Embed Size (px)
Citation preview
TESIS DOCTORAL
GENÉTICA DE LA INTROGRESIÓN DE GENES DEL ALMENDRO
(Prunus dulcis Mill.) EN EL MELOCOTONERO [P. persica (L.)
Batsch]: DESARROLLO DE UNA ESTRATEGIA DE SELECCIÓN DE
LÍNEAS CASI ISOGÉNICAS (NILs) CON MARCADORES
MOLECULARES
AUTOR:
JOSÉ MANUEL DONOSO
Memoria de Investigación presentada al
Departamento de Biología Animal, Biología Vegetal y Ecología para la obtención del grado de
DOCTOR EN BIOLOGÍA Y BIOTECNOLOGÍA VEGETAL
por la Universidad Autónoma de Barcelona
Memoria de la investigación realizada en el
Programa de Genómica y Biotecnología del
Institut de Recerca i Tecnologia Agroalimentàries (IRTA)
Ubicado en el
Centre de Recerca en Agrigenòmica (CRAG),
financiada por el
Institut de Recerca i Tecnologia Agroalimentàries (IRTA) de Cataluña
y el Instituto de Investigaciones Agropecuarias (INIA) de Chile
V°B°
El candidato: El director: El director: El tutor:
José M. Donoso Dr. Pere Arús Dr. Iban Eduardo Dra. Charlotte Contreras Gorina Muñoz Poschenrieder Wiens
IRTA CRAG UAB
Bellatera, Barcelona
25 de julio 2014
A mi abuelita
por construir(me) un mundo mejor
Vincent van Gogh (1888) Orchard with peach trees in blossom
ÍNDICE GENERAL
RESUMEN ................................................................................................................... 11
SUMMARY .................................................................................................................. 13
RESUM ........................................................................................................................ 15
1. INTRODUCCIÓN GENERAL ...................................................................................... 17
1.1 Agricultura y domesticación ......................................................................................... 19
1.2 El género Prunus: taxonomía y sistemática ................................................................... 20
1.2.1 Amygdalus: diversidad y recursos genéticos ........................................................... 21
1.3 El melocotonero ........................................................................................................... 24
1.3.1 Distribución actual ................................................................................................. 24
1.3.2 Botánica ................................................................................................................ 24
1.3.3 Importancia económica y social ............................................................................. 28
1.4 Mejora genética de plantas .......................................................................................... 29
1.5 Mejora genética del melocotonero ............................................................................... 29
1.5.1 Origen y diseminación ............................................................................................ 29
1.5.2 Mejora genética clásica ......................................................................................... 31
1.6 El melocotonero: “especie modelo”.............................................................................. 33
1.7 Herramientas para la mejora molecular ........................................................................ 33
1.7.1 Poblaciones genéticas ............................................................................................ 34
1.7.2 Mapas genéticos .................................................................................................... 37
1.7.2.1 Mapas genéticos en melocotonero .............................................................................. 39
1.8 Análisis de caracteres cuantitativos (QTLs).................................................................... 40
1.8.1 Métodos estadísticos para el mapeo de QTLs ......................................................... 42
1.8.2 Posición y efecto de un QTL .................................................................................... 43
2. OBJETIVOS .............................................................................................................. 45
3. GENETIC CHARACTERIZATION OF A CYTOPLASMIC MALE STERILITY AND TWO RESTORER GENES IN ALMOND X PEACH PROGENIES USING HIGH-DENSITY SNP MAPS ................................................................................................................................... 49
3.1 INTRODUCTION ............................................................................................................ 51
3.2 MATERIALS AND METHODS ......................................................................................... 52
3.2.1 Plant material ........................................................................................................ 52
3.2.2 Phenotyping .......................................................................................................... 52
3.2.3 Marker detection, linkage map construction and genetic analysis .......................... 53
3.2.4 Candidate genes analysis ....................................................................................... 55
3.3 RESULTS ....................................................................................................................... 56
3.3.1 Map construction and comparison ......................................................................... 56
3.3.2 Genetic analysis of the male sterility character ...................................................... 59
3.3.3 Search of candidate genes for the Rf ...................................................................... 61
3.4 DISCUSSION .................................................................................................................. 61
4. MAPPING MAJOR GENES AND QTLS FOR FLOWER, PHENOLOGY, FRUIT QUALITY, LEAF MORPHOLOGY AND DISEASE RESISTANCE TRAITS IN TWO INTER-SPECIFIC ALMOND X PEACH PROGENIES ................................................................................... 65
4.1 INTRODUCTION ........................................................................................................... 67
4.2 MATERIALS AND METHODS ......................................................................................... 68
4.2.1 Plant material ........................................................................................................ 68
4.2.2 Phenotyping .......................................................................................................... 68
4.2.3 Phenotypic data analysis ........................................................................................ 71
4.2.4 Genetic linkage maps and QTL analysis .................................................................. 71
4.3 RESULTS ...................................................................................................................... 72
4.3.1 Trait distributions and correlations ........................................................................ 72
4.3.2 Mapping Mendelian traits...................................................................................... 75
4.3.3 QTL analysis ........................................................................................................... 77
4.3.3.1 Flower traits ................................................................................................................ 77
4.3.3.2 Phenology traits ........................................................................................................... 82
4.3.3.3 Fruit traits.................................................................................................................... 89
4.3.3.4 Leaf traits .................................................................................................................... 89
4.4 DISCUSSION ................................................................................................................. 90
4.4.1 Flower traits .......................................................................................................... 92
4.4.2 Phenology traits ..................................................................................................... 93
4.4.3 Fruit traits .............................................................................................................. 94
4.4.4 Leaf traits .............................................................................................................. 97
4.4.5 Resistance to powdery mildew ............................................................................... 97
4.4.6 Implications for breeding and conclusions .............................................................. 98
5. MARKER-ASSISTED INTROGRESSION OF ALMOND GENES INTO THE PEACH BACKGROUND: A FIRST STEP TOWARDS THE CONSTRUCTION OF A NIL COLLECTION OF ALMOND CHROMOSOME FRAGMENTS INTO PEACH. ........................................... 99
5.1 INTRODUCTION .......................................................................................................... 101
5.2 MATERIALS AND METHODS ....................................................................................... 103
5.2.1 Plant materials and crosses .................................................................................. 103
5.2.2 NIL development strategy .................................................................................... 104
5.2.3 Genotyping .......................................................................................................... 104
5.2.4 The preNIL set: phenotyping and genetic analysis ................................................ 106
5.3 RESULTS ..................................................................................................................... 107
5.3.1 Selection process in the backcross one generation................................................ 107
5.3.2 Genetic analysis .................................................................................................... 112
5.4 DISCUSSION ................................................................................................................ 116
5.4.1 NIL development strategy .................................................................................... 116
5.4.2 Choice of parental lines ........................................................................................ 118
5.4.3 Mapping major genes and QTLs ........................................................................... 119
5.4.4 A model for marker-assisted introgression (MAI) .................................................. 120
6. DISCUSIÓN GENERAL .......................................................................................... 123
6.1 Estudios genéticos y genómicos en melocotonero ...................................................... 125
6.2 Creación de una colección de NILs de almendro en el fondo genético del melocotonero ......................................................................................................................................... 130
6.3 Perspectivas de futuro ................................................................................................ 134
7. CONCLUSIONES .................................................................................................... 137
8. BIBLIOGRAFÍA GENERAL ....................................................................................... 141
9. ANEXOS .............................................................................................................. 159
ABREVIACIONES ....................................................................................................... 189
LISTA DE TABLAS Y FIGURAS ..................................................................................... 191
AGRADECIMIENTOS.................................................................................................. 193
11
RESUMEN
El melocotonero es el frutal de hueso más importante a nivel mundial, y el tercer árbol de
fruta dulce cultivado después del manzano y el peral. A nivel genético es una de las especies
mejor caracterizadas de la familia Rosaceae. El melocotonero presenta un bajo nivel de
variabilidad genética pero es sexualmente compatible con otras especies de Prunus, como el
almendro, que podrían ser una posible fuente de nuevos genes para enriquecer su genoma.
Estudiamos un conjunto de caracteres asociados a la flor, fenología, calidad de fruta,
morfología de la hoja y la resistencia a enfermedades en dos poblaciones de almendro
(‘Texas’) x melocotonero (‘Earlygold’): una F2 (TxE) y un BC1 (T1E) del parental ‘Earlygold’. Tres
mapas genéticos de alta densidad se construyeron utilizando un chip de SNP de 9K y 131
marcadores microsatélite: el mapa F2 (llamado TxE) y los mapas de los parentales del BC1
denominados T1E (para el híbrido) y E (para ‘Earlygold’). La comparación del mapa
intraespecífico de E con los mapas interespecíficos de TxE y T1E mostró una mayor tasa de
recombinación en los cruzamientos intraespecíficos que en los cruzamientos interespecíficos.
El mapa de E presentó aproximadamente la mitad de su genoma sin marcadores polimórficos,
lo que se interpretó por la presencia de regiones idénticas por descendencia debido a su alto
nivel de coancestría. La presencia de plantas androestériles en ambas poblaciones y su
segregación fue consistente con la existencia de androesterilidad citoplasmática, debido a que
los individuos que tienen el citoplasma del almendro requieren la presencia del alelo del
almendro en al menos uno de los dos genes restauradores, Rf1 y Rf2, para ser fértil. Varios
caracteres como el tipo de flor (Sh), el tipo de fruta (Ft), la jugosidad (Jui), el color de la antera
(Ag y Ag2), la pulpa antociánica (Bf2), el color de la flor (Fc2) y la resistencia al oídio (Vr3) se
mapearon como caracteres morfológicos. El estudio de caracteres cuantitativos permitió
identificar 63 QTLs consistentes en 32 caracteres relativos a flor (2), fenología (7), calidad de
fruta (15) y hoja (8). Nuevos alelos del almendro en rasgos importantes como el color de la
piel, la pulpa antociánica o la resistencia al oídio son útiles para enriquecer el pool genético del
melocotonero cultivado. Proponemos la estrategia de Introgresión Asistida por Marcadores
Moleculares (IAM) para integrar los fragmentos cromosómicos del almendro en el
melocotonero cultivado en un breve período de tiempo (2-3 generaciones). Esta estrategia
incluye tres etapas: la primera consiste en la selección de individuos con bajo número de
introgresiones (preNILs) en una amplia población BC1. En esta etapa obtuvimos nueve
individuos con tres o menos introgresiones de 882 individuos T1E, lo que demuestra que esta
etapa es factible. La segunda etapa implica el mapeo de genes mayores de interés utilizando
12
una colección de preNILs. En esta etapa seleccionamos 18 preNILs con cuatro o menos
introgresiones y demostramos que todos los genes mayores podían ser mapeados en sus
posiciones esperadas, aunque esto sólo fue posible para uno de los dos QTLs mayores
estudiados. La tercera etapa consistiría en autofecundar o retrocruzar y autofecundar algunas
preNILs para obtener NILs (líneas casi isogénicas) homocigotas con una sola introgresión de
almendro en el fondo genético del melocotonero. Una colección completa de NILs (cubriendo
todo el genoma del almendro) es una poderosa herramienta para el análisis genético de
caracteres complejos. Además, las NILs con genes de interés se pueden introducir rápidamente
en un programa de mejora genética. Esta tercera etapa está actualmente en progreso y se
retrasará una generación debido a la androesterilidad citoplasmática. Proponemos la
estrategia de IAM utilizando otras especies de Prunus como una forma de incrementar la
variabilidad genética del melocotonero incorporando un conjunto de resistencias a plagas y
enfermedades y mejoras en la calidad de la fruta necesarias para la mejora del melocotonero
en las próximas décadas.
13
SUMMARY
Peach is the most important stone fruit crop of the world in cultivated surface and the third
among temperate fruit after apple and pear. It is one of the best genetically characterized
species of the Rosaceae family. Peach present a low level of genetic variability and it is sexually
compatible with other Prunus species, as almond, that could be a source of new genes for
enrichment its genome. We studied the genetics of traits related to flower, phenology, fruit
quality, leaf morphology and resistance to diseases in two almond (‘Texas’) x peach
(‘Earlygold’) progenies: an F2 (TxE) and a BC1 (T1E) to the ‘Earlygold’ parent. High density maps
were developed using a 9k peach SNP chip and a collection of 131 SSR markers. Three maps
were obtained: the F2 map (named TxE) and the maps from the two parents of the backcross,
T1E (for the hybrid) and E (for ‘Earlygold’). Comparison of the intraspecific E map with the
interspecific TxE and T1E maps showed that recombination rates were much lower in
interspecific than in intraspecific crosses. The E map had approximately half of its genome
without polymorphic markers, which we interpreted as being identical by descent in the fixed
regions due to its high level of coancestry. Male sterile plants were recovered in the F2 and BC1
generations and their segregation was consistent with the existence of a cytoplasmic male
sterility, where individuals having the almond cytoplasm required the presence of the almond
allele in at least one of two independent restorer genes, Rf1 and Rf2, to be fertile. Several
traits as flower type (Sh), fruit type (Ft), juiciness (Jui), anther color (Ag and Ag2), blood flesh
(Bf2), flower color (Fc2) and powdery mildew resistance (Vr3) have been mapped as single
genes. The genetics of quantitative traits has been studied and 63 significant QTLs that had a
consistent behavior across years have been identified for 32 flower (2), phenology (7), fruit
(15) and leaf (8) traits. New alleles from almond on important traits such as red skin color,
blood flesh or powdery mildew resistance have been identified that may prove to be useful for
the introduction of new variability into the peach commercial gene pool. We propose the
strategy of Marker Assisted Introgression (MAI) to integrate chromosomal fragments of
almond into the peach background in a short time span (2-3 generations). MAI includes three
steps: the first consists of selecting a set of individuals with a low number of introgressions
(preNILs) from a large BC1 progeny, and we obtained nine individuals with three or less
introgressions from 882 T1E progeny, showing that this step is feasible. The second MAI step
involves mapping some of the major genes of interest using a collection of preNILs. We
selected 18 peach-almond preNILs with four or less introgressions and showed that all major
genes tested could be mapped to their expected positions, although this occurred in only one
14
of the two major QTLs assayed. The third step consists of selfing or backcrossing and selfing
some of the preNILs to extract homozygous NILs (Near Isogenic Lines) having a single almond
introgression in the peach background. A complete collection of NILs (covering the complete
almond genome) is a powerful tool for genetic analysis of complex characters and NILs
containing genes of interest can be readily introduced into peach breeding to obtain cultivars
with novel genes. This third step is currently in progress and will be delayed one generation
due to the presence of the cytoplasmic male sterility. The extension of the MAI strategy to
other donor Prunus species is proposed as a way to incorporate in the peach genome needed
genes for pest and disease resistance and fruit quality for the cultivars of next decades.
15
RESUM
El presseguer es el fruiter d'os més important a nivell mundial en superfície conreada, i el
tercer entre els fruiters de clima temperat, després del pomer i el perer. A nivell genètic, és
una de les especies millor caracteritzades de la família de les Rosàcies. El presseguer presenta
una baixa variabilitat genètica però es compatible sexualment amb altres especies del gènere
Prunus, com l’ametller, que poden ser una font de nous gens. En aquesta Tesis, s'ha estudiat
un conjunt de caràcters associats a la flor, la fenologia, la qualitat de fruita, la fulla i resistència
a malalties en dues poblacions interespecífiques entre l'ametller 'Texas’ i el presseguer
'Earlygold': una F2 (TxE) i un BC1 (T1E) amb el parental "Earlygold'. Els mapes genètics d’alta
densitat es van obtenir utilitzant el xip d’SNPs 9K de préssec i una col·lecció de 131 marcadors
microsatèl·lits. En total, es van construir tres mapes genètics: el mapa de la població F2 (TxE) i
els mapes dels dos parentals de la població BC1, T1E (per l’hibrid) i E (per ‘Earlygold’). La
comparació del mapa intraespecífic E amb els mapes interespecífics TxE i T1E va mostrar que
els nivells de recombinació eren molt més baixos en els creuaments interespecífics que en els
intraespecífics. La meitat del mapa E no presentava marcadors polimòrfics, el que es va
interpretar per la presencia de regions que eren idèntiques per descendència degut a l’alt
nivell de coancestralitat. Tant en la població TxE com en T1E es van identificar individus
androestèrils, i la seva segregació era consistent amb la existència d’una androesterilitat
citoplasmàtica, on els individus amb el citoplasma d’ametller, necessitaven de la presencia de
l’al·lel d’ametller, en almenys un dels dos gens restauradors, Rf1 i Rf2, per a recuperar la
fertilitat. Varis caràcters com el tipus de flor (Sh), el tipus de fruit (Ft), la sucositat (Jui), el color
de la antera (Ag i Ag2), la polpa antociànica (Bf), el color de la flor (Fc2) i la resistència a l’oïdi
(Vr3) van poder ser mapejats com a caràcters monogènics. La genètica dels caràcters
quantitatius també es va estudiar i es van identificar 63 QTLs amb un comportament
consistent per a 32 caràcters relatius a la flor (2), la fenologia (7), el fruit (15) i la fulla (8). Al
final s’han pogut identificar nous al·lels d’ametller per a caràcters d’interès com el color de la
pell, la polpa antociànica o la resistència a oïdi, que poden ser útils per a introduir nova
variabilitat genètica en el pool genètic del presseguer comercial. Finalment es proposa una
estratègia d’Introgressió Assistida per Marcadors (IAM) per a integrar fragments cromosòmics
de l’ametller en el fons genètic del presseguer en un curt període de temps (2-3 generacions).
La IAM inclou tres etapes: la primera consisteix en la selecció d’un conjunt d’individus amb un
baix nombre d’introgressions (preNILS) a partir d’una amplia població BC1. Nosaltres vam
obtenir 9 individus amb 3 o menys introgressions a partir de 882 individus BC1, demostrant que
16
aquesta primera etapa es factible. La segona etapa de la IAM consistiria en el mapeig de gens
majors utilitzant les preNILs. Nosaltres vam seleccionar 18 preNILs amb 4 o menys
introgressions i vam demostrar que tots els gens majors es van poder mapejar en les seves
posicions esperades. Això nomes va ser possible amb un dels dos QTLs majors analitzats. La
tercera etapa consisteix en autofecundar o tornar a retrocreuar i autofecundar les preNILs per
obtenir NILs (Línies Quasi Isogèniques) en homozigosis que presentin un únic fragment
cromosòmic d’ametller en el fons genètic del presseguer. Una col·lecció de NILs complerta
(cobrint tot el genoma de l’ametller) es una molt bona eina genètica per a l’anàlisi de caràcters
complexos, i a mes a mes, les NILs amb gens d’interès es poden incorporar ràpidament en els
programes de millora genètica per a obtenir varietats amb nous gens. Aquesta tercera etapa
esta en procés i es veurà endarrerida un any degut a la presencia de l’androesterilitat
citoplasmàtica. Es proposa la extensió d’aquesta estratègia a altres especies de Prunus, com
una forma d’incorporar nous gens d’interès a nivell de resistències a malalties o de qualitat de
la fruita per a obtenir els cultivars comercials de presseguer de les properes dècades.
1. INTRODUCCIÓN GENERAL
19
1.1 Agricultura y domesticación
La cultura humana ha vivido diferentes transformaciones en el transcurso de su historia. Una
de ellas, la revolución neolítica, cambio profundamente la relación del hombre con su entorno.
Uno de los aspectos más relevantes de esta transformación es el comienzo de la agricultura;
proceso que se remonta hace aproximadamente 11.000 años atrás en el llamado Creciente
Fértil, una región montañosa del suroeste de Asia (Figura 1). Al mismo tiempo comienza el
proceso de domesticación de las primeras especies vegetales y animales, fenómeno propiciado
por el incremento de tamaño de las poblaciones humanas, y a cambios en la forma de
explotación de los recursos locales (Xu, 2010). En el curso de los siguientes 5.000 años plantas
silvestres como el trigo (Triticum turgidum) y la cebada (Hordeim vulgare) en el Medio oriente,
el maíz (Zea mayz L.) y la patata (Solanum tuberosum) en América, y el arroz (Oriza sativa L.)
en Asia sufrieron el proceso de domesticación, siendo hoy la base alimenticia de la mayor
parte de la población mundial.
El desarrollo de los primeros centros urbanos asociado a los orígenes de la agricultura
sedentaria, coincide con el inicio de la fruticultura, que implicaba un compromiso de largo
plazo con una superficie de tierra. Los primeros frutales domesticados: palma datilera, olivo,
higuera, vid, granado y almendro, tienen su origen a fines del Neolítico y durante la Edad de
Bronce (Janick, 2005). Por su parte, la domesticación del melocotonero se habría comenzado
durante 3.300-2.500 años a.C. (Faust y Timon, 1995).
Figura 1. Mapa del Mediterráneo oriental. La domesticación de las primeras plantas ocurrió en el Cercano Oriente (Creciente Fértil) en la zona delimita por el circulo de color verde, actual sureste de Turquía y norte de Siria (Adaptado de Lev-Yadun et al. 2000).
20
Según Janik (2005) la domesticación de especies frutales involucra cambios genéticos que
incluyen ruptura de dioecia, pérdida de autoincompatibilidad, inducción de partenocarpia y
apirenia, poliploidía y alopoliploidía, facilidad de propagación vegetativa y pérdida de
sustancias tóxicas, espinas, púas, o de la vellosidad. Otros cambios debidos a la selección
incluyen aumento del tamaño del fruto, contenido de azúcares y tiempo de almacenamiento;
cambios mediados por recombinación intra e interespecífica, poliploidización y selección
continua, entre otros.
1.2 El género Prunus: taxonomía y sistemática
El género Prunus (Rosaceae) comprende alrededor de 200 especies de arbustos y árboles
caducifolios y de hoja perenne, algunas de ellas económicamente importantes por la
producción de frutos, incluyendo: melocotonero [Prunus persica (L.) Batsch], albaricoquero (P.
armeniaca L.), almendro (P. dulcis D.A. Webb), cerezo (P. avium L.), ciruelo japonés (P.
japonica Thunb.), ciruelo europeo (P. domestica L.), y guindo ácido (P. cerasus L.) (Hummer y
Janik, 2009; Chin et al. 2014), como por su valor ornamental, maderero o médico (Potter,
2007). Otras especies como P. davidiana, P. ferganensis, P. kansuensis, P. cerasifera y P. mira,
que presentan frutos de baja calidad, destacan por su gran capacidad de adaptación frente a
diferentes condiciones de estrés, tanto de origen biótico como abiótico, lo que les ha conferido
una importancia en el desarrollo de patrones y, más recientemente, como alternativa para la
introgresión de genes de interés en especies cultivadas (Scorza y Okie, 1990; Byrne et al.
2012).
Los frutales cultivados del genero Prunus, como el melocotonero y almendro, corresponden a
un grupo de especies conocidas como ‘frutales de hueso’ (Potter, 2011). Su clasificación
sistemática es la siguiente:
Reino: Plantae
División: Magnoliophyta
Clase: Magnoliopsida
Superorden: Rosanae
Orden: Rosales
Familia: Rosaceae
Tribu: Amigdaloidea
Género: Prunus
21
La clasificación infragenérica del genero Prunus ha sido estudiada por diferentes taxónomos a
lo largo de los últimos siglos (Wen et al. 2008). Actualmente, la clasificación más aceptada es la
propuesta por Rehder (1940), quien adoptó una interpretación amplia del género y lo dividió
en cinco subgéneros, los que son posteriormente divididos en secciones. Los aportes de Mason
(1913) y Kalkman (1965) también han sido ampliamente aceptados. Esta clasificación consiste
en cinco subgéneros: Amygdalus (melocotones y almendras), Cerasus (cerezas), Prunus
(ciruela), Laurocerasus (Laurel cerezo), y Padus (cerezo aliso o cerezo pado) (Chin et al. 2014).
1.2.1 Amygdalus: diversidad y recursos genéticos
El melocotonero está estrechamente emparentado con otros miembros del subgénero
Amygdalus (Scorza y Okie, 1990; Badenes y Parfitt, 1995; Bortiri et al. 2001; Chin et al. 2014)
(Figura 2). Las especies silvestres de Amygdalus emparentadas con el melocotonero y
compatibles sexualmente se presentan como una valiosa alternativa para el enriquecimiento
genético de la especie cultivada (Byrne et al. 2000; Gradziel, 2003; Foulogne et al. 2003a). A
continuación se enumeran las principales especies silvestres de Amygdalus que han producido
descendencia fértil en cruces con melocotonero:
Prunus davidiana (Carr.) Franch. es nativa del noreste de China, donde se utiliza como
patrón, dada su tolerancia a la sequía, a pesar de ser muy sensible a los nematodos.
Además, las variedades muestran una disminución del vigor y una temprana entrada
en producción (Wang, 1985). El árbol es alto (hasta 10 m), con una corteza de color
marrón rojizo; las hojas son largas y glabras, ovadas-lanceoladas, la flor es de color
blanco o rosa claro; el hueso es pequeño y separado de la carne (Scorza y Okie 1990).
Cruzamientos de esta especies con melocotonero se han llevado a cabo para introducir
resistencia a plagas y enfermedades y para generar patrones tolerantes a suelos
marginales o con problemas de replante (Foulongne et al. 2003; Moing et al. 2003;
Savala et al. 2013).
P. ferganensis (Kost. & Rjab) Kov & Kost. se encuentra en el oeste de China, clasificada
por algunos autores como sub-especie de P. persica. Se diferencia por sus hojas más
alargadas; con venas paralelas y los huesos con ranuras continuas (Scorza y Okie 1990).
Presenta frutos de una gran variabilidad y de mejor calidad que otras especies
silvestres (Wang, 1985).
22
Figura 2. Árbol de máxima verosimilitud de las secuencias de ADN plastidial de cuatro genes concatenados para filogenética de Prunus. Los números por encima o por debajo de las ramas indican respaldo ‘bootstrap’ de la máxima verisimilitud/probabilidad posterior Bayesiana. Las abreviaturas para subgénero: Amyg, Amygdalus; Em, Emplectocladus; Cs, de Cerasus; Lc, Laurocerasus, Pd, Padus; M, 'Maddenia' (Chin et al. 2014).
23
P. kansuensis Rehd. se encuentra en el noreste de China, donde se utiliza como patrón;
se diferencia del melocotonero por sus yemas glabras, pistilos alargados y los surcos
paralelos de sus huesos (Wang, 1985). Es un arbusto frondoso, de floración temprana,
con flores resistente a las heladas. La calidad de la fruta es muy baja por su elevada
astringente (Meader, 1939; Meader y Blake, 1940 citados por Scorza y Okie, 1990).
P. mira Koehne se encuentra en el lejano oeste de China (Tíbet oriental). El árbol es
alto, alcanzando alturas superiores a los 20 metros y presenta una gran longevidad,
encontrándose individuos de más de 1000 años de edad. Presenta hojas lanceoladas,
redondeadas en la base y las flores son de color blanco. El fruto es muy variable en
forma, color y tamaño; textura del mesocarpo y adherencia del hueso. El hueso es liso,
aunque en algunos tipos se asemeja a P. persica (Wang, 1985). Algunas formas se
cultivan en el Tíbet y en algunas regiones de India se utiliza como patrón (Scorza y
Okie, 1990) (Figura 3).
Figura 3. Distribución natural de melocotoneros y almendros en China: P. persica (1), P. davidiana (2), P. kansuensis (3), P. mira (4), P. ferganensis (5), P. triloba (6), P. mongólica (7), P. pedunculata (8), P. dehiscens (9) (Yoshida, 1987 en Skorza y Okie, 1990).
24
1.3 El melocotonero
1.3.1 Distribución actual
Actualmente el cultivo de esta especie se desarrolla principalmente en regiones temperadas y
subtropicales en una franja que se ubica entre los 30º de latitud norte y 45º de latitud sur
(Scorza y Sherman, 1996), mostrando una de las mayores adaptabilidades ecológicas entre los
frutales, cultivándose con éxito en climas húmedos del sur de China, norte de Egipto y el oeste
de EE.UU; en climas semidesérticos de California e Irán; en climas temperados de España y
Chile; en climas fríos del norte de China y Canadá y en climas sub-tropicales sin un invierno real
como Florida, México e Israel (Faust y Timon, 1995). Sin embargo, las condiciones de alta
humedad son un factor limitante para la producción del melocotonero por el aumento de la
incidencia de plagas y enfermedades (Byrne et al. 2012).
1.3.2 Botánica
El melocotonero es un árbol caducifolio, robusto y vigoroso, aunque su tamaño está
influenciado principalmente por las condiciones edafo‐climáticas y el vigor conferido por el
patrón (Bassi y Monet, 2008). El sistema radicular es inicialmente profundo, para
posteriormente desarrollarse dentro de los primeros 50 a 60 cm de profundidad, dependiendo
del tipo de suelo.
El árbol en su etapa adulta presenta diferentes tipos de estructuras vegetativas que difieren en
longitud, edad y por su contribución a la producción y calidad de la fruta:
Brote del año: madera de buen vigor, con yemas florales a lo largo de todo el eje y una
yema vegetativa en el ápice; son las más importantes desde el punto de vista
productivo debido a que su vigor se correlaciona positivamente con fruta considerada
de buena calidad.
Brindilla: brote de medio vigor (alrededor de 10 a 25 cm). Es la estructura preferida en
la industria del melocotón para conserva debido a que produce principalmente frutos
de tamaño medio, ideales para su procesamiento.
Dardo: brote productivo de muy pequeño tamaño (1-5 cm) que eventualmente
termina en una yema vegetativa.
Anticipado: brote lateral que surge de una brotación del mismo año.
Chupon: brote de excesivo vigor sin yemas florales.
25
El aspecto general o hábito de crecimiento de esta especie, expresado por la distribución,
ángulo y longitud de los entrenudos de ramas fructíferas a través del dosel determinan su
aspecto y arquitectura natural; presentando al menos seis tipos característicos (Figura 4)
(Bassi, 2003 en Bassi y Monet, 2008).
Figura 4. Los principales hábitos de crecimiento definidos en melocotoneros: a) estándar; b) columna; c)
vertical; d) compacto; e) colgante; f) abierto. (Bassi, 2003 en Bassi y Monet, 2008).
El desarrollo de los nuevos brotes y las hojas ocurre posterior a la antesis. Las hojas son
lanceoladas y acuminadas, pudiendo presentarse de forma plana u ondulada con márgenes o
bordes ligeramente aserrados y dos estipulas caducas denticuladas. Las hojas se encuentran
espaciadas y colocadas en forma alterna en las ramas (Alvarado y Gonzáez, 1999). En la base
del peciolo se presentan glándulas esféricas o reniformes, las que se han utilizado para la
caracterización varietal (Castro et al. 1998). En cada nudo normalmente existen tres yemas:
dos florales en los extremos y una vegetativa en la parte media. Según el vigor y la distribución
de la yemas, el melocotonero puede fructificar en ramas mixtas, ramas de dos años, chifonas o
en ramilletes de mayo, originando una flor perígina y hermafrodita, con un solo pistilo, de 20 a
30 estambres. La forma de la corola, compuesta normalmente de cinco pétalos, clasifica las
26
flores del melocotonero en dos grupos: Rosacea o showy, cuando los pétalos son largos; y
Campanulacea o non‐showy, cuando los pétalos son pequeños, y se observan claramente las
anteras entre los pétalos antes del período de antesis (Bassi y Monet, 2008).
Los estados de desarrollo morfológicos de los principales órganos de una especie desde
brotación a caída de hojas son conocidos como estados fenológicos (Figura 5). En los frutales
caducifolios, como el melocotonero, que presentan mecanismos adaptativos para protegerse
de las bajas temperaturas invernales (Faust et al. 1997), la época de floración se ve
influenciada por dos mecanismos complementarios: la acumulación del frío durante el invierno
es necesario para romper el estado de reposo de las yemas y, posteriormente, la acción de las
temperaturas cálidas se requieren para promover el desarrollo vegetativo y floral (Campoy et
al. 2011). Sin embargo, los estudios realizados en diferentes especies de Prunus (Ruiz et al.
2007; Alburquerque et al. 2008; Okie y Blackburn, 2008) sugieren que los requerimientos de
frío tienen un efecto más importante en la tiempo floración que los requisitos de calor. Por
otra parte, las diferentes variedades de melocotonero presentan una variabilidad en la
densidad de floración, lo que se conoce como floribundidad. La tendencia de determinadas
variedades a producir más yemas florales, les confieren una mayor capacidad de sobrevivir en
invierno y a hacer frente a las heladas primaverales (Marini y Reighard, 2008).
