairwise Fst values between these grouping are
reported at Annexe 3.
35
Landscape genetics
From the initial set of 20 environmental variables, Mantel’s tests enabled to select six
variables most correlated with pairwise Fst (Mantel’s r2 > 0.10 and P < 0.05; Table 2.4).
Multiple regression on distance matrices full model (Table 2.5) revealed that pairwise data
on dam index (b = 0.4852, P = 0.0029), spring water conductivity (b = 0.3617, P = 0.0001)
and inter-annual water level stability (b = 0.3499, P = 0.0178) were significantly correlated
with pairwise Fst values (R2 = 0.6411, P = 0.0001; Table 2.5), whereas the other two
variables were not significant. The final model comprising the three significant variables
presented a similar correlation level (R2 = 0.6397, P = 0.0001; Table 2.5).
Downstream of the Moses-Saunders dam, water level variation was high and steeply
increased with downstream waterway distance (ρ = 1.0000, P < 0.0001; Figure 2.5A),
contrary to upstream Moses-Saunders dam where water level variation was very low and
the apparent slope was much weaker and the relationship weaker (ρ = -0.7545, P = 0.0305;
Figure 2.5A). At the scale of the whole study area, spatial genetic differentiation pattern
was extremely different within the Ontario and Quebec sectors. Indeed, mean pairwise Fst
values decreased significantly with downstream waterway distance below the Moses-
Saunders dam (ρ = -0.8061, P = 0.0082; Figure 2.5B), whereas this relationship was not
significant above that dam (ρ = -0.2381, P = 0.5821; Figure 2.5B). Finally, upstream of the
Moses-Saunders dam, mean pairwise Fst values were not correlated to mean inter-annual
water level variation coefficients (ρ = -0.0958, P = 0.8215; Figure 2.5C), whereas a strong
negative correlation was observed downstream of the dam (ρ = -0.8061, P = 0.0082; Figure
2.5D).
36
Discussion
This study’s objectives were to determine the number, extent and connectivity between
northern pike populations within the Lake Ontario and the St. Lawrence River system, as
well as identifying how environmental factors were influencing the observed population
structure, with a priori prediction on inter-annual water fluctuation. Globally, northern pike
presented weak but spatially variable genetic structure through the whole study area. The
Ontario sector, located above Moses Saunders regulation dam, was more structured than
Quebec sector below that dam. From 20 environmental variables tested, three were found to
significantly influence the observed pattern of population structure including inter-annual
water level variation, different water masses and dam’s presence. Below we discuss the
possible causal associations between observed genetic patterns and these environmental
factors and we compare our results with those of previous studies.
Landscape genetics
Inter-annual water level variation
Even if other factors play an important role in the explanation of the genetic differentiation,
inter-annual water level variation remains our main factor of interest. Downstream Moses-
Saunders regulation dam (Quebec sector), we first observed that inter-annual water level
variation was negatively correlated to the extent of genetic population structure. Prior to
this study, yearly localization and quality of northern pike spawning habitat had been
modelled as a function of annual water levels within lower St. Lawrence River by
Mingelbier et al. (2008). These authors found that inter-annual water level variations may
indeed modulate localization, surface and access to spawning areas and also determine
young-of-the-year survival (Dumont & Fortin 1977; Fortin et al. 1982; Mingelbier et al.
2008). When hydraulicity attained weak levels for four successive years in the 80’s,
spawning habitats has been be reduced by 17% every year (Mingelbier et al. 2004;
Mingelbier & Morin 2005) and related impacts on reproductive success are cumulative.
Clearly then, such temporally unstable habitat loss, in addition to habitat degradation and
fragmentation from human activities, may impact the temporal stability and the extent of
population structure, especially in areas that are more affected by water level variations.
Indeed, at a given locality, the more water levels vary inter-annually, the more suitable
spawning habitats do not spatially coincide between years. For example, in Lake St. Pierre
37
within the lower St. Lawrence River modelled northern pike suitable spawning habitat
spatially differed for two extreme water level scenarios (Figure 2.6; data from Mingelbier et
al. 2008). It implies that in nature, year after year, depending on annual water level,
available spawning habitat location and quality will vary. Consequently, adult northern pike
ready to spawn may be unable to return to their previously suitable natal site which could
be completely above water level during that year. In such a case, they would possibly seek
an alternative suitable spawning area. This would hypothetically limits adults northern
pike’s ability to return to spawn at their natal site and, consequently, this would impede the
maintenance of a pronounced local population genetic structure. For instance, in the
Quebec sector of the study area, it may explain the underlying overall weakness of
population genetic structure. Genetic differentiation varied negatively as a function of inter-
annual water level fluctuation that decreased from upstream to downstream. In contrast,
upstream Moses-Saunders regulation dam (Ontario sector), the much higher inter-annual
water level stability may have favoured the development of a stronger genetic structure
because of a higher probability of homing to natal sites. In summary, we propose that the
Moses-Saunders water regulation dam has a profound effect on the contrasting pattern of
population structure observed between the upstream (Ontario sector) vs. downstream
(Quebec sector) part of our study area.
Water level variation has previously been shown to influence the extent of gene flow and
migration rates in brown trout (Salmo trutta, Ostergaard et al. 2003). Here, occasional but
recurrent drought events were reported to cause frequent extinction-recolonization events,
resulting in strong genetic drift, high gene flow and instability of genetic structure over
time. In eastern mosquitofish (Gambusia holbrooki), when severe episodic drying events
happens in the Everglades in Florida, individuals from different populations inter-mix in
deep-water refuges during dry years where only patches of habitat are available (McElroy
et al. 2011). During a wet year, population genetic structure presented a patchy pattern that
was related to heterogeneity within regions. Inversely, during a dry year, population genetic
structure was very weak and a Walhund effect was detected. These episodic droughts were
hypothesized to lead to reproduction between individuals belonging to different
populations. This could equally apply in the lower St. Lawrence River where population
genetic structure was very weak and water level variation very high. More generally,
38
habitat stability has been related to the extent of population structure in other taxonomic
groups as well. For example, some species of aquatic insects that are specialists of unstable
environments characterized by periodic drought events exhibits stronger dispersal which
results in weaker genetic structure (Myers et al. 2001; Monaghan et al. 2005; Zickovich &
Bohonak 2007; Baggiano et al. 2011).
Water masses
Differences in water conductivity between sampling sites during spring were positively
correlated with the extent of genetic differentiation in the Quebec sector. Water
conductivity was also highly correlated with pH and both variables correspond to relative
membership to different water masses of local water mix (Désilets & Langlois 1989). For
example, the boundary separating the two populations units within Lake St. Louis (north
shore [site 27] vs. south shore [sites 26, 28, 29 and 30], Table 2.1 and Figure 2.3) spatially
corresponds to the stronger boundary of the so called “green waters” from the Lake Ontario
and the “brown waters” from the Ottawa River. Lake Ontario – St. Lawrence River
system’s water masses have very different physicochemical properties (Centre Saint-
Laurent 1996) and this could hypothetically induce northern pike’s local adaptation to
specific conditions of each given water mass and limit gene flow, especially for Ontario
sector’s more divergent populations, although this obviously remain to be rigorously tested.
If so, this could contribute to enhance populations divergence on either side of the mixing
area of different water masses (as in Egea-Serrano et al. 2009). In the study area, since
water-mass flows in parallel through St. Lawrence River with limited mixing (Centre Saint-
Laurent 1996), they also could limit passive dispersal of larvae and young fishes (as in
Roberts 1997). In freshwater ecosystems, the possible influence of physicochemically
distinct water masses influence on population structure has been invoked only once to our
knowledge (Leclerc et al. 2008). In marine ecosystems, however, currents and water mass
origin have often been shown to affect dispersal in fish species that are characterized by a
larval pelagic phase (Hunt & Stabeno 2005; Logerwell et al. 2005).
Dams
The occurrence of dams was also found to be linked to genetic structure discontinuities, and
the two dam complexes located within lower St. Lawrence River (Figure 2.1) coincide with
putative boundaries of population units (Figure 2.3B). Similarly, the other dams isolating
39
St. Lawrence River tributaries and separating upper St. Lawrence River from its lower part
coincided with boundaries of population units. These dams potentially completely impeded
northern pike dispersal since their construction (1929, 1939 and 1979, Centre d’expertise
hydrique du Québec 2013), except for larvae that can still passively disperse through in
upstream-downstream direction. For instance, downstream dispersal was only lightly
affected by dams in the bullhead Cottus gobio (Junker et al. 2012), leading to asymmetrical
gene flow.
Although northern pike can tolerate a wide range of environmental conditions, the
individuals choose its spawning habitat according to several environmental factors,
including water temperature, density of vegetation, dissolved oxygen concentration, water
depth and turbidity (Casselman & Lewis 1996). In our study, water depth, implied into the
variable of inter-annual water level variation, could also implicitly be related to habitat
selection. To compare to other species, a similar study was realized in lower St. Lawrence
River for yellow perch (Perca flavescens, Leclerc et al. 2008) that also uses flood plains for
spawning during early spring. Likewise, dam’s presence and water masses boundaries were
involved in the explanation of yellow perch genetic structure. However, inter-annual water
level variation was not taken into account in that study. On a similar scale and for
comparable sampling sites compared to the yellow perch study, northern pike global
genetic structure was much lower (Fst = 0.005) than previously reported for yellow perch
(Fst = 0.032), which likely reflect the lower dispersal potential of the much smaller perch
relative to pike (April et al. 2013). Moreover, given his top predator status, northern pike
probably presents smaller effective population sizes that cannot buffer as much gene flow
without effect on genetic differentiation. Yet boundaries of population units observed in
both species almost perfectly spatially coincided (Leclerc et al. 2008). This suggests that
taxonomically very distinct species from a same ecosystem that share characteristics of
their reproductive ecology may be affected in the same manner by environmental factors
influencing population connectivity.
Population structure and genetic diversity
Weak overall population genetic structure was observed in our study area but it was clearly
much weaker in the lower St. Lawrence River than in Lake Ontario and upper St. Lawrence
40
River. We defined the occurrence of 12 populations in Ontario sector (Lake Ontario and
upper St. Lawrence River) and 8 populations in Quebec sector (lower St. Lawrence River).
Even if these groupings are weakly differentiated, they were considered as populations
units since we showed that northern pike did not reach panmixia in Lake Ontario and St.
Lawrence River system after a significant genetic pattern was proved to be correlated with
landscape features, hence non-random. Consequently, in this system, it is wiser to consider
northern pike divided in more than one population. Even scientific community struggles to
define the limits of the population concept (Lowe & Allendorf 2010; Waples & Gaggiotti
2006), but to define populations with confidence genetic connectivity and demographic
connectivity components must be assessed. Here we cannot infer with certitude on
demographic connectivity and gene flow since we did not study effective population sizes
that affect the impacts of gene flow on population divergence and genetic drift (Whitlock
and McCauley 1999).