La producción de frutos comienza a partir del segundo o tercer año cuando culmina el período
de juvenilidad (Bassi y Monet, 2008). El fruto del melocotonero es una drupa, que puede
presentar forma redondeada (globoso) o alargada (plano). La pulpa carnosa, o mesocarpo, es
de color blanca, amarilla o rojiza, presentándose adherida (pavía) o separado del hueso
(prisco), según el tipo de fruto (Alvarado et al. 1999). La curva de crecimiento del fruto sigue
una curva doble sigmoidea con tres fases claramente destacadas: i) rápido crecimiento,
división celular; ii) estancamiento del crecimiento, endurecimiento del hueso, y iii) segunda
fase del crecimiento, elongación celular (Gage y Stutte, 1991). La epidermis del fruto presenta
dos tipologías: i) el velloso o melocotón y, ii) el glabro o nectarina, mutación del melocotón
estándar probablemente originado por primera vez en el noroeste de China (Faust y Timon,
1995). Según Wen et al. (1995) el locus responsable del carácter nectarina estaría ligado o
tendría un efecto pleiotrópico con varios otros caracteres como: tamaño, contenido de sólidos
solubles y ácidos orgánicos, período de desarrollo del fruto y la exigencia de unidades de frío,
lo que lo ha posicionado como una excelente alternativa al melocotonero tradicional, ganando
grandes cuotas de mercado en los últimos años.
27
Figura 5. Estados fenológicos del melocotonero. a) yema de invierno, b) inicio de brotación, c) botón
rosado, d) inicio de floración, e) plena floración, f) fin de floración, g) caía de pétalos, h) caída de corola,
i) fruto cuajado, j) fruto pequeño, k) endurecimiento del hueso, l) fruto en crecimiento, m) cambio de
color , n) madurez comercial, o) madurez fisiológica. (Cortesía de E. Bellini, Universidad de Florencia,
Italia. Adaptado de Okie et al. 2008)
28
1.3.3 Importancia económica y social
El melocotonero es uno de los cultivos frutales de mayor importancia a nivel mundial. En los
últimos 15 años, la producción mundial del melocotonero prácticamente se ha duplicado como
consecuencia del uso de técnicas de cultivo más eficientes, de la introducción de nuevas
variedades y de patrones mejor adaptados (Llácer, 2005; Iglesias, 2013) y al rápido incremento
de la producción en China (Byrne et al. 2012). Se calcula que en el año 20012 la producción
mundial alcanzó la cifra de 21.1 millones de toneladas, siendo la tercera fruta dulce más
producida a nivel mundial después del manzano y el peral (Byrne et al. 2012; FAOSTAT, 2014).
Los principales productores a nivel mundial son encabezado por China, que concentra el 57%
de la producción mundial (Tabla 1) (FAOSTAT, 2014).
Los países de la Unión Europea produjeron 3.4 millones de toneladas de melocotón durante el
año 2012, representando el 16% de la producción mundial. El principal productor es Italia
(39%), seguido por Grecia (22%), España (21%) y Francia (8%) (FAOSTAT, 2014).
Tabla 1. Principales países productores de melocotón, año 2012 (FAOSTAT, 2014).
País Producción
(t) Superficie
(ha) Rendimiento
(t/ha)
China 12.027.600 770.000 15.6
Italia 1.331.621 71.012 18.8
Estados Unidos de América 1.058.830 56.365 18.8
Grecia 760.200 44.100 17.2
España 747.200 50.000 14.9
Turquía 575.730 28.362 20.3
Irán (Republica Islámica de) 500.000 20.000 25.0
Chile 325.000 20.000 16.3
Argentina 290.000 26.000 11.2
Egipto 285.194 26.611 10.7
Francia 275.521 11.923 23.1
India 250.000 37.500 6.7
Brasil 232.987 19.155 12.2
Argelia 177.986 18.657 9.5
Sudáfrica 175.665 10.200 17.2
Republica de Corea 172.599 14.357 12.0
México 162.866 33.216 4.9
Japón 135.200 9.950 13.6
Túnez 128.000 16.000 8.0
Republica Popular Democrática de Corea 118.500 21.500 5.5
29
1.4 Mejora genética de plantas
La mejora genética de plantas se inició con la búsqueda y selección de individuos con
características superiores en el medio silvestre. Por miles de años este proceso se llevo a cabo
de manera empírica e instintiva. Sin embargo, desde el siglo XX en adelante con el
redescubrimiento de las leyes de Mendel y el desarrollo de la genética moderna la mejora se
ha convertido en un área relevante de las ciencias biológicas; especialmente importante si
consideramos que aproximadamente el 50% de los aumentos de rendimiento obtenidos
durante la revolución verde, en los cultivos más importantes para la humanidad, son
atribuibles a la introducción de nuevas variedades obtenidas mediante mejora (Hayward et al.
1993). Por el contrario, la mejora genética de frutales fue un campo descuidado durante
muchos años, debido principalmente a la escasez de mutaciones, su gran tamaño y
complejidad biológica (largo período generacional). El trabajo en melocotonero, sin embargo,
constó de grandes esfuerzos lo que permitió un mayor conocimiento de su genética (Monet y
Bassi, 2008) en comparación con otras especies leñosas.
1.5 Mejora genética del melocotonero
1.5.1 Origen y diseminación
El nombre botánico del melocotonero [Prunus persica (L.) Batsch] se refiere a la cuidad
putativa de origen, Persia (actualmente Irán), que utilizó Lineó (1758) para nombrarlo por
primera vez. Más de 100 años después, gracias al esfuerzo de diferentes botánicos (De
candelle, 1883; Hedrik, 1917; Vavilov, 1951 citados por Bassi and Monet, 2008) se conoció y
aceptó el verdadero origen de la especie. El melocotonero es nativo de China (Wang, 1985;
Huang et al 2008), concretamente de la cuenca del río Tarim (Faust and Timon, 1995), donde
aún se encuentra en estado silvestre, presentando la mayor fuente de variabilidad genética de
la especie en el mundo (Yoon et al. 2006).
La diseminación del melocotonero desde el oeste de China siguió la ruta comercial a través de
Persia, conocida como la ‘Ruta de la Seda’. Desde allí se introdujo en Egipto (1.400 a.C.) donde
sus frutos eran utilizados como ofrenda al ‘Dios de la Tranquilidad’ y en Grecia donde los
registros de su producción se remontan a 400 y 300 años a.C. Posteriormente, en los primeros
siglos de nuestra era, los Romanos expandieron su cultivo por toda la costa Mediterránea
(Hancock et al. 2008) y a otros países del continente europeo como Inglaterra, donde es
30
cultivado desde el año 200 d.C., al mismo tiempo que el melocotonero colonizaba tierras
niponas (Yamamoto et al. 2003). Finalmente, durante el siglo XVI los primeros exploradores
españoles y portugueses lo llevaron en sus embarcaciones al continente americano, donde se
cultivo inicialmente en Florida, México y Sur América, para ser rápidamente adoptado por los
nativos americanos y extendido por toda Norte América (Figura 6) (Scorza y Okie, 1990).
La propagación por medio de semillas fue la principal vía para la obtención de cultivares hasta
la mitad del siglo XIX en los EE.UU. y Europa, y hasta mediados del siglo XX en América Central
y América del Sur. Por lo tanto, existen muchas variedades de melocotón que han sido objeto
de varios siglos de selección en cuanto a la adaptación y otras características en toda Europa,
América del Norte, América del Sur y Japón (Byrne et al. 2000; Pérez, 1989; Pérez et al. 1993;
Yamamoto et al. 2003). Muchas de esas selecciones aún se cultivan localmente (Byrne et al.
2012) y constituyen una valiosa fuente de germoplasma para los programas de mejora
actuales (Bouhadida et al. 2007).
Figura 6. Diseminación temprana del melocotonero (Adaptado de Byrne et al. 2012).
31
1.5.2 Mejora genética clásica
La mejora genética es un proceso que implica ciclos de cruzamientos entre genotipos con una
variación genética útil y la identificación y selección de fenotipos superiores a partir de los que
se desarrollan variedades superiores a las precedentes (Torres et al. 2012). Los esfuerzos de
mejora en melocotonero, tanto en el sector público como privado, se han dirigido a satisfacer
las demandas del mercado y la industria, procurando principalmente el desarrollo de
variedades de gran tamaño, alta productividad, completa coloración roja de la piel, ausencia o
bajo nivel de pubescencia, forma redondeada, firmeza de la pulpa y frutos de pulpa amarilla o
blanca (Byrne, 2005; Okie et al, 2008). Estos programas mostraron un gran dinamismo durante
la pasada centuria (Fideghelli et al. 1998; Sansavini et al. 2006) entregando una media de 100
variedades por año en la última decada (Byrne et al. 2012). Sin embargo, la mayoría de ellas se
han originado a partir de sólo unos cuantos parentales fundadores que se utilizaron por los
primeros programas de mejora en los EE.UU (Faust y Timon, 1995; Scorza et al. 1985).
Aranzana et al. (2003; 2010) estudiaron la estructura poblacional de 224 variedades
procedentes de programas de mejora de EE.UU., España, Italia, Francia y Canadá, incluyendo 8
de las variedades consideradas fundadoras de los programas de mejora moderna de los
EE.UU., para conocer el real impacto genético de los padres fundadores en el fondo genético
de las variedades de melocotoneros actuales y encontraron que cinco de ellas ('Elberta', 'Fay
Elberta', 'Early Elberta', 'Rio Oso Gem' y 'J.H. Hale') conforman la mayor y directa fuente de la
variabilidad genética del melocotonero actual, corroborando los registros y referencias
bibliográficas sobre la materia.
A pesar de la escasa base genética, producto de su comportamiento autógamo y a los cuellos
de botella surgidos en la historia de la domesticación-mejora de la especie (Aranzana et al.
2010), tres grandes logros durante la mejora genética del melocotonero cultivado son
destacables: la expansión de su cultivo a diferentes climas mostrando una gran adaptabilidad
climática; la extensión del período de cosecha y la diversificación de su mercado
principalmente mediada por el desarrollo de la nectarina (Byrne et al. 2012), y los más actuales
melocotones y nectarinas planos.
En la actualidad, la mejora genética del melocotonero enfrenta nuevos desafíos. En primer
lugar, el desarrollo de variedades resistentes a plagas y enfermedades son una deseable
alternativa para satisfacer la creciente conciencia ambiental entre los consumidores (Byrne,
2002) y para proveer de alternativas sostenibles a los productores, disminuyendo las
32
aportaciones de productos químicos al ambiente (Pascal et al. 2010). En segundo lugar, la
mayoría de las variedades actuales de melocotonero se desarrollaron en EE.UU. y Europa,
lugares donde el tiempo transcurrido entre la fecha de cosecha y el consumo de la fruta no
sobrepasa los 10-15 días, por lo que el comportamiento poscosecha de las variedades
liberadas no fue un objetivo prioritario de los programas. Con el incremento del intercambio
comercial y el posicionamiento de algunos países del Hemisferio Sur como potencias
exportadoras, el tiempo de almacenamiento en poscosecha de los melocotones ha
aumentando considerablemente a una media de 30-45 días, tiempo en el cual los melocotones
desarrollan problemas fisiológicos conocidos en su conjunto como ‘daño por frió’ (del inglés
‘chilling injury’) que ocasionan una pérdida substancial en la calidad de la fruta, una merma
económica a toda la cadena productiva y un detrimento del consumo en contra-estación
(Crisosto, 2002). Por tal motivo, numeroso estudios se han conducido para entender las bases
genéticas de la problemática (González-Agüero et al. 2008; Ogundiwin et al. 2008; Cantin et al.
2010; Martínez-García et al, 2012; Martínez-García et al, 2013) y diversos programas de
mejora tienen como uno de sus objetivos prioritarios el desarrollo de variedades con una
mayor vida poscosecha (Infante et al. 1998). Es así como, una nueva gama de variedades son
requeridas para ser cosechados en un estado maduro, que soporten un largo almacenaje
(Faust y Timon, 2005), e incorporen un conjunto de resistencias a plagas y enfermedades
(Byrne, 2005).
Por otra parte, el cambio más dramático que han enfrentado los programas de mejora de
melocotonero en las últimas décadas ha sido la reducción de financiamiento público, en
contrapartida al incremento de la importancia de los programas privados, los que son
responsables actualmente del desarrollo del mayor número de nuevas variedades en EE.UU.,
Francia, y España. En EE.UU. alrededor de la mitad de los programas públicos de mejora de
melocotonero se han clausurado desde 1970. Los que permanecen activos deben utilizar las
ganancias generadas por las patentas para cubrir parcial o completamente su financiamiento.
Este hecho permite que muchos programas continúen siendo viables, pero tiene el
inconveniente que a largo plazo limitará la investigación en genética y recursos fitogenéticos y
en el intercambio de germoplasma entre diferentes países y programas (Byrne 2005; Okie et
al. 2008).
33
1.6 El melocotonero: “especie modelo”
El melocotonero ha sido durante mucho tiempo una de las especies mejor caracterizadas
genéticamente dentro de la familia Rosaceae (Arús et al. 2012), siendo considerada como
especie modelo, junto a Malus x domestica y Fragaria vesca L., para el desarrollo de estudios
genómicos y genéticos en virtud de un conjunto de características ventajosas para ello (Abbott
et al. 2002; Verde et al. 2005; Bielenberg et al. 2009). Es una especie diploide con ocho
cromosomas (2n = 2x = 16) (Jelenkovic y Harrinton, 1972) sin una historia significativa de
duplicación dentro de su genoma (Verde et al. 2013); no posee mecanismos de auto-
incompatibilidad gametofítica como otras especies cultivadas de su género, lo que permite la
creación de poblaciones F2 para proyectos de mapeo genético y su periodo inter generacional
de 2-3 años es relativamente corto comparado con los 5-10 años de otras especies leñosas
(Rieger, 2006; Arús et al 2012).
Desde un punto de vista genómico, se puede considerar que tiene un genoma pequeño (≈230
Mb) (Verde et al. 2013) menor a dos veces el tamaño del genoma de Arabidopsis y más
pequeño que los genomas de Fragaria vesca (Shulaev et al. 2011), de Malus x domestica
(Velasco et al. 2010) y el recientemente secuenciado genoma de Prunus mume (≈280 Mb)
(Zhang et al. 2014).
1.7 Herramientas para la mejora molecular
La comunidad científica actual cuenta con diversas herramientas para el estudio genético y
genómico del melocotonero. Las características ventajosas de la especie, descritas en el
apartado 6, como el temprano inicio de los estudios genéticos llevados a cabo principalmente
en EE.UU. y Europa durante el siglo XX y el esfuerzo de diferentes países y grupos de
investigación de EE.UU., España, Italia, Chile y Francia, culminó con la reciente secuenciación y
liberación del genoma de la especie (Verde et al. 2013). La integración de toda la información
genética y genómica disponible abrirá la era post-genómica, que se caracteriza por la
disponibilidad de un genoma completo y las nuevas tecnologías de secuenciación masiva de
ADN y ARN. En este sentido, estamos frente a una revolución en el uso de nuevas técnicas de
análisis de alto rendimiento, lo que puede significar un cambio de paradigma científico en la
identificación de regiones genómicas de interés y su posterior aplicación en la mejora (Salazar
et al. 2014).
34
En las siguientes secciones se describirán los aspectos más importantes relacionados con el
desarrollo y utilización de poblaciones genéticas, mapas genéticos y el estudio de QTLs en
plantas con un énfasis especial en Prunus, así como los aspectos teóricos más relevantes.
1.7.1 Poblaciones genéticas
Diversos tipos de poblaciones pueden ser utilizadas para el desarrollo de estudios genéticos en
vegetales: poblaciones F2, poblaciones F2 inmortales, poblaciones de retrocruzamiento (BC),
doble haploides (DHs), Líneas consanguíneas recombinantes (RILs), y líneas casi isogénicas
(NILs) (Tabla 2). En términos generales, las poblaciones F2 y BC son simples y fáciles de
construir, requieren relativamente poco tiempo en su desarrollo, pero son altamente
heterocigotas por lo que su reproducción no puede efectuarse por medio de semillas. En
cultivos, se utilizan temporalmente para la construcción de mapas genéticos preliminares. Por
el contrario, en frutales son las poblaciones más utilizadas. Alternativamente, las poblaciones
RILs, DHs, y NILs son completamente homocigotas; pueden ser multiplicadas eternamente
mediante semillas, representando un recurso permanente para el desarrollo de estudios
genéticos en diferentes ambientes y con la posibilidad de ser transferidas entre diversos
grupos de investigación (Boophati, 2013).
Tabla 2. Características de las principales poblaciones usadas en estudios genéticos.
Propiedad Poblaciones
F2 BC DH RILs NILs
Nº generaciones requeridas
2 2 2 6-8 6-9
Nº de meiosis 1 2 2 múltiples múltiples
Nº posible de genotipos por locus
3 2 2 2 2
Herencia marcador dominante
3:1 1:0 1:1 1:1 1:1
Herencia marcador codominante
1:2:1 1:1 1:1 1:1 1:1
No existen estudios específicos que determinen el número ideal de individuos que requiere
tener una población genética dada (Boophati, 2013). Sin embargo, la precisión de la medición
de la distancia genética entre los marcadores, así como la determinación del orden entre ellos,
está directamente relacionada con el número de individuos de la población de mapeo (Young
et al. 2000). En la práctica se utilizan poblaciones consistentes entre 50-250 individuos, lo que
35
ha demostrado ser suficiente para construir el esqueleto inicial del mapa (Mohan et al. 1998) y
desarrollar estudios genéticos iniciales, aunque para el desarrollo de mapas de alta resolución
o para el mapeo fino son necesarios mas de 1.000 individuos (Collard, 2005).
La elección del tipo de población de mapeo para estudios genéticos y utilización en programas
de mejora depende de la estrategia reproductiva de la especie. Para especies autógamas,
poblaciones tipo F2 y RILs son ampliamente utilizadas, las que se originan generalmente
mediante el cruce de dos padres altamente homocigotos. En especies alogamas o de
polinización cruzada, que en su mayoría no toleran la consanguinidad, son mayormente
desarrolladas las poblaciones tipo F1, por medio del cruce entre dos padres heterocigotos.
Poblaciones BC y DHs pueden ser utilizadas para ambos tipos de plantas. El método de
desarrollo de las principales poblaciones utilizadas en la mejora se presenta en la Figura 7.
Figura 7. Diagrama de los principales tipo de poblaciones utilizadas para el mapeo genético (Adaptado de Collard et al. 2005 y Boophati, 2013).
36
Las NILs corresponden a un tipo de población genética diseñadas con la finalidad de superar
las limitaciones observadas en el estudio de caracteres cuantitativos observadas en otro tipo
de poblaciones y para el aprovechamiento máximo de la variabilidad generada a partir de un
cruzamiento. En cada línea casi isogénica se presenta una sola introgresión o fragmento
exógeno, procedente de un genoma donante, en el fondo genético de un genoma receptor o
recurrente (Eshed y Zamir 1995). Además, la condición que cada línea posee sólo una pequeña
fracción del parental donante puede limitar los problemas de fertilidad asociados a los
cruzamientos interespecíficos (Eshed y Zamir, 1994).
El desarrollo de este tipo de poblaciones involucra diversas generaciones de retrocruzamiento,
asistidas con marcadores moleculares en cada generación para seleccionar las plantas que
presentan el menor número de introgresiones o porcentaje del genoma donante, más una o
dos rondas de autopolinizaciones para fijar los segmentos exóticos y poder visualizar los rasgos
mediados por genes recesivos.
En general, si dos NILs difieren en algún carácter fenotípico se asume que esta variación esta
mediada por el efecto de los alelos del fragmento de ADN introgresado en aquella NIL. Esta
misma inferencia puede ser realizada contrastando cada NIL contra su parental recurrente, lo
que permite la identificación de regiones genómicas de interés para el enriquecimiento
genético de especies cultivadas. Por lo tanto, las NILs constituyen poderosas herramientas
para el análisis genético y la introgresión de genes de interés. En particular, son
extremadamente valiosas para aquellas especies en las que no se cuenta con un protocolo
eficiente de transformación donde la incorporación de los genes identificados como de interés
mediante la producción de plantas transgénicas sería una alternativa (Boopitha, 2013).
La primera colección reportada de NILs se construyó mediante el cruzamiento de una especie
silvestre de tomate (L. pennellii) con un cultivar comercial de tomate (Lycopersicon
esculentum) utilizado en la industria (Eshed y Zamir, 1994). La colección estuvo compuesta de
50 líneas de introgresión y permitió la identificación de 106 QTLs, una cantidad
significativamente mayor en comparación con los estudios realizados previamente en
poblaciones de plantas (Eshed y Zamir, 1995). En términos generales, el número de QTLs
detectados por carácter en una NILs es mucho mayor a los detectados con poblaciones tipo RIL
o DH y tiene la gran ventaja que debido a que los QTLs se encuentran fijados en un genotipo
concreto, se puede estudiar el grado de dominancia, las interacciones epistáticas entre QTLs,
37
la heterosis de los QTLs y llevar a cabo el clonaje de gen implicados en un QTL (Torres et al.
2012).
Otra importante ventaja de este tipo de poblaciones es la aplicación directa a la mejora
mediante la incorporación de nueva variabilidad genética en los cultivares élite a partir del
cruzamiento con una de las líneas de introgresión con regiones genómicas de interés
identificadas. En concreto, la variedad de tomate AB2 que se desarrolló a partir del trabajo de
Gur y Zamir (2004) introduciendo un QTL de S. pennellii, ha sido uno de los cultivares de
tomate para industria más cultivados en California en los últimos años (Torres et al. 2012).
1.7.2 Mapas genéticos
El estudio de los genomas mediante el empleo de mapas puede dividirse en dos grandes
categorías: (1) mapas genéticos o de ligamiento y (2) mapas físicos (Patterson, 1996). Los
mapas físicos identifican la posición de genes y otros elementos del ADN en los cromosomas
facilitando el clonaje posicional de genes y el análisis de cromosomas y genomas en detalle.
Una alternativa del mapeo físico es el mapeo citomolecular o citológico, en el cual los
marcadores de ADN son directamente visualizados en los cromosomas mediante la utilización
de un microscopio, pudiendo medir directamente la distancias entre ellos (Patterson, 1996;
Boopathi, 2013). En esta revisión, y debido a la naturaleza de nuestro trabajo, se dará énfasis
al mapeo genético.
Un mapa genético, de ligamiento o meíotico, es un representación grafica de la localización
relativa de diferentes loci en los cromosomas (Van Ooijen y Jansen, 2013). Su construcción está
basada en el conocimiento de la frecuencia de recombinación de los alelos de diferentes loci
en los cromosomas y es el primer paso para la aplicación de los marcadores moleculares en la
mejora genética de plantas (Tanksley et al. 1989). El desarrollo de un mapa genético sigue tres
pasos principales: (1) la construcción de una población genética; (2) la identificación de
polimorfismos y (3) el análisis de ligamiento de los marcadores (Collard et al. 2005). Desde el
desarrollo del primer mapa genético en 1913 por Sturtevant la aplicación de esta herramienta,
entre otras cosas, ha permitido:
Realizar análisis genético permitiendo la localización de caracteres cualitativos y
cuantitativos en diferentes especies.
38
Facilitar la introgresión de genes o QTLs de interés a través de la selección asistida por
marcadores moleculares.
Comparar mapas entre diferentes especies para evaluar similaridad en el orden de los
genes.
Proporcionar un marco para el anclaje con mapas físicos y facilidad el ensamblaje
durante el proceso de secuenciación de genomas.
Iniciar trabajos de clonaje posicional de genes responsables de caracteres de interés
agronómico.
En la construcción de un mapa genético dos elementos básicos son requeridos: una población
segregante (discutido en el apartado 7.1.) y una batería de marcadores que nos permitan
caracterizar genéticamente a la población. Inicialmente se utilizó la apariencia visual
(marcadores morfológicos) de los organismos para la construcción de los primeros mapas
genéticos, pero su escaso número, y en algunos casos complejo análisis, limitó su utilización en
estudios genéticos. Posteriormente el desarrollo de marcadores bioquímicos o isoenzimáticos
permitió incrementar las posibilidades y alcances de esta técnica. Sin embargo, fue el
desarrollo de los marcadores basados en la variabilidad del ADN los que han ampliado las
aplicaciones genéticas de esta herramienta, incluyendo:
Estudios de diversidad genética, filogenia, domesticación y evolución
Genética de poblaciones
Introgresión y flujo génico
Mapeo de asociación
Mapeo genético
Identificación de cultivares y taxonomía
Certificación de pureza genética de líneas e híbridos
Detección de la variación somaclonal
En la actualidad, el genoma de las principales especies vegetales de interés económico se
encuentra secuenciado, lo que ha propiciado el desarrollo de plataformas de caracterización
genética, conocidas como Chip de ADN, lo que permite conocer la variabilidad del ADN en su
nivel más profundo, es decir, a nivel de cada nucleótido; con un nivel de automatización nunca
antes visto y a precios que decrecen rápidamente. Este tipo de marcadores, conocidos como
SNPs están ampliamente distribuidos en el genoma aunque su presencia y distribución varía
39
entre especies (Boopathi, 2013). El polimorfismo de un solo nucleótido o SNP (Single
Nucleotide Polymorphism) es una mutación que afecta a una única base y puede corresponder
al cambio de una sola base por otra o mediada por inserciones o deleciones de una base en
medio de una secuencia. Este tipo de marcadores presentan una baja tasa de mutación y son
estables de generación en generación a través del genoma (Edwards et al 2007). Además, los
SNPs tienen varias ventajas para el mapeo genético sobre otros marcadores moleculares: se
producen menos errores durante la detección y evaluación que los SSR y es posible mapear
loci de rasgos cuantitativos (QTL) con mayor precisión que con marcadores tipo RFLP o SSR (Yu
et al. 2011).
1.7.2.1 Mapas genéticos en melocotonero
El primer mapa genético reportado en frutales se desarrolló en una población intraespecífica
F2 de melocotonero utilizando 83 marcadores tipo RAPD, una isoenzima y 4 marcadores
morfológicos (Chaparro et al. 1994), marcando un hito muy relevante en el campo de la
genética frutal. Sin embargo, debido a la naturaleza de los marcadores utilizados en su
elaboración el trabajo no tuvo mayor trascendencia para la construcción de futuros mapas. El
desarrollo de marcadores tipo RFLP en el comienzo de la década de 1980 proporcionó una
fuente virtualmente ilimitada de marcadores de alta calidad, presentes en todo el genoma,
proveyendo de una herramienta para la construcción de mapas en la mayoría de las especies
vegetales (Infante et al. 1998). Con este tipo de marcadores se desarrollaron los dos siguientes
mapas genéticos en Prunus (Rajapakse et al. 1995; Fooland et al. 1995). En los años posteriores
los mapas construidos integraron marcadores dominantes tipos RAPD y AFLP con marcadores
codominantes como los RFLP y marcadores morfológicos (Dirlewanger et al. 1998) o utilizaron
sólo marcadores AFLP (Lu et al. 1998). Sin embargo, estos mapas se consideran incompletos
debido a que el número de grupos de ligamiento detectados en ellos era diferente del
esperado; tenían una baja densidad de marcadores (4.5-8.5 cM / marcador); incluían grandes
intervalos sin marcadores y muchos de ellos no era posible incluirlos en algún grupo de
ligamiento (Abott et al. 2008).
El primer mapa de ligamiento saturado en Prunus se realizó en una población F2 interespecífica
proveniente del cruce del almendro ‘Texas’ y el melocotonero ‘Earlygold’. Este mapa se
construyó exclusivamente con marcadores transferibles (11 isoenzimas y 226 RFLPs),
distribuidos en ocho grupos de ligamiento con una distancia total de 491 cM, representando
una densidad promedio de 2.0 cM/marcador y ningún intervalo entre marcadores mostró una
40
distancia superior a 12 cM (1998 Joobeur et al). Posteriormente, Aranzana et al. (2003) y
Dirlewanger et al. (2004) aumentaron la densidad del mapa con la incorporación de 176 SSRs y
123 RFLP. Este mapa, conocido como ‘T x E’, se adoptó por la comunidad científica como el
mapa de referencia del genero Prunus; permitió el uso de un conjunto de marcadores como
referencias para la construcción de otros mapas en diferentes poblaciones, estableció una
terminología común para los grupos de ligamiento y el orden de los marcadores dentro de
cada grupo (Abbot et al. 1998).
El desarrollo de marcadores tipo microsatélite (SSR) en Prunus representó una importante
mejora en el área de los marcadores moleculares; facilitando la construcción de mapas
genéticos de segunda generación en Prunus (Dirlewanger et al. 2006) gracias a su
reproducibilidad, herencia codominante, polimorfismo y transferibilidad entre especies
(Collard et al. 2005). Diversos mapas genéticos desarrollados en Prunus mediante SSR (Salazar
et al. 2014) han permitido identificar y mapear la mayoría de los genes mayores (Tabla 3)
documentados hasta el momento en el mapa de referencia del genero Prunus para
melocotonero.
En los últimos años diferentes iniciativas tendientes al desarrollo de chip de SNPs se han
llevado a cabo (Ogundiwin et al. (2008); Ahmad et al. (2011) Verde et al. 2012) permitiendo el
desarrollo de mapas genéticos de alta densidad (Martínez-Gómez, 2013; Donoso et al. En
preparación). Estos trabajos junto a la posibilidad de contar un genoma secuenciado de alta
calidad están posibilitando el mapeo fino y la ubicación de genes candidatos, con un
mejoramiento en la eficiencia y resolución nunca antes lograda.
1.8 Análisis de caracteres cuantitativos (QTLs)
Posterior al reconocimiento de los descubrimientos realizados por Mendel y el inicial
desarrollo de la genética como ciencia, surgió una controversia entre mendelianos y
biométricos, debido a que la explicación dada por Mendel sobre la herencia servía para
explicar la herencia de los caracteres cualitativos, es decir, para aquellos con segregación
discontinua que presentan clases fenotípicas claramente diferenciadas, en contraposición de
los caracteres cuantitativos, los que presenta una distribución continua que no permite
diferenciar clases fenotípicas claramente. Este tipo de caracteres conocidos como caracteres
cuantitativos, también llamados poligénicos, continuos, multifactoriales o complejos,
dependen de la acción acumulable de muchos genes. Se ha constatado que la mayoría de los
41
caracteres de importancia económica en la agricultura están controlados por este tipo de
caracteres. A su vez, las regiones específicas dentro de los genomas donde se encuentran los
genes asociados a un carácter cuantitativo particular se denominan loci de caracteres
cuantitativos (Quantitative Trait Loci) (Collard, 2005).
Tabla 3. Genes mayores documentados que afectan caracteres morfológicos y agronómicos en melocotonero.
a Genes localizados cerca del punto de translocación entre ambos grupos de ligamiento.
Los caracteres cuantitativos complican enormemente las labores de mejora ya que el fenotipo
de un individuo refleja sólo una parte de su potencial genético. Así, al estar controlados por
múltiples genes, plantas con el mismo fenotipo pueden llevar alelos diferentes en uno o varios
genes. Además, individuos con los mismos QTLs pueden mostrar fenotipos diferentes cuando
se desarrollan en ambientes distintos. Finalmente, el efecto de un QTL puede depender de la
Trait Gene Linkage
groupReferences
Adaptation
Siempreverde Evg 1 Rodriguez et al. (1994); Wang et al (2002)
Árbol
Hábito crecimiento (normal/pilar) Br 2 Lammerts (1949); Scorza et al. (2002)
Altura planta (normal/enana) Dw 6 Lammerts (1945); Yamamoto et al. (2001)
Flores
Doble flor (única/doble) Dl 2 Chaparro et al. (1994)
Color flor B 1 Jáuregui (1998)
Color flor (rosado/rosado palido) Fc 3 Yamamoto et al. (2001)
Polen (fértil/estéril) Ps 6 Dirlewanger et al. (1999, 2006).
Número de carpelos Pcp 3 Bliss et al. (2002)
Color antera (amarillo/antociánico) Ag 3 Joobeur (1998)
Aborto del fruto Af 6 Dirlewanger et al. (2006)
Forma flor (Campanulacea/Rosacea) Sh 8 Ogundiwin et al. (2009); Fan et al. (2010)
Hojas
Tamaño hoja (angosto/ancho) Nl 6 Yamamoto et al. (2001)
Color hoja (rojo/amarillo) Gr 6-8a Jáuregui (1998); Yamamoto et al. (2001)
Glandula (reniforme/globosa/eglandular) E 7 Connors (1921); Dettori et al. (2001)
Fruto
Color mesocarpo (blanco/amarillo) Y 1 Warburton et al. (1996); Bliss et al. (2002)
Color mesocarpo (normal/antociánico) Bf 4 Werner et al. (1998); Bliss et al. (2002)
Color mesocarpo (normal/antociánico) DBF 5 Shen et al. (2013)
Color alrededor del hueso Cs 3 Bliss et al. (2002)
Adhesión del mesocarpo (pavía/prisco) F 4 Etienne et al. (2002)
Fruto no ácido D 5 Dirlewanger et al. (1998, 1999); Etienne et al. (2002)
Vellocidad de la piel (nectarina/melocotón) G 5 Dirlewanger et al. (1998, 1999); Bliss et al. (2002)
Sabor semilla (amargo/dulce) Sk 5 Bliss et al. (2002)
Tamaño fruto (redondo/plano) S 6 Lesley (1939); Dirlewanger et al. (1999); Picañol et al. (2013)
Colo piela Sc 6-8 Yamamoto et al. (2001)
Resistencia pestes o enfermedadaes
Resistencia nematodo agallador Mi 2 Bliss et al. (2002); Cao et al. (2011)
Resistencia Oídio Vr3 6-8a Pascal et al. (2010)
42
constitución alélica de otros QTLs en la misma planta debido a interacciones epistáticas (Torres
et al. 2012)
La teoría del mapeo de QTLs fue descrita por primera vez por Sax (1923) y desarrollada
posteriormente por Thoday (1961) quien sugirió que la segregación de genes con herencia
simple podría ser utilizada para detectar QTLs ligados. La posibilidad de utilizar marcadores
moleculares, como los RFLP (Paterson et al. 1988), con éxito en el estudio de QTLs abrió un
nuevo interés en el mapeo de QTLs al demostrar que algunos marcadores moleculares
explicaban una parte substancial de la variación fenotípica de un carácter cuantitativo. Así, el
análisis de QTLs fue el término que se acuñó para estudiar este tipo de variación genética, para
localizar los genes responsables y para explorar sus efectos e interacciones (Torres et al. 2012).
En términos generales, la identificación de un gen o de un QTL dentro del genoma de la planta
es como encontrar la proverbial aguja en un pajar. Sin embargo, el análisis de QTLs se puede
utilizar para dividir el pajar en montones manejables y buscarlos sistemáticamente (Boophati,
2013). En términos simples, el análisis de QTL está basado en el principio de la detección de
una asociación entre el fenotipo y el genotipo de los marcadores (Collard et al. 2005). Los
marcadores se utilizan para dividir la población de mapeo en diferentes grupos genotípicos
basado en la presencia o ausencia de un locus marcador particular, y para determinar si
existen diferencias significativas entre los grupos con respecto al carácter cuantitativo que se
está midiendo. Por lo tanto, una diferencia estadísticamente significativa entre las medias
fenotípicas de los marcadores indica que el locus marcador utilizado para dividir la población
de mapeo está vinculado a un QTL asociado al rasgo.
1.8.1 Métodos estadísticos para el mapeo de QTLs
En poblaciones biparentales existen tres principales métodos para la detección de QTLs: (1)
análisis de un solo marcador; (2) el mapeo por intervalos simple y (3) el mapeo por intervalos
compuesto. En el análisis de marcadores individuales o de un sólo marcador, normalmente se
utilizan pruebas estadísticas como la prueba de Student, el análisis de la varianza (ANOVA) y la
regresión lineal. La principal ventaja de este método es su simplicidad y que puede ser
realizado con programas básicos de estadística. Además, no se requiere el desarrollo de un
mapa genético debido a que la correlación se realiza de forma individual para cada marcador
con la variación fenotípica (Tanksley, 1993). El método de mapeo por intervalos simple (SIM)
es el más popular para el mapeo de QTLs en poblaciones genéticas. El SIM utiliza mapas
43
genéticos para analizar el intervalo entre pares adyacentes de marcadores ligados a lo largo de
los cromosomas, superando las limitaciones del análisis de un sólo marcador (Lander y
Botstein, 1989). El mapeo por intervalos compuesto (CIM) es un método que combina el
mapeo por intervalos para un único QTL en un intervalo dado con el análisis por regresión
múltiple de marcadores asociados con otros QTLs e incluye marcadores genéticos adicionales
(cofactores) en el modelo estadístico para controlar el fondo genético. Este tipo de enfoque es
más preciso y eficaz que los anteriores (Jansen y Stam, 1994), al eliminar la mayor parte de la
varianza genética producida por otros QTLs lo que reduce la varianza residual. Los resultados
de las pruebas estadísticas tanto para SIM y CIM se presentan frecuentemente utilizando un
valor logarítmico de probabilidades (LOD). Por lo general, el resultado del análisis de QTLs que
entregan los programas estadísticos es un grafico con el orden de los marcadores en el eje x y
la prueba estadística (valor LOD) en el eje de las y. (Boophati, 2013).
1.8.2 Posición y efecto de un QTL
Diversos estudios se han realizado con el fin de determinar el umbral crítico que debe superar
un QTL para declararlo estadísticamente significativo. Morton (1955) determinó que el umbral
crítico para señalar un ligamiento significativo entre dos loci debía ser un LOD superior o igual
a 3. Lo que implica una relación de probabilidades de 1.000 a 1 a favor de la presencia de un
QTL en una determinada posición del mapa. Posteriormente, otras investigaciones se han
llevado a cabo para estudiar el nivel del umbral crítico modulando genomas de diferentes
tamaños y densidad de marcadores (Lander y Botstein, 1989; Van Ooinjen 1999). Sin embargo,
dado que la detección de QTLs implica múltiples pruebas estadísticas en todo el genoma, el
nivel de significancia nominal fijada previamente, dará lugar a un elevado error de tipo I, es
decir, a un gran número de falsos positivos.
En términos estrictos se debe considerar valido un QTL cuando el valor del LOD del QTL supera
el valor del LOD determinado por un método estadístico más robusto mediante
procedimientos de remuestreo, como la prueba de permutación propuesta Churchill y Doerge
(1994). En esta prueba los valores fenotípicos de la población se mezclan, mientras que los
valores genotípicos de los marcadores se mantienen constantes y el análisis de QTL se realiza
miles de veces para evaluar el nivel de falsos positivos en las asociaciones carácter-marcador
(por ejemplo 10.000 veces es una razonable aproximación del 1% de confianza) y los niveles de
significación pueden determinarse en base al nivel de falsos positivos en las asociaciones
carácter-marcador (Torres et al. 2012). Sin embargo, es ampliamente utilizado el valor de LOD
44
3 como muestra altamente confiable de la validez de un QTL. Además, el LOD 3 supera en la
mayoría de los casos el valor entregado por la prueba estadística de permutación.
Dada que la ubicación más probable de un QTL (lugar del mapa en el que se detecta el mayor
valor de LOD) representa una aproximación estadística de la verdadera ubicación del locus
responsable de la variabilidad genética en el carácter, en la mayoría de los estudios actuales se
utiliza la regla de menos uno LOD y menos dos LOD (Van Ooijen, 1992) para calcular los
extremos del intervalo de confianza, lo que es fundamental para su empleo en mejora genética
y realizar análisis comparativos entre años, localidades y poblaciones.
Una vez localizado el QTL, el siguiente paso es estimar el efecto genético o modo de acción. El
efecto genético de un QTL detectado por mapeo por intervalos se calcula a partir de los
valores fenotípicos medios de las correspondientes clases genotípicas del QTL en la posición
del mapa con máximo valor de LOD. Para poblaciones BC, el efecto genético es una
combinación del aditivo y los efectos de dominancia, debido que a falta de una clase
homocigótica los efectos de dominancia no pueden ser separados como se realiza en una
población tipo F2. Por el contrario, las poblaciones de líneas homocigóticas (RILs) no permiten
estimar los efectos de dominancia, debido a la falta de la clase heterocigótica (Torres et al.
2012).
2. OBJETIVOS
47
El objetivo general de esta Tesis Doctoral es la evaluación del genoma del almendro como
fuente de enriquecimiento del pool genético del melocotonero cultivado. Para ello se han
planteado un conjunto de objetivos específicos que se detallan a continuación:
1- Saturar y comparar los mapas genéticos de la población F2 del almendro ‘Texas’ y el
melocotonero ‘Earlygold’ (TxE) y del primer retrocruzamiento con ‘Earlygold’ (T1E)
mediante marcadores moleculares tipo SSRs y SNPs.
2- Identificar y mapear los genes mayores/QTLs responsables de la variabilidad fenotípica
observada en las poblaciones interespecíficas (TxE y T1E) para un conjunto de
caracteres de interés agronómico asociados a rasgos de morfología de flor y hoja,
calidad de fruta, fenología y resistencia a enfermedades.
3- Establecer los métodos y estrategias más adecuados para la construcción de una
colección de líneas casi isogénicas (“near isogenic lines”, NILs) de almendro en el fondo
genético del melocotonero cultivado.
3. GENETIC CHARACTERIZATION OF A
CYTOPLASMIC MALE STERILITY AND TWO
RESTORER GENES IN ALMOND X PEACH
PROGENIES USING HIGH-DENSITY SNP MAPS
51
3.1 INTRODUCTION
Cytoplasmic male sterility (CMS) is driven by rearrangements in the mitochondrial genome
that result in plants unable to produce fertile pollen (Pelletier and Budar, 2007). Usually CMS is
a binary system where the products of one or more nuclear genes (restorer genes) interfere
with the causal mitochondrial proteins and reestablish fertility (Schnable and Wise, 1998;
Budar and Pelletier, 2001). CMS is widespread in the plant kingdom and has been described in
more than 150 species (Schnable and Wise, 1998) including members of the Poaceae,
Leguminosae, Umbelliferae, Brassicaceae, Chenopodiaceae, Solanaceae and Liliaceae. Various
cases of male sterility have been reported in the Rosaceae, as in Fragaria vesca (Tennessen et
al. 2013), peach (Scott and Weimberger, 1938; Werner and Creller 1997), Japanese apricot
(Yaegaki et al. 2003), almond (Alonso and Socias, 2003) and pear (Thompson et al. 1976),
although CMS has only been documented for peach, Japanese apricot and pear. CMS is an
important model for the analysis of the interplay between organelle and nuclear genomes that
has implications in the evolution of sex in plants (Caruso et al. 2012) and is a key technological
aspect in the development of F1 hybrid seed for many of the most important crops (Kempe
end Gils, 2011).
Peach is the only species of the cultivated Prunus (including also cherry, almond, plum and
apricot) that does not have a functional gametophytic self-incompatibility system and behaves
as self-pollinating. This character, along with its important economical value, have made peach
a model species for genetic studies of Prunus and many major genes have been described
(Monet et al. 1992) and mapped on its genome (Dirlewanger et al. 2004; Arús et al. 2012).
Peach is also one of the best characterized species of the Rosaceae family and its whole
genome sequence has recently been published (Verde et al. 2013).
Self pollination is the major factor that explains the low level of genetic diversity of peach
(Aranzana et al. 2010; Aranzana et al. 2012; Verde et al. 2013; Li et al. 2013). In contrast, the
almond genome is highly variable as revealed with molecular markers (Byrne 1990; Mnejja et
al. 2010), and may be a source of novel alleles for peach that would confer new properties and
provide raw materials for characters such as disease resistance, extended fruit shelf life and
organoleptic fruit quality. These are some of the major objectives of peach breeding that are
difficult to achieve by the scarcity of variability of its gene pool.
52
One of the key elements of the success of interspecific crosses is the fertility of the F1 and
successive generations. F1 hybrids between almond and peach are usually fertile, but we
found male sterile plants in their F2 and BC1 progenies. In this paper we examine the male
sterility found in two crosses between almond and peach: the F2 between ‘Texas’ almond and
‘Earlygold’ peach, a progeny that was used to construct the reference map of Prunus (Joobeur
et al. 1998; Dirlewanger et al. 2004) and a new population, the backcross one (‘Texas’ x
‘Earlygold’) x ‘Earlygold’, for which we have obtained high density SNP maps that are described
here. Our data indicate that the almond cytoplasm confers male sterility to the peach unless
the almond allele of at least one of two independent restorer genes (Rf1 and Rf2) is present.
3.2 MATERIALS AND METHODS
3.2.1 Plant material
We used two mapping populations: an F2 of 80 individuals, obtained by selfing the F1 hybrid
plant ‘MB 1.37’ (almond ‘Texas’ x peach ‘Earlygold’), named TxE. A high density map exists
already for this progeny (Dirlewanger et al. 2004) and we have recently added 31 plants, for a
final size of N=111, to improve its resolution. The original TxE population is kept at the IRTA
Center of Cabrils (Barcelona, Spain) and a copy was planted in the IRTA Experimental Station of
Lleida at Gimenells (Spain) both grafted on ‘Garnem’ rootstocks. A new backcross one (BC1)
population derived from the cross between the hybrid ‘MB 1.37’ and the peach ‘Earlygold’ of
size N=185 has been created and named T1E. Original trees of T1E were planted on their own
roots at Cabrils. Grafted plants of T1E on ‘Garnem’ rootstocks were also located in the fields of
Gimenells.
3.2.2 Phenotyping
The male sterility character was studied in three seasons (2010-2013). Male sterile plants were
characterized by the lack of pollen and the presence of empty and white anthers in contrast
with the fertile plants that presented pollen and colored anthers ranging from yellow to
antocyanic (Figure 8). In addition, the pollen germination capacity in all individuals of T1E was
evaluated in vitro according the protocol described by Asma (2008) with an additional 15% of
sucrose.
53
Figure 8. a) Male sterile flower with white anthers and absence of pollen, and b) fertile flower with colored anthers and presence of pollen.
3.2.3 Marker detection, linkage map construction and genetic analysis
Genomic DNA was extracted from young leaves using the CTAB method (Doyle and Doyle,
1990) omitting the final RNAse treatment step. Sample DNA quality and concentration were
checked and measured with a DNA spectrophotometer (NanoDrop Technologies, Wilmington,
USA).
Genetic maps were obtained using a set of 131 selected SSRs with good genome coverage
most of them previously located on the TxE map by Aranzana et al. (2003) and Howad et al.
(2005) or of known genome physical position based on their sequence (Annex 1). Four of these
markers were developed here based on the list of SSRs of the GDR to cover the distal part of
G6 (3) and the distal part of the G2 (1). They were named as CPP (C for CRAG, PP for Prunus
persica) followed by a number that coincides with that of the SSR annotated at the IGA peach
genome browser
(http://services.appliedgenomics.org/fgb2/iga/prunus_public/gbrowse/prunus_public/). Their
main characteristics are provided in Table 4. These markers were studied only in the 31 new
individuals of TxE and in all the T1E population. Most of the SSR markers used were common
between TxE and T1E (Annex 1). Two additional SSRs (TPScp10 and TPScp10) developed from
Japanese plum chloroplast (Ohta et al. 2005) were used to evaluate the almond or peach origin
of the cytoplasm in T1E population.
In addition we genotyped 50 individuals of the TxE population and 123 individuals of T1E with
the 9k Illumina Infinium SNP chip developed by the Peach International Genome Initiative
(Verde et al., 2012). Genotyping was done at the Fondazione Edmund Mach (San Michele
54
all’Adige, Italy) with DNA (50ng/μl) extracted with the DNAeasy 96 Plant kit of Qiagen as
described in Verde et al. (2012). Genotypes were scored with the GenomeStudio Data Analysis
software of Illumina Inc. (Gencall threshold 0.15). Markers with GeneTrain score <0.6 were
excluded from the dataset used for mapping. SNPs showing skewed segregations (P < 0.05)
were utilized for mapping and discarded only if unlinked.
Table 4. Characteristics of the SSR markers in linkage group 2 and 6 developed for linkage analysis in the ‘Texas’ x ‘Earlygold’ BC1 population.
Name Primers AT1 Genome position
CPP8062 Forward: CCTCGCTGAAAACTTGATG 55 2: 10.246.714
Reverse: GCCAAGGACATTTTGAAAC 10.246.855
CPP20836 Forward: CATTTTTCACCCCAACCATC 55 6: 1.141.321
Reverse: CATTGTTGGAATTTTGCTTC 1.141.477
CPP21245 Forward:GGGAGATACGGGATTTGGAT 55 6: 3.108.842
Reverse: AGCCTTTTTGGACCTCCCTA 3.109.025
CPP21413 Forward: ACGTCCTTTGGGAAATCCAT 55 6: 4.150.412
Reverse: AGCACAACACTCTCGAAATCC 4.150.515 1 AT= annealing temperature (ºC)
Linkage maps were constructed using MapMaker/exp 3.0 (Lincoln et al. 1992) with the
Kosambi mapping function at a minimum logarithm of odds (LOD) grouping threshold ≥3.0.
Segregation distortion of individual markers was revealed by a chi-squared test using JoinMap
v 4.0 software (Van Ooijen, 2006). Linkage maps were drawn using the MapChart 2.1 software
(Voorrips, 2002). For the T1E progeny we elaborated two maps, each one with the data from
one of the parents: the ‘Texas’ x ‘Earlygold’ F1 hybrid plant used as female parent, that we
called the T1E map, and the map from the pollen donor ‘Earlygold’, called the E map. Linkage
group terminology was the usual in Prunus (Dirlewanger et al. 2004; Verde et al. 2013).
Given the high number of SNPs identified we mapped only one per genome position or bin, i.e.
group of markers with the same genotype for all individuals and separated by at least one
recombination event from its neighboring bins. A single SNP was used to label each bin,
normally containing more markers. The selected marker was the closest to the origin of the bin
based on its physical position that had all or most data for the individuals studied (i.e.,
excluding SNPs that were scored as dominant or heterozygous for the hybrid individual and
‘Earlygold’ in the T1E and E maps). Exception to this rule were a few markers (54) of the E map
55
in which the SNP used to label a specific bin was selected to be one that was in common with
TxE and T1E to facilitate the visualization of the map comparison presented in Figure 2. The
SSRs were all added as markers in the maps so they could be used as anchor points between
the three maps studied and with other Prunus published maps.
Results were inconclusive when the male sterility character was mapped as a single gene in the
TxE, T1E and E maps. Given these results, we followed a two-step procedure that consisted
first of mapping these data as a quantitative character using MapQTL, using values of 2 for
fertile and 1 for sterile plants and, second, knowing the approximate positions of the two QTLs
detected, we used the ensemble of the genotype data of these two loci to manually find their
position in the full dataset of ordered markers of the two linkage groups where these loci were
located. A unique and fully consistent position was found for both loci in the positions
identified by MapQTL.
3.2.4 Candidate genes analysis
For the PPR genes (Table 5) we used the information of annotated genes in the Prunus genome
v1.0 (http://www.rosaceae.org/search/genes; Jung and Main 2014) using ‘pentatricopeptide
protein’ as a keyword. For the non-PPR genes described in Chen et al.( 2014) we tried to obtain
sequence information from the bibliography and used this information to do a tblastx in the
GDR webpage using the default options.
Table 5. PPR genes found in the regions containing Rf1 and Rf2 in the Prunus genome.
Name Location Start (bp) Stop (bp)
ppa004557m scaffold_2 1,188,729 1,190,329
ppa003463m scaffold_2 3,027,943 3,030,377
ppa001444m scaffold_2 3,894,642 3,897,125
ppa021440m scaffold_2 4,230,526 4,232,581
ppa023365m scaffold_6 5,768,164 5,769,950
ppa015993m scaffold_6 5,799,668 5,803,260
ppa024218m scaffold_6 5,906,881 5,908,413
ppa025792m scaffold_6 5,915,202 5,917,143
ppa003571m scaffold_6 6,024,610 6,028,036
ppa026767m scaffold_6 6,174,107 6,175,847
ppa023798m scaffold_6 6,182,493 6,184,532
ppa019799m scaffold_6 6,204,975 6,206,456
56
3.3 RESULTS
3.3.1 Map construction and comparison
The three maps obtained, TxE, T1E and E are presented in the Figure 9. The TxE genetic map
with 1,948 markers (114 SSRs and 1,834 SNPs) detected the expected 8 linkage groups (G1-
G8), covering a total length of 472.1 cM (average density of 0.24 cM/marker). The longest
group was G1 with 84.4 cM and the shorter G3 with 43.8 cM and the largest gap was 7.3 cM on
G7. The T1E backcross one population gave rise to two genetic maps. The linkage map of the
female parent, T1E, consisted of 113 SSRs and 1,919 SNPs and was the most populated with
2,032 markers distributed into eight linkage groups (G1-G8). The total map length was 370.1
cM, with G1 covering the longest genetic distance of 53.6 cM and G5 the shortest with 39.8
cM. The average marker density was 0.18 cM between adjacent markers and the longest gap
had 6.7 cM on G8.
The genetic map of E, the peach male parent, had 1,091 segregating markers (1,050 SNPs and
40 SSRs), approximately half of the markers that were polymorphic in the T1E map. Eight
linkage groups were identified covering a longer distance than any of the other two maps,
520.4 cM, although the marker density was much lower (0.48cM/marker). In contrast with TxE
and T1E where marker distribution was generally uniform, the distribution of markers in the E
map was extremely heterogeneous with chromosomal fragments with densities similar to T1E
and TxE and others without markers, resulting in large gaps (nine gaps longer than 10 cM, two
of which in G2 and G6 longer than 25 cM), vast distal regions of the genome that had no
segregating markers with an overall coverage of 155.4 Mb compared to the 207.3 Mb of T1E
(75.0%) or the 211.9 Mb of TxE (73.3%), and lower physical coverage between mapped
markers of all linkage groups that was very low in certain of them (compared to T1E): a 32.4%
of G4, a 36.4 % of G5 or a 70.2% of G8. Considering the gaps >2 Mb, these were rare in TxE and
T1E, four in total for each map with a maximum gap of 2.9 Mb, but much more frequent
in E where this number was of 23 with a maximum gap of 19.7 Mb in G4 and adding to a total
distance of 103.0 Mb, almost half of the distance covered by TxE or T1E.
Ninety-five SSRs were in common between TxE and T1E, all in the same linkage group and with
the same order, except for the CPPCT029 and CPPCT053 markers between TxE and T1E. T1E
and E shared the 40 SSRs that had in common and of these 31 were also anchor points with
TxE. A large proportion of the 1,834 SNPs mapped in TxE were also mapped in T1E (97.5%) and
57
vice versa (92.9%) for the 1,919 SNPs mapped in T1E. These proportions were much lower in E,
where only 478 SNPs (25.9%) were common with TxE and 491 (25.6%) with T1E. The order of
the SNPs between TxE and T1E was identical, with the only exception of SNP_IGA_155433 that
mapped to a slightly different position in G2 of both maps.
Figure 9. Linkage maps obtained, one with the almond (‘Texas’) x peach (‘Earlygold’) F2 population (TxE), and two more with the backcross one population to peach, one for the hybrid female parent (T1E) and the other for the peach ‘Earlygold’ male parent (E). Each marker position corresponds to a bin (i.e. a group of markers with the same genotype for all the plants studied that are represented by a single marker). Some of the anchor markers of each map are connected with lines. The selected anchor markers are all the SSRs and some of the SNPs, particularly of the E map to show the completeness of the comparison between T1E and E. The names of the SNP markers are shortened to facilitate the visualization of the maps. The two restorer genes are highlighted in red. (The figure 9 follows in the next pages).
SA2056CPPCT016
0.0
SA26510.6EPDCU3122SA3621
1.2
SA78952.2SA105203.2SA111064.2SA144385.2SA174197.1CPPCT010SA18927
8.1
SA232518.7SA24481M16a
9.3
SA2811211.9SA2829413.7
SA2983615.5
EPPCU533117.2PACITA00517.3SA31646CPPCT027
19.2
SA4759521.4
SA6363822.8SA6713723.5SA7691224.2EPPCU109025.1
UDP96-005SA78954
30.9
SA8432433.2
SA8980835.5
CPDCT02440.5SA9509541.5SA9623242.4EPPCU194543.3SA9896043.4SA10106544.2SA101538CPPCT026
45.0
SA103917EPDCU3489
47.8
BPPCT020SA104819
49.3
SA10600050.5SA10829951.7SA10922352.9SA11022754.1SA11041355.3SA111259BPPCT016
56.5
SA11175557.2SA11204257.9SA11227158.6SA11269859.3SA11292460.7SA11344961.4SA11409462.1SNP_1_3905918763.5SA118443CPPCT042
64.2
EPDCU286267.0
CPPCT02968.6
CPPCT05370.8
SA12136472.6
SSC1_4153528575.0
SA12302376.2SA12318077.4SA133606BPPCT028
78.6
SA13285579.6SA13158980.6SA12942281.6SA12446682.6
SA12371984.6
G1_TxE
SA20560.0EPDCU31220.8SA36211.1UDP96-0181.4SA78952.1SA91973.4SA106354.1SA174194.8SA18927SA23251
5.5
CPPCT0047.9EPPCU5331SA28294PACITA005
12.2
SA3164614.3SA3502715.4SA5590316.5PceGA59SA63638
17.0
SA76912EPPCU1090UDP96-005
19.1
SA83053CPPCT003
21.2
SA8691821.9SA8875122.6SA9158323.3SA9712824.8SA9896027.7SA9994328.4SA10106529.9SA10133131.4SA101815CPPCT026
32.1
SA10281933.2SA103507EPDCU3489
35.3
SA10600038.0SA10829939.4SA10922340.1SA10961940.8SA10989742.2SA11105442.9BPPCT01643.6SA11175544.2SA11387844.8SA11489846.1CPPCT01946.7S1_3905918747.2CPPCT042EPDCU2862
47.7
SA11939148.2CPPCT053SA817857
48.7
SA120057CPPCT029
49.2
SA12174049.7SA12302350.2SA12318050.7SA133606BPPCT028
51.2
SA13285552.0SA12666852.8SA12371953.6
G1_T1E
SA20560.0SA29380.8SA3551UDP96-018
2.5
SA52583.4SA57264.3
SA78955.9
SA2260324.3SA2325125.2
SA2426027.8SA2470328.7
SA2553030.4
SA2605332.1
SA28294SA29009
33.8
SA2983637.8
SA3062039.9SA3253540.8SA3502741.7SA3643642.6SA3753143.5
SA4677346.1SA5862647.0
SA6582749.6
SA78367UDP96-005
53.9
SA7945555.5
EPPCU1090SA79719
57.1
SA8729065.8
SA9712879.9
SA9804281.6
SA9834083.3SA9896084.1
SA10512296.8
SA10600098.2
SA106646101.0
SA108299102.7
G1_E
SA2352840.0SA2302701.0CPPCT044SA136625
2.0
SA1405733.4SA1567424.8SA1989376.2UDP98-025SA242118
7.5
SA2468388.1
SA2492739.9SA25228711.1CPDCT04411.7
SA25807813.2
SA26036116.3BPPCT004SA767680
17.8
SA263828EPDCU4017BPPCT001
18.3
SA269074CPSCT044
20.1
SA27505721.2SA27534123.5UDP96-013SA276840
24.6
SA27733625.6SA277934CPDCT004
26.6
UDP98-41127.5SA27884928.5SA27943929.5SA28075531.6
pchgms133.7
RC1328_36635.1BPPCT030CPPCT043
36.5
SA28505837.6CPSCT021SA285878
38.7
SA28752243.4PceGA3444.3SA28787545.1SA28809845.9
SA28928247.6CPSCT03448.4UDA-02349.8SA29024349.9
G2_TxESA233375CPPCT044CPP8062
0.0
SA2307150.7AMPA931.4SA1366252.2SA1377453.0
Rf1SA144919
3.8
SA1928904.6SA198937MA024a
5.4
SA240333UDP98-025
6.5
SA2498497.0SA257549CPDCT044
7.5
BPPCT004SA263098
10.1
SA264220EPDCU4017
12.2
SA265240BPPCT001
12.7
SA26631713.4SA269074CPSCT044
17.5
SA26966018.0SA27317518.5M1aSA274867
19.6
SA27505720.6SA275481UDP96-013
21.6
SA27657122.5SA27727323.4SA27793424.3SA278061CPDCT004
25.2
UDP98-41126.3SA278849pchgms1
28.6
SA28158229.5SA28258230.4RC1328_36631.3BPPCT030CPPCT043
32.2
S2_2227436332.9SA28412434.4SA28505835.1CPSCT02138.1SA28460241.3SA28463442.6SA287522PceGA34
45.1
SA28800045.8SA28884547.3SA288975CPSCT034
48.8
SA290277UDA-023
49.9
G2_T1E
CPPCT0440.0
SA229248AMPA93
2.8
SA25986411.6SA18851912.3SA19692413.0
SA21459416.7SA217696MA024a
17.4
SA45618824.9
SA25754926.6
SA27317538.4
SA27413340.1
SA28884567.2SA29027768.0
G2_E
58
SA291055EPPCU5990
0,0
SA2939250,6EPDCU46100,7SA2945331,3SA2954402,7SA2959784,1SA296203UDP97-403
4,8
SA297349BPPCT007
5,3
SA2997966,6SA3043077,9SA309280BPPCT039
9,2
SA31005710,5SA311192EPDCU3083
11,8
SA31450913,4SA31583715,0SA31661516,6SA31928018,2
SA32269821,5
SA32269823,1
SA88706124,7SA344789CPPCT002
26,3
SA34923327,9SA35074928,7SA35149429,5SA352749UDP96-008
30,3
SA35739631,4SA36070432,5SA36195733,6SA36320334,7
SA36535736,9
SA36585438,0
SA36593339,1
SA36635440,2
EPDCU053243,7
G3_TxE
snp_3_130507EPPCU5990
0,0
SA2939252,5SA2945333,3SA2954404,1SA2956794,9SA297349UDP97-403BPPCT007
6,5
SA2974957,2SA2981397,9SA2984098,6SA3005469,3SA48210210,0SA30087710,7SA30204211,4SA30475512,1SA30791814,8SA308756BPPCT039
15,5
EPDCU308316,6SA31361517,4SA31928018,2SA32269819,0SA43305019,8SA42805620,6SA42804721,6SA32530523,6SA34088424,4SA34196225,2SA34461226,7SA346432CPPCT002
28,2
SA34841828,8SA34923329,4SA35156730,0UDP96-00830,6SA36070432,2SA70491833,8SA36283635,4SA36320336,2SA36403637,8SA36483339,4SA36504840,2SA36585441,4EPDCU053242,6
SA36721444,3SA36753345,1
G3_T1E
snp_3_1305070,0
SSC3_2546911,1
SA2919873,3SA2929654,1SA2933184,9
BPPCT0079,9
SA309881BPPCT039
20,2
SA31361523,5SA31711424,3
SA431437SA756400
25,9
SA91376928,4
SA32709332,5SA33846933,3
SA32837334,9
SA333140SA340884
36,5
SA34331140,4SA34471241,4SA34541942,2
SA34616443,3
CPPCT00245,5
SA35154848,8
SA35156753,0SA35559053,8
SA35946257,1
SA36070459,6
SA36112661,3
SA36257164,6SA36359565,4
SA36504867,9SA36564768,7EPDCU053269,6
G3_E
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5SA3879929,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA41238034,3SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6SA44011046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
G4_TxE
BPPCT010SA368926
0,0
SA369001EPDCU5060
1,1
SA3695311,9SA3746102,7SA3787313,5SA3790615,0
pchgms27,9
SA3819679,5SA38250210,1SA38267710,7
SA38349213,8CPPCT011CPPCT005
14,6
SA38479115,3SA38503016,0SA38518916,7SA38608918,2SA38816818,9SA38920419,6SA39515221,1SA39368422,6SA39254923,3SA39162924,0SA395253CPDCT045
24,7
SA39965826,4SA40182928,1SA402416UDP96-003
29,5
M12a31,6SA40916732,5SA41238034,3SA41266235,2SA41311537,0EPPCU2000SA415301BPPCT015
37,9
SA41858239,1SA41976240,3SA420316UDA-021CPPCT046
41,5
SA42562243,1RC0544_09044,2SA76629844,7SA44066244,9UDA-02745,2Ps12e245,8
G4_T1E
EPDCU50600,0
SA3703576,3
SA3746108,3
SA37873110,3
SA38035811,7
pchgms213,1
SA38137914,4
CPPCT01117,1SA38473117,4CPPCT00517,7
SA38656021,6SA38816822,9SA39375924,4SA392186CPDCT045
25,1
SA39602826,0SA39836826,9SA39928027,8SA39965828,7SA40026029,6SA40107230,5
SA40208134,9
SA40241636,7
SA404010M12a
39,3
SA40433240,1
SA40489941,8
SA40589442,9
SA40594944,0
SA40711545,1
SA40861447,6
BPPCT01556,6
G4_E
SA5433680.0SA545448CPPCT040
1.0
SA5505041.9SA5522543.7AMPA112SA556288
4.6
SA5628675.5SA5658636.4SA5696717.3SA5715488.2SA57258210.0SA572841UDP97-401
10.9
SA58260013.5
SA58431514.8
SA58620216.1
SA58695517.4
PACITA02120.0SA588670BPPCT017
21.1
CPSCT00622.5
SA59376324.6SA594176BPPCT037
26.7
SA59460127.5SA59474528.3pchgms4SA595126
29.1
SA595212CPPCT013
30.1
SA59639331.1SA59720232.1EPDCU5183EPDCU4658SA600072
33.1
SA60049336.4SA60113538.0
SA60239743.1SA602512CPSCT022
44.7
BPPCT01445.3SA60260546.3
SA60304748.3
G5_TxE
SA543368CPPCT040
0.0
SA5505041.6SA556288BPPCT026
4.0
SA5628674.7UDP97-401SA575030
5.4
SA5826006.3SA5843158.1SA5862029.0SA5874509.9SA58937111.7SA58975012.6SA59054613.5SA591147BPPCT017CPSCT006
15.3
SA593763BPPCT037
17.9
SA59474518.7SA595312pchgms4
19.5
CPPCT01321.2SA59639322.5SA59720225.7SA59743626.3SA598118EPDCU5183
26.9
SA59878427.4SA59962927.9EPDCU465828.4SA60007228.9BPPCT03829.4SA60049330.2
SA60113534.5
CPSCT02236.9RC3786_396BPPCT014
38.1
SA60290139.8
G5_T1E
SA5862020.0
SA5869351.8SA5875282.6
SA5893714.5
BPPCT03713.7
SA59531316.9
EPDCU465824.8BPPCT03825.5
SA60113527.1
G5_E
SA6072400.0SA6070131.0SA6138482.0SA6127543.0
SA6115115.0Ps7a2SA610487
6.0
SA6096307.0SA6190818.4
SA62155611.2
SA62439116.6
SA625354UDP96-001
18.7
EPPCU930019.3
SA62732821.2
SA62753522.3
SA62985523.4
SA63024324.5
SA63101425.6
SA63203327.8SA63242328.9SSC6_10042074BPPCT008
30.0
SA63599931.1SA63906232.2SA64163733.3SA64450234.4SA65042235.5SA65579436.6SA661965CPSCT012
37.7
SA66756342.0SA66872543.1SA66905044.2SA671806pchcms5
46.3
SA67507748.2SA67657150.1SA67714752.0SA677625BPPCT025
53.9
SA67903854.9CPPCT04755.9SA68003256.7SA68088957.5SA68273559.0SA68354659.8SA68660961.3SA68758362.1SA68810363.6SA68864364.4SA688827UDP98-412
65.2
MA040a65.7SA68995766.7AMPA130SA690792
67.7
SA69119669.0SA69162470.3MA14aSA692396
71.6
SA693239EPPCU4092
73.8
SA69409874.4SA69452175.0SA69471475.6CPPCT030SA697308
76.2
SA69761776.8SA69943277.4CPPCT02178.6
G6_TxECPP214130.0SA6070130.7Ps7a2CPP21245CPP20836
1.1
SA6104871.8SA6048342.5SA6064354.5SA6215566.5SA6222317.2SA623894
Rf29.2
SA6258439.9UDP96-00110.6SA62732812.1SA62753512.9SA62906213.7SA62985514.5SA640430BPPCT008
16.0
SA65249216.5SA655794CPSCT012
17.0
SA66756317.7SA66872519.2SA670494pchcms5
20.7
SA676571BPPCT025
24.1
SA67903826.4CPPCT04727.6SA68121928.2SA68273528.8SA68354629.4SA68361130.0SA68395630.6SA68660932.5SA68758333.8SA689067UDP98-412MA040a
34.4
SA691114MA14aAMPA130
34.9
EPPCU4092SA693379
37.0
SA69440838.0SA69471439.0SA69499040.0SA69562941.0SA69597442.0SA696903CPPCT030CPPCT021
43.0
G6_T1E
CPP214130.0SA6165081.0SA616119CPP21245CPP20836
1.8
SA6048348.2SA6052909.1
SA60586310.9
SA60643513.3
SA62985525.2SA63026626.1SA63055027.0
SA64043028.8
SA64092833.5
SA65249237.2
BPPCT02562.6SA67806063.5
SA67985265.2SA68061566.0SA68121966.8
SA68829077.9
MA040aSA690390
80.4
SA691236MA14a
82.5
SA69176783.3SA69337984.1
G6_E
59
Comparison between linkage and physical maps resulted in the identification of discrepancies,
the most relevant of which were two large inversions at the distal end of G1 (>5.1 Mb), and
proximal end of G7 (>4.2 Mb), misplacement of a fragment of >1.2 Mb of G2 at the proximal
end of this group, a fragment of >2.2 Mb of G4 mapped to the central part of G2 and another
fragment of G4 (>0.4 Mb) was located in the central region of G6. Markers of unmapped
scaffolds S9, S10, S12 and S17 could be placed at a map position on G3, G3, G2 and G6,
respectively. These data are coincident with some of the sequence refinements introduced to
the v1.0 version of the peach genome that can be found at the GDR
(http://www.rosaceae.org/species/prunus_persica/genome_v1.0_refinements).