The extent of population genetic structure we documented was also lower than previously
reported for northern pike in another large open system on a similar geographic scale of
approximately 800 km. Thus, northern pike’s global genetic differentiation was notably
higher in the coastal Baltic Sea (Fst = 0.032, Laikre et al. 2005), than for Lake Ontario – St.
Lawrence River system (Fst = 0.021), and much higher than populations of the Quebec
sector of the St. Lawrence River (Fst = 0.005). Baltic Sea is an almost enclosed water body
which does not experience major inter-annual water level instability as it is the case for the
lower St. Lawrence River, and this could partly explain the weaker genetic structure
observed in this study. More generally, at a large geographic scale, low levels of population
genetic structure have been reported for northern pike in connected habitats (e.g. Senanan
& Kapuscinski 2000; Miller et al. 2001; Laikre et al. 2005; Bosworth & Farrell 2006) but
more pronounced (yet moderate) levels were documented between disconnected habitats
(e.g. Hansen et al. 1999; Senanan & Kapuscinski 2000; Jacobsen et al. 2005). At a smaller
scale, extremely low but significant genetic differences have been reported between
proximate sampling sites (Miller et al. 2001; Bosworth & Farrell 2006), akin to what we
observed for the Ontario sector and some pair of sites in Quebec region where inter-annual
water level variation was minimal. Although northern pike has been reported to be
41
sedentary (reviewed by Craig 1996, 2008; Rosell & MacOscar 2002; Koed et al. 2006;
Vehanen et al. 2006; Bosworth & Farrell 2006), some individuals have sometimes shown
long distance excursions (e.g. 130 km over 3 days in Massé et al. 1988). Overall, these
observations indicate that northern pike can substantially disperse over large and small
geographic areas, thus resulting in a globally low level of genetic differentiation in
comparison with most freshwater species (DeWoody & Avise 2000).
IBD relationship showed that clinal genetic variation overall played a significant
explanatory role in the observed genetic structure. IBD relationship was stronger in Lake
Ontario (Mantel’s r = 0.4905, P = 0.0001) than in St. Lawrence River (Mantel’s r = 0.2454,
P = 0.0038). Also, slopes of the IBD relationships showed that geographic distance has a
greater impact on the extent of genetic isolation in Ontario sector (slope = 6.32X10-5, P <
0.00001) than in Quebec sector (slope = 2.06X10-5, P = 0.00308). Thus, geographic
distance played a greater role in the explanation of the pattern of population genetic
structure observed upstream than downstream of the study area. Quite clearly also, natural
geographic isolation accounted for an important part of observed population genetic
structure, since the four annexes (Niagara River, site 1; Hamilton basin, site 2; and
Richelieu and Ottawa Rivers, sites 22- 23; Table 2.3 and Figure 2.1) were much divergent
from the rest of the study area as evidenced from regional global Fst values that were
significantly higher with than without inclusion of these sampling sites.
Finally, as reported in other studies, we observed that generally speaking, northern pike is
characterized by an overall low level of genetic diversity (in terms of number of alleles per
locus, polymorphism, and heterozygozity) compared to other freshwater species, especially
in North America (DeWoody & Avise 2000). This is likely due to its evolutionary history
during glacial periods whereby geographic isolation in small glacial refugia hypothetically
caused severe reductions in effective population size and consequently loss of genetic
variation which has not rebuilt by mutation given the short evolutionary time frame since
the last glacial retreats (Miller & Kapuscinski 1997; Hansen et al. 1999; Senanan &
Kapuscinski 2000; Miller et al. 2001; Jacobsen et al. 2005; Launey et al. 2006; Bosworth
& Farrell 2006; Lucentini et al. 2006).
42
In view of the spatially variable extent of population structure, northern pike management
perspectives should be carefully reconsidered, in particular by taking into account the
influence of inter-annual water level variation on population structure. Regions of lower St.
Lawrence River that are more prone to water level variation (Lake St. Louis and below)
should be managed in a metapopulation perspective (Hanski 2004), given that northern pike
population units from these areas, although genetically distinct are very highly connected
(Lowe & Allendorf 2010). We did not directly study directional gene flow and migration
rates through the study area, but this would provide further information on how landscape
features affect northern pike dispersal. Also, performing simulations to evaluate the
historical influence of anthropic features like dams on population structure was beyond the
scope of this study but should be considered as a further step of this research program.
Finally, we hypothesized that different water masses could lead to adaptation, and this
avenue could be investigated by performing a population genomic study using thousands of
markers distributed throughout the genome, for instance using RAD sequencing (e.g.
Hohenlohe et al. 2010; Gagnaire et al. 2013; Stölting et al. 2013). These could be relevant
research avenues towards improving our comprehension of northern pike population
structure and its ecological determinants. The results of our study highlight the importance
of reconsidering northern pike biology in management plans and conservation strategies,
since depending on landscape features this species may present very high connectivity. In
contrast, this is what has been implicitly inferred from the observation of high sedentary
behavior for this species, which clearly is not compatible with the relatively weak
population structure reported here and in previous studies. Finally, to our knowledge, this
study represents one of the very few examples of the effect of habitat instability impeding
the development of population genetic structure, thus highlighting the relevance of
performing similar studies in other taxonomic groups.
43
Acknowledgements
We would like to thank Philippe Brodeur, Yves Mailhot, Chantal Côté, Pierre Dumont,
Daniel Hatin, Mélissa Larochelle and technicians (William Cayer-Blais, Yanick Soulard,
Geneviève Richard, Nicolas Harnois, Vanessa Cauchon) all from Ministère du
Développement durable, de l’Environnement, de la Faune et des Parcs du Québec
(MDDEFP), as well as John M. Farrell and Chris Barry from SUNY College of
Environmental Science and Forestry, Gavin Christie, Alastair Mathers, Chris Wilson and
Jim Hoyle from Ontario Ministry of Natural Resources (OMNR), Ian Kelsey and Jeff
McNiece from Central Lake Ontario Conservation Authority (CLOCA), Susan Doka and
Nicholas Mandrak from the Departement of Fisheries and Oceans Canada (DFO), Rodger
Klindt from New York State Department of Environmental Conservation (NYS DEC) and
commercial fishermen for their invaluable support in obtaining samples. We also thank
Guillaume Côté, Marie-Hélène Perreault, Amélie Gilbert and Lucie Papillon for laboratory
assistance and technical support. We are also grateful to Geneviève Richard for producing
habitat maps and Sébastien Boutin for computational assistance. We also thank Charles
Perrier, Vincent Bourret, Mélanie Dionne, Pierre-Alexandre Gagnaire, Glenn Yanick,
Émilie Leclerc and Vicky Albert for useful advices and comments. Funding this project
was provided by Natural Sciences and Engineering Research Council of Canada (NSERC,
collaborative project) to Louis Bernatchez and from MDDEFP. Funding from NSERC,
Fonds de Recherche du Québec Nature et Technologies (FQRNT), Fonds de soutien à la
Maîtrise from Département de Biologie of Université Laval and Québec-Océan (QO)
financially supported Geneviève Ouellet-Cauchon. This is a contribution to the research
program of QO.
44
Table32.1. Sample statistics related to each sampling site and analyzed at 22 microsatellite loci. N: number of northern pike genotypes,
according to moment of sampling as a function of spawning time; HE: expected heterozygosity; HO: observed heterozygozity; Ar:
mean allelic richness over all loci standardized for smallest sample size (20 individuals); Apr: mean private allelic richness over all loci
standardized for smallest sample size (20 individuals); Fis: inbreeding coefficient averaged over all loci (*significant Bonferroni 0.05
threshold); ‡tested temporal genetic structure (2009 vs. 2010); †tested genetic structure according to sampling period (prior spawning
time vs. spawning time); **Lake and fluvial annexes.
ID Site Latitude Longitude Year Upstream waterway distance
N per year per site N per site
2009-2010 pooled
Prior Spawn. Post Unknw. Total HE HO Ar Apr Fis
Niagara River (L.O. tributary)
1 Niagara River ** 42°58' 14" -78°58' 26" 2007 101.0 0 58 11 0 69 87 0.64 0.63 5.07 0.06 0.02
2009
0 18 0 0 18
West Lake Ontario (L.O.)
2 Hamilton basin ** 43°17' 29" -79°47' 19" 2010 0.0 0 4 19 8 31 31 0.57 0.54 4.63 0.10 0.07
3 Etobicoke 43°35' 55" -79°29' 52" 2009 42.2 0 0 12 0 12 25 0.64 0.63 5.76 0.08 0.03
2010
0 1 12 0 13
4 Toronto 43°37' 16" -79°21' 14" 2009 50.8 0 0 36 0 36 53 0.66 0.64 5.77 0.06 0.03
2010
0 4 13 0 17
5 Scarborough 43°42' 29" -79°13' 40" 2009 65.2 0 0 11 0 11 20 0.64 0.66 5.74 0.03 -0.02
2010
0 3 6 0 9
6 Pickering 43°48' 14" -79° 5' 33" 2009 82.0 0 0 9 0 9 42 0.63 0.62 5.64 0.02 0.02
2010
0 17 16 0 33
East Lake Ontario (L.O.)
7 West Lake 43°56' 16" -77°17' 15" 2010 214.5 0 56 2 0 58 58 0.62 0.63 5.58 0.07 0.00
8 Western Bay of Quinte 44° 8' 50" -77°20' 15" 2009 332.5 0 58 0 0 58 79 0.65 0.66 5.91 0.07 0.00
2010
0 20 1 0 21
9 Eastern Bay of Quinte 44° 2' 42" -77° 3' 31" 2010 294.5 0 38 3 0 41 41 0.65 0.61 5.80 0.08 0.07
0
45
ID Site Latitude Longitude Year Upstream waterway distance
N per year per site N per site
2009-2010 pooled
Prior Spawn. Post Unknw. Total HE HO Ar Apr Fis
Thousand Islands (St.L.R.)