3.3.2 Genetic analysis of the male sterility character
Both chloroplast SSRs showed bands of different sizes for ‘Texas’ and ‘Earlygold’. The MB1.37
hybrid and all individuals of the TxE and T1E progenies had the ‘Texas’ allele, as expected
considering that ‘Texas’ and MB1.37 were used as female parents.
SA7276620.0SA704075CPSCT004
1.0
SA7498162.4
SA7511233.8
CPPCT0396.7SA7531226.8SA754563CPPCT022
8.9
SA761233pchgms6
10.7
SA76166411.7SA76224912.7SA76289513.7SA763910UDP98-408
14.7
UDAP-43216.0SA76908416.9SA77097817.8SA77202818.7SA77489819.6SA77606720.5UDAp-407CPPCT057
21.4
SA77682623.9
SA77735725.1
SA77812527.6
SA77858730.1SA77954031.3SA781003CPPCT033
32.5
SA78135233.6
SA78242740.9
SA782916PMS02
44.4
SA78437345.1SA78461645.8EPPCU517647.0pchcms247.6SA78586849.1
SA78771550.6
SA78935353.6SA78970054.3SA78994155.0SA79012255.7SA79016756.4CPPCT017SA790678
57.1
SA791313EPDCU3392
59.2
SA79258061.6
Ps5c364.4
G7_TxE
SA7276620.0SA7237010.8
SA7040752.5
SA7338334.2CPSCT004SA744253
5.0
SA7498166.3CPPCT0396.7
SA7587679.3SA75996710.0pchgms6SA762094
11.4
SA762895UDP98-408
12.9
SA76968713.9
SA77422215.8
SA77800217.7CPPCT05718.0SA77849818.7SA77954019.8
SA781003CPPCT033
24.1
SA781691MA20a
25.8
S7_1762827.4SA782750PMS02
27.9
SA78326229.9SA783973EPPCU5176
30.6
pchcms231.1SA78633331.9SA78667633.5
SA78798735.9S7_2016936.7SA78994137.5SA79012238.3CPPCT017SA790678
39.1
SA79159140.5EPDCU339241.9
Ps5c3SA792580
45.3
G7_T1E
SA7276620.0
SA7237011.6
SA7145724.9SA7113685.7SA7078487.4SA7040758.2SA7322849.9SA73780110.7SA738499CPSCT004
11.5
SA74588013.1SA74939613.6SA750944CPPCT039
14.1
SA33466914.9
SA75378418.0SA75451218.8SA75664119.6SA75740120.4
SA75996724.2
SA76947128.0SA770284SA770978
28.8
SA77422231.8
SA77699439.4SA777798CPPCT057
40.2
SA77813840.8SA77938641.4
SA78145545.3MA20a45.9
SA782750PMS02
49.2
SA78318750.0SA78327451.6SA78403052.4SA78500053.2EPPCU517654.0pchcms254.5
SA78595857.1
SA78881158.8
CPPCT017SA790469
61.4
Ps5c366.4
G7_E
CPSCT0180.0SA7936060.1
SA7950203.6
SA7992915.3
SA8023397.0
SA8097718.7BPPCT006SA809997
10.4
SA81997811.4
CPDCT03413.4SA84169614.1CPPCT05814.6SA83432115.4SA85305316.2SA85545917.0
CPPCT00619.5SA85935420.4SA86203421.3SA86480522.2
SA86570923.9SA86631224.8SA86636625.7
SA86780027.4SA87033728.3SA87108229.2
SA87241131.8SA87276532.7SA87305533.6SA87463934.5SA87510835.4SA87661036.3SA87737038.0SA877454UDP98-409
38.9
SA87804441.2SA87898142.3SA879224EPDCU3454
43.4
SA88062044.1SA88112044.8SA88132745.5SSC8_1908376946.9SA88180447.6SA88242748.3SA883292EPDCU3117
49.7
SA88533550.7
G8_TxE
CPSCT018SA793606
0.0
SA7957560.8SA7967551.6SA7992913.1SA8003773.9SA8006344.7SA8023396.2SA8037587.0SA809771BPPCT006CPPCT058CPDCT034
7.8
SA8343218.5SA8368579.2SA85550710.7SA85960212.2SA860815CPPCT006
13.7
SA86631215.2
M6a21.9SA86833922.0SA86904023.2SA86941924.4
SA87011027.6SA87050928.4SA87108229.2
SA87305530.8
SA87534333.2SA87596634.0SA876618UDP98-409
34.8
SA87804435.9SA87929138.0EPDCU345438.5SA88062039.2SA88180440.6SA88242741.3SA88275242.0SA88352442.7EPDCU311743.4SA88383844.2
SA88415345.9
SA88512147.6
G8_T1E
BPPCT0060.0
SA8165043.6SA8179674.2SA8206464.8SA8240396.0SA8443756.6SA8383767.8CPPCT0588.4
CPDCT03410.0
SA83432111.9
SA85259914.0SA85347314.7SA85535615.4SA85550716.1
SA85960218.2SA86217719.6SA86234920.3SA86280121.0CPPCT00621.7SA86463222.6SA86541223.5
SA86631227.9SA86682928.8SA867794M6a
30.6
SA86905931.4SA86927632.2SA86974833.0SA87011033.8
SA87256637.8
SA87297839.4SA87305540.2
SA87515841.8SA877484UDP98-409
42.6
SA87929145.1SA87999245.9SA88049946.7
G8_E
CPPCT0400.0
AMPA1124.6
UDP97-40110.6
PaCITA0218.2BPPCT01719.9CPSCT00621.2BPPCT03725.3pchgms428.5CPPCT01329.1EPDCU518332.1EPDCU465832.8
CPSCT02241.1BPPCT01442.1
G5-TxE
CPPCT0400.0BPPCT0264.4UDP97-4015.5
BPPCT01713.9CPSCT00615.6BPPCT03717.8pchgms419.4CPPCT01321.1EPDCU51826.9EPDCU465828.0BPPCT03829.1
CPSCT02236.7BPPCT01437.8
G5-T1E
BPPCT0370.0
EPDCU465811.5BPPCT03812.1
G5-E
Ps7a20.0
EPPCU930013.5UDP96-00114.4
BPPCT00825.4
CPSCT01231.5
pchcms540.5
BPPCT02548.4CPPCT04750.3
MA040a54.3
UDP98-41260.4AMPA13063.0MA14a66.6EPPCU409269.0CPPCT03069.9CPPCT02173.6
G6-TxE
SSR208360.0Ps7a2SSR21245
1.1
SSR214133.6UDP96-00112.6BPPCT00817.5CPSCT01218.7pchcms522.2BPPCT02525.7CPPCT04728.9UDP98-412MA040a
36.5
AMPA13037.0MA14a37.8EPPCU40938.6CPPCT03044.6CPPCT02145.1
G6-T1E
g-22.0
BPPCT0250.0
MA040a18.8MA14a21.0
G6.2-E
60
Field observations on male sterility were fully consistent between years and congruent with
the pollen viability test in vitro in the TxE and T1E populations. In T1E, from a total of 173
plants phenotyped, 121 were fertile and 52 male sterile, and in TxE only one plant was male
sterile whereas all the others that could be phenotyped (89) produced fertile pollen. We
compared these segregations with those expected considering that this character was
determined by two dominant epistatic loci (called Rf1 and Rf2, for restorer of male fertility),
where the almond parent carried the two dominant alleles Rf1 and Rf2, the peach parent was
homozygous for the recessive alleles, their hybrid MB1.37 was a heterozygous Rf1rf1/Rf2rf2,
and the individuals of TxE and T1E carrying the double recessive homozygote were sterile and
the rest fertile. Data from T1E were in agreement with a 3:1 segregation ratio ( 2= 2.36; ns),
but those of TxE significantly differed from a 15:1 ( 2= 4.06; P=0.044).
QTL analysis of the male sterility character in the largest T1E population allowed identifying
two regions of its map harboring clear QTLs and none in the E map. The two loci were in the
proximal parts of G2 and G6 and were detected with LODs 16.7 and 17.4, respectively,
explaining 36 and 37% of the phenotypic variability and 67% when considered together. Based
in the positions detected by MapQTL, we located manually the two genes in G2 and G6 and
found them to have a clear position in these groups. Rf1 cosegregated with a bin at 3.8 cM
from the top of G2 (SNP_IGA_144919 and 119 more SNPs covering a physical distance of 3.4
Mb), flanked by SNP_IGA_144913 (1.118.746 bp) and SNP_IGA_192890 (4.535.916 bp) at 3.0
and 4.6 cM, respectively, corresponding to a total physical distance of 3.4 Mb. Rf2 co-mapped
with two bins containing markers SNP_IGA_623894 and SNP_IGA_625843 (map positions 9.2
and 9.9 cM) and four more SNPs that spanned a distance of 0.7 Mb and was flanked by
SNP_IGA_622231 (5.606.752 bp) and SSR UDP96-001 (7.040.897 bp) with cM positions of 7.2
and 10.6 cM, respectively, and covering a total physical distance of 1.4 Mb.
Only the male sterile plant of the TxE progeny had a marker genotype compatible with the
positions of Rf1 and Rf2 as mapped in T1E and the 89 remaining had not. Nevertheless, the
position of these two loci could only be estimated very roughly in TxE, corresponding to the
14.3 cM region between the bins defined by SNP_IGA_230270 and SNP_IGA_260361 in G2 for
Rf1 and the 39.3 cM fragment between markers SNP_IGA_609630 and SSR pchgms5 for Rf2 in
G6.
61
3.3.3 Search of candidate genes for the Rf
In the peach genome there were a total of 554 genes with PPR motifs annotated, four of which
were located in the 3.4 Mb sequence of G2 containing Rf1 and 16 in the 1.4 Mb of G6
encompassing Rf2 (Table2S). Any of the non-PPR genes that have been reported as restorer
genes (Chen and Liu 2014) and for which sequence information was available has been found
in the target regions were Rf1 and Rf2 were located. These genes include the Rf2 from maize
(Cui et al. 1996), Rf2, Rf3, Rf4 and Rf17 from rice (Itabashi et al. 2011, Luo et al. 2013, Fuji and
Toriyama 2009), and Rf1 from sugar beet (Matsuhira et al 2012).
3.4 DISCUSSION
High density maps were developed using two interspecific almond x peach populations with
the 9k IPGI Illumina Infinium chip and a set of 131 SSRs most of them of known position in the
Prunus reference linkage map. The three maps constructed, one for the F2 (TxE) and two for
the backcross one progeny (T1E and E) demonstrated the high quality of the data obtained in
the following aspects: i) as expected the majority (>92%) of the markers were common to the
TxE and T1E maps, as they are derived from the same individual (the hybrid plant MB1.37) ii)
anchor markers between maps were syntenic and collinear with almost no exception; iii) the E
map had a much higher level of recombination per unit of physical distance than the TxE and
T1E maps, suggesting that the recombination rates are higher in intraspecific than in
interspecific progenies as observed in other Prunus crosses (Arús et al. 2005), iv) the number
of markers in the interspecific progenies for the SNP chip were around 2,000 each, whereas
only half were segregating in the map of the peach intraspecific parent. Eduardo et al. (2013)
used the same 9k IPGI chip in a peach x peach progeny (‘Bolero’ x ‘OroA’) and found also lower
numbers of segregating markers (1,450 for ‘Bolero’ and 350 for ‘OroA’). Moreover, the TxE and
T1E maps had a homogeneous coverage of the whole genome with only a few gaps >2Mb,
none of them longer than 2.9Mb. Independently from the fact that the physical coverage of
the maps was usually lower in the intraspecific maps, this results suggest either that
ascertainment bias was not an important factor in the almond/peach materials or that it was
compensated with a higher level of polymorphism compared to peach alone materials
resulting in a similar or higher marker number and coverage. These results indicate also that
the IPGI chip can be expanded to almond/peach progenies.
62
The map constructed with the peach ‘Earlygold’ was characterized by fragments with high
marker density followed by regions without markers, in contrast with the almond x peach
maps that had a relatively homogeneous distribution of markers. Similar results have been
observed when using high density SNP maps in other peach x peach crosses (Eduardo et al.
2013; Martínez-García et al. 2013). These results indicate that the regions without markers
may correspond to genome fragments that are identical by descent, and these fragments may
account for a large proportion of the genome, estimated in E as 103.0 Mb (50% of the total
physical distance covered by T1E). This hypothesis is supported by the recent history of
cultivated peach where most commercial European and North American cultivars come from a
bottleneck at the beginning of the US breeding programs leading among other things to a high
level of inbreeding (Hesse 1975; Scorza et al. 1985). Moreover, the number of generations
between the founders and the current commercial cultivars is probably very low considering
the long life, propagation by grafting and breeding schemes (usually cultivars are selected from
F1 progenies between two partly heterozygous parents) typical from fruit trees. This would
result in the conservation of large chromosomal fragments as supported by the high
conservation of linkage disequilibrium of peach (Aranzana et al. 2010; Li et al, 2013). The
consequences are that the parents used by breeders are often close relatives with large parts
of their genomes and those of the cultivars resulting from their offspring being identical by
descent as our results suggest. This has implications for genome analysis and breeding, as only
the parts of the genome that are heterozygous will segregate and only the crossovers
produced at these heterozygous fragments will result in changes that may produce innovative
gene combinations. This means also that only a part of the genome needs to be monitored
with markers when using markers for whole genome selection. Then, maps with only partial
coverage with markers would be suitable for genetic analysis, provided that the parents are
previously tested for a large initial sample of markers with good coverage of the genome,
allowing the identification of the segregating regions of each particular parent or cross.
Our results suggest that the male sterility character is determined by the interaction of two
restorer genes, Rf1 and Rf2. Presence of the dominant allele (the almond allele) of either gene
would result in a fertile plant. This hypothesis is confirmed by the agreement of the observed
data on T1E with a 3:1 segregation and by the identification of two genome regions of 3.4 and
1.4 Mb located in G2 and G6, respectively, where these two genes are located. Considering
only nuclear inheritance, this hypothesis would conflict with the fertile ‘Earlygold’ phenotype
because the absence of almond alleles at Rf1 and Rf2 would have implied its sterility. If one
considers the existence of a CMS system where the peach and the almond cytoplasm were
63
different and individuals with the almond cytoplasm would be fertile only when having one
almond allele at Rf1 or Rf2, whereas this will not be a requirement for fertility for individuals
with the peach cytoplasm, the data for T1E would completely fit this hypothesis. Other simple
hypotheses (involving one or two genes) of only genetic male sterility were discarded by our
data, as they imply that the ‘Earlygold’ parent should be heterozygous for alleles conferring
fertility and sterility in at least one locus. This locus should then segregate in T1E and be
mapped in the E map, which did not occur.
The situation in TxE fitted well the described two-locus model, although in this case the
expected 15:1 segregation was not in agreement with the 89:1 segregation observed. This
departure can be explained as the marker segregations had a lower frequency of homozygous
peach alleles in both regions, significant in G6 ( 2=10.45; P=.0012) but not in G2 ( 2=3.68;
P=.055), indicating that they were selected against the peach alleles as it was noticed
previously by Joobeur et al. (1998) and we confirm here.
Cytoplasmic male sterility is determined by the interaction between the mitochondrial and the
nuclear genomes (Schnable and Wise 1998; Budar and Pelletier, 2001). Our results are
compatible with this model, where the products of two almond genes would interact with an
unknown mitochondrially-encoded protein of this species and determine the fertile
phenotype. In peach these products do not exist, so fertility can only be recovered when the
almond alleles are present. The most common nuclear factors involved in fertility restoration
are pentatricopeptide repeat (PPR) proteins that are ubiquitous in the plant genomes (Lurin et
al. 2004; Liu and Chen, 2014). This also occurs in peach where 554 genes containing PPR motifs
were identified in its genome, some of which in the target regions of G2 (4) and G6 (16) where
the Rf1 and Rf2 genes are. In addition, we identified two other candidates of non-PPR genes
with high homology of Rf genes described in other species only in the G6 region containing
Rf2. The numbers of candidates found in G2 were much lower than those of G6 for a much
shorter region of the genome (3.4 vs 1.4 Mb). This may be due to the fact that the G2 region
that contains Rf1 was identified as a possible centromeric region by Verde et al. (2013), having
low gene density and low recombination, whereas Rf2 is located at the distal part of
chromosome 6 with higher gene density and recombination. In G6, some of the PPR genes are
in tandem (ppa026767/ppa023798m and ppa023796m/ppa015333m). Given that Rf genes
that encode for PPR proteins use to be located in clusters with other non-Rf PPR encoding
genes (Fujii et al. 2011), these two genes are more likely than others to be the cause of Rf2.
64
Male sterility, cytoplasmic or genetic, has been used as an efficient system for commercial
production of F1 hybrid seed in herbaceous species (Kempe and Gils, 2011). This is not a
varietal type currently used in peach and most fruit tree crops because grafting is the usual
propagation procedure that allows the multiplication of selected vigorous heterozygotes.
However, certain male sterile individuals such as cultivars Chinese Cling and JH Hale (Okie,
1998), are among the founders of the first US peach breeding programs, because of their
outstanding performance as parents for breeding purposes (Weinberger, 1944; Scorza et al.
1985) and also because all seeds collected from them come from crosses with neighboring
plants facilitating the usually tedious pollination procedure. The pollen sterile character was
found to be determined by a single gene (Ps/ps) by Scott and Weinbeger (1938) that was
mapped by Dirlewanger et al. (2006) at position 0.0 cM of G6. The closest marker that can be
placed on the physical map, the RFLP FG215 (position 8.8cM on the map and 285,872 bp on
the genome sequence) is not compatible with the position of Rf2 that we have placed in the
interval 5,606,752-7,040,897, suggesting that Ps and Rf2 are different loci. The existence of a
second male sterility gene ps2 was reported by Werner and Creller (1997), although its map
position has not been determined. A case of male sterility for almond was reported by Alonso
and Socias (2003) where a cross between the male sterile cultivar Rof and a fertile peach
heterozygous for Ps yielded only fertile hybrids, suggesting that if male sterility was of nuclear
origin the gene or genes involved were different than Ps.
The presence of a cytoplasmic male sterility has been reported in peach (Werner and Creller
1997), coming from accession PI 240928, although no evidence of the existence of restorer
genes has been provided. The male sterility of certain accessions of Japanese apricot (P.
mume) was also shown to be produced by CMS but in this case certain crosses with fertile
individuals restored fertility suggesting the presence of Rf alleles (Yaegaki et al, 2003).
Assuming that the CMS of ‘Texas’ can be generalized for almond, the consequences of this
finding are that the introgression of genes from almond into peach would result in sterile
individuals unless one of the Rf genes would be also introgressed or if the peach parent is used
as mother plant in one of the crosses. This may also occur in progeny between peach and
other closely related Prunus species and has to be taken into account when planning the
crossing schemes to integrate new genes from these species into peach, so that the peach
cytoplasm is recovered at some point of the process to avoid undesirable sterility problems.
4. MAPPING MAJOR GENES AND QTLS FOR
FLOWER, PHENOLOGY, FRUIT QUALITY, LEAF
MORPHOLOGY AND DISEASE RESISTANCE TRAITS IN
TWO INTER-SPECIFIC ALMOND X PEACH PROGENIES
67
4.1 INTRODUCTION
Peach, Prunus persica L. (Batsch), is an economically important temperate tree fruit and one of
the model species for the Rosaceae family (Shulaev et al. 2008). Its genome has been recently
sequenced (Verde et al. 2013) and used for comparative studies with strawberry and apple,
two other key species of this family (Illa et al. 2011). Since very early, geneticists realized that
the genetic basis of USA and European commercial cultivars was very narrow (Scorza et al.
1985), which was later confirmed with molecular markers not only for these materials
(Aranzana et al. 2010) but for modern Asian cultivars as well (Li et al.2013). Ancient oriental
cultivars and landraces were more variable and could be a source of variability for peach
breeding programs (Li et al.2013). Another source of new genetic variability exists in close
relatives of peach such as P. dulcis, P. davidiana, P. kansuensis and P. ferganensis, where
interspecific hybridization is possible and crosses with peach have been used for rootstock
development, and for introgression of novel traits (Gradziel 2003; Foulongne et al. 2003a).
Linkage drag, enhanced by suppression of recombination, low fertility, and the long time
usually required to recover an elite genotype from an interspecific or wide cross, have limited
the adoption of this strategy in peach breeding programs.
An almond x peach progeny was developed at IRTA to develop a Prunus genetic map that later
on became the Prunus reference map (Dirlewanger et al. 2004). The high polymorphism of this
population facilitated the construction of this map and provided the scientific community with
a common terminology and orientation for linkage groups and a large set of transferable
markers that were used as anchors for constructing other maps (Arús et al. 2012) and to align
the physical map assembled for the construction of the whole genome sequence (Verde et al.
2013).
QTL analysis of biparental populations, mainly F1 or F2 populations, has been widely used in
Prunus and the number of published major genes and QTLs has doubled since 2011 with a total
of 760 loci (670 QTLs) for 110 agronomic traits identified (Salazar et al. 2014). In spite of this
high number of QTLs none of them has been already cloned, due in part to the size and
populations types used in these studies. For this reason the development of experimental
populations particularly designed for high quality phenotyping and genetic studies, such as
near-isogenic lines (NILs), is needed for QTL dissection and fine mapping (Eshed and Zamir
1995; Eduardo et al. 2005; Xu et al. 2010).
68
In this work we developed and analyzed two interspecific populations between almond and
peach with the objectives of understanding the genetic variability of 42 traits, exploring
possible alleles from almond that could be introgressed in peach commercial cultivars, and to
generate the basic plant materials to construct a collection of NILs of almond in the peach
background.
4.2 MATERIALS AND METHODS
4.2.1 Plant material
In this work we used two interespecific populations. The first one is an F2 of 111 individuals
named TxE, obtained by selfing the F1 hybrid called ‘MB 1.37’, a cross between the almond
‘Texas’ and the peach ‘Earlygold’. This progeny includes the 80 individuals used to develop the
reference map of Prunus (Joobeur et al., 1998) plus 31 additional plants that allow improving
its resolution for genetic studies. We obtained data for at least one trait for 88 individuals. The
trees of TxE used for this research are kept at the IRTA Center of Cabrils and the Experimental
Station of Lleida in Gimenells (Spain) grafted on ‘Garnem’ rootstocks. A BC1 population (T1E) of
185 individuals was created from the cross ‘MB 1.37’ × ‘Earlygold’. We obtained data for at
least one trait for 178 individuals. Original trees of T1E were planted on their own roots in
Cabrils, and grafted plants on ‘Garnem’ were located in the fields of Gimenells. In Cabrils
spacing within and between rows was and 1.0 x 4.0m for T1E and 2.0 x 4.0 for TxE and in
Gimenells was of 1.5 x 3.5m for both populations. Standard cultural practices were applied in
both locations but trees were not thinned.
4.2.2 Phenotyping
The TxE population was evaluated for 40 traits in one location (Gimenells) during three years
(2011, 2012, and 2013). The T1E population was evaluated for the same 40 traits plus the
juvenility period and leaf fall date, in two locations (Cabrils and Gimenells) during three years
(2011, 2012, and 2013). The exceptions were for leaf fall, juvenility and powdery mildew
resistance that were only evaluated in Cabrils, and blooming density and phenology traits that
were not evaluated in Gimenells in 2011. The 42 traits have been divided into families of traits
and are described below.
69
Flower traits: Flower type (Sh): the typology showy/non-showy was described originally by
Connors (1920) as a major gene in peach. Showy flowers are determined by the recessive allele
(sh) and present large petals. Non-showy flowers show small petals, with anthers emerging
from the corolla before full anthesis. Anther color (Ag and Ag2) was scored as anthocyanic
anther or yellow anther in TxE. Given that certain individuals initially scored as yellow had
antocyanic spots when observed at the binocular lens, all yellow phenotypes were reexamined
with the binocular and re-phenotyped before final scoring of its phenotype. The Ag gene was
previously described as a single gene in the TxE population and mapped to linkage group 3
(G3) by Joobeur (1998), where the yellow anther was determined by the recessive homozygote
agag. T1E individuals segregated for orange and red anthers, but none of them had yellow
anthers. Flower color (Fc2) was classified as pink or pale pink. Pistil length (PiL) was scored as
very short (1), very short and medium size (2) and normal (3). The blooming density (BD) was
scored in a scale from 1 to 5 (1: low; 2: low-medium; 3: medium; 4: medium-high and 5: high).
Phenology traits: Beginning of shooting (BS) was scored as the number of Julian days at the
moment when 5% of shoots were in expansion. Beginning of flowering time (BFT) and End of
flowering time (EFT) were scored as the number of Julian days when a 5% and a 95% of flowers
were open, respectively. Flowering duration (FD) was obtained by the difference between
beginning and end of flowering. Fruit production (FP) was scored in a scale from 1 to 4 (1: no
fruits, 2: less than 10 fruits, 3: 10 to 50 fruits, 4: more than 50 fruits). Maturity date (MD) was
scored as the number of Julian days when 50% of the fruits were considered mature based on
visual color change and manual evaluation of firmness. Fruit development period (FDP) was
obtained as the difference between scores of end of flowering and maturity date. Leaf fall (LF)
was scored as the number of Julian days when 95% of the leaves had dropped. The juvenility
period (Juv) was scored as the number of years necessary to produce the first fruits after
planting.
Fruit traits: Fruit traits were evaluated in five mature fruits of each individual. Fruit type (Ft)
was scored in the TxE population as peach type or almond type depending on the
development of a fleshy mesocarp and a change of external or internal fruit color. In T1E all
the fruits were peach type. Juiciness (Jui) was scored as the capacity of producing juice (1) or
not (2). Blood flesh (Bf2) was scored as presence (2) or absence (1) of red flesh color. The
intensity of the red skin color (ISC) was scored as 1 (light red), 2 (dark red), 3 (dark-violet red)
or 4 (violet). Fruit skin color was scored as the percentage of surface covered by anthocyanin
coloration (PSC) according to the following scale: 1 = 0-25%, 2 = 25-50%, 3 = 50-75%, 4 = 75-
70
100%. Soluble solid content (SSC) was scored as Brix degrees by applying a drop of fruit juice in
a digital refractometer PAL-1 (Atago, Tokyo, Japan). For titratable acidity (TA) evaluation, two
slides from each fruit were cut and stored at -20 ºC until their evaluation. TA was determined
as g/l by titrating 10 ml of distilled water and 10 ml of the unfrozen fruit juice or fruit paste
with 0.1 N NaOH to pH 8.2. Other traits scored were: fruit weight (FW) and stone weight (SW)
as the average of the fruit and stone weight from the five fruits scored, and flesh weight (FlW)
as the difference FW-SW, all expressed in g. Characters to measure fruit shape were (see
Figure 10): fruit polar diameter (FpD), fruit cheek diameter (FcD), fruit suture diameter (FsD),
stone polar diameter (SpD), stone cheek diameter (ScD), stone suture diameter (SsD), flesh
polar diameter (FlpD), flesh cheek diameter (FlcD) and flesh suture diameter (FlsD), all
expressed in cm. Flesh diameters were obtained as the difference between FpD-SpD, FcD-ScD
and FsD-SsD respectively.
Leaf traits: each year eight leaves of each tree were collected in July. To minimize leaf variation
in each tree, leaves were collected from the middle of sun exposed branches, with medium
vigour and at the level of human height. Leaves were scanned and images were saved as jpeg
files and imported into Tomato Analyzer 3.0 for automated phenotypic measurements
(http://www.oardc.ohio-state.edu/vanderknaap). The analyzed parameters were: leaf
perimeter (LP), leaf surface (LS), leaf blade width (LBW), leaf length (LL), leaf blade length
(LBL), and petiole length (PL) as the difference LL-LBL. The units from these traits were
expressed in pixels. Subsequently, the leaves were dried for 3 days at 60 °C and were weighed,
to obtain the average leaf dry weight (LW) in g. A drawing of the leaf dimensions measured is
presented in Figure 1. Chlorophyll content (CC) was measured with a SPAD-502 device (Konica
Minolta, Osaka, Japan) that emits two wavelengths (650 and 940 nm), and the final
measurement of chlorophyll content is the ratio between the two intensities of light after
passing through each leaf.
Disease resistance: Powdery mildew resistance (Vr3) was characterized as the presence or
absence of the disease in both populations by natural exposure. The trees were not treated
during the years that this trait was evaluated (2011 to 2013). Trees that were affected at least
in one year were considered as susceptible.
71
4.2.3 Phenotypic data analysis
Statistical analyses were performed using JMP 8.0 software (SAS Institute, Cary, NC, USA). The
distribution for each trait was represented in frequency histograms. Correlations between
different traits and years were calculated using the Pearson correlation coefficient. The
normality of each trait was tested with the Shapiro-Wilk test (Shapiro 1965). The histograms
were drawn using R 3.1.0 software (http://cran.r-project.org/bin/windows/base/).
Figure 10. Scheme of a) fruit, stone and b) leaf dimensions.
4.2.4 Genetic linkage maps and QTL analysis
For linkage analysis we used the data from the 9k IPGI SNP Illumina Infinium chip (Verde et al.
2012) in 50 plants of the TxE population and 123 plants of the T1E population. In addition we
mapped 131 SSRs covering the whole genome in 88 and 178 plants of TxE and T1E,
respectively. Maps were constructed with these markers (see Chapter 3) using MapMaker/Exp
3.0 (Lincoln et al. 1992) and coalesced in the eight expected linkage groups. The TxE map used
contained 1,948 markers (114 SSRs and 1,834 SNPs) and covered a total distance of 472.1 cM,
and the T1E population was used to construct two maps, one with the markers heterozygous
in the female parent, the MB1.37 hybrid plant (the T1E map) that contained 2,031 markers
(113 SSRs and 1,919 SNPs) and spanned 370.1 cM and the map obtained with the male
‘Earlygold’ parent (the E map) with 1,091 markers (40 SSRs and 1,050 SNPs). Most of the
72
markers (>92%) of T1E and TxE are in common and >43% of markers shared with the other two
maps.
Phenotypic characters behaving as simple Mendelian factors were mapped as individual
markers using MapMaker v3.0. These were: flower color (Fc2), anther color (Ag2), juiciness
(Jui), blood flesh (Bf2) and powdery mildew resistance (Vr3) were mapped as phenotypic
markers in the T1E map, Flower shape (Sh) in the E map and Anther color (Ag), Fruit type (Ft)
and Powdery mildew resistance (Vr3) in TxE map. Linkage group terminology was the one
coined for the TxE Prunus reference map (Dirlewanger et al. 2004).
The remaining characters were subject to QTL analysis using the interval mapping method with
the mapQTL 4.0 software package (Van Ooijen et al. 2002). QTLs with a LOD score greater or
equal to 3.0 were declared significant. When a QTL with a LOD value of 2.5 or higher was
consistent with other years in the same trait, with criteria of LOD 3.0 or more, also was
considered significant. Maps and QTL positions were drawn using the MapChart 2.1 software
(Voorrips, 2002). We considered a QTL as consistent if it was detected all the years in at least
one of the locations, having overlapping confidence intervals (those established with two LOD
score unit below the maximum for each specific QTL). Major QTLs were those that were
consistent and explained at least 20% of the phenotypic variance for any of the years, locations
and populations that were studied. In TxE gene action was estimated based on the ratio (d/a)
between the additive (a; (A+B/2)) and dominance (d; H-((A+B)/2)) effects and they were
classified as underdominant (U; >-1.25 ), dominant for peach allele (D; -1.25 to -0.75), partial
dominant for peach allele (AD; -0.75 to -0.25 ), additive (A; -0.25 to 0.25 ), partial dominant for
almond allele (D; 0.25 to 0.75 ), dominant for almond allele (D; 0.75 to 1.25 ) and
overdominant (O; >1.25 ).
4.3 RESULTS
4.3.1 Trait distributions and correlations
The TxE and T1E populations segregated for many characters as shown in Figure 11. The 42
traits evaluated were classified in five groups: five of flower, nine of phenology, 19 of fruit,
eight of leaf and one disease resistance. Eight of these characters could be analyzed as
Mendelian genes and the remaining 35 were considered quantitative. Graphs with the
phenotype including distributions of the progenies and data from the parents are in Annex 2
73
and 3 TxE and T1E respectively. Pictures of flowers, fruits, stones and leaves of the parentals
and some individuals of their progenies are presented as Annex 4. Variability for most
characters was very large, particularly in the TxE population. The hybrid individual MB1.37
presented intermediate values between T and E in certain traits as in blooming density,
maturity date, fruit weight and dimensions and petiole length, but had higher values than the
two parents as in fruit and stone polar diameter, or similar values than ‘Texas’ (leaf length) or
‘Earlygold’ (fruit and stone suture and cheek diameters).
Transgressive segregation was observed in both populations for most traits, except for
maturity date, fruit development period and fruit weight. The histograms of all traits evaluated
in both populations are available in Annex 5. Fruit dimensions, SSC and leaf morphology (only
in TxE) presented a normal distribution. On the other hand, pistil size, blooming density, most
phenological traits, TA, intensity and percentage of skin color, and stone weight did not fit a
normal distribution. Chlorophyll content in TxE presented a normal distribution but no in T1E.
Leaf morphology characters in T1E did not present a clear pattern because it depended on the
year and location. For example, leaf perimeter presented a normal distribution in both places
during 2013 but not during 2012 and petiole length presented a normal distribution in
Gimenells in both years but in Cabrils normality only occurred in 2013.
Correlations between years and locations were significant (p<0.01) for all traits except for TA in
2011 in TxE (Annex 6) and for flowering duration and chlorophyll content in 2012 in T1E
(Annex 7). Flowering duration also showed the lowest correlations between years in TxE with a
value of 0.34. Maturity date showed the highest correlation values between years and
locations ranging from 0.79 to 0.93 in T1E and from 0.95 to 0.97 in TxE. Other traits that
presented high correlations between years and locations in T1E were intensity of skin color,
presenting a range between 0.54 and 0.81, and beginning of flowering time, with a range
between 0.53 and 0.78.
Blooming density, beginning of shooting, flowering duration, SSC, TA, chlorophyll content, and
juvenility were not correlated with any trait in TxE and T1E. A high correlation was found
between pistil size and fruit production in TxE (0.79) and in T1E (0.29). MD and FDP were
highly correlated in both populations, but in T1E were not correlated with other traits whereas
in TxE were negatively correlated with fruit and flesh weight, fruit dimensions and blood flesh,
indicating that earlier fruits were bigger.
74
In TxE fruit weight was correlated with all the fruit dimension parameters and the same
occurred between stone weight and stone dimensions, but fruit and stone parameters were
not correlated. This pattern was not as clear in T1E where fruit and stone weight were
correlated with other fruit and stone dimension traits in some years and locations but not in
others.
Figure 11. Images of the fruits fromTexas, MB1.37, Earlygold and some individuals from TxE and T1E progenies.
Most leaf traits in T1E (leaf surface, leaf perimeters, leaf length, leaf blade length, leaf blade
with and leaf weight) showed high correlations between them in each location, ranging from
TxEfruits
T1E fruits
75
0.71 to 0.98 and 0.75 to 0.98 in Cabrils and from 0.60 to 0.97 and 0.66 to 0.98 in Gimenells the
years 2012 and 2013, respectively. However, a low level of correlation was observed between
locations ranging from to 0.15 to 0.44. This could indicate a location effect for this trait. The
same phenomenon was observed in TxE.
4.3.2 Mapping Mendelian traits
Seven of these characters were treated qualitatively and eight Mendelian genes could be
mapped in the three maps constructed (Table 6), four (Fc2, Ag2, Jui, Bf2) in the T1E map, one
(Sh) in the E map, two (Ag and Ft) in the TxE map and one (Vr3) in both T1E and TxE. One of
these characters, anther color, produced information on two genes, one mapped in TxE (Ag)
and the other in T1E (Ag2). All characters had segregation ratios as expected under the single-
gene hypothesis except for Fc2 and Vr3 (only in TxE) that had an excess of individuals with pink
anthers and resistant, respectively (Table 6). Six of these genes are described for the first time:
Fc2, for flower color, another gene Fc was described previously by Yamamoto et al. (2001) but
mapped to a different position in G3; Vr3 is a new gene for powdery mildew resistance
mapping at a different position than those described before, one in G6 (Vr2; Pascal et al. 2010)
and several QTLs in G7 (Verde et al. 2002; Pacheco et al. 2009), G6 and G8 (Foulogne et al.
2003b).
Table 6. Segregation of single genes mapped in this study.
a In parenthesis predicted genotype. b*Significant (P≤ 0.05), **Significant (P≤ 0.01).
Flower
typeSh/sh
showy
(sh/sh )
non showy
(Sh/sh )
showy
(sh/sh )E 1:1
showy
(n=76)
non showy
(n=79)0,06
Flower
color 2Fc2/fc2
white
(fc2/fc2 )
reddish
(Fc2/Fc2 )
pale pink
(Fc2/fc2 )T1E 1:1
pale pink
(n=61)
reddish
(n=92)6,28*
Anther
colorAg/ag
yellow
(ag/ag )
red
(Ag/Ag )
anthocyanic
(Ag/ag )TxE 1:3
anthocyanic
(n=71)
yellow
(n=21)0,10
Anther
color 2Ag2/ag2
yellow
(ag2/ag2 )
red
(Ag2/Ag2 )
anthocyanic
(Ag2/ag2 )T1E 1:1
red
(n=57)
orange
(n=48)0,77
Fruit
typeFt/ft
almond
(ft/ft )
peach
(Ft/Ft )
peach
(Ft/ft )TxE 1:3
almond
(n= 11)
peach
(n= 29 )0,13
Juiciness Jui/juinon juicy
(Jui/ - )
juicy
(jui/jui )
non juicy
(Jui/jui )T1E 1:1
juicy
(n=65)
non juicy
(n=64)0,08
Blood
flesh 2Bf2/bf2
unknown
(Bf2/- )
yellow
(bf2/bf2 )
red
(Bf2/bf 2)T1E 1:1
red
(n=73)
yellow
(n=57)1,97
TxE 3:1resistant
(n=75)
susceptible
(n=9) 9,06**
T1E 1:1resistant
(n=75)
susceptible
(n=84)0,51
PopulationExpected
segregationObserved segregation X2 b
Resistance
Powdery
mildew
Vr3/vr3resistant
(Vr3/ -)
susceptible
(vr3/vr3 )
resistant
(Vr3/vr3 )
Trait Symbol Texasa Earlygolda F1a
76
In total, six new monogenic traits (Fc2, Ag2, Bf2, Jui, Ft, Vr3) have been positioned in the
Prunus genome and other two (Ag and Sh) that were already mapped have been further
defined.
Four of these genes affect flower traits. The flower type (Sh) character (showy/non Showy) was
located in the E map on G8 co-segregating with the CPPCT006 SSR marker (8: 13659021),
between SNP markers SNP_IGA_863252 (8: 13459205) and SNP_IGA_ 864149 (8: 13756987),
spanning a region of 1.4 cM (0.30 Mb). Sh was previously mapped by Ogundiwin et al. (2009)
between markers CPPCT006 (8: 13659021) and Unk5 (8: 17336781) and Eduardo et al. (2011)
mapped it cosegregating with the ssrPaCITA15 (8: 13322647). An anther color (Ag) gene has
been mapped as a morphological marker in TxE on G3, between the markers SNP_IGA_322925
(3: 9071075) and SNP_IGA_344789 (3: 13891040), in a region of 1.7 cM (4.82 Mb). In previous
maps of the same population it colocalised with the CC2 (3: 12231238) marker (Joobeur 1998),
between markers AG57A (9259448) and CPDCT008 (10023959) in an interval of 1.8 cM (0.76
Mb). Another anther color gene (Ag2) has been mapped in G1 of T1E. Its position was between
markers SNP_IGA_82861 (1: 23722082) and SNP_IGA_86918 (1:25642323), in a region of 3 cM
(1.92 Mb). A flower color gene (Fc) was previously mapped to G3 by Yamamoto et al. (2001),
whereas the gene that we have found in T1E (Fc2) maps on G4 of T1E between the markers
pchgms2 (4: 2086474) and SNP_IGA_381287 (4: 2299484), in a region of 3.5 cM (0.21 Mb).
While color variability was observed in the TxE population, we were not able to identify a clear
color pattern that allowed a qualitative classification.
Three more genes affected fruit traits. The first one is the almond vs. peach-like fruit that we
termed as fruit type (Ft) that has been located in the TxE map on G4, between the markers
SNP_IGA_410955 (4: 10898535) and BPPCT015 (4: 12546880), in a region of 2 cM (1.65 Mb).
This trait was not segregating in T1E which was expected given that the allele that confers the
almond type (ft) is recessive. The other two major genes for fruit traits segregated in T1E and
were the Juiciness (Jui) gene that mapped between the markers SNP_IGA_107095 (1:
34224252) and SNP_IGA_107417 (1: 34424837) spanning a region of 1.4 cM (0.20 Mb), and the
blood flesh (Bf2) gene that was mapped on G1, between the markers CPPCT029 (1: 40195426)
and SNP_IGA_123023 (1: 41781710) spanning a region of 1.4 cM (1.58 Mb). For Jui the
dominant allele was that carried by peach that determines juicy fruit, whereas for Bf2, red
color is dominant and was provided by the almond parent. Other two genes of similar
characteristics, Bf and DBF, were described for blood flesh by Shen et al. (2013). They mapped
to G4 and G5 respectively.
77
Finally, the gene of resistance to Powdery mildew (Vr3) was mapped in both populations in the
same position in G2 between the markers CPDCT044 (2:14069755) and BPPCT004
(2:18671271) in T1E and between CPDCT044 and SNP_IGA_260361 (2: 14773178) in TxE.
Although this trait was evaluated using the natural inoculum in the field data were very
consistent between the different years evaluated.
4.3.3 QTL analysis
Considering all years, locations and the three maps analyzed, a total of 336 QTLs were
detected in the three maps: 238 in the T1E map, 12 in the E map and 86 in the TxE map (Annex
8). QTLs were identified in the 35 quantitative traits studied, varying between one and four
QTLs for each trait. Considering only the consistent QTLs, we found 196 (Figure 12): 145 in the
T1E map, 7 in the E map and 44 in the TxE map, representing 58.3% of total QTLs detected. For
some traits, as maturity date or petiole length, most of the QTLs detected were consistent,
while in others, as SSC, TA, and flowering duration none of the QTLs detected was consistent.
Considering consistent QTLs from different years, locations and populations mapping in
overlapping map regions as the same QTL, the final number of unique QTLs detected was 64:
43 in the T1E map, 2 in the E map and 19 in the TxE map (Table 7 and Figure 13). We will
describe the consistent QTLs in next sections.
4.3.3.1 Flower traits
For pistil length a major QTL explaining a 74.4% of the phenotypic variance was detected in TxE
on G6 (qP-PiL6), close to the CPPCT030 marker. In T1E, two minor QTLs were detected, one on
G1 (qP-PiL1) and another on the central part of G4 (qP-PiL4). These QTLs explained between
8.4 and 17.8% of the phenotypic variance respectively. For blooming density a major QTL was
detected in T1E, at the end of G1, and only in Gimenells (qP-BD1) explaining around 23.8-
25.7% of the phenotypic variance. No QTLs were detected for this character in the TxE
population.
78
Table 7. Summary of consistent QTLs identified in this study using the TxE and T1E progenies, including trait name, location, population where it was identified, QTL name (according to the GDR recommendations), year when phenotypic data was obtained, LOD score of the maximum peak, nearest marker, position of the maximum peak, and parameters for genic action estimation (a, d, d/a) and gene action.
QTLs Flower
Trait Location Population QTL
name Year LOD Nearest marker
Position (cM)
R2 a
a d d / a
Genic action
b
Pistil length Cabrils -
Gimenells
T1E qP-PiL1 2011-2013 3,05 SNP_IGA_107417 39,4 8,4 -0,29
qP-PiL4 7,13 CPDCT045 24,7 18,4 0,47
TE qP-PiL6 2011-2013 25,44 CPPCT030 76,2 74,4 0,28 1,21 4,39 O
Blooming density
Gimenells T1E qP-BD1 2012 6,70 CPPCT029 49,2 25,7 1,14
qP-BD1 2013 7,54 SNP_IGA_109897 42,2 23,8 1,23
QTLs Phenology
Trait Location Population QTL
name Year LOD Nearest marker
Position (cM)
R2 a
a d d / a
Genic action
b
Beginning of shooting
Cabrils
T1E qP-BS8 2011 3,93 CPPCT006 13,7 10,8 3,54
qP-BS8 2012 4,38 SNP_IGA_803758 7,0 12,7 2,84
qP-BS8 2013 3,75 SNP_IGA_796755 1,6 11,6 4,93
Gimenells
T1E qP-BS2 2012 3,61 SNP_IGA_144919 3,8 12,1 2,38
qP-BS2 2013 4,54 CPSCT044 19,0 13,5 1,97
qP-BS8 2012 2,55 SNP_IGA_802339 6,2 8,6 2,02
Gimenells TE qP-BS6 2012 3,14 SNP_IGA_694098 74,4 16,6 -0,73 2,81 -3,85 U
qP-BS6 2013 2,53 CPPCT030 76,2 13,4 -1,47 3,57 -2,43 U
Cabrils
E qP-BS7 2011 4,24 SNP_IGA_779386 41,4 12,1 3,73
qP-BS7 2012 7,51 SNP_IGA_779386 41,4 21,8 3,72
qP-BS7 2013 8,13 SNP_IGA_779386 41,4 23,5 7,03
Gimenells E qP-BS7 2012 3,28 SNP_IGA_781455 45,3 11,0 2,30
Begining of flowering
Time
Cabrils
T1E qP-BFT2 2011 2,77 SNP_IGA_288668 47,3 9,1 -2,94
qP-BFT8
3,63 SNP_IGA_802339 6,2 11,5 3,26
qP-BFT1 2012 4,27 SNP_IGA_99943 28,4 12,3 -3,06
qP-BFT8
5,66 SNP_IGA_803758 7,0 16,0 3,48
qP-BFT1 2013 3,95 SNP_IGA_31646 14,3 12,4 -6,52
qP-BFT8 4,02 SNP_IGA_796755 1,6 12,7 6,4
Gimenells
T1E qP-BFT1 2012 8,62 SNP_IGA_109897 42,2 26,3 -3,31
qP-BFT2
3,14 pchgms1 28,6 10,5 -2,07
qP-BFT1 2013 6,39 SNP_IGA_101331 31,4 19,1 -2,82
qP-BFT2
2,86 CPPCT044 7,5 9,0 -1,94
Gimenells TE qP-BFT1 2012 4,47 CPPCT010 80,1 23,8 -2,12 0,10 -0,05 A
qP-BFT1 2013 3,68 CPPCT010 80,1 19,8 -2,32 0,56 -0,24 A
End of flowering
time
Cabrils
T1E qP-EFT8 2011 3,08 SNP_IGA_796755 1,6 12,1 3,42
qP-EFT1 2012 4,53 SNP_IGA_91583 23,3 13,1 -2,95
qP-EFT8
4,63 CPSCT018 0,0 13,3 2,96
qP-EFT1 2013 6,70 SNP_IGA_96232 24,8 20,6 -6,45
qP-EFT8 5,44 SNP_IGA_796755 1,6 17,0 5,86
Gimenells T1E qP-EFT1 2012 6,79 SNP_IGA_10635 4,1 23,3 -2,42
qP-EFT1 2013 6,37 SNP_IGA_91583 23,3 19,8 -3,37
Cabrils
E qP-EFT7 2011 3,62 SNP_IGA_776994 36,8 13,6 3,61
qP-EFT7 2012 4,65 SNP_IGA_778138 40,8 14,3 3,07
qP-EFT7 2013 2,50 SNP_IGA_776994 36,8 8,9 4,24
Fruit production
Cabrils - Gimenells
T1E qP-FP6 2011-2013 13,94 SNP_IGA_683956 30,6 33,3 1,19
Gimenells TE qP-FP6 2011-2013 11,39 CPPCT030 76,2 45,7 0,36 1,21 3,40 O
79
QTLs Phenology (continued)
Maturity date
Cabrils
T1E qP-MD4 2011 8,16 SNP_IGA_413115 36,1 44,8 30,99
qP-MD4 2012 12,06 SNP_IGA_409167 31,6 35,9 29,38
qP-MD4 2013 4,47 SNP_IGA_412662 34,3 32,9 17,67
Gimenells
T1E qP-MD4 2011 10,91 SNP_IGA_420316 40,6 57,9 40,01
qP-MD4 2012 11,81 SNP_IGA_413115 36,1 43,1 32,08
qP-MD4 2013 9,71 EPPCU2000 37,0 44,9 33,49
Gimenells
TE qP-MD4 2011 10,05 SNP_IGA_413115 35,2 81,9 45,31 -2,79 -0,06 A
qP-MD4 2012 11,41 SNP_IGA_412380 34,3 77,7 36,71 1,02 0,03 A
qP-MD4 2013 9,28 SNP_IGA_412380 34,3 76,1 37,05 4,18 0,11 A
Fruit develepment
period
Cabrils
T1E qP-FDP4 2011 6,96 SNP_IGA_413115 36,1 43,2 29,43
qP-FDP4 2012 11,36 SNP_IGA_412380 31,6 34,2 29,07
qP-FDP4 2013 3,74 SNP_IGA_412380 33,4 28,3 18,15
Gimenells T1E qP-FDP4 2012 11,89 SNP_IGA_413115 36,1 48,8 34,63
qP-FDP4 2013 9,02 EPPCU2000 37,0 43,8 33,74
Gimenells TE qP-FDP4 2012 11,52 SNP_IGA_412380 34,3 79,5 37,48 3,88 0,10 A
qP-FDP4 2013 7,91 SNP_IGA_412380 34,3 75,3 38,11 6,67 0,18 A
Leaf fall Cabrils
T1E qP-LF8 2010-2011 3,78 SNP_IGA_796755 1,6 11,1 12,2
qP-LF8 2011-2012 4,27 SNP_IGA_796755 1,6 11,3 11,95
qP-LF8 2012-2013 3,53 SNP_IGA_869040 23,1 10,7 9,68
Juvenility
period Cabrils T1E qP-Juv6 2006-2012 3,94 BPPCT025 24,1 12,6 -0,61
QTLs fruit quality
Trait Location Population QTL
name Year LOD Nearest marker
Position (cM)
R2 a
a d d / a
Genic action
b
Blood Flesh Gimenells TE qP-Bf3 2011-2013 3,95 SNP_IGA_317001 18,0 50,7 -0,50 -0,14 0,29 AR
Juiciness Gimenells TE qP-Jui1 2011-2013 2,76 SNP_IGA_129422 81,6 31,8 0,40 0,21 0,53 AR
Intensity skin color
Cabrils T1E qP-ISC1 2012 3,64 CPPCT053 48,7 17,0 0,68
qP-ISC1 2013 8,33 SNP_IGA_88751 22,6 59,9 1,40
Gimenells
T1E qP-ISC1 2011 3,38 SNP_IGA_23251 5,5 25,1 0,91
qP-ISC1 2012 6,33 SNP_IGA_91583 23,3 25,2 0,92
qP-ISC1 2013 4,61 EPPCU5331 12,2 23,3 0,83
Percentage skin color
Cabrils
T1E qP-PSC1 2011 3,16 SNP_IGA_123719 53,6 25,5 1,03
qP-PSC4
4,60 M12a 31,6 33,0 -1,13
qP-PSC1 2012 6,63 SNP_IGA_126668 52,8 30,3 0,98
qP-PSC4
2,93 SNP_IGA_412380 33,4 14,5 -0,68
qP-PSC1 2013 8,08 BPPCT028 51,2 57,9 1,52
qP-PSC4 2,50 M12a 31,6 23,5 -0,95
Gimenells
T1E qP-PSC1 2011 2,55 SNP_IGA_126668 52,8 19,9 0,88
qP-PSC1 2012 7,99 BPPCT028 51,2 30,5 1,09
qP-PSC4
6,25 M12a 31,6 24,8 -0,98
qP-PSC1 2013 3,96 SNP_IGA_123719 53,6 22,1 1,01
qP-PSC4 6,63 M12a 31,6 32,1 -1,21
Gimenells
TE qP-PSC3 2011 3,99 SNP_IGA_317001 18,2 57,6 -1,50 0,35 -0,23 A
qP-PSC3 2012 4,26 SNP_IGA_887061 24,7 41,7 -1,32 0,57 -0,43 AD
qP-PSC3 2013 3,00 SNP_IGA_321565 21,5 37,4 -1,33 1,23 -0,93 D
Fruit weight
Gimenells
T1E qP-FW6 2011 2,71 CPP21413 0,0 21,3 24,80
qP-FW6 2012 5,30 CPP21413 0,0 21,7 28,60
qP-FW6 2013 3,58 CPP21413 0,0 18,9 28,08
Gimenells
TE qP-FW4 2011 6,56 SNP_IGA_410265 31,7 66,6 -13,87 24,80 -1,79 U
qP-FW4 2012 6,93 SNP_IGA_410265 31,7 57,2 -15,68 26,76 -1,71 U
qP-FW4 2013 4,65 SNP_IGA_410265 31,7 48,5 -10,73 33,94 -3,16 U
80
QTLs fruit quality (continued)
Stone weight
Cabrils T1E qP-SW6 2011 3,61 SNP_IGA_682735 28,8 28,1 2,78
qP-SW6 2012 9,35 CPPCT047 27,6 37,4 2,98
Gimenells
T1E qP-SW6 2011 4,90 CPPCT047 27,6 37,5 3,44
qP-SW6 2012 8,99 CPPCT047 27,6 35,3 3,32
qP-SW6 2013 7,84 CPPCT047 27,6 37,1 3,82
Flesh weight
Gimenells
T1E qP-FlW7 2011 3,34 SNP_IGA_790122 38,3 27,5 -25,17
qP-FlW7 2012 2,88 SNP_IGA_769687 13,9 13,3 -21,03
qP-FlW7 2013 2,86 CPPCT047 18,0 16,3 -24,75
Gimenells
TE qP-FlW4 2011 6,56 SNP_IGA_410265 31,7 66,6 -13,40 23,94 -1,79 U
qP-FlW4 2012 6,70 SNP_IGA_410265 31,7 58,0 -15,60 26,35 -1,69 U
qP-FlW4 2013 4,78 SNP_IGA_410265 31,7 49,4 -10,29 31,86 -3,09 U
Fruit polar diameter
Gimenells
TE qP-FpD4 2011 5,72 SNP_IGA_410265 31,7 61,7 -0,61 0,78 -1,28 U
qP-FpD4 2012 5,62 SNP_IGA_410265 31,7 50,0 -0,47 0,79 -1,69 U
qP-FpD4 2013 2,90 SNP_IGA_410265 31,7 35,8 -0,31 0,85 -2,73 U
Fruit cheek diameter
Gimenells
T1E qP-FcD7 2011 3,31 EPPCU5176 30,6 23,4 -0,71
qP-FcD7 2012 3,56 SNP_IGA_769687 13,9 15,5 -0,55
qP-FcD7 2013 3,66 CPPCT057 18,0 20,3 -0,61
Gimenells
TE qP-FcD4 2011 7,94 SNP_IGA_410265 31,7 73,3 -0,74 1,08 -1,45 U
qP-FcD4 2012 8,36 SNP_IGA_410265 31,7 64,0 -0,64 1,03 -1,60 U
qP-FcD4 2013 5,29 SNP_IGA_410265 31,7 55,1 -0,53 1,07 -2,01 U
Fruit suture diameter
Gimenells
TE qP-FsD4 2011 8,04 SNP_IGA_410265 31,7 73,9 -0,65 0,85 -1,31 U
qP-FsD4 2012 8,16 SNP_IGA_410265 31,7 63,2 -0,64 0,85 -1,33 U
qP-FsD4 2013 4,42 SNP_IGA_410265 31,7 48,9 -0,49 0,91 -1,87 U
Stone cheek diameter
Cabrils
T1E qP-ScD6 2011 4,14 SNP_IGA_629177 14,5 31,6 0,39
qP-ScD6 2012 7,64 SNP_IGA_680864 28,2 31,7 0,39
qP-ScD6 2013 2,77 BPPCT025 27,3 27,3 0,28
Gimenells
T1E qP-ScD6 2011 4,17 BPPCT008 16,0 34,0 0,47
qP-ScD6 2012 11,44 CPPCT047 27,6 41,3 0,46
qP-ScD6 2013 10,58 CPPCT047 27,6 46,0 0,54
Stone suture diameter
Cabrils
T1E qP-SsD6 2011 3,86 SNP_IGA_682735 28,8 30,9 0,38
qP-SsD6 2012 8,95 CPPCT047 27,6 35,8 0,39
qP-SsD6 2013 3,60 EPPCU4092 37,0 34,0 0,30
Gimenells
T1E qP-SsD6 2011 4,41 pchcms5 20,7 33,4 0,33
qP-SsD6 2012 10,24 SNP_IGA_683956 30,6 38,4 0,38
qP-SsD6 2013 10,17 SNP_IGA_683956 30,6 45,1 0,40
Flesh polar diameter
Gimenells
TE qP-FlpD4 2011 7,17 SNP_IGA_410955 33,8 69,3 -0,60 0,63 -1,05 D
qP-FlpD4 2012 8,25 EPPCU2000 36,9 65,2 -0,62 0,56 -0,90 D
qP-FlpD4 2013 4,54 SNP_IGA_410955 32,2 49,1 -0,36 0,62 -1,72 U
Flesh cheek diameter
Gimenells
TE qP-FlcD4 2011 8,67 SNP_IGA_412380 34,3 77,5 -0,88 1,02 -1,17 D
qP-FlcD4 2012 8,28 SNP_IGA_410955 32,6 66,5 -0,60 1,01 -1,67 U
qP-FlcD4 2013 5,78 SNP_IGA_410265 31,7 58,1 -0,46 0,84 -1,82 U
Flesh suture diameter
Gimenells
TE qP-FlsD4 2011 8,18 SNP_IGA_412380 34,3 76,9 -0,75 0,84 -1,12 D
qP-FlsD4 2012 7,72 SNP_IGA_412380 34,3 63,2 -0,58 0,78 -1,36 U
qP-FlsD4 2013 4,12 SNP_IGA_410265 31,7 46,5 -0,43 0,78 -1,83 U
QTLs Leaf
Trait Location Population QTL
name Year LOD Nearest marker
Position (cM)
R2 a
a d d / a
Genic action
b
Leaf perimeter
Cabrils
T1E qP-LP1 2012 5,02 CPPCT004 7,9 16,9 -353,18
qP-LP1 2013 7,14 CPPCT004 7,9 23,4 -393,61
qP-LP8 5,10 SNP_IGA_799291 3,1 16,7 326,32
Gimenells
T1E qP-LP8 2012 4,12 SNP_IGA_795756 0,8 13,1 215,69
qP-LP1 2013 2,79 CPPCT004 7,9 9,0 -177,85
qP-LP8 5,70 SNP_IGA_796755 1,6 17,0 243,57
81
QTLs Leaf (continued)
Leaf surface
Cabrils
T1E qP-LS1 2012 5,57 SNP_IGA_9197 3,4 20,4 -48,85
qP-LS1 2013 6,77 SNP_IGA_23351 5,5 21,8 -71,49
qP-LS7
3,04 CPPCT017 39,1 10,3 46,57
qP-LS8 3,50 SNP_IGA_800634 4,7 11,8 50,41
Gimenells
T1E qP-LS7 2012 3,30 EPDCU3392 41,9 10,7 33,27
qP-LS8
3,35 SNP_IGA_795756 0,8 10,8 33,74
qP-LS1 2013 3,71 SNP_IGA_2651 0,0 11,5 -35,53
qP-LS7
2,82 EPPCU5176 30,6 8,8 30,83
qP-LS8 3,99 SNP_IGA_796755 1,6 12,2 36,60
Leaf blade width
Cabrils
T1E qP-LBW1 2012 2,74 SNP_IGA_2651 0,0 9,5 -23,32
qP-LBW6
3,10 pchcms5 20,7 10,6 23,68
qP-LBW1 2013 4,21 EPDCU3122 0,8 13,8 -35,36
qP-LBW6 4,57 BPPCT025 24,1 14,9 34,91
Gimenells T1E qP-LBW1 2013 3,14 SNP_IGA_2651 0,0 9,8 -21,64
qP-LBW6 4,63 pchcms5 20,7 14,0 25,66
Leaf length
Cabrils
T1E qP-LL1 2012 7,35 CPPCT004 7,9 26,4 -149,18
qP-LL1 2013 6,40 CPPCT004 7,9 21,3 -165,32
qP-LL8 5,45 SNP_IGA_799291 3,1 17,7 146,99
Gimenells T1E qP-LL8 2012 4,01 SNP_IGA_795756 0,8 12,8 87,39
qP-LL8 2013 5,68 SNP_IGA_796755 1,6 17 100,44
Leaf blade length
Cabrils
T1E qP-LBL1 2012 7,91 CPPCT004 7,9 25,3 -133,56
qP-LBL1 2013 8,05 CPPCT004 7,9 25,9 -167,89
qP-LBL8 4,13 SNP_IGA_799291 3,1 13,8 119,29
Gimenells
T1E qP-LBL8 2012 3,47 SNP_IGA_795756 0,8 11,4 76,11
qP-LBL1 2013 2,78 CPPCT004 7,9 8,9 -71,43
qP-LBL8 4,27 SNP_IGA_796755 1,6 13,0 85,91
Petiole length
Cabrils
T1E qP-PL5 2012 4,13 SNP_IGA_598784 27,4 13,8 20,22
qP-PL6
3,37 MA14a 34,9 11,4 18,39
qP-PL7
2,68 MA20a 25,8 9,2 16,53
qP-PL8
4,48 SNP_IGA_859354 12,2 14,9 21,25
qP-PL5 2013 3,44 SNP_IGA_590546 13,5 11,6 18,15
qP-PL6
4,10 MA14a 34,9 13,5 19,63
qP-PL7
4,16 CPPCT033 24,1 13,8 19,79
qP-PL8 13,61 SNP_IGA_870509 28,3 39 34,07
Gimenells
T1E qP-PL5 2012 2,66 SNP_IGA_590546 13,5 8,9 15,34
qP-PL7
3,12 PMS02 27,9 10,3 16,55
qP-PL8
6,78 SNP_IGA_869040 23,1 22,6 25,47
qP-PL5 2013 3,94 SNP_IGA_589750 12,9 12,4 18,09
qP-PL6
2,64 MA040a 34,4 8,3 14,75
qP-PL7
3,82 CPPCT033 24,1 11,7 17,59
qP-PL8
10,61 SNP_IGA_869040 23,1 29,9 29,01
Gimenells
TE qP-PL5 2012 3,06 SNP_IGA_594745 28,3 16,7 23,73 5,68 0,24 A
qP-PL8
2,66 SNP_IGA_876610 36,3 15,0 18,74 20,10 1,07 R
qP-PL5 2013 4,83 SNP_IGA_584315 14,8 28,1 29,22 14,09 0,48 AR
qP-PL8 7,35 SNP_IGA_881120 44,8 35,8 33,09 5,94 0,18 A
Leaf weight
Cabrils
T1E qP-LW1 2012 3,89 SNP_IGA_9197 3,4 14,4 -0,06
qP-LW6
3,35 pchcms5 20,7 12,3 0,05
qP-LW1 2013 4,81 SNP_IGA_23251 5,5 15,9 -0,08
qP-LW6
3,71 pchcms5 20,7 12,3 0,06
qP-LW8 3,58 SNP_IGA_800634 4,7 11,9 0,06
Gimenells
T1E qP-LW1 2012 3,89 SNP_IGA_18927 5,5 13,5 -0,04
qP-LW6
2,83 SNP_IGA_687583 33,8 9,5 0,04
qP-LW8
4,02 CPSCT018 0,0 13,2 0,04
qP-LW1 2013 3,59 SNP_IGA_17419 4,8 11,3 -0,04
qP-LW8 6,21 SNP_IGA_796755 1,6 18,4 0,06
82
QTLs Leaf (continued)
Chlorophyll content
Cabrils
T1E qP-CC6 2011 5,27 SNP_IGA_695974 42,0 14,5 -4,09
qP-CC6 2012 5,40 CPPCT021 43,0 15,8 -3,82
qP-CC6 2013 5,35 SNP_IGA_695974 42,0 15,7 -3,49
a In TxE is ((A+B)/2), being the A the almond allele and in T1E is A-H, being A the homozygous almond allele b U: underdominant, D: dominance for peach allele; AD: partial dominance for peach allele; A: additive, AR: partial dominance for a allele; R: dominant for peach allele, O: overdominant.