10 Cataraqui River ‡ 44°14' 10" -76°28' 3" 2009 297.1 0 45 12 0 57 117 0.65 0.67 5.78 0.07 -0.02
2010
0 60 0 0 60
11 Carleton Island 44°10' 46" -76°14' 26" 2010 310,0 0 31 2 0 33 33 0.63 0.66 5.89 0.05 -0.03
12 French Creek 44°11' 49" -76° 7' 21" 2009 329,0 0 86 0 0 86 96 0.63 0.63 5.62 0.01 0.00
2010
0 10 0 0 10
13 French Bay 44°14' 6" -76° 5' 36" 2010 324,0 0 85 0 0 85 85 0.63 0.64 5.72 0.05 -0.01
14 Grindstone Island south 44°15' 12" -76° 8' 32" 2010 321.5 0 32 5 0 37 37 0.65 0.64 5.99 0.02 0.04
15 Frontenac 44°15' 12" -76° 3' 2" 2010 327.2 0 48 4 0 52 52 0.63 0.64 5.87 0.09 -0.01
16 Grindstone Island east 44°17' 54" -76° 4' 24" 2010 333.7 0 9 76 0 85 85 0.59 0.63 5.15 0.04 -0.05*
17 Point Vivian 44°18' 38" -75°57' 49" 2009 337.2 0 5 0 0 5 60 0.62 0.63 5.71 0.03 0.00
2010
0 43 12 0 55
18 Crooked Creek 44°21' 55" -75°49' 41" 2009 358.4 0 15 0 0 15 24 0.62 0.62 5.74 0.08 0.02
2010
0 8 1 0 9
19 Mallorytown 44°25' 16" -75°51' 55" 2009 350.9 0 60 0 0 60 60 0.62 0.63 5.69 0.02 0.00
Lake St. Francis (St.L.R.)
20 South Glengarry 45°10' 56" -74°23' 21" 2010 500.1 65 0 0 0 65 65 0.65 0.66 5.39 0.02 -0.01
21 Saint-Zotique 45°13' 16" -74°17' 9" 2010 509.5 0 35 0 0 35 35 0.63 0.63 5.60 0.05 0.01
Richelieu River (St.L.R. trib.)
22 Île-aux-Noix ‡† ** 45° 7' 0" -73°15' 60" 2009 772.6 0 85 0 0 85 162 0.6 0.59 5.31 0.03 0.02
2010
77 0 0 0 77
Ottawa River (St.L.R. trib.)
23 Gatineau ‡† ** 45°31' 46" -75°27' 33" 2009 685.2 29 27 0 0 56 153 0.6 0.6 5.46 0.13 0.01
2010
0 97 0 0 97
Lake Des Deux Montagnes (St.L.R.)
24 Rigaud ‡ 45°29' 50" -74°20' 8" 2009 582.5 37 0 0 0 37 132 0.61 0.61 5.49 0.06 0.00
2010
95 0 0 0 95
25 Pointe Calumet 45°29' 58" -73°58' 2" 2010 564.3 48 0 0 0 48 48 0.61 0.6 5.64 0.03 0.01
Lake St. Louis (St.L.R.)
26 Vaudreuil-Dorion ‡ 45°20' 31" -73°57' 42" 2009 547,0 33 0 0 0 33 72 0.63 0.62 5.65 0.02 0.01
2010
39 0 0 0 39
46
ID Site Latitude Longitude Year Upstream waterway distance
N per year per site N per site
2009-2010 pooled
Prior Spawn. Post Unknw. Total HE HO Ar Apr Fis
27 Northern Île Perrot ‡† 45°23' 58" -73°53' 41" 2009 558,0 0 24 0 0 24 91 0.63 0.64 5.68 0.03 0.00
2010
40 27 0 0 67
28 Maple Grove 45°19' 12" -73°51' 36" 2009 547.5 2 0 0 0 2 97 0.64 0.64 5.67 0.05 -0.01
2010
18 77 0 0 95
29 Ruisseau St-Jean 45°22' 11" -73°46' 19" 2009 557.2 0 52 0 0 52 52 0.66 0.65 5.84 0.04 0.02
30 Châteauguay 45°23' 46" -73°45' 10" 2010 561.8 0 61 0 0 61 61 0.66 0.68 5.89 0.03 -0.02
St-Lawrence River corridor, downstream part (St.L.R.)
31 Boucherville ‡ 45°35' 43" -73°29' 4" 2009 597.8 2 33 13 0 48 77 0.64 0.64 5.83 0.06 0.02
2010
0 29 0 0 29
32 Repentigny 45°45' 50" -73°25' 1" 2009 615.9 7 0 0 0 7 64 0.63 0.62 5.85 0.05 0.03
2010
0 57 0 0 57
33 Contrecoeur ‡ 45°51' 55" -73°15' 4" 2009 633.9 0 50 0 0 50 113 0.64 0.63 5.72 0.03 0.02
2010
0 63 0 0 63
Lake St. Pierre area (St.L.R.)
34 Archipel ‡† 46° 6' 32" -73° 1' 16" 2009 668.8 64 5 0 0 69 138 0.63 0.63 5.69 0.04 0.00
2010
10 59 0 0 69
35 Pierreville † 46° 8' 2" -72°51' 56" 2009 681.2 16 28 0 0 44 54 0.61 0.61 5.68 0.04 0.01
2010
10 0 0 0 10
36 Maskinongé ‡† 46°12' 21" -72°57' 2" 2009 684.4 60 7 0 0 67 114 0.63 0.62 5.69 0.03 0.01
2010
10 37 0 0 47
37 Yamachiche † 46°15' 37" -72°49' 30" 2009 692.1 34 24 0 0 58 58 0.63 0.63 5.78 0.04 0.01
38 Baie-du-Febvre ‡† 46°10' 25" -72°46' 24" 2009 688.9 33 30 0 0 63 119 0.61 0.61 5.56 0.05 0.02
2010
0 56 0 0 56
Downstream Lake St. Pierre (St.L.R.)
39 St-Angèle 46°20' 3" -72°30' 54" 2009 716.8 11 0 0 0 11 20 0.63 0.68 5.88 0.16 -0.05
2010
9 0 0 0 9
40 Gentilly ‡ 46°24' 2" -72°22' 8" 2009 730.4 46 0 0 0 46 103 0.62 0.62 5.68 0.05 0.00
2010
57 0 0 0 57
Total
852 1777 276 8 2913 2913
47
Table42.2. Microsatellite loci characteristics. NA: Number of alleles per locus; TA: PCR annealing temperature in degrees Celsius.
Locus Source Repeat motif Motif Primer sequence (5'-3') Size range
(bp) NA TA
Concentration in PCR reaction
F or R (pg/ul)
Marker set
Dye
EL02 Ouellet-Cauchon et al. submitted
AC di F: ACACATGCGTCTACAAGCACA 175-221 22 60 0.18 3 Hex
R: CCTCCCTGGCATACGTCTTAC
EL03 idem CA di F: GGCGAGTTAGGAGCTCAGGTA 122-148 11 60 0.12 3 Hex
R: TGGGGAGCGATGTGTATGTA
EL05 idem AC di F: GGAAATGGGGAGTCTCCTGTA 166-202 16 60 0.08 3 Ned
R: TGCAAACAGTCCTTTTGGAAG
EL12 idem CA di F: TGGGGTTGTACACAAACTTTCTC 142-168 13 60 0.06 3 Fam
R: TAGCCCAATCATTACCCTTGG
EL15 idem CGCA tetra F: TGAAAAGCAGTGTTGCATCTG 107-139 11 60 0.11 4 Ned
R: TTCTGTCCATCCATCTCCATC
EL17 idem AC tetra F: GTGCTTTTGGGTACAATCAATG 317-353 15 60 0.23 4 Ned
R: TTTCACCAAATACCTGGTCTCA
EL20 idem AC di F: CCAAAGCCAGTTGATGCTAAG 306-380 38 60 0.18 3 Fam
R: CTCAAACTGTGCCTCACACAA
EL22 idem CT di F: ACATTCATTCGGAGCAGTCAG 285-311 12 60 0.33 4 Fam
R: CCCATGCCAATGAAGATATTG
EL23 idem GA di F: GTGCGTTCGTCTCTCATCTTC 264-303 27 60 0.14 3 Hex
R: GATCTGTCCATCCTTCCTGTG
EL27 idem TAC tri F: AATGCTTCTGAATGCTTGCAC 140-194 16 60 0.08 4 Fam
R: CAAAGGATAGACAGCAAAGCAA
Elu19 Miller & Kapuscinski 1997
(AC)23Ag(AC)3
ATT(AC)3 di
cplx F: CATCATGAACATTCAGACGC 119-169 22 60 0.13 4 Hex
R: GAGATGCTAATTCATCCACTG
B117 Aguilar et al. 2005 NA tetra F: TGACCGACATACCGTAACTC 271-319 13 56 0.06 1 Vic
R: GGATGAAGTGATAAGGATGGT
PkB16 Genetic Identification Service 2000
NA tetra F: TGCGTCAATCATCCGTAT 123-179 16 56 0.07 1 Fam
R: AGCAAAGTGTCATTTCTTCAGT
PkB211 idem NA tetra F: ACAACGCATTCAAGTGGAG 187-227 11 56 0.19 2 Hex
R: TGAGGTGACTGTGTGAGTCTG
48
Locus Source Repeat motif Motif Primer sequence (5'-3') Size range
(bp) NA TA
Concentration in PCR reaction
F or R (pg/ul)
Marker set
Dye
B24 Aguilar et al. 2005 NA tetra F: TGAAATTCACTTGTTGTGTCTG 153-225 19 56 0.08 2 Fam
R: GTCCGCTGTTGACCTTTT
B25 idem NA di F: GTCACCGTGGTCTGTCAG 183-283 26 56 0.05 2 Ned
R: TGGGTAATGGAGAGAAAGAA
B259 idem NA tetra F: AGGCTCCACTGTAAATGCTTT 282-326 11 56 0.04 2 Hex
R: GTGCTAAAGGGAGGACTTCTG
B304 idem NA tetra F: CCTTCAGATCAGTAATGTCAG 204-248 11 56 0.06 1 Ned
R: AGGTCAGTGAGGACAGAGGT
B422 idem NA tetra F: TGACTGTGTGAGTCTGTAAGA 252-288 11 56 0.39 2 Fam
R: ACAACTGGCCTTGAGAG
B451 idem NA tetra F: CTGGATCACTGTCTCTTTTCTG 195-287 22 56 0.19 1 Pet
R: GAGAGGGTGAGAACACCAGT
B457 idem NA tetra F: CTGTCCACCTCTTGGTCT 169-209 11 56 0.05 1 Vic
R: AGGGAGTGTTAGAGATGGAT
PkB47 Genetic Identification Service 2000
NA di F: CCAAACAGCAGATTAGTTGG 147-183 17 56 0.38 1 Ned
R: CTGCAAGAGTACAAAAGGACA
49
Table52.3. Environmental variables included in landscape genetics analyses. Within
description is specified the treatment of variables to build distance matrices.
Environmental variable
Description Source
Current velocity Difference in mean annual current velocity between sampling sites (m/s) between sites
Centre Saint-Laurent (1996)
Dam index Index that accounts for number of dams, type and age of dams between sampling sites
Centre d’expertise hydrique du Québec, 2013 (http://www.cehq.gouv.qc.ca/barrages/default.asp)
Fish BPC contamination
Difference in adult northern pike contamination by BPCs (mg/kg) between sites
Centre Saint-Laurent (1996)
Fish mercury contamination
Difference in adult northern pike contamination by mercury (mg/kg) between sites
Centre Saint-Laurent (1996)
Hydrography Sites belong to the same water entity (0) or to two different water entities (1) according to hydrographic cutting
-
Inorganic compounds contamination
Difference in index of excess inorganic compounds criteria for aquatic life between sites
Centre Saint-Laurent (1996)
Inter-annual water level stability
Negatives values of sum of inter-annual water level variation coefficient between 1960 and 2000 (correlated with hydraulicity), between sites (square error/mean)
Ministère du Développement durable, de l’Environnement, de la Faune et des Parcs du Québec (MDDEFP) data
Navigation channel Navigation channel crossing between sites (0: no crossing, 1: crossing)
GENIE application from Environment Canada (http://www.ec.gc.ca/stl/default.asp?lang=Fr&n=74CE97B8-1)
Organic compounds contamination
Difference in index of excess organic compounds criteria for aquatic life between sites
Centre Saint-Laurent (1996)
pH Difference in mean pH over 3 seasons (spring-summer-autumn) between sites
Mean over 3 seasons (spring-summer-autumn) calculated from Désilets & Langlois (1989)
Sediment types Difference in mean diameter particles from sediments between sites
Centre Saint-Laurent (1996)
Water conductivity in spring
Difference in water conductivity in spring (μS/cm) between sites
Désilets & Langlois (1989)
Water temperature in spring
Difference in water temperature in spring (°C) between sites
Désilets & Langlois (1989)
Tide amplitude Difference in tides amplitude (m) between sites
Centre Saint-Laurent (1996)
50
Environmental variable
Description Source
Toxics contaminated areas
Presence of contaminated areas by one or many toxic compounds (Hg, mirex, BPC, HAP) at site
Centre Saint-Laurent (1996)
Turbidity Difference in mean water turbidity over 3 seasons (spring-summer-autumn, μS) between sites
Mean over 3 seasons (spring-summer-autumn) calculated from Désilets & Langlois (1989)
Water color Difference in mean water color over 3 seasons (spring-summer-autumn, μS/cm) between sites
Mean over 3 seasons (spring-summer-autumn) calculated from Désilets & Langlois (1989)
Water masses Sites belongs to the same water mass (0) or to two different water masses (1)
GENIE application from Environment Canada (http://www.ec.gc.ca/stl/default.asp?lang=Fr&n=74CE97B8-1)
Waterway distance Waterway geographic distance (km) Calculated with ArcGIS 9.2 from ERSI and data from DMTI Spatial®
Wetlands fragmentation
Continuity (0) or discontinuity (1) of wetlands between sampling sites
GENIE application from Environment Canada (http://www.ec.gc.ca/stl/default.asp?lang=Fr&n=74CE97B8-1)
51
Table62.4. Mantel tests results of pairwise Fst matrix coupled with environmental variables
matrices and identification of variables selected for subsequent multivariate analysis. pH
variable was discarded from subsequent analyses because of collinearity with spring water
conductivity. For variables definition details and information sources, see Table 2.5.
Environmental variable Mantel's r P-value Selection
Dam index 0.4155 0.0011 x
Inter-annual water level stability 0.2780 0.0031 x
Spring water conductivity 0.1573 0.0004 x
pH 0.1544 0.0113
Spring water temperature 0.1534 0.0127 x
Hydrography 0.1231 0.0001 x
Current velocity 0.0923 0.0049
Tide amplitude 0.0842 0.0196
Wetlands fragmentation 0.0709 0.0037
Waterway distance 0.0511 0.0123 x
Toxics contaminated areas 0.0458 0.0257
Inorganic compounds contamination 0.0446 0.0473
Fish BPC contamination 0.0243 0.0629
Water masses 0.0180 0.0337
Organic compounds contamination 0.0083 0.0492
Sediment types 0.0073 0.3401
Water color 0.0038 0.2584
Navigation channel 0.0002 0.4076
Fish mercury contamination < 0.0001 0.5265
Turbidity < 0.0001 0.4565
52
Table72.5. Multiple regression on distance matrices (MRM) model on environmental
variables results with Pearson’s correlation coefficient and pairwise Fst matrix as a
response variable. A) Full model on selected variables by Mantel's tests (see Table 1). B)
Final model with significant variables from full model in (A). b: standard partial regression
coefficient with associated P-value; R2: coefficient of multiple determination with
associated P-value; F: Fisher's pseudo-test value with associated P-value.
A) full model B) final model
Model components b P b P
Dam index 0.4852 0.0029 0.5015 0.0009
Spring water conductivity 0.3617 0.0001 0.3493 0.0001
Inter-annual water level stability 0.3499 0.0178 0.3375 0.0178
Hydrography -0.0419 0.7113 - -
Waterway distance 0.0329 0.7922 - -
Spring water temperature 0.0198 0.8816 - -
Model significance R2 P R2 P
0.6411 0.0001 0.6397 0.0001
Fisher's test F P F P
48.83 0.0001 98.85 0.0001
53
Figure 2.1. Sampling sites in St. Lawrence River and two of its tributaries (Ottawa River and Richelieu River), as well as Lake
Ontario and one of its tributary (Niagara River). Lines correspond to localization of dams and the star identifies the Moses-Saunders
regulation dam. Lake and fluvial annexes are circled.
54
Figure 2.2. Isolation by distance relationships. Red circles represent within Ontario sector comparisons without annexes (Niagara
River and Hamilton basin, respectively sites 1 and 2) and blue circles correspond to within Quebec sector comparisons without
annexes (Richelieu and Ottawa Rivers, respectively sites 22 and 23). a represents the slope for each relationships, for all sites and both
sectors.
55
A)
B)
Figure 2.3. A) First 20 barriers in Ontario sector and in B) Quebec sector inferred by
BARRIER. Lines thickness is function of barriers’ relative strength (indicated in
percentage). Thick line: >15%, medium line: 5-15%, thin line: <5%. Barrier that separates
downstream Quebec sector from Ontario sector (17%) is represented both in (A) and (B)
maps.
56
Figure 2.4. Distribution of the 20 first barriers localization within Lake Ontario and St.
Lawrence River system as a function of their relative strength and waterway distance from
the upstream farthest point (Hamilton basin, site 2).
57
Figure 2.5. Sliding windows of sites located in a 50 km window that moves following
water flow across system with a 25 km step. A) Mean inter-annual water level variation
coefficients and B) mean pairwise Fst values between sites as a function of middle
downstream waterway distance from the upstream farthest point (Hamilton basin, site 2) of
each window. Mean pairwise Fst values between sites as a function of mean inter-annual
water level variation coefficients for C) above and D) below Moses-Saunders regulation
dam.
58
A) B)
C)
Figure 2.6. Modelled suitable spawning habitats for northern pike within Lake St. Pierre in
lower St. Lawrence River for two extreme water levels scenarios, A) in 1965 where water
level was low and B) in 1997 where water level was high. Blue lines and red lines illustrate
flood plain upper limit at maximum and minimum water levels, respectively. Green color
indicates suitable spawning habitats, from high quality habitats in dark from low quality
habitats in light. C) Overlap of spawning habitat surfaces from (A) and (B) considering
quality. Data set originates from Mingelbier et al. (2008).
59
Conclusion générale
Cette étude fut réalisée en collaboration avec le Ministère du Développement durable, de
l’Environnement, de la Faune et des Parcs du Québec (MDDEFP) dans un cadre de
recherche qui visait à acquérir des connaissances sur les populations du grand brochet
(Esox lucius) du système lac Ontario – fleuve Saint-Laurent dans l’optique de diriger les
futures orientations de gestion de cette espèce fortement exploitée. Plus précisément,
l’objectif principal était de caractériser la structure génétique des populations du grand
brochet du système lac Ontario – fleuve Saint-Laurent et d’identifier les déterminismes
environnementaux de la structure génétique observée.
Le grand brochet est une espèce qui détient une faible diversité génétique et,
conséquemment, présentait un très faible nombre de marqueurs microsatellites hautement
polymorphes disponibles dans la littérature. De ce fait, dans un premier temps, nous avons
procédé au développement de nouveaux marqueurs chez cette espèce. Dix-sept paires
d’amorces furent développées pour enrichir la banque de marqueurs microsatellites
préexistants dans la littérature. Ces marqueurs microsatellites ont présenté une diversité
génétique globalement modérée (par comparaison à la moyenne des microsatellites
observés chez d’autres espèces) mais très variable d’un marqueur à l’autre. Ainsi, les
marqueurs qui présentaient la plus grande diversité génétique détiennent un fort potentiel
d’étude chez le grand brochet et donc 10 d’entre deux ont pu être utilisés dans notre étude
de la génétique du paysage chez les populations de grand brochet du lac Ontario et du
fleuve Saint-Laurent.
Dans le but de vérifier si ces nouveaux marqueurs pourraient être éventuellement utilisés
dans des études génétiques portant sur les autres espèces d’ésocidés, le succès
d’amplification de ces microsatellites fut testé chez les cinq autres espèces d’ésocidés, i.e.
le brochet de l’Amur (E. reichertii) d’Eurasie, le brochet d’Amérique (E. americanus
americanus), le brochet vermiculé (E. americanus vermiculatus), le maskinongé (E.
masquinongy) et le brochet maillé (E. niger) d’Amérique du Nord. Également, ces
marqueurs furent testés chez le grand brochet d’Europe (E. lucius). Pour chaque espèce
d’ésocidés, une portion de ces marqueurs s’est avérée amplifiable et polymorphe. Le succès
60
de l’amplification fut remarquable chez le brochet de l’Amur, où tous les 17 marqueurs
furent amplifiés avec succès.
Dans un deuxième temps, ces nouveaux marqueurs ainsi que les 39 marqueurs préexistants
à ce moment dans la littérature (Miller & Kapuscinski 1997; Hansen et al. 1999; Genetic
Identification Service Inc. 2000; Launey et al. 2003; Aguilar et al. 2005) furent testés sur
les populations de grand brochet du lac Ontario et du fleuve Saint-Laurent dans le but de
sélectionner les marqueurs les plus prometteurs pour l’étude des populations du système
(i.e. amplification de qualité et diversité génétique maximale). Des 17 nouveaux marqueurs,
10 furent sélectionnés pour l’étude de la structure génétique présentée au deuxième
chapitre, auxquels se sont ajoutés 12 marqueurs préexistants dans la littérature. La diversité
génétique du grand brochet dans le lac Ontario et le fleuve Saint-Laurent s’est avérée
moyenne pour cette espèce. L’intensité de la structure génétique observée était globalement
très faible mais spatialement hétérogène ; l’aval du fleuve Saint-Laurent présentant une
structure génétique largement moindre que celle de l’amont du fleuve Saint-Laurent et du
lac Ontario. L’analyse de génétique du paysage a révélé que la structure génétique observée
était influencée par la présence de barrages, par la présence de masses d’eau aux
caractéristiques physico-chimiques différentes et par la stabilité interannuelle du niveau de
l’eau. Ces trois variables ont été positivement corrélées à l’intensité de la différenciation
génétique.