4.3.3.2 Phenology traits
A total of 23 consistent QTLs (10 major QTLs) were detected for eight of the nine traits studied:
15 in T1E, two in E and six in TxE; three were in both T1E and TxE. The most significant QTLs
were for MD and FDP in both populations in the same region of G4 (qP-MD4 and qP-FDP4),
explaining from 32.9 to 81.9% of the phenotypic variance for MD and 28.3 to 79.5% for FDP. All
of them peaked between markers SNP_IGA_409167 and SNP_IGA_420306. The presence of
the almond allele in this locus in T1E population increases the MD in an average of 32 days. In
TxE the almond allele present an additive effect that increases MD in an average of 42 days.
Consistent QTLs for beginning of flowering time were identified in G1, G2 and G8 in T1E and
only in G1 in TxE. The QTL (qP-BF1) located in T1E and TxE at the beginning of G1 was
identified in all the datasets except in Cabrils in 2011. These QTL explained 19.1-26.3% of the
phenotypic variance in Gimenells and around the 12% in Cabrils. The second QTL (qP-BFT2),
located at the beginning of G2, was identified in T1E both years in Gimenells and only in 2011
in Cabrils. The third QTL was located in G8 (qP-BFT8) and was detected in Cabrils but not in
Gimenells and explained 11.5 and 16.0% of the phenotypic variance. In TxE the major QTL
identified for BFT in G1 explained 19.8-23.8% of the phenotypic variance and in T1E 13.1-
23.3%. Although in TxE is more at the beginning of the group they have overlapping regions in
some years, therefore we considered that was the same and it is called qP-BFT1. In this same
region a consistent QTL for End of flowering was identified in T1E (qP-EFT1) explaining 13.1
and 23.3% of the phenotypic variance. For end of flowering time, three QTLs were identified in
T1E, two co-localizing with those described for beginning of flowering time in G1 (qP-EFT1) and
G8 (qP-EFT1), and another in the central part of G7 found only in the Earlygold map (qP-EFT7).
For beginning of shooting, four QTLs were identified: three at similar positions than those
described before for the flowering time characters, two in G2 (qP-BS2) and G8 (qP-BS8) in T1E
and one in G7 (qP-BS7) mapped in E explaining similar proportions of the phenotypic variance
as before. A different QTL was found in G6 of TxE (qP-BS6) with R2=13.4-16.6%.
83
QTLs Flower traits
SA26510,0EPDCU31220,8SA36211,1UDP96-0181,4SA48082,1SA91973,4SA106354,1SA174194,8SA18927SA23251
5,5
CPPCT0047,9EPPCU5331SA30043PACITA005
12,2
SA3164614,3SA3222515,4SA5590316,5PceGA59SA63638
17,0
SA76912EPPCU1090UDP96-005
19,1
SA83053CPPCT003
21,2
SA8691821,9SA8875122,6SA9158323,3SA9623224,8SA9774727,7SA9994328,4SA10106529,9SA10133131,4SA101815CPPCT026
32,1
SA10281933,2SA103507EPDCU3489
35,3
SA10587838,0SA10741739,4SA10922340,1SA10961940,8SA10989742,2SA11105442,9BPPCT01643,6SA11175544,2SA11387844,8SA11489846,1CPPCT01946,7S1_3905918747,2CPPCT042EPDCU2862
47,7
SA11939148,2CPPCT053SA817857
48,7
SA120057CPPCT029
49,2
SA12174049,7SA12302350,2SA12318050,7SA133606BPPCT028
51,2
SA13285552,0SA12666852,8SA12371953,6
Pis
til-siz
e-2
011-2
013-C
-8.4
%
Blo
om
ing-d
ensity
-2012-G
-25.7
%
Blo
om
ing-d
ensity
-2013-G
-23.8
%
G1_T1EBPPCT010SA368926
0,0
SA369001EPDCU5060
1,1
SA3695311,9SA3705402,7SA3774923,5SA3790615,0pchgms27,9SA3819679,5SA38250210,1SA38267710,7SA38349213,8CPPCT011CPPCT005
14,6
SA38479115,3SA38503016,0SA38518916,7SA38608918,2SA38622218,9SA38920419,6SA39515221,1SA39368422,6SA39254923,3SA39162924,0SA395253CPDCT045
24,7
SA48435426,4SA40182928,1SA402724UDP96-003
29,5
M12a31,6SA40916732,5SA41238034,3SA41266235,2SA41311537,0EPPCU2000SA415301BPPCT015
37,9
SA41858239,1SA41976240,3SA420316UDA-021CPPCT046
41,5
SA42562243,1RC0544_09044,2SA76629844,7SA44066244,9UDA-02745,2Ps12e245,8
Pis
til-siz
e-2
011-2
013-C
-18.4
%
G4_T1E
SA6072400,0SA6070131,0SA6138482,0SA6127543,0
SA6115115,0Ps7a2SA610487
6,0
SA6096307,0SA6190818,4
SA62155611,2
SA62439116,6SA625354UDP96-001
18,7
EPPCU930019,3SA62732821,2SA62753522,3SA62985523,4SA63024324,5SA63101425,6SA63203327,8SA63242328,9SSC6_10042074BPPCT008
30,0
SA63599931,1SA63906232,2SA64163733,3SA64450234,4SA65042235,5SA65579436,6SA661965CPSCT012
37,7
SA66756342,0SA66872543,1SA66905044,2SA671806pchcms5
46,3
SA67507748,2SA67657150,1SA67714752,0SA677625BPPCT025
53,9
SA67903854,9CPPCT04755,9SA68003256,7SA68088957,5SA68273559,0SA68354659,8SA68660961,3SA68758362,1SA68810363,6SA68864364,4SA688827UDP98-412
65,2
MA040a65,7SA68995766,7AMPA130SA690792
67,7
SA69119669,0SA69162470,3MA14aSA692396
71,6
SA693239EPPCU4092
73,8
SA69409874,4SA69452175,0SA69471475,6CPPCT030SA697308
76,2
SA69761776,8SA69943277,4CPPCT02178,6
Pis
til-siz
e-2
011-2
013-C
-74.4
%
G6_TxE
Blooming density (BD)
Pistil size (PistilS)
QTLs Phenology traits
SA26510,0EPDCU31220,8SA36211,1UDP96-0181,4SA48082,1SA91973,4SA106354,1SA174194,8SA18927SA23251
5,5
CPPCT0047,9EPPCU5331SA30043PACITA005
12,2
SA3164614,3SA3222515,4SA5590316,5PceGA59SA63638
17,0
SA76912EPPCU1090UDP96-005
19,1
SA83053CPPCT003
21,2
SA8691821,9SA8875122,6SA9158323,3SA9623224,8SA9774727,7SA9994328,4SA10106529,9SA10133131,4SA101815CPPCT026
32,1
SA10281933,2SA103507EPDCU3489
35,3
SA10587838,0SA10741739,4SA10922340,1SA10961940,8SA10989742,2SA11105442,9BPPCT01643,6SA11175544,2SA11387844,8SA11489846,1CPPCT01946,7S1_3905918747,2CPPCT042EPDCU2862
47,7
SA11939148,2CPPCT053SA817857
48,7
SA120057CPPCT029
49,2
SA12174049,7SA12302350,2SA12318050,7SA133606BPPCT028
51,2
SA13285552,0SA12666852,8SA12371953,6
Be
gin
nin
g-flo
we
ring
-20
12
-C-1
2.3
%
Be
gin
nin
g-flo
we
ring
-20
13
-C-1
2.4
%
Be
gin
nin
g-flo
we
ring
-20
12
-G-2
6.3
%
Be
gin
nin
g-flo
we
ring
-20
13
-G-1
9.1
%
En
d-flo
we
ring
-20
12
-C-1
3.1
%
En
d-flo
we
ring
-20
13
-C-2
0.6
%
En
d-flo
we
ring
-20
12
-G-2
3.3
%
En
d-flo
we
ring
-20
13
-G-1
9.8
%
G1_T1E
SA2006CPPCT016
0,0
SA26510,6EPDCU3122SA3621
1,2
SA78952,2SA105203,2SA111064,2SA144385,2SA174197,1CPPCT010SA18927
8,1
SA232518,7SA24481M16a
9,3
SA2811211,9SA2829413,7SA2983615,5EPPCU533117,2PACITA00517,3SA31646CPPCT027
19,2
SA4759521,4SA6363822,8SA6713723,5SA7691224,2EPPCU109025,1UDP96-005SA78954
30,9
SA8432433,2SA8980835,5CPDCT02440,5SA9509541,5SA9623242,4EPDCU194543,3SA9896043,4SA10106544,2SA101538CPPCT026
45,0
SA103917EPDCU3489
47,8
BPPCT020SA104819
49,3
SA10600050,5SA10829951,7SA10922352,9SA11022754,1SA11041355,3SA111259BPPCT016
56,5
SA11175557,2SA11204257,9SA11227158,6SA11269859,3SA11292460,7SA11344961,4SA11409462,1SNP_1_3905918763,5SA118443CPPCT042
64,2
EPDCU286267,0CPPCT02968,6CPPCT05370,8SA12136472,6SSC1_4153528575,0SA12302376,2SA12318077,4SA133606BPPCT028
78,6
SA13285579,6SA13158980,6SA12942281,6SA12446682,6SA12371984,6
Be
gin
nin
g-flo
we
ring
-20
12
-G-2
3.8
%
Be
gin
nin
g-flo
we
ring
-20
13
-G-1
9.8
%
G1_TxE
SA26510,0EPDCU31220,8SA36211,1UDP96-0181,4SA48082,1SA91973,4SA106354,1SA174194,8SA18927SA23251
5,5
CPPCT0047,9EPPCU5331SA30043PACITA005
12,2
SA3164614,3SA3222515,4SA5590316,5PceGA59SA63638
17,0
SA76912EPPCU1090UDP96-005
19,1
SA83053CPPCT003
21,2
SA8691821,9SA8875122,6SA9158323,3SA9623224,8SA9774727,7SA9994328,4SA10106529,9SA10133131,4SA101815CPPCT026
32,1
SA10281933,2SA103507EPDCU3489
35,3
SA10587838,0SA10741739,4SA10922340,1SA10961940,8SA10989742,2SA11105442,9BPPCT01643,6SA11175544,2SA11387844,8SA11489846,1CPPCT01946,7S1_3905918747,2CPPCT042EPDCU2862
47,7
SA11939148,2CPPCT053SA817857
48,7
SA120057CPPCT029
49,2
SA12174049,7SA12302350,2SA12318050,7SA133606BPPCT028
51,2
SA13285552,0SA12666852,8SA12371953,6
Be
gin
nin
g-flo
we
ring
-20
12
-C-1
2.3
%
Be
gin
nin
g-flo
we
ring
-20
13
-C-1
2.4
%
Be
gin
nin
g-flo
we
ring
-20
12
-G-2
6.3
%
Be
gin
nin
g-flo
we
ring
-20
13
-G-1
9.1
%
En
d-flo
we
ring
-20
12
-C-1
3.1
%
En
d-flo
we
ring
-20
13
-C-2
0.6
%
En
d-flo
we
ring
-20
12
-G-2
3.3
%
En
d-flo
we
ring
-20
13
-G-1
9.8
%
G1_T1E
SA2006CPPCT016
0,0
SA26510,6EPDCU3122SA3621
1,2
SA78952,2SA105203,2SA111064,2SA144385,2SA174197,1CPPCT010SA18927
8,1
SA232518,7SA24481M16a
9,3
SA2811211,9SA2829413,7SA2983615,5EPPCU533117,2PACITA00517,3SA31646CPPCT027
19,2
SA4759521,4SA6363822,8SA6713723,5SA7691224,2EPPCU109025,1UDP96-005SA78954
30,9
SA8432433,2SA8980835,5CPDCT02440,5SA9509541,5SA9623242,4EPDCU194543,3SA9896043,4SA10106544,2SA101538CPPCT026
45,0
SA103917EPDCU3489
47,8
BPPCT020SA104819
49,3
SA10600050,5SA10829951,7SA10922352,9SA11022754,1SA11041355,3SA111259BPPCT016
56,5
SA11175557,2SA11204257,9SA11227158,6SA11269859,3SA11292460,7SA11344961,4SA11409462,1SNP_1_3905918763,5SA118443CPPCT042
64,2
EPDCU286267,0CPPCT02968,6CPPCT05370,8SA12136472,6SSC1_4153528575,0SA12302376,2SA12318077,4SA133606BPPCT028
78,6
SA13285579,6SA13158980,6SA12942281,6SA12446682,6SA12371984,6
Be
gin
nin
g-flo
we
ring
-20
12
-G-2
3.8
%
Be
gin
nin
g-flo
we
ring
-20
13
-G-1
9.8
%
G1_TxE
SA233375CPPCT044calSG2
0,0
SA2302700,7AMPA931,4SA1366252,2SA1377453,0Rf1SA144919
3,8
SA1928904,6SA198937MA024a
5,4
SA240333UDP98-025
6,5
SA2498497,0SA252287CPDCT044
7,5
BPPCT004SA263098
10,1
SA264220EPDCU4017
12,2
SA265240BPPCT001
12,7
SA26631713,4SA269074CPSCT044
17,5
SA26966018,0SA27317518,5M1aSA274867
19,6
SA27505720,6SA275481UDP96-013
21,6
SA27657122,5SA27727323,4SA27793424,3SA278061CPDCT004
25,2
UDP98-41126,3SA278849pchgms1
28,6
SA28158229,5SA28258230,4RC1328_36631,3BPPCT030CPPCT043
32,2
S2_2227436332,9SA28412434,4SA28505835,1CPSCT02138,1SA28460241,3SA28463442,6SA287522PceGA34
45,1
SA28800045,8SA28866847,3SA288975CPSCT034
48,8
SA289282UDA-023
49,9
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-12
.1%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-13
.7%
Be
gin
nin
g-flo
we
ring
-20
12
-C-9
.1%
Be
gin
nin
g-flo
we
ring
-20
12
-G-1
0.5
%
Be
gin
nin
g-flo
we
ring
-20
13
-G-9
.0%
G2_T1E
Figura 12. Location of putative QTLs controlling flower, phenology, fruit quality and leaf morphology
traits on TxE, T1E and E maps. At the top of each linkage group followed by the number according to the
reference map is the parent used for mapping. The color of the bars indicates the place of assessment
(green = Cabrils; = Gimenells blue, yellow = Cabrils-Gimenells). The thick parts of the vertical bars next to
the linkage groups (G) indicate minus one logarithm of the odds (LOD) intervals and the thin bars
represent minus two-LOD intervals. (The figure 12 follows in the next pages).
84
QTLs Phenology traits
BPPCT010SA368926
0,0
SA369001EPDCU5060
1,1
SA3695311,9SA3705402,7SA3774923,5SA3790615,0pchgms27,9SA3819679,5SA38250210,1SA38267710,7SA38349213,8CPPCT011CPPCT005
14,6
SA38479115,3SA38503016,0SA38518916,7SA38608918,2SA38622218,9SA38920419,6SA39515221,1SA39368422,6SA39254923,3SA39162924,0SA395253CPDCT045
24,7
SA48435426,4SA40182928,1SA402724UDP96-003
29,5
M12a31,6SA40916732,5SA41238034,3SA41266235,2SA41311537,0EPPCU2000SA415301BPPCT015
37,9
SA41858239,1SA41976240,3SA420316UDA-021CPPCT046
41,5
SA42562243,1RC0544_09044,2SA76629844,7SA44066244,9UDA-02745,2Ps12e245,8
Ma
turity
-da
te-2
01
1-C
-44
.8%
Ma
turity
-da
te-2
01
2-C
-35
.9%
Ma
turity
-da
te-2
01
3-C
-32
.9%
Ma
turity
-da
te-2
01
1-G
-57
.9%
Ma
turity
-da
te-2
01
2-G
-43
.1%
Ma
turity
-da
te-2
01
3-G
-44
.9%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
1-C
-43
.2%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-C
-34
.2%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
3-C
-28
.3
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-G
-48
.8%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
3-G
-43
.8%
G4_T1E
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5SA3847919,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA41238034,3SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6RC0544_09046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
Ma
turity
-da
te-2
01
1-G
-81
.9%
Ma
turity
-da
te-2
01
2-G
-77
.7%
Ma
turity
-da
te-2
01
3-G
-76
.1%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
1-C
-79
.5%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-C
-75
.3%
G4_TxE
CPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Ju
ve
nility
-C-2
00
6-2
01
2-C
-12
.6%
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-3
3.3
%
G6_T1E
SA6072400,0SA6070131,0SA6138482,0SA6127543,0SA6115115,0Ps7a2SA610487
6,0
SA6096307,0SA6190818,4SA62155611,2SA62439116,6SA625354UDP96-001
18,7
EPPCU930019,3SA62732821,2SA62753522,3SA62985523,4SA63024324,5SA63101425,6SA63203327,8SA63242328,9SSC6_10042074BPPCT008
30,0
SA63599931,1SA63906232,2SA64163733,3SA64450234,4SA65042235,5SA65579436,6SA661965CPSCT012
37,7
SA66756342,0SA66872543,1SA66905044,2SA671806pchcms5
46,3
SA67507748,2SA67657150,1SA67714752,0SA677625BPPCT025
53,9
SA67903854,9CPPCT04755,9SA68003256,7SA68088957,5SA68273559,0SA68354659,8SA68660961,3SA68758362,1SA68810363,6SA68864364,4SA688827UDP98-412
65,2
MA040a65,7SA68995766,7AMPA130SA690792
67,7
SA69119669,0SA69162470,3MA14aSA692396
71,6
SA693239EPPCU4092
73,8
SA69409874,4SA69452175,0SA69471475,6CPPCT030SA697308
76,2
SA69761776,8SA69943277,4CPPCT02178,6
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-4
5.7
%
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-16
.6%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-13
.4%
G6_TxE
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5SA3847919,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA41238034,3SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6RC0544_09046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
Ma
turity
-da
te-2
01
1-G
-81
.9%
Ma
turity
-da
te-2
01
2-G
-77
.7%
Ma
turity
-da
te-2
01
3-G
-76
.1%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
1-C
-79
.5%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-C
-75
.3%
G4_TxE
CPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Ju
ve
nility
-C-2
00
6-2
01
2-C
-12
.6%
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-3
3.3
%
G6_T1E
SA6072400,0SA6070131,0SA6138482,0SA6127543,0SA6115115,0Ps7a2SA610487
6,0
SA6096307,0SA6190818,4SA62155611,2SA62439116,6SA625354UDP96-001
18,7
EPPCU930019,3SA62732821,2SA62753522,3SA62985523,4SA63024324,5SA63101425,6SA63203327,8SA63242328,9SSC6_10042074BPPCT008
30,0
SA63599931,1SA63906232,2SA64163733,3SA64450234,4SA65042235,5SA65579436,6SA661965CPSCT012
37,7
SA66756342,0SA66872543,1SA66905044,2SA671806pchcms5
46,3
SA67507748,2SA67657150,1SA67714752,0SA677625BPPCT025
53,9
SA67903854,9CPPCT04755,9SA68003256,7SA68088957,5SA68273559,0SA68354659,8SA68660961,3SA68758362,1SA68810363,6SA68864364,4SA688827UDP98-412
65,2
MA040a65,7SA68995766,7AMPA130SA690792
67,7
SA69119669,0SA69162470,3MA14aSA692396
71,6
SA693239EPPCU4092
73,8
SA69409874,4SA69452175,0SA69471475,6CPPCT030SA697308
76,2
SA69761776,8SA69943277,4CPPCT02178,6
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-4
5.7
%
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-16
.6%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-13
.4%
G6_TxE
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5SA3847919,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA41238034,3SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6RC0544_09046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
Ma
turity
-da
te-2
01
1-G
-81
.9%
Ma
turity
-da
te-2
01
2-G
-77
.7%
Ma
turity
-da
te-2
01
3-G
-76
.1%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
1-C
-79
.5%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-C
-75
.3%
G4_TxE
CPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Ju
ve
nility
-C-2
00
6-2
01
2-C
-12
.6%
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-3
3.3
%
G6_T1E
SA6072400,0SA6070131,0SA6138482,0SA6127543,0SA6115115,0Ps7a2SA610487
6,0
SA6096307,0SA6190818,4SA62155611,2SA62439116,6SA625354UDP96-001
18,7
EPPCU930019,3SA62732821,2SA62753522,3SA62985523,4SA63024324,5SA63101425,6SA63203327,8SA63242328,9SSC6_10042074BPPCT008
30,0
SA63599931,1SA63906232,2SA64163733,3SA64450234,4SA65042235,5SA65579436,6SA661965CPSCT012
37,7
SA66756342,0SA66872543,1SA66905044,2SA671806pchcms5
46,3
SA67507748,2SA67657150,1SA67714752,0SA677625BPPCT025
53,9
SA67903854,9CPPCT04755,9SA68003256,7SA68088957,5SA68273559,0SA68354659,8SA68660961,3SA68758362,1SA68810363,6SA68864364,4SA688827UDP98-412
65,2
MA040a65,7SA68995766,7AMPA130SA690792
67,7
SA69119669,0SA69162470,3MA14aSA692396
71,6
SA693239EPPCU4092
73,8
SA69409874,4SA69452175,0SA69471475,6CPPCT030SA697308
76,2
SA69761776,8SA69943277,4CPPCT02178,6
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-4
5.7
%
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-16
.6%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-13
.4%
G6_TxE
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5SA3847919,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA41238034,3SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6RC0544_09046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
Ma
turity
-da
te-2
01
1-G
-81
.9%
Ma
turity
-da
te-2
01
2-G
-77
.7%
Ma
turity
-da
te-2
01
3-G
-76
.1%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
1-C
-79
.5%
Fru
it-de
ve
lep
me
nt-p
erio
d-2
01
2-C
-75
.3%
G4_TxE
CPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Ju
ve
nility
-C-2
00
6-2
01
2-C
-12
.6%
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-3
3.3
%
G6_T1E
SA6072400,0SA6070131,0SA6138482,0SA6127543,0SA6115115,0Ps7a2SA610487
6,0
SA6096307,0SA6190818,4SA62155611,2SA62439116,6SA625354UDP96-001
18,7
EPPCU930019,3SA62732821,2SA62753522,3SA62985523,4SA63024324,5SA63101425,6SA63203327,8SA63242328,9SSC6_10042074BPPCT008
30,0
SA63599931,1SA63906232,2SA64163733,3SA64450234,4SA65042235,5SA65579436,6SA661965CPSCT012
37,7
SA66756342,0SA66872543,1SA66905044,2SA671806pchcms5
46,3
SA67507748,2SA67657150,1SA67714752,0SA677625BPPCT025
53,9
SA67903854,9CPPCT04755,9SA68003256,7SA68088957,5SA68273559,0SA68354659,8SA68660961,3SA68758362,1SA68810363,6SA68864364,4SA688827UDP98-412
65,2
MA040a65,7SA68995766,7AMPA130SA690792
67,7
SA69119669,0SA69162470,3MA14aSA692396
71,6
SA693239EPPCU4092
73,8
SA69409874,4SA69452175,0SA69471475,6CPPCT030SA697308
76,2
SA69761776,8SA69943277,4CPPCT02178,6
Fru
it-pro
du
ctio
n-C
G-2
01
1-2
01
3-4
5.7
%
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-16
.6%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-13
.4%
G6_TxE
SA7276620,0SA7258271,6SA7145724,9SA7113685,7SA7078487,4SA7041738,2SA7322849,9SA73780110,7SA738499CPSCT004
11,5
SA74588013,1SA74939613,6SA750944CPPCT039
14,1
SA33466914,9SA75378418,0SA75451218,8SA75664119,6SA75740120,4SA75964924,2
SA76947128,0SA770284SA770978
28,8
SA77312531,8
SA77699439,4SA777798CPPCT057
40,2
SA77813840,8SA77938641,4SA78145545,3MA20a45,9SA782750PMS02
49,2
SA78318750,0SA78327451,6SA78403052,4SA78500053,2EPPCU517654,0pchcms254,5SA78595857,1SA78881158,8CPPCT017SA790469
61,4
Ps5c366,4
Be
gin
nin
g-s
ho
otin
g-2
01
1-C
-12
.1%
Be
gin
nin
g-s
ho
otin
g-2
01
2-C
-21
.8%
Be
gin
nin
g-s
ho
otin
g-2
01
3-C
-23
.5%
Be
gin
nin
g-s
ho
otin
g-2
01
2-G
-11
.0%
En
d-flo
we
ring
-20
11
-C-1
3.6
%
En
d-flo
we
ring
-20
12
-C-1
4.4
%
En
d-flo
we
ring
-20
13
-C-8
.9%
G7_E
CPSCT018SA793606
0,0
SA7957560,8SA7967551,6SA7992913,1SA8003773,9SA8006344,7SA8023396,2SA8037587,0SA809771BPPCT006CPDCT034CPPCT058
7,8
SA8179158,5SA8368579,2SA85655210,7SA85935412,2SA860815CPPCT006
13,7
SA86615715,2M6a21,9SA86833922,0SA86904023,2SA86941924,4SA87033727,6SA87050928,4SA87108229,2SA87129630,8SA87534333,2SA87596634,0SA876618UDP98-409
34,8
SA87804435,9SSC8_1858485638,0EPDCU345438,5SA88062039,2SA88180440,6SA88242741,3SA88275242,0SA88352442,7EPDCU311743,4SA88383844,2SA88415345,9SA88512147,6
Le
af-fa
ll-20
10
-C-1
1.1
%
Le
af-fa
ll-20
11
-C-1
1.3
%
Le
af-fa
ll-20
12
-C-1
0.7
%
Be
gin
nin
g-s
ho
otin
g-2
01
1-C
-10
.8%
Be
gin
nin
g-s
ho
otin
g-2
01
2-C
-12
.7%
Be
gin
nin
g-s
ho
otin
g-2
01
3-C
-11
.6%
Be
gin
nin
g-s
ho
otin
g-2
01
3-G
-8.6
%
Be
gin
nin
g-flo
we
ring
-20
11
-C-1
1.5
%
Be
gin
nin
g-flo
we
ring
-20
12
-C-1
6.0
%
Be
gin
nin
g-flo
we
ring
-20
13
-C-1
2.7
%
En
d-flo
we
ring
-20
11
-C-1
2.1
%
En
d-flo
we
ring
-20
12
-C-1
3.3
%
En
d-flo
we
ring
-20
13
-C-1
7.0
%
G8_T1E
85
QTLs Fruit quality traitsSA2006CPPCT016
0,0
SA26510,6EPDCU3122SA3621
1,2
SA78952,2SA105203,2SA111064,2SA144385,2SA174197,1CPPCT010SA18927
8,1
SA232518,7SA24481M16a
9,3
SA2811211,9
SA2829413,7
SA2983615,5
EPPCU533117,2PACITA00517,3
SA31646CPPCT027
19,2
SA4759521,4
SA6363822,8SA6713723,5SA7691224,2EPPCU109025,1
UDP96-005SA78954
30,9
SA8432433,2
SA8980835,5
CPDCT02440,5SA9509541,5SA9623242,4EPDCU194543,3SA9896043,4SA10106544,2SA101538CPPCT026
45,0
SA103917EPDCU3489
47,8
BPPCT020SA104819
49,3
SA10600050,5SA10829951,7SA10922352,9SA11022754,1SA11041355,3SA111259BPPCT016
56,5
SA11175557,2SA11204257,9SA11227158,6SA11269859,3SA11292460,7SA11344961,4SA11409462,1SNP_1_3905918763,5SA118443CPPCT042
64,2
EPDCU286267,0
CPPCT02968,6
CPPCT05370,8
SA12136472,6
SSC1_4153528575,0
SA12302376,2
SA12318077,4SA133606BPPCT028
78,6
SA13285579,6SA13158980,6SA12942281,6SA12446682,6
SA12371984,6
Juic
y-2
011-2
013-G
-31.8
%
G1_TxE
SA26510,0EPDCU31220,9SA36211,2UDP96-0181,5SA48082,2SA91973,6SA106354,3SA174195,0SA18927SA23251
5,7
CPPCT0048,3EPPCU5331SA30043PACITA005
12,0
SA3164614,2SA3222515,3SA5590316,4PceGA59SA63638
17,0
SA76912EPPCU1090UDP96-005
19,1
SA83053CPPCT003
21,2
Ag221,8SA8691822,5SA8875123,2SA9158323,9SA9623225,3SA9774728,1SA9994328,8SA10106530,2SA10133131,6SA101815CPPCT026
32,3
SA10281933,4SA103507EPDCU3489
35,6
SA10587837,7Jui38,4SA10741739,1SA10922339,8SA10961940,5SA10989741,9SA11105442,6BPPCT01643,3SA11175544,0SA11387844,7SA11489846,0CPPCT01946,7S1_3905918747,2CPPCT042EPDCU2862
47,7
SA11939148,2CPPCT053SA817857
48,7
SA120057CPPCT029
49,2
SA121740Bf2
49,7
SA12302350,2SA12318050,7SA133606BPPCT028
51,2
SA13285552,0SA12666852,8SA12371953,6
Inte
nsity
-skin
-colo
r-2012-C
-17.0
%
Inte
nsity
-skin
-colo
r-2013-C
-59.9
%
Inte
nsity
-skin
-colo
r-2011-G
-25.1
%
Inte
nsity
-skin
-colo
r-2012-G
-25.2
%
Inte
nsity
-skin
-colo
r-2013-G
-23.3
%
Inte
nsity
-skin
-colo
r-2011-C
-25.5
%
Perc
enta
ge-s
kin
-colo
r-2012-C
-30.3
%
Perc
enta
ge-s
kin
-colo
r-2013-C
-57.9
%
Perc
enta
ge-s
kin
-colo
r-2013-G
-19.9
%
Perc
enta
ge-s
kin
-colo
r-2012-G
-30.5
%
Perc
enta
ge-s
kin
-colo
r-2013-G
-22.1
%
G1_T1E
SA291055EPPCU5990
0,0
SA2939250,6EPDCU46100,7SA2945331,3SA2954402,7SA2959784,1SA296203UDP97-403
4,8
SA297349BPPCT007
5,3
SA2997966,6SA3043077,9SA309280BPPCT039
9,2
SA31005710,5SA311192EPDCU3083
11,8
SA31450913,4SA31583715,0SA31661516,6
SA31700118,2
SA32156521,5
SA32406723,1
SA88706124,7AgSA344789CPPCT002
26,3
SA34923327,9SA35074928,7SA35149429,5SA352749UDP96-008
30,3
SA35739631,4SA36070432,5SA36195733,6SA36308134,7
SA36535736,9
SA36585438,0
SA36593339,1
SA36635440,2
EPDCU053243,7
Perc
enta
ge-s
kin
-colo
r-2011-G
-57.6
%
Perc
enta
ge-s
kin
-colo