Cette étude a permis d’effectuer le regroupement d’unités populationnelles chez le grand
brochet dans le lac Ontario et le fleuve Saint-Laurent. Nous avons vu que les populations
étaient davantage différenciées entre elles dans la partie amont du fleuve Saint-Laurent et
dans le lac Ontario que dans la partie aval du fleuve Saint-Laurent, ce qui implique que les
populations de la partie amont du système possédaient une connectivité moindre.
Également, les populations de la partie aval du fleuve Saint-Laurent étaient de plus grande
superficie que celles de sa partie amont et que celles du le lac Ontario. Comme l’intensité et
le patron de la structure de populations sont contrastés selon les différentes régions du
système, les perspectives de gestion du grand brochet devraient être révisées avec
précaution. La nature instable de l’habitat dans la partie aval du fleuve Saint-Laurent, qui
est davantage sensible aux variations interannuelles du niveau d’eau, devrait être prise en
61
compte. Les populations de cette région, bien qu’elles soient génétiquement distinctes, sont
très connectées et devraient être gérées dans une optique de métapopulation.
Par ailleurs, nous avons remarqué que la structure génétique était corrélée avec les
différentes masses d’eau du système qui possèdent des caractéristiques physicochimiques
différentes. La zone la plus critique est celle du Lac Saint-Louis qui est localisé dans la
partie aval du fleuve Saint-Laurent. En effet, ce lac est le lieu de rencontre de deux
différentes masses d’eau, soit les « eaux brunes » de la rivière des Outaouais qui occupent
la partie nord du lac et les « eaux vertes » du Lac Ontario qui proviennent de la partie
amont du fleuve Saint-Laurent et qui occupent la partie sud du lac Saint-Louis. Ces deux
masses d’eau présentent des propriétés physico-chimiques très différentes et forment vers le
centre du lac une petite zone de mélange à l’est et à l’ouest de l’Île Perrot. Les individus
récoltés aux sites d’échantillonnage de la rive sud (eaux vertes) appartenaient à une
population différente de ceux du site de la rive nord (eaux brunes). Cette dichotomie nord-
sud fut également observée dans le cas de la perchaude (Leclerc et al. 2008). Il serait donc
important de considérer de manière indépendante la rive sud et la rive nord dans
l’application des mesures de gestion propres à chaque population de grand brochet du lac
Saint-Louis.
D’un point de vue général, les résultats de cette étude permettront de perfectionner les
outils de gestion des espèces de poissons du fleuve Saint-Laurent et du lac Ontario qui
utilisent la plaine inondable comme habitat de reproduction (Mingelbier & Morin 2005).
Les populations de ces espèces, en exploitant les milieux humides inondés au printemps
pour la fraie, seraient vraisemblablement sujettes à l’influence des variations interannuelles
du niveau d’eau. Plus particulièrement, par l’adaptation de ce modèle de structure de
population en considérant la biologie propre à chaque espèce, les résultats de l’influence de
la variation du niveau d’eau sur la structure de populations du grand brochet pourront
inspirer les mesures de gestion des autres espèces lentiques (i.e. qui utilisent les zones de
faible courant à végétation submergée et dense). Entre autres, les espèces lentiques
concernées dans le système sont l’achigan à grande bouche (Micropterus salmoides), le
crapet-soleil (Lepomis gibbosus), la barbote brune (Ameiurus nebulosus), le Méné jaune
(Notemigonus crysoleucas) et le Queue à taches noires (Notropis hudsonius). Il est
62
important de noter que l’application de ce modèle de structure de populations n’est
probablement pas appropriée pour les espèces lotiques (i.e. qui utilisent les zones de
courant rapide et de faible couverture végétale) comme l’esturgeon jaune (Acipenser
fulvescens), le doré jaune (Sander vitreus) et le doré noir (Sander canadensis). En effet, ces
espèces ont une utilisation d’habitat qui diffère davantage de celle du grand brochet et donc
les principes écologiques impliqués dans la structure de populations ne sont pas
nécessairement les mêmes.
Nous avons mis en évidence que la structure des populations du grand brochet est
influencée par les caractéristiques de sa biologie et de son écologie et que ces
caractéristiques sont localement modulées en fonction des facteurs environnementaux
locaux. En conséquence, la gestion des populations du grand brochet doit non seulement
s’appuyer sur les principes biologiques généraux de l’espèce, mais également sur
l’influence des facteurs environnementaux propres à chaque système sur l’écologie de
l’espèce.
63
Bibliographie
Aguilar A, Banks J, Levine F, Wayne RK (2005) Population genetics of northern pike
(Esox lucius) introduced into Lake Davis, California. Canadian Journal of Fisheries
and Aquatic Sciences, 62, 1589–1599.
Aljanabi SM, Martinez I (1997) Universal and rapid salt-extraction of high quality genomic
DNA for PCR-based techniques. Nucleic acids research, 25, 4692–3.
April, J., Hanner, R. H., Mayden, R. L., Bernatchez, L. (2013). Metabolic rate and climatic
fluctuations shape continental wide pattern of genetic divergence and biodiversity in
fishes. PloS one, 8, e70296.
Baggiano O, Schmidt DJ, Sheldon F, Hughes JM (2011) The role of altitude and associated
habitat stability in determining patterns of population genetic structure in two species
of Atalophlebia (Ephemeroptera: Leptophlebiidae). Freshwater Biology, 56, 230–249.
Balloux F, Lugon-Moulin N (2002) The estimation of population differentiation with
microsatellite markers. Molecular ecology, 11, 155–65.
Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (2004) GENETIX 4.05 software
under Windows TM for popualtion genetics.
Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and
powerful approach to multiple testing. Journal of the Royal Statistical Society. Series
B (Methodological), 57, 289–300.
Bosworth A, Farrell JM (2006) Genetic Divergence among Northern Pike from Spawning
Locations in the Upper St. Lawrence River. North American Journal of Fisheries
Management, 26, 676–684.
Carlander KD, Campbell JS, Muncy RJ (1978) Inventory of Percid and Esocid Habitat in
North America (RL Kendal, Ed,).
Carvalho GR, Hauser L (1995) Molecular Genetics in Fisheries (GR Carvalho, TJ Pitcher,
Eds,). Springer Netherlands, Dordrecht, Netherlands.
Casselman J, Lewis C (1996) Habitat requirements of northern pike (Essox lucius).
Canadian Journal of Fisheries and Aquatic Sciences, 53, 161–174.
Centre d’expertise hydrique du Québec (2013) Dams directory. Ministère du
Développement durable, de l’Environnement, de la Faune et des Parcs du Québec
(MDDEFP).
Centre Saint-Laurent (1996) Rapport-Synthèse Sur L’État Du Saint-Laurent. Éditions
Multimondes, Montréal, Canada.
64
Chistiakov D a., Hellemans B, Volckaert FAM (2006) Microsatellites and their genomic
distribution, evolution, function and applications: A review with special reference to
fish genetics. Aquaculture, 255, 1–29.
Conesa A, Götz S, García-Gómez JM et al. (2005) Blast2GO: a universal tool for
annotation, visualization and analysis in functional genomics research. Bioinformatics,
21, 3674–3676.
Craig JF (1996) Pike: biology and exploitation. Chapman & Hall, London, United
Kingdom.
Craig JF (2008) A short review of pike ecology. Hydrobiologia, 601, 5–16.
Crossman EJ, Casselman JM (1987) Annotated Bibliography of the Pike, Esox Lucius
(Osteichthyes: Salmoniformes). Royal Ontario Museum, Toronto, Canada.
Cucherousset J, Paillisson J-M, Cuzol a., Roussel J-M (2009) Spatial behaviour of young-
of-the-year northern pike ( Esox lucius L.) in a temporarily flooded nursery area.
Ecology of Freshwater Fish, 18, 314–322.
Désilets L, Langlois C (1989) Variabilité Spatiale Et Saisonnière De La Qualité De L’eau
Du Fleuve Saint-Laurent. Environnement Canada, Centre Saint-Laurent. Direction des
Eaux Intérieures, Québec, Canada.
DeWoody JA, Avise JC (2000) Microsatellite variation in marine, freshwater and
anadromous fishes compared with other animals. Journal of Fish Biology, 56, 461–
473.
Dumont P, Fortin R (1977) Effects of Spring Water Levels on the Reproduction of the
Upper Richelieu and Missiquoi Bay Northern Pike (Esox Lucius L.). Université du
Québec à Montréal.
Egea-Serrano A, Tejedo M, Torralva M (2009) Populational divergence in the impact of
three nitrogenous compounds and their combination on larvae of the frog Palophylax
perezi (Seoane, 1885). Chemosphere, 76, 869–877.
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): an integrated software
package for population genetics data analysis. Evolutionary bioinformatics online, 1,
47–50.
Farrell JM, Mead J V., Murry BA (2006) Protracted spawning of St Lawrence River
northern pike (Esox lucius): simulated effects on survival, growth, and production.
Ecology of Freshwater Fish, 15, 169–179.
65
Fitzpatrick SW, Brasileiro C a, Haddad CFB, Zamudio KR (2009) Geographical variation
in genetic structure of an Atlantic Coastal Forest frog reveals regional differences in
habitat stability. Molecular ecology, 18, 2877–96.
Fjeldså J, Lovett J (1997) Biodiversity and environmental stability. Biodiversity and
Conservation, 323, 315–324.
Fortin R, Dumont P, Fournier H, Cadieux C, Villeneuve D (1982) Reproduction and Year
Class Strength of the Northern Pike (Esox-Lucius L) in the Upper Richelieu and
Missisquoi Bay. Canadian Journal of Zoology, 60, 227–240.
Frankham R, Ballou DJ, Briscoe AD (2010) Introduction to Conservation Genetics.
Cambridge University Press.
Franklin D, Jr LS (1963) Early life history of the northern pike, Esox lucius L., with special
reference to the factors influencing the numerical strength of year classes.
Transactions of the American Fisheries Society, 8659, 91–92.
Fraser D, Bernatchez L (2001) Adaptive evolutionary conservation: towards a unified
concept for defining conservation units. Molecular Ecology, 10, 2741–2752.
Freyhof J, Kottelat M (2008) Esox lucius (Northern Pike). The UICN Red List of
Threatened Species.
Gaggiotti OE, Bekkevold D, Jørgensen HBH et al. (2009) Disentangling the effects of
evolutionary, demographic, and environmental factors influencing genetic structure of
natural populations: Atlantic herring as a case study. Evolution, 63, 2939–51.
Gagnaire P-A, Pavey SA, Normandeau E, Bernatchez L (2013) the Genetic Architecture of
Reproductive Isolation During Speciation-With-Gene-Flow in Lake Whitefish Species
Pairs Assessed By Rad-Sequencing. Evolution, Available in early view.
Garant D, Dodson JJ, Bernatchez L (2000) Ecological determinants and temporal stability
of the within-river population structure in Atlantic salmon (Salmo salar L.). Molecular
ecology, 9, 615–28.
Genetic Identification Service Inc. (2000) Tetranucleotide Microsatellite Markers in
Northern Pike (Esox lucius).
Gingras D (1997) Capsules-éclair sur l’état du Saint-Laurent : Le fleuve en bref.
Environnement Canada – Région du Québec, Conservation de l’environnement,
Centre Saint-Laurent.
Guillot G, Estoup A, Mortier F, Cosson JF (2005) A spatial statistical model for landscape
genetics. Genetics, 170, 1261–80.
66
Hansen M, Nielsen E (2000) Genetic monitoring of supportive breeding in brown trout
(Salmo trutta L.), using microsatellite DNA markers. Canadian Journal of Fisheries
and Aquatic Sciences, 2139, 2130–2139.
Hansen M, Taggart J, Meldrup D (1999) Development of new VNTR markers for pike and
assessment of variability at di―and tetranucleotide repeat microsatellite loci.
Journal of Fish Biology, 183–188.
Hohenlohe P a, Bassham S, Etter PD et al. (2010) Population genomics of parallel
adaptation in threespine stickleback using sequenced RAD tags. PLoS genetics, 6, 1–
23.
Holderegger R, Wagner HH (2006) A brief guide to Landscape Genetics. Landscape
Ecology, 21, 793–796.
Holderegger R, Wagner HH (2008) Landscape Genetics. BioScience, 58, 199.
Höök T, Eagan N, Webb P (2001) Habitat and human influences on larval fish assemblages
in northern Lake Huron coastal marsh bays. Wetlands, 21, 281–291.
Hunt G, Stabeno P (2005) Oceanography and ecology of the Aleutian Archipelago: spatial
and temporal variation. Fisheries oceanography, 14, 292–306.
Jacobsen BH, Hansen MM, Loeschcke V (2005) Microsatellite DNA analysis of northern
pike (Esox lucius L.) populations: insights into the genetic structure and demographic
history of a genetically depauperate species. Biological Journal of the Linnean
Society, 84, 91–101.
Jones, O. R., Wang, J. (2012). A comparison of four methods for detecting weak genetic
structure from marker data. Ecology and evolution, 2, 1048-1055.
Jude D, Pappas J (1992) Fish utilization of Great Lakes coastal wetlands. Journal of Great
Lakes Research, 18, 25–26.
Junker J, Peter A, Wagner CE et al. (2012) River fragmentation increases localized
population genetic structure and enhances asymmetry of dispersal in bullhead (Cottus
gobio). Conservation Genetics, 13, 545–556.
Kalinowski ST (2005) Hp-Rare 1.0: a Computer Program for Performing Rarefaction on
Measures of Allelic Richness. Molecular Ecology Notes, 5, 187–189.
Karås P, Lehtonen H (1993) Patterns of movement and migration of pike(Esox lucius L.) in
the Baltic Sea. Nordic journal of freshwater research, 68, 72–79.
Kimura M, Weiss G (1964) The stepping stone model of population structure and the
decrease of genetic correlation with distance. Genetics, 49, 561–576.
67
Koed a., Balleby K, Mejlhede P, Aarestrup K (2006) Annual movement of adult pike (Esox
lucius L.) in a lowland river. Ecology of Freshwater Fish, 15, 191–199.
Laikre L, Miller LM, Palmé A et al. (2005) Spatial genetic structure of northern pike (Esox
lucius) in the Baltic Sea. Molecular ecology, 14, 1955–64.
Lande R (1988) Genetics and demography in biological conservation. Science, 241, 1455–
1460.
Latch, E. K., Dharmarajan, G., Glaubitz, J. C., & Rhodes Jr, O. E. (2006). Relative
performance of Bayesian clustering software for inferring population substructure and
individual assignment at low levels of population differentiation. Conservation
Genetics, 7, 295-302.
Launey S, Krieg F, Morin J, Laroche J (2003) Five new microsatellite markers for Northern
pike ( Esox lucius ). Molecular Ecology Notes, 3, 366–368.
Launey S, Morin J, Minery S, Laroche J (2006) Microsatellite genetic variation reveals
extensive introgression between wild and introduced stocks, and a new evolutionary
unit in French pike Esox lucius L. Journal of fish biology, 68, 193–216.
Leclerc E, Mailhot Y, Mingelbier M, Bernatchez L (2008) The landscape genetics of
yellow perch (Perca flavescens) in a large fluvial ecosystem. Molecular ecology, 17,
1702–17.
Legendre P, Lapointe F, Casgrain P (1994) Modeling brain evolution from behavior: a
permutational regression approach. Evolution, 48, 1487–1499.
Logerwell E, Aydin K, Barbeaux S et al. (2005) Geographic patterns in the demersal
ichthyofauna of the Aleutian Islands. Fisheries Oceanography, 14, 93–112.
Lorenzoni M, Corboli M, Martin Dörr a. ., Mearelli M, Giovinazzo G (2002) The growth of
pike (Esox lucius Linnaeus, 1798) in Lake Trasimeno (Umbria, Italy). Fisheries
Research, 59, 239–246.
Lowe, W. H., & Allendorf, F. W. (2010). What can genetics tell us about population
connectivity?. Molecular Ecology, 19, 3038-3051.
Lucentini L, Palomba a., Gigliarelli L et al. (2009) Temporal changes and effective
population size of an Italian isolated and supportive-breeding managed northern pike
(Esox lucius) population. Fisheries Research, 96, 139–147.
Lucentini L, Palomba A, Lancioni H et al. (2006) Microsatellite polymorphism in Italian
populations of northern pike (Esox lucius L.). Fisheries Research, 80, 251–262.
68
Maes GE, Van Houdt JKJ, De Charleroy D, Volckaert F a. M (2003) Indications for a
recent Holarctic expansion of pike based on a preliminary study of mtDNA variation.
Journal of Fish Biology, 63, 254–259.
Manel S, Schwartz MK, Luikart G, Taberlet P (2003) Landscape genetics: combining
landscape ecology and population genetics. Trends in Ecology & Evolution, 18, 189–
197.
Manni F, Guerard E, Heyer E (2004) Geographic patterns of (genetic, morphologic,
linguistic) variation: how barriers can be detected by using Monmonier’s algorithm.
Human Biology, 76, 173–190.
Mantel N (1967) The detection of disease clustering and a generalized regression approach.
Cancer research, 27, 209–220.
Marsh J (2012) St. Lawrence River. The Canadian Encyclopedia.
Martiny J, Eisen J, Penn K, Allison S, Horner-Devine MC (2011) Drivers of bacterial Î2-
diversity depend on spatial scale. Proceedings of the National Academy of Sciences,
108, 7850–7854.
Massé G, Dumont P (1991) Influence des régimes hydrologique et thermique de la rivière
aux Pins (Québec) sur les migrations de fraie du Grand Brochet et sur l’avalaison des
jeunes brochets. Aquatic Living Resources, 4, 275–287.
Massé G, Fortin R, Dumont P, Ferraris J (1988) Étude et aménagement de la frayère
multispécifique de la rivière aux Pins et dynamique de la population de Grand brochet
Esox lucius L., du fleuve Saint-Laurent, Boucherville, Québec. Montréal, Canada.
McElroy T, Kandl K, Trexler J (2011) Temporal Population Genetic Structure of Eastern
Mosquitofish in a Dynamic Aquatic Landscape. Journal of Heredity, 102, 678–687.
McNeely J, Miller KR, Reid W V, Mittermeier RA, Werner TB (1990) Strategies for
Conserving Biodiversity. In: Conserving the world’s biological diversity , p. 193.
IUCN/WRI/WWF/World Bank, Washington D.C, USA.
Messier GD, Garant D, Bergeron P, Réale D (2012) Environmental conditions affect spatial
genetic structures and dispersal patterns in a solitary rodent. Molecular Ecology, 21,
5363–73.
Miller L, Kallemeyn L, Senanan W (2001) Spawning-site and natal-site fidelity by northern
pike in a large lake: mark–recapture and genetic evidence. Transactions of the
American Fisheries Society, 130, 307–316.
69
Miller LM, Kapuscinski a R (1997) Historical analysis of genetic variation reveals low
effective population size in a northern pike (Esox lucius) population. Genetics, 147,
1249–58.
Miller LM, Senanan W (2003) A Review of Northern Pike Population Genetics Research
and Its Implications for Management. North American Journal of Fisheries
Management, 23, 297–306.
Mingelbier M, Brodeur P, Morin J (2004) Impacts de la régularisation du débit des Grands
Lacs et des changements climatiques sur l’habitat des poissons du fleuve Saint-
Laurent. Vecteur environnement, 37, 34–43.
Mingelbier M, Brodeur P, Morin J (2008) Spatially explicit model predicting the spawning
habitat and early stage mortality of Northern pike (Esox lucius) in a large system: the
St. Lawrence River between 1960 and 2000. Hydrobiologia, 601, 55–69.
Mingelbier M, Morin J (2005) Modélisation numérique 2 D de l’habitat des poissons du
Saint-Laurent fluvial pour évaluer l'impact des changements climatiques et de la
régularisation. Le Naturaliste Canadien, 129, 96–102.
Monaghan MT, Gattolliat J-L, Sartori M et al. (2005) Trans-oceanic and endemic origins of
the small minnow mayflies (Ephemeroptera, Baetidae) of Madagascar. Proceedings.
Biological sciences / The Royal Society, 272, 1829–36.
Moritz C (1994) Defining’evolutionarily significant units' for conservation. TRENDS in
Ecology and Evolution, 373–375.
Myers M, Sperling F, Resh V (2001) Dispersal of two species of Trichoptera from desert
springs: Conservation implications for isolated vs connected populations. Journal of
Insect Conservation, 5, 207–215.
Nelson R, Platts W, Casey O (1987) Evidence for variability in spawning behavior of
interior cutthroat trout in response to environmental uncertainty. Western North
American Naturalist, 41, 480–487.
Ostergaard S, Hansen M, Loeschcke V, Nielsen E (2003) Long-•term temporal changes of
genetic composition in brown trout (Salmo trutta L.) populations inhabiting an
unstable environment. Molecular Ecology, 12, 3123–3135.
Ouellet-Cauchon G, Normandeau E, Mingelbier M, Bernatchez L (in prep.) Novel
microsatellite markers for northern pike (Esox lucius) and cross-amplification across
all Esox species.
Palsbøll PJ, Bérubé M, Allendorf FW (2007) Identification of management units using
population genetic data. Trends in Ecology and Evolution, 22, 11–6.