r-2012-G
-41.7
%
Perc
enta
ge-s
kin
-colo
r-2013-G
-37.4
%
Blo
od-fle
sh-2
011-2
013-G
-50.7
%
G3_TxE
BPPCT010SA368926
0,0
SA3705130,9SA3707031,8SA3744342,7SA3754423,6SA3803234,5pchgms25,4CPPCT0056,6SA3828687,5
SA3847919,4SA39043010,3SA39094111,2CPPCT011CPDCT045
12,1
SA39562114,9SA39590116,3SA39695819,1SA40035920,5SA40061321,9SA402302UDP96-003
23,3
SA40315225,3SA40372726,6SA403891EPPCU1106
27,3
M12aSA405773
27,8
SA40634528,8SA40791929,8SA409167EPDCU3832
30,8
SA41026531,7SA41095532,6SA412380Ft
34,3
SA41311535,2EPPCU200036,9SA41530137,3BPPCT01537,6SA41709438,2SA41731038,8SA41858239,4SA41976240,6SA420819UDA-021
41,2
CPPCT04642,1SA421418BPPCT023
43,0
SA425622UDA-027
43,5
EPPCU177544,6RC0544_09046,5CPPCT051SA475922
48,2
SA49384849,2SA50474950,2
Fru
it-we
ight-2
011-G
-66.6
%
Fru
it-we
ight-2
012-G
-57.2
%
Fru
it-we
ight-2
013-G
-48.5
%
Fle
sh-w
eig
ht-2
011-G
-66.6
%
Fle
sh-w
eig
ht-2
012-G
-58.0
%
Fle
sh-w
eig
ht-2
013-G
-49.4
%
Fru
it-pola
r-dia
mete
r-2011-G
-61.7
%
Fru
it-pola
r-dia
mete
r-2012-G
-50.0
%
Fru
it-pola
r-dia
mete
r-2013-G
-35.8
% Fru
it-cheek-d
iam
ete
r-2011-G
-73.3
%
Fru
it-cheek-d
iam
ete
r-2012-G
-64.0
%
Fru
it-cheek-d
iam
ete
r-2013-G
-55.1
%
Fru
it-sutu
re-d
iam
ete
r-2011-G
-73.9
%
Fru
it-sutu
re-d
iam
ete
r-2012-G
-63.2
%
Fru
it-sutu
re-d
iam
ete
r-2013-G
-48.9
%
Fle
sh-p
ola
r-dia
mete
r-2011-G
-69.3
%
Fle
sh-p
ola
r-dia
mete
r-2012-G
-65.2
%
Fle
sh-p
ola
r-dia
mete
r-2013-G
-49.1
%
Fle
sh-c
heek-d
iam
ete
r-2011-G
-77.5
%
Fle
sh-c
heek-d
iam
ete
r-2012-G
-66.5
%
Fle
sh-c
heek-d
iam
ete
r-2013-G
-58.1
%
Fle
sh-s
utu
re-d
iam
ete
r-2011-G
-76.9
%
Fle
sh-s
utu
re-d
iam
ete
r-2012-G
-63.2
%
Fle
sh-s
utu
re-d
iam
ete
r-2013-G
-46.5
%
G4_TxE
BPPCT010SA368926
0,0
SA369001EPDCU5060
1,1
SA3695312,0SA3705402,9SA3774923,8SA3790615,0
pchgms27,3
Fc28,9
SA38196710,7SA38250211,3SA38267711,9
SA38349214,8CPPCT011CPPCT005
15,5
SA38479116,3SA38503017,1SA38518917,9SA38608919,5SA38622220,3SA38920421,1SA39515222,7SA39368423,5SA39254924,3SA39162925,1SA395253CPDCT045
25,9
SA48435427,7
SA40182929,5SA402724UDP96-003
30,9
M12a33,1
SA40916734,1
SA41238036,0SA41266237,0SA41311538,9EPPCU2000SA415301BPPCT015
39,9
SA41858241,2SA41976242,5SA420316UDA-021CPPCT046
43,8
SA42562245,7RC0544_09047,0SA76629847,6SA44066247,9UDA-02748,2Ps12e248,8
Perc
enta
ge-s
kin
-colo
r-2011-C
-33.0
%
Perc
enta
ge-s
kin
-colo
r-2012-C
-14.5
%
Perc
enta
ge-s
kin
-colo
r-2013-C
-23.5
%
Perc
enta
ge-s
kin
-colo
r-2012-G
-24.8
%
Perc
enta
ge-s
kin
-colo
r-2013-G
-32.1
%
G4_T1E
86
QTLs Fruit quality traits
CPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Fru
it-we
ight-2
011-G
-21.3
%
Fru
it-we
ight-2
012-G
-21.7
%
Fru
it-we
ight-2
013-G
-18.9
%
Sto
ne-w
eig
ht-2
011-C
-28.1
%
Sto
ne-w
eig
ht-2
012-C
-37.4
%
Sto
ne-w
eig
ht-2
011-G
-37.5
%
Sto
ne-w
eig
ht-2
012-G
-35.3
%
Sto
ne-w
eig
ht-2
013-G
-37.1
%
Sto
ne-c
heek-d
iam
ete
r-2011-C
-31.6
%
Sto
ne-c
heek-d
iam
ete
r-2012-C
-31.7
%
Sto
ne-c
heek-d
iam
ete
r-2013-C
-27.3
%
Sto
ne-c
heek-d
iam
ete
r-2011-G
-34.0
%
Sto
ne-c
heek-d
iam
ete
r-2012-G
-41.3
%
Sto
ne-c
heek-d
iam
ete
r-2013-G
-46.0
%
Sto
ne-s
utu
re-d
iam
ete
r-2011-C
-30.9
%
Sto
ne-s
utu
re-d
iam
ete
r-2012-C
-35.8
%
Sto
ne-s
utu
re-d
iam
ete
r-2013-C
-34.0
%
Sto
ne-s
utu
re-d
iam
ete
r-2011-G
-33.4
%
Sto
ne-s
utu
re-d
iam
ete
r-2012-G
-38.1
%
Sto
ne-s
utu
re-d
iam
ete
r-2013-G
-45.1
%
G6_T1E
SA7251130,0SA7094960,8
SA7040752,5
SA7338334,2CPSCT004SA744253
5,0
SA7498166,3CPPCT0396,7
SA7587679,3SA75911110,0pchgms6SA762094
11,4
SA762895UDP98-408
12,9
SA76968713,9
SA77202815,8
SA77800217,7CPPCT05718,0SA77849818,7SA77880819,8
SA781003CPPCT033
24,1
SA781691MA20a
25,8
S7_1762827,4SA782750PMS02
27,9
SA78326229,9SA783973EPPCU5176
30,6
pchcms231,1SA78633331,9SA78667633,5
SA78798735,9S7_2016936,7SA78994137,5SA79012238,3CPPCT017SA790678
39,1
SA79159140,5EPDCU339241,9
Ps5c3SA792580
45,3
Fle
sh-w
eig
ht-2
011-G
-27.5
%
Fle
sh-w
eig
ht-2
012-G
-13.3
%
Fle
sh-w
eig
ht-2
013-G
-16.3
% Fru
it-cheek-d
iam
ete
r-2011-G
-23.4
%
Fru
it-cheek-d
iam
ete
r-2012-G
-15.5
%
Fru
it-cheek-d
iam
ete
r-2013-G
-20.3
%
G7_T1E
QTLs Leaf traits
SA26510,0EPDCU31220,8SA36211,1UDP96-0181,4SA48082,1SA91973,4SA106354,1SA174194,8SA18927SA23251
5,5
CPPCT0047,9EPPCU5331SA30043PACITA005
12,2
SA3164614,3SA3222515,4SA5590316,5PceGA59SA63638
17,0
SA76912EPPCU1090UDP96-005
19,1
SA83053CPPCT003
21,2
SA8691821,9SA8875122,6SA9158323,3SA9623224,8SA9774727,7SA9994328,4SA10106529,9SA10133131,4SA101815CPPCT026
32,1
SA10281933,2SA103507EPDCU3489
35,3
SA10587838,0SA10741739,4SA10922340,1SA10961940,8SA10989742,2SA11105442,9BPPCT01643,6SA11175544,2SA11387844,8SA11489846,1CPPCT01946,7S1_3905918747,2CPPCT042EPDCU2862
47,7
SA11939148,2CPPCT053SA817857
48,7
SA120057CPPCT029
49,2
SA12174049,7SA12302350,2SA12318050,7SA133606BPPCT028
51,2
SA13285552,0SA12666852,8SA12371953,6
Leaf-p
erim
ete
r-2012-C
-16.9
%
Leaf-p
erim
ete
r-2013-C
-23.4
%
Leaf-p
erim
ete
r-2013-G
-9.0
%
Leaf-s
urfa
ce-2
012-C
-17.4
%
Leaf-s
urfa
ce-2
013-C
-21.8
%
Leaf-s
urfa
ce-2
013-G
-11.5
%
Leaf-la
min
a-w
idth
-2012-C
-9.5
%
Leaf-la
min
a-w
idth
-2013-C
-13.8
%
Leaf-la
min
a-w
idth
-2012-G
-9.8
%
Leaf-le
ngth
-2012-C
-22.2
%
Leaf-le
ngth
-2013-C
-21.3
%
Leaf-la
min
a-le
ngth
-2012-C
-25.3
%
Leaf-la
min
a-le
ngth
-2013-C
-25.9
%
Leaf-la
min
a-le
ngth
-2013-G
-8.9
%
Leaf-w
eig
ht-2
012-C
-14.4
%
Leaf-w
eig
ht-2
013-C
-15.9
%
Leaf-w
eig
ht-2
012-G
-13.5
%
Leaf-w
eig
ht-2
013-G
-11.3
%
G1_T1E
SA543368CPPCT040
0,0
SA5505041,6SA556288BPPCT026
4,0
SA5628674,7UDP97-401SA575030
5,4
SA5826006,3SA5843158,1SA5858109,0SA5874509,9SA58921911,7SA58975012,6SA59054613,5SA591147BPPCT017CPSCT006
15,3
SA593763BPPCT037
17,9
SA59474518,7SA594796pchgms4
19,5
CPPCT01321,2SA59639322,5SA59720225,7SA59743626,3SA598118EPDCU5183
26,9
SA59878427,4SA59962927,9EPDCU465828,4SA60007228,9BPPCT03829,4SA60049330,2SA60113534,5CPSCT02236,9RC3786_396BPPCT014
38,1
SA60290139,8
Petio
le-le
ngth
-2012-C
-13.8
%
Petio
le-le
ngth
-2013-C
-11.6
%
Petio
le-le
ngth
-2012-G
-8.9
%
Petio
le-le
ngth
-2013-G
-12.4
%
G5_T1E
87
QTLs Leaf traits
SA5433680,0SA545448CPPCT040
1,0
SA5505041,9SA5522543,7AMPA112SA556288
4,6
SA5628675,5SA5658636,4SA5696717,3SA5715488,2SA57258210,0SA572841UDP97-401
10,9
SA58260013,5SA58431514,8SA58620216,1SA58695517,4PACITA02120,0SA588670BPPCT017
21,1
CPSCT00622,5SA59376324,6SA594176BPPCT037
26,7
SA59460127,5SA59474528,3pchgms4SA595126
29,1
SA595212CPPCT013
30,1
SA59639331,1SA59720232,1EPDCU5183EPDCU4658SA600072
33,1
SA60049336,4SA60113538,0
RC3786_39643,1SA602512CPSCT022
44,7
BPPCT01445,3SA60260546,3
SA60304748,3
Petio
le-le
ngth
-2012-G
-16.7
%
Petio
le-le
ngth
-2013-G
-28.1
%
G5_TxECPP214130,0SA6070130,7Ps7a2CPP21245CPP20836
1,1
SA6104871,8S6_561692,5SA6190814,5SA6215566,5SA6222317,2SA623894Rf2
9,2
SA6258439,9UDP96-00110,6SA62732812,1SA62753512,9SA62906213,7SA62917714,5SA632423BPPCT008
16,0
SA64163716,5SA655794CPSCT012
17,0
SA66756317,7SA66872519,2SA670494pchcms5
20,7
SA676571BPPCT025
24,1
SA67903826,4CPPCT04727,6SA68086428,2SA68273528,8SA68354629,4SA68361130,0SA68395630,6SA68660932,5SA68758333,8SA689067UDP98-412MA040a
34,4
SA691114MA14aAMPA130
34,9
EPPCU4092SA693863
37,0
SA69440838,0SA69471439,0SA69499040,0SA69562941,0SA69597442,0SA696903CPPCT030CPPCT021
43,0
Leaf-la
min
a-w
idth
-2012-C
-10.6
%
Leaf-la
min
a-w
idth
-2013-C
-14.9
%
Leaf-la
min
a-w
idth
-2012-G
-14.0
%
Petio
le-le
ngth
-2012-C
-11.4
%
Petio
le-le
ngth
-2013-C
-13.5
%
Petio
le-le
ngth
-2013-G
-8.3
%
Leaf-w
eig
ht-2
012-C
-12.3
%
Leaf-w
eig
ht-2
013-C
-12.3
%
Leaf-w
eig
ht-2
012-G
-9.5
% Ch
loro
phyll-c
onte
nt-2
011-C
-14.5
%
Ch
loro
phyll-c
onte
nt-2
012-C
-15.8
%
Ch
loro
phyll-c
onte
nt-2
013-C
-15.7
%
G6_T1E
SA7251130,0SA7094960,8SA7040752,5SA7338334,2CPSCT004SA744253
5,0
SA7498166,3CPPCT0396,7
SA7587679,3SA75911110,0pchgms6SA762094
11,4
SA762895UDP98-408
12,9
SA76968713,9SA77202815,8SA77800217,7CPPCT05718,0SA77849818,7SA77880819,8
SA781003CPPCT033
24,1
SA781691MA20a
25,8
S7_1762827,4SA782750PMS02
27,9
SA78326229,9SA783973EPPCU5176
30,6
pchcms231,1SA78633331,9SA78667633,5SA78798735,9S7_2016936,7SA78994137,5SA79012238,3CPPCT017SA790678
39,1
SA79159140,5EPDCU339241,9Ps5c3SA792580
45,3
Leaf-s
urfa
ce-2
013-C
-10.3
%
Leaf-s
urfa
ce-2
012-G
-10.7
%
Leaf-s
urfa
ce-2
013-G
-8.8
%
Petio
le-le
ngth
-2012-C
-9.2
%
Petio
le-le
ngth
-2013-C
-13.8
%
Petio
le-le
ngth
-2012-G
-10.3
%
Petio
le-le
ngth
-2013-G
-11.7
%
G7_T1E
CPSCT018SA793606
0,0
SA7957560,8SA7967551,6SA7992913,1SA8003773,9SA8006344,7SA8023396,2SA8037587,0SA809771BPPCT006CPDCT034CPPCT058
7,8
SA8179158,5SA8368579,2SA85655210,7SA85935412,2SA860815CPPCT006
13,7
SA86615715,2
M6a21,9SA86833922,0SA86904023,2SA86941924,4
SA87033727,6SA87050928,4SA87108229,2
SA87129630,8
SA87534333,2SA87596634,0SA876618UDP98-409
34,8
SA87804435,9SSC8_1858485638,0EPDCU345438,5SA88062039,2SA88180440,6SA88242741,3SA88275242,0SA88352442,7EPDCU311743,4SA88383844,2SA88415345,9SA88512147,6
Leaf-p
erim
ete
r-2013-C
-16.7
%
Leaf-p
erim
ete
r-2012-G
-13.1
%
Leaf-p
erim
ete
r-2013-G
-17.0
%
Leaf-s
urfa
ce-2
013-C
-11.8
%
Leaf-s
urfa
ce-2
012-G
-10.8
%
Leaf-s
urfa
ce-2
013-G
-12.2
%
Leaf-le
ngth
-2012-C
-10.2
%
Leaf-le
ngth
-2013-C
-17.7
%
Leaf-le
ngth
-2012-G
-12.8
%
Leaf-le
ngth
-2013-G
-17.0
%
Leaf-la
min
a-le
ngth
-2013-C
-13.8
%
Leaf-la
min
a-le
ngth
-2012-G
-11.4
%
Leaf-la
min
a-le
ngth
-2013-G
-13.0
%
Leaf-w
eig
ht-2
013-C
-11.9
%
Leaf-w
eig
ht-2
012-G
-13.2
%
Leaf-w
eig
ht-2
013-G
-18.4
%
Petio
le-le
ngth
-2012-C
-14.9
%
Petio
le-le
ngth
-2013-C
-39.0
%
Petio
le-le
ngth
-2012-G
-22.6
%
Petio
le-le
ngth
-2013-G
-29.9
%
G8_T1E
CPSCT0180,0SA7936060,1
SA7950203,6SA7992915,3SA8023397,0SA8097718,7BPPCT006SA809997
10,4
SA81997811,4CPDCT03413,4SA83685714,1CPPCT05814,6SA83432115,4SA85305316,2SA85545917,0CPPCT00619,5SA85935420,4SA86203421,3SA86480522,2SA86570923,9SA86631224,8SA86636625,7SA86780027,4SA87033728,3SA87108229,2SA87241131,8SA87276532,7SA87305533,6SA87463934,5SA87510835,4SA87661036,3SA87737038,0SA877454UDP98-409
38,9
SA87804441,2SA87898142,3SA879224EPDCU3454
43,4
SA88062044,1SA88112044,8SA88132745,5SSC8_1908376946,9SA88180447,6SA88242748,3SA883292EPDCU3117
49,7
SA88533550,7
Petio
le-le
ngth
-2012-G
-15.0
%
Petio
le-le
ngth
-2013-G
-35.8
%
G8_TxE
88
A major QTL for fruit production (qP-FP6) was detected in the central part of G6 explaining
45.7% of the phenotypic variance in TxE and 33.3% in T1E. This QTL colocalized also with a QTL
for Juvenility in T1E (qP-Juv6) explaining a 13.3% of the phenotypic variance. A QTL for leaf fall
date was detected in G8 (qP-LF8) in T1E at Cabrils that was the only place where it was
measured.
G3G2
13
20
34
40
18
12
19
2223
26
37
41
44
47
35
14
0
2
5
G7
59
55
51
46
40
3635
31
25
18
1
66
3
62
23
13
10
57
0
0
2
6
10
15
18
20
23
25
29
32
35
30
34
3739
46
40
26
G80
4
7
15
18
23
32
38
41
47
52
59
22
13
25
54
G50
13
26
35
5
7
20
22
24
47
50
12
15
23
9
14
G40
89
11
14
26
28
30
43
47
54
58
37
16
40
46
50
57
G10
2
56
10
13
1516
181920
28
25
29
27
31
35
3738
424344
474849
51
5556
58
60
63
65
69
71
7778
81
85
G60
23
5
15
2930
45
49
61
7374
33
51
65
67
80
1
21
79
qP-PiL4
Jui
Vr3
Ft
qP-LBW1qP-LW1qP-LS1
qP-LL1qP-LBL1
qP-LP1
qP-BFT1
qP-EFT1
qP-BFT1
qP-PiL1
qP-JUI1
qP-BD1
qP-ISC1
qP-PSC1
qP-BFT2
qP-BS2
qP-Bf3
qP-PSC3
qP-FDP4qP-MD4qP-FDP4
qP-FsD4qP-FpD4qP-FlW4
qP-MD4qP-PSC4qP-FW4
qP-FcD4qP-FlsD4qP-FlcD4qP-FlpD4
qP-PL5
qP-PL5
qP-FW6
qP-LBW6
qP-LW6
qP-JUV6
qP-SsD6
qP-PL6
qP-FP6
qP-FP6
qP-PiL6
qP-BS6
qP-CC6
qP-FcD7
qP-FlW7
qP-BS7
qP-BFT7
qP-PL7
qP-EFT7
qP-LS7
qP-LL8qP-LP8qP-LLL8
qP-LW8qP-LS8 qP-EFT8
qP-BFT8qP-LF8qP-BS8
qP-PL8
qP-PL8
T
E
T
E
Bf2
Ag2
Fc2
Sh
Ag
Figure 13. Genes and consistent QTLs mapped in this work in the TxE and T1E progenies and represented in the Prunus reference map. Genes are in text box. QTLs in blue, red and green were identified using the maps of T1E, E and TxE respectively.
89
4.3.3.3 Fruit traits
A total of 20 consistent QTLs were detected for fruit quality traits: 9 in T1E and 11 in TxE.
Individual QTLs explained between 17.0 % and 77.5% of the phenotypic variance. A major QTL
for juiciness explaining a 31.8% of the phenotypic variance was found in TxE (qP-Jui1) at the
end of G1 collocating with the position of the Jui gene mapped in T1E. For the blood flesh trait
one QTL was detected in the central region of G3 in TxE (qP-Bf3) explaining a 50.7% of the
phenotypic variance and at a different position than the gene Bf2 mapping in the distal part of
G1 in T1E. The variability of intensity of skin color in T1E was explained by a major QTL in the
middle of G1 (qP-ISC1) with R2 ranging between a 17.0 and a 59.9%. Two major QTLs were
detected in T1E for the percentage of skin color: one was detected in both locations at the end
of G1 (qP-PSC1) and explaining between a 19.9 and a 57.9% of the phenotypic variance, and
the other QTL was detected in the middle of G4 (qP-PSC4) and explained between a 14.5 and a
33.0% of the phenotypic variance. In TxE a major QTL was detected in G3 (qP-PSC3) explaining
between the 18.2 and the 24.7% of the phenotypic variance.
For fruit weight a consistent QTL was detected in T1E at the beginning of G6 (qP-FW6)
explaining around the 20% of the phenotypic variance. In TxE most of the variance of this trait
(40-62.6%) is explained by a major QTL found in G4 (qP-FW4). The same occurred for other
characters related with fruit dimensions in this population where a major QTL was found in G4
for flesh weight (qP-FlW4), fruit and flesh polar diameters (qP-FpD4 and qP-FlpD4), fruit and
flesh cheek diameter (qP-FcD4, qP-FlcD4) and fruit suture diameter (qP-FsD4, qP-FlD4), all of
them explaining between 41 and 76% of the phenotypic variance. In TxE a major QTL for stone
weight was detected in both locations and all years in the central part of G6 close to the
marker CPPCT047 (qP-SW6). In this genomic region other QTLs were also detected in T1E for
stone cheek diameter (qP-ScD6) and stone suture diameter (qP-SsD6), explaining between
28.1 and 46.0% of the phenotypic variance. Finally, we also identified major QTLs for flesh
weight and fruit cheek diameter in T1E in G7 only in Gimenells (qP-FlW7, qP-FcD7) explaining
13.8-27.5 and 15.5-23.4% of the phenotypic variance.
4.3.3.4 Leaf traits
A total of 19 consistent QTLs were detected for leaf traits in both populations: 17 only in T1E
and two in both T1E and TxE. Individual QTLs explained between 8.3 % and 39.0% of the
90
phenotypic variance, seven being major QTLs. QTLs for leaf traits were detected in all
chromosomes except G2, G3 and G4.
For leaf perimeter two QTLs were detected in T1E, a major QTL at the beginning of G1 (qP-LP1)
and a QTL at the beginning of G8 (qP-LP8). At the same position of G1 and G8 we also detected
QTLs for leaf surface (qP-LS1, qP-LS8), leaf length (qP-LL1 and qP-LL8), leaf blade length (qP-
LBL1 and qP-LBL8), and leaf weight (qP-LW1 and qP-LW8). Leaf blade width had a QTL in G1
(qP-LBW1), another one in G6 (qP-LBW6) but none in G8. Petiole length variability identified
four QTLs: two of them present in all populations years and locations, one in the proximal end
of G5 (qP-PL5) with R2=8.9-28.1%, and another one located in the middle of G8 (qP-PL8),
explaining from 14.9 to 39.0% of the phenotypic variance. Other QTLs for PL were detected in
G6 and G7 of T1E (qP-PL6, qP-PL7). Other QTLs were also detected for leaf surface at the end
of G7 (qP-LS7), for leaf blade width and for leaf weight on G6 (qP-LBW6 and qP-LW6). For
chlorophyll content a QTL was identified in G6 in T1E (qP-CC6) that explained during the three
years around the 15% of the phenotypic variance. Any QTL was detected for this trait in TxE.
4.4 DISCUSSION
We have mapped eight major genes and 64 QTLs across seasons using two almond x peach
interspecific progenies. From the QTLs identified, 44 were in the backcross one population T1E
(43 mapped in the map of the almond x peach interspecific hybrid used as female parent and 2
in the peach ‘Earlygold’ male parent), and 19 in the F2 progeny TxE. We expected a higher
segregation in the TxE than in the T1E progeny, because the characters with dominant gene
action in the peach parent would not be detected in the BC1 population, but we found a lower
number of QTLs in TxE. The most important reason is that the stringent criterion used for
declaring a consistent QTL favored the populations with higher size (N=88 in TxE vs. N=178 in
T1E), particularly for loci that explained low proportions of the observed phenotypic variation
(R2=8-15%), because more numerous populations have more statistical power to identify QTLs
with low effect. In addition, the fact that T1E was in two locations and that QTLs were
accepted as consistent when they were found all years in one of them was also important.
Only two QTLs were detected with the E map, which we attribute to different reasons: a) the
lower level of genetic variability within peach, b) the fact that a large part of the genome of
‘Earlygold’ is identical by descent (Chapter 3) and c) the phenotypic effects within the peach
gene pool could be often masked by larger effects from the almond allele.
91
Only a six of the 20 QTLs detected in TxE were found in T1E, while one could expect this
occurring more frequently. These were beginning of flowering time (qP-Bf1), Maturity date
(qP-MD4), Fruit development period (qP-FDP4), Juiciness (qP-Jui1) and two QTLs of petiole
length (qP-PL5 and qP-PL8). These characters may be less affected by the environment, the
genetic background or both than others, resulting in a more heritable behavior. The genetic
background may explain a good part of this low correspondence between QTLs, one example is
the fruit dimension traits that in the case of TxE are strongly affected by the presence of
individuals with almond-like fruit type, determined by a the major gene Ft that are not present
in the T1E progeny. All dimension traits identify only a major QTL in G4 that correspond to the
position of the Ft gene and no more QTLs are detected, whereas the T1E progeny does not
detect any QTL on G4 and two different QTLs in G6 and G7.
The analysis of T1E in two locations is an opportunity to detect possible genotype x
environmental interactions. These locations have contrasted climates: Cabrils, located on the
Mediterranean coast North of Barcelona has a very mild wheather, whereas Gimenells lying in
central Catalonia, 150 Km west of Barcelona, has a continental climate. In addition, the Cabrils
plants were planted on their own roots and at a tighter density than the copy of Gimenells that
was grafted and submitted to a more standard agricultural practice. We identified six QTLs that
were only found in one location and not in the other; two for beginning of flowering time (qP-
BFT8) and leaf length (qP-LL1) were only present in Cabrils and four, determining blooming
density (qP-BD1), fruit weight (qP-FW6), flesh weight (qP-FlW7) and fruit cheek diameter (qP-
FcD7) were detected in Gimenells but not in Cabrils. For qP-BFT8 it may respond to climatic
differences between the two locations, and the characters related with fruit dimensions may
be associated with the cultural practices that determined that fruit in Gimenells had higher
sizes than in Cabrils (Annex 2 and 3).
A QTL analysis was previously done in the TxE population of Cabrils in 1996 and 1997 using a
map with 172 markers (162 RFLPs, 11 isoenzymes and two morphological traits) and less
individuals and a lower LOD score threshold for the QTL analysis (Joobeur 1998). Some of the
traits analyzed were also analyzed in this work, allowing the comparison of the results. These
traits were three phenological traits (BFT, EFT and FD), and five leaf traits (LS, LBL, LBW, PL and
CC). For flowering time a coincident QTL was identified on G1, being the only one detected by
Joobeur (1998) with a LOD score threshold higher than 3. For flowering duration different QTLs
were found in the two studies but none of them was consistent in both works. Any coincident
92
QTL in both works was neither identified for leaf surface, leaf weight nor chlorophyll content.
For the other traits another situation was found, for example Joobeur (1998) identified one
QTL for leaf blade width that in our study we were not able to identify in TxE but it was
identified in T1E. For leaf length, a QTL in G3 was detected in both works but other detected in
G2 and G4 were not. Finally for petiole length coincident QTLs were detected in G5, G7 and G8
but not in G3. The differences between both studies could be due to the population size,
genetic map and LOD threshold differences, or by the presence of genotype x environment
interactions.
Interspecific crosses allow the analysis of characters that present contrasted phenotypes
between the species involved. Some of these characters have a simple inheritance and allow
the identification of major genes or major QTLs that explain a large part of the observed
variability. In our almond x peach crosses we have been able to map ten major genes, eight
described here and two more corresponding to two fertility restorer genes on G2 and G6
described in the Chapter 3. In addition, several characters resolved in QTLs explaining more
than 50% of R, such as maturity date (and fruit development period that we consider the same
QTL), pistil length in TxE or blood flesh in G3 of T1E. Some of these major genes or QTLs
corresponded to traits of unknown genetics, such as fruit type (almond vs. peach), anther color
(red vs. yellow), pistil length (short vs. long) or juiciness (juicy vs. non-juicy) never described
before and corresponding to characters that are clearly distinctive between peach and
almond. Others, as fruit flesh and skin anthocyanic color, flower color or powdery mildew
resistance, corresponded to characters segregating within peach, but that interestingly were
encoded in most cases by genes at chromosome positions different from those described so
far, indicating that the variability supplied by almond is often in different genes than that
found at the intraspecific level. This is important not only to identify different genes that cause
similar phenotypes, but also as a source of novel variability that can be combined to that
already available to produce cultivars with added value. One obvious example is that of the
resistance to powdery mildew in G2 that can be pyramided with others found before (Dabov,
1983; Foulogne et al. 2003b; Pascal et al. 2010) to obtain cultivars with a broader or more
durable resistance.