70
Primack RB (2006) Essentials of Conservation Biology. Sinauer Associates, Sunderland,
USA.
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using
multilocus genotype data. Genetics, 155, 945–59.
Raat A (1988) Synopsis of Biological Data on the Northern Pike Esox Lucius Linnaeus
1758. FAO Fish Synopsis.
Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for
exact tests and ecumenicism. Journal of Heredity, 86, 248–249.
Reiss H, Hoarau G, Dickey-Collas M, Wolff WJ (2009) Genetic population structure of
marine fish: mismatch between biological and fisheries management units. Fish and
Fisheries, 10, 361–395.
Rice WR (1989) Analysing Tables of Statistical Tests. Evolution, 43, 223–225.
Roberts CM (1997) Connectivity and Management of Caribbean Coral Reefs. Science, 278,
1454–1457.
Rosell R, MacOscar K (2002) Movements of pike, Esox lucius, in Lower Lough Erne,
determined by mark–recapture between 1994 and 2000. Fisheries Management and
Ecology, 9, 189–196.
Rousset F (1997) Genetic differentiation and estimation of gene flow from F-statistics
under isolation by distance. Genetics, 145, 1219–1228.
Rukavina N, Boyce FM (2012) Lake Ontario. The Canadian Encyclopedia.
Ryder O a. (1986) Species conservation and systematics: the dilemma of subspecies.
Trends in Ecology & Evolution, 1, 9–10.
Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments.
Nature biotechnology, 18, 1–2.
Senanan W, Kapuscinski AR (2000) Genetic relationships among populations of northern
pike (Esox lucius). Canadian Journal of Fisheries and Aquatic Sciences, 57, 391–404.
Slatkin M (1987) Gene Flow and the Geographic Structure of Natural Populations. Science,
236, 787–792.
Smith BM, Farrell JM, Underwood HB, Smith SJ (2007) Year-Class Formation of Upper
St. Lawrence River Northern Pike. North American Journal of Fisheries Management,
27, 481–491.
71
Stölting KN, Nipper R, Lindtke D et al. (2013) Genomic scan for single nucleotide
polymorphisms reveals patterns of divergence and gene flow between ecologically
divergent species. Molecular Ecology, 22, 842–55.
Storfer a, Murphy M a, Evans JS et al. (2007) Putting the “landscape” in landscape
genetics. Heredity, 98, 128–42.
Titus RG, Mosegaard H (1992) Fluctuating recruitment and variable life history of
migratory brown trout, Salmo trutta L., in a small, unstable stream. Journal of Fish
Biology, 41, 239–255.
Vehanen T, Hyvarinen P, Johansson K, Laaksonen T (2006) Patterns of movement of adult
northern pike (Esox lucius L.) in a regulated river. Ecology of Freshwater Fish, 15,
154–160.
Wan Q-H, Wu H, Fujihara T, Fang S-G (2004) Which genetic marker for which
conservation genetics issue? Electrophoresis, 25, 2165–76.
Waples RS (1989) A generalized approach for estimating effective population size from
temporal changes in allele frequency. Genetics, 121, 379–91.
Waples, R. S., Gaggiotti, O. (2006). What is a population? An empirical evaluation of some
genetic methods for identifying the number of gene pools and their degree of
connectivity. Molecular ecology, 15, 1419-1439.
Westin L, Limburg KE (2002) Newly discovered reproductive isolation reveals sympatric
populations of Esox lucius in the Baltic. Journal of Fish Biology, 61, 1647–1652.
Whitlock, M. C., & McCauley, D. E. (1999). Indirect measures of gene flow and migration:
FST≠ 1/(4Nm+ 1). Heredity, 82, 117-125.
Zickovich JM, Bohonak AJ (2007) Dispersal ability and genetic structure in aquatic
invertebrates: a comparative study in southern California streams and reservoirs.
Freshwater Biology, 52, 1982–1996.
72
Annexe 1. Mean values of physicochemical variables of St. Lawrence River’s principal water masses (Centre Saint-Laurent
1996). NTU : Nephelometric Turbidity Unit.
Water masses Conductivity
(μS/cm)
Apparent color
(Pt-Co unit)
Turbidity (NTU)
Suspended matter (mg/L)
Temperature (°C)
pH
Great Lakes 305 13 1.4 2.5 13.5 8.2
Ottawa River 80 62 4.2 6.0 14.6 7.4
Ottawa R. and North shore mix 171 86 15.0 14.3 14.2 7.7
Great Lakes and South shore mix 272 56 6.4 15.0 14.0 8.1
Quebec sector mix 244 48 14.0 12.2 12.7 7.9
73
Annexe 2. Population groupings assessment.
A) Analyses of molecular variance (AMOVA) A) between sampling years B) between sampling periods (pre- and during spawning
only).
Groups compared Component D.f. Sum of squares
% variation
P-value
A) Temporal samples (2009 and 2010, N = 12) Among sites 11 324.83 1.38 <0.00001
Among periods 12 93.67 0.12 0.00644
Within sites 2758 18485.99 98.50 <0.00001
B) Sampling periods (pre- and during spawning, Among sites 7 182.51 1.22 <0.00001
N = 8) Among periods 8 61.76 0.13 0.02060
Within sites 1762 11805.92 98.65 <0.00001
74
B) Mean pairwise Fst values between population groupings for 1) Ontario sector and 2) Quebec sector. See Results section of Chapter
2 for groupings correspondence.
1) Ontario sector
Group 1 2 3 4 5 6 7 8 9 10 11 12
1 -
2 0.00709 -
3 0.02878 0.02462 -
4 0.03201 0.03525 0.03688 -
5 0.03317 0.03036 0.03504 0.01718 -
6 0.02198 0.01562 0.02682 0.01783 0.01204 -
7 0.02328 0.01585 0.02572 0.01950 0.01594 0.00452 -
8 0.04212 0.02834 0.04536 0.04017 0.02373 0.01632 0.01885 -
9 0.02671 0.01988 0.02967 0.02129 0.01633 0.00495 0.00377 0.01649 -
10 0.02134 0.01897 0.02698 0.01575 0.01230 0.00404 0.00493 0.02476 0.00035 -
11 0.08164 0.08036 0.10295 0.08632 0.10629 0.08717 0.08474 0.11232 0.09466 0.08385 -
12 0.05735 0.06477 0.07797 0.05648 0.05628 0.05498 0.05869 0.07185 0.06560 0.05298 0.08998 -
2) Quebec sector
Group 1 2 3 4 5 6 7 8
1 -
2 0.00867 -
3 0.02572 0.01491 -
4 0.01327 0.00415 0.00859 -
5 0.01210 0.00759 0.00848 0.00433 -
6 0.01706 0.01016 0.00526 0.00504 0.00218 -
7 0.03366 0.02306 0.02144 0.01906 0.02265 0.01863 -
8 0.03541 0.02911 0.00668 0.01963 0.02074 0.01629 0.02766 -
75
Annexe 3. Multilocus pairwise Fst values (Weir & Cockerham 1984) above diagonal and associated p-values below diagonal.
P-values still significant after with FDR correction are represented in bold characters. See sampling sites correspondence at Table 2.3.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
1 - 0.08998 0.05910 0.04733 0.06563 0.06477 0.07797 0.05597 0.05698 0.05628 0.05806 0.05637 0.05190 0.05162 0.06362 0.07185 0.06560 0.05298 0.06316 0.06114
2 <0,00001 - 0.08192 0.07481 0.08820 0.08036 0.10295 0.08833 0.08431 0.10629 0.08877 0.08519 0.08557 0.07872 0.08594 0.11232 0.09466 0.08385 0.08910 0.09352
3 <0,00001 <0,00001 - -0.00127 0.00313 0.00480 0.02575 0.02800 0.03561 0.03309 0.02059 0.01730 0.02028 0.02157 0.02790 0.04315 0.02685 0.02001 0.02215 0.02655
4 <0,00001 <0,00001 0.67900 - 0.00393 0.00936 0.03020 0.02950 0.03101 0.02818 0.01972 0.01884 0.01732 0.02167 0.02478 0.03736 0.02446 0.01768 0.02095 0.02697
5 <0,00001 <0,00001 0.23000 0.08800 - 0.00710 0.03040 0.03242 0.03554 0.03824 0.02899 0.02277 0.02500 0.02709 0.03225 0.04585 0.02881 0.02632 0.02213 0.02652
6 <0,00001 <0,00001 0.05800 <0,00001 0.02200 - 0.02462 0.03300 0.03750 0.03036 0.01709 0.01329 0.01415 0.01568 0.01889 0.02834 0.01988 0.01897 0.01552 0.02446
7 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 - 0.03225 0.04151 0.03504 0.02682 0.02544 0.02682 0.02242 0.02918 0.04536 0.02967 0.02698 0.02584 0.04297
8 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 - 0.00244 0.01548 0.01739 0.01505 0.01346 0.01735 0.01991 0.03800 0.01950 0.01432 0.02180 0.03657
9 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.11000 - 0.01888 0.02122 0.01910 0.01925 0.01815 0.02374 0.04234 0.02308 0.01718 0.02088 0.03876
10 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 - 0.01176 0.01520 0.01232 0.01306 0.01948 0.02373 0.01633 0.01230 0.01602 0.03097
11 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 - 0.00602 0.00302 0.00519 0.00233 0.01799 0.00558 0.00591 0.00674 0.01990
12 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00200 - 0.00246 0.00266 0.00850 0.02353 0.00673 0.00747 0.00574 0.02077
13 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.05100 0.00800 - 0.00587 0.00228 0.01465 0.00432 0.00216 0.00526 0.02126
14 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.03600 0.06000 0.00400 - 0.00823 0.02454 0.00573 0.00441 0.00238 0.01670
15 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.16200 <0,00001 0.04900 0.00100 - 0.01398 0.00208 0.00356 0.00373 0.02171
16 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 - 0.01649 0.02476 0.01333 0.03033
17 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00600 <0,00001 0.00100 0.00700 0.08200 <0,00001 - 0.00035 0.00053 0.01844
18 <0,00001 <0,00001 0.00200 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.05500 0.00600 0.15900 0.11200 0.10100 <0,00001 0.42200 - 0.00426 0.01853
19 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00800 0.00100 <0,00001 0.13100 0.03400 <0,00001 0.35000 0.11100 - 0.01497
20 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 -
21 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 <0,00001 0.00500 0.00500 0.00100
22 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
23 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
24 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
25 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
26 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 0.00700 <0,00001 <0,00001
27 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
28 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
29 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001
30 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
31 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
32 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
76
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
33 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
34 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
35 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001
36 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
37 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
38 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
39 <0,00001 <0,00001 0.00100 <0,00001 <0,00001 0.04400 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00300 0.00200 0.01300 0.00600 <0,00001 0.00300 0.00200 0.01000 <0,00001
40 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
1 0.07088 0.07622 0.08676 0.07820 0.07044 0.05720 0.07097 0.05457 0.05620 0.05624 0.06277 0.05876 0.06082 0.06245 0.06922 0.06286 0.06454 0.06192 0.06355 0.06307
2 0.08546 0.09881 0.09330 0.09679 0.08849 0.09002 0.09707 0.09517 0.08258 0.09038 0.08952 0.09243 0.08782 0.09203 0.09129 0.09342 0.09655 0.09532 0.09244 0.08845
3 0.02082 0.02966 0.03087 0.02651 0.02189 0.01910 0.01928 0.02028 0.01955 0.01971 0.02190 0.02127 0.01927 0.01960 0.02079 0.02357 0.01808 0.02241 0.01553 0.01787
4 0.02257 0.02407 0.03230 0.02929 0.02056 0.01999 0.02387 0.02075 0.02082 0.02161 0.02337 0.02049 0.01969 0.02048 0.02301 0.02383 0.01974 0.02298 0.01821 0.02004
5 0.02139 0.02211 0.02861 0.02508 0.02060 0.02214 0.01945 0.02281 0.02144 0.02442 0.02435 0.02577 0.01942 0.02147 0.01936 0.02672 0.02099 0.02572 0.01800 0.01964
6 0.01498 0.01883 0.01958 0.01542 0.00891 0.01225 0.01139 0.01606 0.01656 0.01968 0.01703 0.01408 0.01177 0.01257 0.00970 0.01514 0.01066 0.01468 0.00621 0.01048
7 0.03075 0.04419 0.03084 0.02528 0.02429 0.02846 0.02870 0.02950 0.03150 0.03280 0.03151 0.03014 0.02762 0.02389 0.02475 0.02973 0.02005 0.02871 0.01795 0.02490
8 0.02815 0.04110 0.04799 0.03558 0.03276 0.02603 0.03104 0.02693 0.02428 0.02762 0.02519 0.03036 0.02629 0.02865 0.02957 0.03017 0.02472 0.03049 0.02282 0.02732
9 0.03137 0.04535 0.05189 0.04594 0.03729 0.03305 0.03886 0.03308 0.02847 0.03049 0.02772 0.03774 0.03151 0.03466 0.03817 0.03358 0.03167 0.03496 0.02886 0.03192
10 0.03093 0.04211 0.04321 0.03945 0.02984 0.02364 0.02989 0.02392 0.02548 0.02821 0.02400 0.02708 0.02388 0.02563 0.02930 0.02741 0.02300 0.02714 0.02154 0.02544
11 0.01324 0.02139 0.02912 0.02275 0.01363 0.01087 0.01502 0.01209 0.01282 0.01362 0.01257 0.01209 0.01145 0.01122 0.01243 0.01231 0.00813 0.01464 0.01125 0.01050
12 0.01395 0.02323 0.02134 0.01652 0.00978 0.01134 0.01352 0.01131 0.01660 0.01525 0.01248 0.01221 0.01038 0.01054 0.01127 0.01152 0.00827 0.01105 0.00930 0.00992
13 0.01210 0.02020 0.02313 0.01512 0.01024 0.00622 0.01125 0.01015 0.01344 0.01646 0.01244 0.00950 0.00880 0.00918 0.01050 0.01126 0.00827 0.00960 0.00836 0.00816
14 0.01239 0.02587 0.02190 0.02028 0.01327 0.01149 0.01239 0.01147 0.01307 0.01356 0.01125 0.01092 0.00898 0.01026 0.01023 0.01043 0.00869 0.01084 0.00856 0.01047
15 0.01065 0.02104 0.02262 0.01432 0.01184 0.00798 0.01162 0.01259 0.00997 0.01498 0.01186 0.01057 0.01050 0.00882 0.01065 0.00991 0.00877 0.00921 0.00907 0.00841
16 0.02623 0.03369 0.03926 0.03218 0.02790 0.02197 0.02312 0.02318 0.02605 0.02980 0.02243 0.02158 0.02157 0.02358 0.02232 0.02432 0.02310 0.02486 0.02393 0.02185
17 0.00952 0.02404 0.02416 0.01831 0.01308 0.00818 0.01272 0.01187 0.01160 0.01492 0.01204 0.01115 0.00892 0.00961 0.00973 0.01056 0.00863 0.01022 0.00965 0.00870
18 0.01003 0.02384 0.02708 0.02407 0.01670 0.00799 0.01410 0.01311 0.01065 0.01518 0.01650 0.01391 0.01243 0.01237 0.01240 0.01264 0.01422 0.01214 0.01343 0.01186
19 0.00767 0.02139 0.01843 0.01678 0.01064 0.01055 0.00844 0.01066 0.01255 0.01432 0.01039 0.01229 0.00877 0.00946 0.00945 0.01135 0.00882 0.01130 0.00965 0.00892
20 0.00867 0.03366 0.03541 0.02861 0.02283 0.01458 0.01327 0.01190 0.01153 0.00886 0.01103 0.01104 0.01059 0.01470 0.01467 0.01967 0.01709 0.01793 0.01486 0.01575
21 - 0.02306 0.02911 0.01759 0.01223 0.00737 0.00415 0.00881 0.00740 0.00581 0.00818 0.00781 0.00715 0.00916 0.00664 0.01186 0.01036 0.01411 0.00576 0.00872
22 <0,00001 - 0.02766 0.02467 0.01821 0.02024 0.01906 0.02395 0.02619 0.02807 0.02793 0.02214 0.01984 0.01998 0.01552 0.02151 0.01832 0.01939 0.01712 0.01683
23 <0,00001 <0,00001 - 0.00778 0.00558 0.01990 0.01963 0.02324 0.02347 0.02986 0.02316 0.01961 0.01751 0.01500 0.01495 0.02044 0.01544 0.01596 0.01574 0.01387
24 <0,00001 <0,00001 <0,00001 - 0.00202 0.00892 0.00963 0.01220 0.01246 0.01980 0.01199 0.00905 0.00932 0.00622 0.00750 0.01263 0.00508 0.00918 0.00357 0.00577
77
21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
25 <0,00001 <0,00001 <0,00001 0.07200 - 0.00466 0.00754 0.00747 0.00880 0.01248 0.00775 0.00426 0.00370 0.00318 0.00290 0.00655 0.00235 0.00495 0.00111 0.00136
26 <0,00001 <0,00001 <0,00001 <0,00001 0.00700 - 0.00309 -0.00018 0.00341 0.00541 0.00257 0.00161 0.00078 0.00086 0.00365 0.00296 0.00081 0.00096 -0.00086 -0.00028
27 0.01500 <0,00001 <0,00001 <0,00001 <0,00001 0.01600 - 0.00286 0.00677 0.00861 0.00432 0.00310 0.00350 0.00428 0.00245 0.00837 0.00464 0.00798 0.00003 0.00416
28 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.53800 0.00500 - 0.00165 0.00263 -0.00011 -0.00050 0.00022 0.00158 0.00457 0.00432 0.00229 0.00400 -0.00133 0.00224
29 0.00400 <0,00001 <0,00001 <0,00001 <0,00001 0.02600 <0,00001 0.09400 - -0.00026 0.00025 0.00117 0.00148 0.00298 0.00672 0.00895 0.00583 0.00637 -0.00075 0.00304
30 0.00500 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.02300 0.50800 - 0.00237 0.00157 0.00247 0.00448 0.00748 0.00650 0.00643 0.00855 0.00374 0.00572
31 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.02900 0.00200 0.48700 0.43500 0.04800 - 0.00053 0.00079 0.00275 0.00546 0.00538 0.00229 0.00637 -0.00023 0.00185
32 0.00100 <0,00001 <0,00001 <0,00001 0.01300 0.13100 0.01300 0.64300 0.20800 0.12200 0.30700 - -0.00145 -0.00008 0.00022 0.00252 -0.00008 0.00267 -0.00151 -0.00019
33 <0,00001 <0,00001 <0,00001 <0,00001 0.00700 0.21400 0.00300 0.37600 0.10700 0.02400 0.19100 0.93300 - 0.00021 -0.00012 0.00314 0.00048 0.00183 -0.00245 -0.00033
34 <0,00001 <0,00001 <0,00001 <0,00001 0.01200 0.16400 <0,00001 0.03700 0.00500 <0,00001 0.00500 0.48000 0.34400 - -0.00005 0.00254 -0.00119 0.00084 -0.00169 -0.00086
35 0.00500 <0,00001 <0,00001 <0,00001 0.05900 0.01100 0.04000 0.00400 <0,00001 <0,00001 <0,00001 0.39800 0.51800 0.48100 - 0.00407 0.00040 0.00343 -0.00094 0.00018
36 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.00800 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.01200 <0,00001 0.00100 0.00300 - 0.00171 0.00312 0.00307 0.00243
37 <0,00001 <0,00001 <0,00001 <0,00001 0.07100 0.24400 <0,00001 0.03200 0.00100 0.00100 0.05400 0.48200 0.30600 0.90000 0.36200 0.07500 - 0.00156 -0.00372 -0.00192
38 <0,00001 <0,00001 <0,00001 <0,00001 0.00200 0.16000 <0,00001 <0,00001 <0,00001 <0,00001 <0,00001 0.01100 0.02000 0.12700 0.00500 <0,00001 0.08900 - 0.00117 -0.00078
39 0.05600 <0,00001 <0,00001 0.09100 0.34000 0.57400 0.42300 0.66600 0.56400 0.08900 0.49900 0.67000 0.83900 0.74400 0.58800 0.09700 0.93500 0.27700 - -0.00214
40 <0,00001 <0,00001 <0,00001 <0,00001 0.16300 0.54400 0.00100 0.01400 0.02500 <0,00001 0.04200 0.52400 0.62500 0.87400 0.39700 0.01100 0.97000 0.83700 0.80000 -
78
Annexe 4. Analyses of molecular variance (AMOVA) between population groupings.
A) Within whole study area
Groups compared Component D.f. Sum of squares
% variation
P-value
Groupings (N=20) Among groups 19 905.88 2.06 <0.00001
Among sites 20 174.04 0.19 <0.00001
Within sites 5786 38991.90 97.76 <0.00001
B) Within Ontario sector
Groups compared Component D.f. Sum of squares
% variation
P-value
Groupings (N=12) Among groups 11 476.37 2.77 <0.00001
Among sites 7 62.52 0.31 0.00020
Within sites 2151 14310.75 96.92 <0.00001
C) Within Quebec sector
Groups compared Component D.f. Sum of squares
% variation
P-value
Groupings (N=8) Among groups 7 263.84 1.05 <0.00001
Among sites 13 111.52 0.15 <0.00001
Within sites 3635 24681.15 98.80 <0.00001