4.4.1 Flower traits
The Sh gene, responsible for the type of flower in peach was initially mapped on G8 by
Ogundiwin et al. (2009) and later by Fan et al. (2010) and Eduardo et al. (2011) in two peach
93
intra-specific crosses. This gene was heterozygous in ‘Earlygold’ and placed at the expected
position of its map, confirming its inheritance and position on the Prunus genome.
For pistil length a major QTL has been identified in TxE in G6. In this population this trait is
highly correlated with fruit production for which a major QTL was also detected in the same
region. The same chromosomal region of G6 contains one or two tightly linked genes that
affect fruit shape (S/s) and fruit abortion (Af/af), traits that are also associated to the length of
the pistil and fruit production (Dirlewanger et al. 2006; Picañol et al. 2013). In T1E, a QTL for
fruit production was also detected in the same region, but no QTLs were found for pistil
length, that instead mapped to G1 and G4, suggesting that at least in this population fruit
production was not associated with pistil length.
For Blooming density we identified a major QTL on G1 where the peach allele decreased flower
density. This is to our knowledge the first time that a QTL has been reported for this trait in
Prunus, an important one as it determines the needs of flower or fruit thinning during the
growing season, one of the most expensive operations of peach cultivation.
4.4.2 Phenology traits
Six consistent QTLs on different linkage groups, G1, G2, G4, G6, G7 and G8, were detected for
three phenology traits related with the time of shooting and blooming (beginning and end) in
two progenies. None was found in all locations, populations and characters. Only one at the
proximal end of G8 was detected in T1E for all characters, although the QTL for beginning of
flowering was not detected in Gimenells. The QTL on G6 appeared only in TxE and the
observed on G7 only in the E map. These characters are highly heritable and appear to be
related as suggested by the high correlations between their data of different environments,
but there are examples in the literature that do not support this hypothesis. In almond, a low
correlation between leafing and blooming dates was observed in a large sample of materials
(Kester et al. 1973), and later on Dicenta et al. (1993) identified that the level of correlation
between these traits was not strong enough for early selection of blooming date based on the
leafing date. Data from almond (Ballester et al. 2001; Sánchez-Pérez et al. 2007; Sánchez-Pérez
et al. 2012), peach (Quilot et al. 2004; Fan et al. 2010; Zhebentyayeva et al. 2014; Romeu et al.
2014) apricot (Olukolu et al. 2009; Campoy et al. 2011; Socquet-Juglard et al. 2013), sour
cherry (Wang et al. 2000) and integrating several Prunus species for comparing the inheritance
of this trait throughout the genus (Dirlewanger et al. 2012), are similar to those we found,
94
supporting a complex inheritance of these traits in peach and other Prunus with many genes
involved in each trait and different sets of these genes, partly overlapping between traits,
segregating in each mapping population (Dirlewanger et al. 2012).
For MD and FDP a major QTL was found on G4 in both populations (T1E and TxE). This locus
has been already detected using several populations from different Prunus species as peach,
apricot and sweet cherry (Dirlewanger et al. 2012). This fact suggests that a common
mechanism may control fruit maturation in different Prunus species. In peach this locus has
been fine mapped using a progeny where it was segregating as a codominant trait (Eduardo et
al. 2011; Pirona et al. 2013).
The juvenile reproductive phase refers to the period when young plants are unable to respond
to inductive environmental signals to induce flowering (Basheer, 2007), or to produce fruits as
it has been interpreted in this study. The transition to maturity stage is influenced by
environmental as well as genetic factors (Hackett, 1985). We scored this character as the
number of years required by each plant of T1E to produce fruit for the first time, with values
that ranged from three to six and identified a QTL (qP-Juv1) that explained of 13.3% of the
phenotypic variance and with the almond allele increasing the juvenility period. No other
results on genetic analysis of this character are to our knowledge available for Prunus, but in
citrus Raga et al. (2012) detected four QTLs related to juvenility that jointly explained 39.2% of
the phenotypic variance. Knowledge of the inheritance for this character may be helpful to
breed lines with short intergeneration periods that would speed up the breeding process.
4.4.3 Fruit traits
Several studies have been carried out to decipher fruit quality genetics in peach (de Souza et
al. 1998; Dirlewanger et al. 1999; Yamamoto et al. 2001; Etienne et al. 2002; Quilot et al. 2004;
Eduardo et al. 2011; Eduardo et al. 2013; Martínez-García et al. 2013) and in other Prunus
species (Wang et al. 2000; Zhang et al. 2010; Rosyara et al. 2013; Salazar et al. 2013), but few
of them have used interspecific populations (Quarta et al. 2000; Quilot et al. 2004). In this
study we have identified several loci involved in important fruit quality traits in two
interspecific progenies between almond and peach.
The fruit type trait has been mapped as a morphological marker in a 2 cM region of the TxE
map, the same region were the MD and the slow ripening locus have been recently located
95
(Eduardo et al. 2011; Pirona et al. 2013; Eduardo et al. 2014 in preparation). These authors
proposed a NAC-like transcription factor gene (ppa008301) as a candidate gene for both traits.
It could be that when almond alleles from this locus are in homozygosis, trees do not have the
ability to start the ripening process, and if the almond allele is in heterozygosis the effect is the
delay of the maturity date. Some authors suggested that a dry, splitting mesocarp is likely to
be ancestral for the common ancestor of subg. Amygdalus, and the fleshy, non-splitting
mesocarp found in peaches was probably developed in China (Yazbek et al. 2013) from wild
peach species such as P. davidiana (Carrière) Franch., P. kansuensis Rehder, and P. mira
Koehne, that are still cultivated locally in northern and northwestern regions from China
(Wang 1985). Our results suggest that another scenario could be possible and that the
common ancestor presented a fleshy mesocarp and almond lost the ability to ripen by a loss of
function the NAC-like gene ppa008301. Therefore, the Fruit type locus described here could
have been important during the domestication process of the actual fleshy peaches and during
the speciation process between almond and peach. Sequencing the homologue of ppa008301
in almond could shed light into this matter.
Blood flesh color has been mapped in T1E as a morphological trait (Bf2) at the end on G1.
However, in the TxE population this same trait detected only a major QTL on G3 (R2=50.7), in
the same genomic region were the anthocyanic anther color (Ag) has been located. Previously,
two loci implicated in this trait have been described, the blood-flesh phenotype determined by
a single recessive locus (Bf) located in G4 (Gillen and Bliss, 2005) present in ‘Harrow Blood’, a
cultivar showing blood-flesh in both immature and mature fruits, and the dominant blood flesh
phenotype coming from the ‘Wu Yue Xian’ cultivar that has been recently mapped by Shen et
al. (2013) at the top of G5 and that is controlled by a single dominant locus (DBF). Therefore,
these loci are not allelic to Bf2.
One major QTL was detected for the intensity of skin color on G1 in the same region where
one of the anther color genes was located (Ag2). For the percentage of skin color two major
QTLs were identified: one at the end of G1, in the same region of Bf2, and another on G4, in
the region of the Ft locus. Considering that TxE and T1E have been developed from the same
parents, this scenario reflects a complex genetic regulation of anthocyanic traits. A possible
explanation for this phenomenon is the relationship that could exist between the traits related
to the anthocyanin pigments in different parts of the plant. For example, the three loci
involved with the anther color (Ag and Ag2) and the blood flesh (Bf2) loci could have a
pleiotropic effect over other traits differentially expressed in both populations as the intensity
96
or percentage of red skin color. Another possible factor involved, is the ripening process that
could also modulate the ability to enable the expression of the percentage of external red
color. Frett et al. (2014) found a major and three minor QTLs for red blush in peach. The major
QTL is located in the same region of the QTL detected in TxE in G3. In T1E, two minor QTL were
detected on G4, one of which in the same region where the locus Flower color 2 (Fc2) has been
mapped.
QTLs cluster for Fruit weight and Fruit dimensions were detected on G6 and on G7 in T1E and
on G4 in TxE. The QTL observed on G4 in TxE presented a dominant effect from peach and for
this reason was not possible to identify it in the T1E population. Furthermore as we have
explained previously the cluster of QTLs located in G4 of TxE is probably a pleiotropic effect of
the Fruit type trait. In T1E, the cluster of QTLs from G6 includes QTLs for Fruit weight and
Stone weight and dimensions, and in G7 for Flesh weight and Fruit cheek Diameter, suggesting
that Fruit weight can be dissected in Flesh and Stone weights and that both are controlled by
different loci. Several QTLs have been described for FW in Prunus species, in G6 (Dirlewanger
et al. 1999) and in G4 and G6 (Yamamoto et al. 2001; Eduardo et al. 2011), in F2 intraspecific
populations in peach, and in G4 in a BC2 inter-specific population between P davidiana x P.
persica (Quilot et al. 2004). The locus from G4 has been detected in all the populations except
in JxF, where the fruit shape trait is segregating and could be masking the effects of the G4
locus. We must keep in mind that most populations where this locus has been associated with
FW are interespecific populations. Except in Yamamoto et al. (2001) that used two peach
parentals but one is an ornamental cultivar and has been selected for flower traits and not for
fruit size, and in CxA (Eduardo et al. 2011) where it was associated to a pleiotropic effect of the
MD, being bigger the fruits with longer FDP. The locus from G6 is associated with the locus
fruit shape (S) in the FJ (flat) x F (round). In CxA, where S is not segregating the QTL for fruit
weight was also detected. This could indicate that the locus controlling fruit shape is also
controlling the fruit weight in populations where S is not segregating. Looking at the position
where S has been mapped (Dirlewanger et al. 2006; Picañol et al. 2013) and to our cluster of
QTLs it is not clear if it is the same locus or not. These results suggest that these loci from G4
and G6 would have a broad effect in the peach germplasm during domestication.
For TA QTLs were detected in two out the three years of evaluation on G6 in both populations.
Although these QTLs were not consistent all years is important to note the coincidence with
other studies that presented QTLs in this group (Dirlewanger et al. 1999; Quilot et al. 2004).
97
4.4.4 Leaf traits
The location of the different QTLs identified for most of the leaf traits suggest that there are at
least two loci controlling most of the phenotypic variance and that are located in G1 and G8.
Another important locus also was identified on G6 for Leaf blade width and leaf weight. Almost
no data has been published for leaf traits neither in Prunus nor in other species (Chitwood et
al. 2013). As far as we know the only reported result for leaf dimensions in peach is the Nl
locus, a major gene for leaf shape (narrow / wide) identified by Yamamoto et al. (2001). This
locus was located in a genomic region coincident with the QTLs located in our study on G6,
suggesting that both loci could be allelic. Another leaf trait previously analyzed is the
chlorophyll content. In Prunus this trait has been studied in assessments associated with the
problematic of iron chlorosis in a population with a complex genetic background of Prunus
cerasifera, P. dulcis and P. persica, where two QTLs (G4 and G6) were identified for this trait
(Gonzalo et al. 2012). While our results are consistent in identifying QTLs in G6, the location of
these suggests they are not allelic. To interpret the results of leaf traits we must keep in mind
that are traits difficult to phenotype because although we tried to take representative leaves,
in each tree there is a wide variance of leaves in different stages of development. Although this
complexity, in this study we set out to discover some loci that contribute to the phenotypic
differences in leaf morphology between peach and almond.
4.4.5 Resistance to powdery mildew
Powdery mildew control in peach requires several fungicide applications per year with the
associated negative ecological and economical consequences. Most commercial peach
cultivars are susceptible to the disease, and although some sources of tolerance have been
found in peach (Pacheco et al. 2009) or close species as P. davidiana (Foulogne et al. 2003b) or
P. ferganensis (Dabov, 1983; Verde et al. 2002) mapping in G6, G7 and G8, only a source of
complete resistance has been described recently in the peach rootstock cultivar Pamirskij 5
(Pascal et al. 2010) and mapped as a single dominant gene in G6 (Pascal et al. 2010).
Therefore, the major gene Vr3 described in this study is a new source of full resistance to
powdery mildew in peach. The availability of different sources of resistance and molecular
markers linked to them allow pyramidizing them to obtain cultivars with more durable
resistance.
98
4.4.6 Implications for breeding and conclusions
Despite the low genetic diversity of occidental peach commercial cultivars (Scorza et al. 1985),
phenotypic variability has been observed for several fruit traits as flesh color
(white/yellow/blood), flesh adhesion (cling/freestone), fruit shape (flat/round), acidity
(acid/sub-acid) and skin hairiness (nectarine/peach) between others. Some of these traits have
been mapped (Arús et al. 2012; Salazar et al. 2014) and are currently being used in breeding
programs for marker assisted selection (Eduardo et al. 2013). However, peach variability could
be further enriched using oriental germplasm (Li et al. 2013) or using close species as almond
as donors. This last approach has been mainly used for rootstock development (Byrne et al.
2012) or for introgression of resistance (Foulogne et al. 2003a), but introgression for improving
fruit quality traits has not been reported. Some reasons that can explain why introgression in
peach is not a common strategy are the long intergenerational period and genetic linkage drag
of undesired traits. In this work we have identified interesting alleles from almond that could
be introgressed in peach, and although it is a long process, a possible strategy could be
generating pre-breeding collections of introgresión lines as the one that is being develop using
the plant material described here (Picañol et al. 2007). This strategy could allow to introgress
interesting traits in peach in a more efficient way. Some of these interesting alleles could be
the resistance to powdery mildew (Vr3), the blood flesh (Bf2) locus and the major QTLs for skin
color in G1 and G4. Another trait that could be further explored is the fruit type. Heterozygous
individuals for this character behaved as overdominant, producing fruits with higher weight
than those of either parent. Finally, given that at least one of the stone and flesh QTLs are
different it could also be interesting to investigate if certain allele combinations of these two
loci could allow produce commercial cultivars with a higher relationship flesh/stone.
5. MARKER-ASSISTED INTROGRESSION OF
ALMOND GENES INTO THE PEACH BACKGROUND:
A FIRST STEP TOWARDS THE CONSTRUCTION OF A
NIL COLLECTION OF ALMOND CHROMOSOME
FRAGMENTS INTO PEACH.
101
5.1 INTRODUCTION
Peach is a species with a low level of variability compared to other crops of the same genus
such as almond, apricot, plum or cherry (Byrne 1990; Mnejja et al. 2010). Considering only the
peach gene pool, occidental commercial germplasm has a lower level of variability than the
oriental materials, as estimated by Li al. (2013). This is a consequence of the absence in peach
of a functional self-incompatibility system, unlike most other Prunus, and of important
bottlenecks in its recent history since domestication 6.000 years ago in China (Faust and Timon
1995). Low levels of variability are a limit to the progress towards some of the main challenges
of current breeding programs that include longer shelf life, improved fruit quality, a higher
level of disease resistance and adaptation to climate change.
One way to increase genetic variation is by using the vast reservoir of novel alleles found in
landraces, cultivated relatives, and wild germplasm (Tanksley and McCouch 1997). New
sources of variability for peach varieties grown in the western countries may arise from other
sources known to be more variable such as local European cultivars (Aranzana et al. 2010),
Chinese accessions (Li et al. 2013) or other species of the genus that are compatible to peach,
such as other cultivated Prunus such as almond (P. dulcis) and Japanese plum (P. salicina) or
the wild relatives closer to peach, such as P. mira, P. kansuensis, P. davidiana, P. ferganensis,
and P. cerasifera. Crosses between these species are possible and some of the interspecific
hybrids have been developed and are currently used as rootstocks for peach (Martínez-Gómez
and Gradziel 2002; Gradziel 2003; Moreno 2004; Zarrouk et al. 2005; Felipe 2009, Pinochet
2009). Some of the first molecular marker maps of peach were developed using interspecific
populations between peach and almond (Foolad et al. 1995; Joobeur et al. 1998) and peach
crosses with P. davidiana (Foulongne et al. 2002). Given the low level of variability of peach,
these populations were a guarantee of a high marker polymorphism that facilitated the
development of highly populated maps with coverage of the entire genome. One of these
maps, an F2 between ‘Texas’ almond and ‘Earlygold’ peach was accepted by the scientific
community as the reference map for the genus and was taken as the basis for linkage group
assignment and direction and provided data on the position of a large number of transferable
markers to be used for the construction of maps in other populations (Dirlewanger et al.
2004).
102
Genes from compatible species have been a major source of useful variability in the cultivated
tomato, a species that shares with peach a low level of variability and is intercompatible with
many other wild relatives. These genes include mainly disease resistances (Zamir et al. 1994;
Griffiths and Scott 2001; Bai et al. 2003; Verlaan et al. 2013), but also characters important to
enhance favorable traits such as soluble solids content, yield, early fruit ripening, color, and
viscosity (Eshed and Zamir 1995; Tanksley and Nelson 1996; Fulton et al. 2000; Frary et al.
2002). Another example is apple (Malus x domestica) where the resistance to apple scab
(Venturia inaequalis) has been introgressed from M. floribunda (Crandall 1926; Crosby et al.
1992; Gessler et al 2006) and M. sieversii (Bus et al. 2005) into susceptible commercial apple
materials. In peach, while several nematode resistance genes have been identified and
characterized coming from P. cerasifera, almond and other peach cultivars and are being
introduced into rootstocks (Fernández et al. 1994; Felipe et al. 1997, Gomez-Aparisi et al.
2001), there is only one recent example of a resistance to powdery mildew that has been
introgressed into peach scions coming from P. davidiana (Foulongne et al. 2003a).
The study of quantitative characters using their co-segregation with markers from a linkage
map using markers of linkage maps of traditional populations presents various drawbacks. If
the number of individuals is low, typically below several hundred only one part of the QTLs can
be identified (Tanksley 1993), their position on the maps is estimated with low precision
(Lebreton et al. 1998) and their effects tend to be overestimated (Melchinger et al. 1998). In
all, this results in a partial or biased understanding of the genetic determinism of the character
under study. Eshed and Zamir (1994) proposed the construction of near-isogenic lines (NILs) as
a way to increase the efficiency of the genetic analysis of any character, particularly if
polygenic, and to detect new major genes and QTLs of interest provided by exotic or wild
genetic sources (Tanksley and Futon 2007). A NIL collection is composed by a low number of
individuals (usually 40-60), where each presents a unique introgression of the donor parent (a
wild or exotic line) on the background of the recurrent parent (an elite line of the parent with
economic interest), so that the sum of the fragments of the each individual of the collection
cover all the donor genome. Differences between the phenotypes of a given NIL and the
recurrent line are produced by genes that occur in the introgressed fragment. Since the NILs
and the recurrent parent can be replicated, phenotyping is done very accurately and the
effects of each introgressed fragment can be estimated in a homogeneous genotypic
background. This allows identifying and characterizing more QTLs and a more precise mapping
of these (Eshed and Zamir, 1994, Eduardo et al. 2007, Fernández-Silva et al. 2010). NIL
103
collections are also adequate to study the QTL x QTL (Grandillo et al. 2007; Fernandez-Silva et
al 2010), QTL x environment (Bernachi et al. 1998, Frary et al. 2000, Eduardo et al. 2005) and
QTL x genotype (Monforte et al. 2001, Swamy and Sarla 2008, Fernandez et al. 2009)
interactions.
Our long term objective is to create a NIL collection of almond chromosome fragments of
‘Texas’ into the background of ‘Earlygold’ peach. This will allow us a twofold objective: a) to
develop a resource for genetic analysis in peach, and b) to evaluate the capability of almond to
supply genes of interest for peach and to produce individuals with single fragments of almond
containing genes of interest for peach that are in the commercial peach background and thus
can be readily incorporated into commercial breeding programmes. So far NIL populations
have been created for annual species such as tomato (Eshed and Zamir 1995; Monforte et al.
2000), wheat (Pestsova et al. 2001), lettuce (Jeuken et al. 2004), rice (Sobriza et al. 2004),
melon (Eduardo et al 2005), diploid strawberry (Bonet 2010) or the model plant Arabidopsis
(Koumproglou et al. 2002; Keurentjes et al. 2007; Torjek et al. 2008; Fletcher et al. 2013)
where the number of generations is not a limiting factor in their progress. Nevertheless, this is
a critical question in peach due to its long intergeneration period (3-4 years). In this paper we
provide our results on the creation of a large backcross one population (‘Texas’ x ‘Earlygold’) x
‘Earlygold’ (T1E) and the selection from it of individuals with a low number of introgressions as
the primary step towards the controlled introgression of almond chromosomal fragments.
With the help of markers as a selection tool we propose a strategy that would allow the
production of commercial lines with one introgression in only two or three generations,
allowing for the incorporation of interesting almond alleles at the commercial peach breeding
operation.
5.2 MATERIALS AND METHODS
5.2.1 Plant materials and crosses
We used the hybrid plant ‘MB1.37’ coming from the cross between ‘Texas’ almond as female
parent and ‘Earlygold’ peach as pollen donor using the latter as recurrent parent to obtain a
backcross one generation (T1E). Crosses were performed during the spring of 2006, 2007 and
2008. Due to the high number of crosses performed, pollen from ‘Earlygold’ was kept in
Parafilm sealed Petri dishes at -20ºC, and used for the pollination of the following year. To
104
check for pollen viability we used the method described by Asma (2008) with an additional
15% of sucrose.
5.2.2 NIL development strategy
Given the long intergeneration period of Prunus, we chose a strategy that minimized the
number of generations. For that we produced a large BC1 progeny from which we selected as
many lines as possible with three or less introgressions. These lines would require only one
additional selfing generation (BC1S1) to obtain homozygous NILs with sufficient frequency. The
number of offspring required to obtain homozygous NILs would be 46 and 190 seedlings in
lines with two or three introgressions, respectively (calculated as n= log α /log (1-p), where n=
number of individuals, α = 0.05 and p= probability of finding a specific homozygous NIL, which
is (¼)k, with k=number of introgressions of the parental line). Individuals with more
introgressions would require an additional backcross generation to have heterozygous lines
with three or less introgressions that could be selfed and used to extract homozygous NILs.
Selecting in the first backcross generation has the additional advantage that the introgressed
fragments are large, reducing the probability of undetected introgressions with the marker
density used for this analysis.
5.2.3 Genotyping
Genomic DNA was extracted from young leaves using the CTAB method (Doyle and Doyle,
1990) omitting the final RNAse treatment step. Plants of T1E were selected using a three-step
procedure with the objective of reducing the cost of the operation. In the first step all plants
were analyzed with a set of eight SSRs (set 1; Table 8) located each at one of the extremes of
the eight Prunus linkage groups selected from the TxE map of Dirlewanger et al. (2004). Only
plants having three or less of these markers heterozygous for the almond allele were selected.
In the second step, the selected plants were then genotyped for a second SSR set (set 2; Table
8) with eight more SSRs located at the opposite extreme of the linkage group than those of set
1. Only the plants with three or less heterozygous loci for sets 1 and 2 were selected. Finally,
the selected plants were genotyped for 89 additional SSRs with coverage of the complete
genome. The eight markers of set 1 were selected to be multiplexed at an annealing
temperature (Ta) of 57ºC. Marker assisted selection (MAS) in the step two had to be
multiplexed in two groups of four markers, one (2a) at Ta=55ºC and the other (2b) at Ta=50ºC
(Table 8).
105
Table 8. The two sets of SSR markers used for the selection of the T1E lines with low numbers of introgressions. Sets with the same reference (1,2a and 2b) were multiplexed
Linkage group
Set Marker Annealing Temp. (oC)
Origin
G1 1 BPPCT028 57 Dirlewanger et al. (2002)
G2 1 CPPCT044 57 Aranzana et al. (2002)
G3 1 BPPCT007 57 Dirlewanger et al. (2002)
G4 1 EPDCU5060 57 Howad et al. (2005)
G5 1 CPPCT040 57 Aranzana et al. (2002)
G6 1 CPPCT021 57 Aranzana et al. (2002)
G7 1 CPSCT004 57 Mnejja et al. (2005)
G8 1 EPPCU3117 57 Howad et al. (2005)
G1 2a UDP96-018 55 Testolin et al. (2000)
G2 2b UDA-023 50 Messina et al. (2004)
G3 2a EPDCU0532 55 Howad et al. (2005)
G4 2a CPPCT051 55 Aranzana et al. (2002)
G5 2a BPPCT014 55 Dirlewanger et al. (2002)
G6 2b Ps7a2 50 Joobeur et al. (2000)
G7 2b Ps5c3 50 Cantini et al. (2001)
G8 2b CPSCT018 50 Mnejja et al. (2005)
All markers of the two first steps were analyzed in an ABI Prism® 3130xl (Applied Biosystems)
capillary sequencer. The PCR amplification conditions for the multiplex of eight SSRs were:
1.55 μl of HPLC water (Panreac), 1μl of Lab1X buffer (Lab 10X: KCl 50mM, Tris-HCl 10mM pH
8.3, gelatine 0.0001%), 0.6μl MgCl2 25mM (Applied Biosystems), 1μl of 2mM dNTP mix
(Applied Biosystems), 0.25μl of each forward primer labeled with fluorochrome 8μM (Applied
Biosystems), 0.2μl of each reverse primer 10μM (Applied Biosystems or Operon), 0.3μl of Taq
polymerase (Applied Biosystems).
The individuals selected that had three or less introgressions detected with the 16 SSRs tested
in the two before steps were genotyped with 93 additional SSRs. The SSRs used were the same
studied in T1E population (Chapter 3) with some exceptions: 14 markers (CPP8026, MA024a,
UDP98-025, M1a, CPPCT005, UDA-027, Ps12e2, BPPCT026, BPPCT038, CPP21413, CPP21245,
CPP20836, UDP98-408, BPPCT006) were excluded and 10 (CPPCT027, PceGA59, AMPA93,
106
BPPCT024, BPPCT023, CPPTC051, AMPA112, Pacita021, EPPCU9300, UDAp-423) were added,
resulting in similar genome coverage. In six markers (AMPA93, M14a, CPPCT017, CPPCT057,
CPPCT039 and M6a) was not possible interpret all genotypic information due to presented
preferential amplification in favour of peach genome therefore when the genotype was
homozygous for allele of ‘Earlygold’ we considered as missing data.
5.2.4 The preNIL set: phenotyping and genetic analysis
At the end of the selection process we chose a set of lines that had a low number of
introgressions and contained the whole almond genome so it was possible to use them as
parents towards the extraction of a complete set of NILs. This set of selected lines, to which we
will refer as preNILs, were phenotyped as described in Chapter 4. Our objective was to perform
a proof of concept for the genetic analysis of major genes using only this set of preNILs and
show that at this stage it is possible to determine their map positions. For that we studied all
major genes segregating in T1E, implying that they were additive or dominant for the almond
allele. We assayed also two major QTLs (i.e., those reproducible across years and with an
explained proportion of the variability higher than 20% each year) that were detected in the
T1E progeny and to check to what extent genetic analysis in the preNIL set was also possible
with certain QTLs.
For their genetic analysis, the lines of the preNIL set were divided into the two phenotypic
classes and we compared their graphical genotypes. Chromosomal regions having one
genotype in all individuals of one phenotypic class (the homozygote for the peach allele) and
the alternative (the heterozygote almond/peach) in the other were identified as those that
contained the gene under study.
107
5.3 RESULTS
5.3.1 Selection process in the backcross one generation
During years 2006 to 2008 we performed approximately 8,500 controlled pollinations that
yielded 1,720 seeds. These seeds were stratified and produced a total of 1,080 seedlings, to
which we added 15 BC1 plants obtained previously, with a total number of 1,095 analyzed
individuals. The first step of the process of marker-assisted selection (MAS) with 8 SSRs
allowed identifying 213 (19.5%) plants that did not belong to the BC1 population: they
originated from self-pollination (14.2%) or from cross-pollination (5.3%) with other
neighboring trees, which gave a final number of 882 BC1 plants. For this first set of markers,
3,899 (55.2%) were heterozygous with one allele of almond and another of peach, which we
interpreted as introgressions (Table 9). In all, G2 had the lowest percentage of heterozygous
individuals (48.7%) and G8 had the highest (66.3%). After marker examination, 226 plants (26%
of the initial 882) with 3 or less detected introgressions were carried to the next stage of
selection.
Table 9. Percentage of individuals having at least one introgression in each chromosome and on average in the different stages of selection in the BC1 generation of ‘Texas’ almond x ‘Earlygold’ peach.
Selection stage
Nº of plants1
Linkage group
G1 G2 G3 G4 G5 G6 G7 G8 Average
Stage 1 882 57.2 48.7 54.4 58.5 54.2 50.4 52.6 66.3 55.2
(8 SSRs) 226 37.4 25.2 28.5 37.5 28.5 33.8 28.6 44.5 33.0
Stage 2 226 45.3 38.0 37.7 46.4 41.8 39.7 42.3 50.3 42.6
(16 SSRs) 22 45.4 31.8 18.1 63.6 22.7 31.8 40.9 40.9 36.3
Stage 3 22 54.5 45.5 27.3 72.7 31.8 36.4 45.5 45.5 45.5
(109 SSRs) 9 66.7 11.1 11.1 77.8 33.3 11.1 33.3 44.4 33.3
1On the top line, the initial number of plants, the bottom line shows the number of plants selected at
the end of each stage to obtain plants with three or less introgressions.
Eight additional SSRs were genotyped in these 226 plants where we found 1,084 heterozygous
data, 59% of the total analyzed. Considering the 16 markers together and assuming that
individuals with both markers in heterozygosis for the almond allele in a particular linkage
group had a single introgression, the proportion of individuals with at least one introgression
ranged from 50.3% in G8 to 37.7% in G3 (Table 9). The plants selected to have three or less
108
introgressions at this stage were 22 (9.7% of the 226, or 2.5% of the 882), one with two
introgressions and the other 21 with three.
In a third step, 93 additional SSRs were analyzed in the 22 selected plants that allowed the
identification of undetected introgressions and genotyping errors in the previous steps leading
to the final selection of 9 plants with three or less introgressions (8 plants with three and one
plant with two). Three of these plants had very low vigor and were discarded for further use.
As a consequence, we had to change our original plan of having a set of preNILs with three or
less introgressions and completed these six plants with 12 individuals with four introgressions
to obtain a final set of 18 plants: one with two introgressions (preNIL 67), five with three
introgressions (preNILs 87, 147, 306, 630, 695) and 12 with four introgressions (preNILs: 3, 27,
31, 79, 110, 193, 333, 412, 498, 505, 694, 769). This group of plants (Table 10) covers at least
threefold the almond genome in all linkage groups except of G5 where coverage is more than
twice (Figure 14).
109
Table 10. Genotypes of the set of selected preNILs. To facilitate the overall interpretation the background has been highlighted with orange for heterozygous peach/almond genotypes (H), and with yellow for peach homozygous (B) genotypes.
1”-“ no data; these genotypes occurred in SSRs where the peach alleles were dominant and heterozygous for the ‘Earlygold’ parent resulting in segregations with two of the four classes that were indistinguishable
2The distances of the genetic map correspond at the map described in Chapter 1 in cM.
3 27 31 67 79 87 110 147 193 306 333 412 498 505 630 694 695 769
G1
EPDCU3122 0.8 B B H H B H B B B B B B B B B B H B
UDP96-018 1.4 B B H H B H B B B B B B B B B B H B
CPPCT004 7.9 B B H H B H B B B B B B B B B B H B
EPPCU5331 12.2 B B H H B H B B B B B B B B B B H B
PACITA005 12.2 B B H H B H B B B B B B B B B B H B
EPPCU1090 19.1 B B H H B H B B B B B B B B B B H B
UDP96-005 19.1 B B H H B H B B B B B B B B B B H B
CPPCT003 21.2 B B H H B H B B B B B B B B B B H B
CPPCT026 32.1 B B H H B H B B B B B B B B B B H B
EPDCU3489 35.3 B B H H B H B B B B B B B B B B H B
BPPCT016 43.6 B B H H B H B B B B H H B B B H H B
CPPCT019 46.7 B B H H B H B B B B H H B B B H H B
CPPCT042 47.7 B B H H B H B B B B H H B B B H H B
EPDCU2862 47.7 B B H H B H B B B B H H B B B H H B
CPPCT053 48.7 B B H H B H B B B B H H B B B H H B
CPPCT029 49.2 B B H H B H B B B B H H B B B H H B
BPPCT028 51.2 B B H H B H B B B B H H B B B H H B
G2
CPPCT044 0.0 H H H B B B B B B B H H B B B B B H
CPP8062 0.0 H H H B B B B B B B H H B B B B B H
AMPA93 1.4 H H - B - B - B B - H - B B - B - B
MA024a 5.4 H H H B B B B B B B H H B B B B B B
UDP98-025 6.5 H H H B B B B B B B H H B B B B B B
CPDCT044 7.5 H H H B B B B B B B H H B B B B B B
BPPCT004 10.1 H H H B B B B B B B H H B B B B B B
EPDCU4017 12.2 H H H B B B B B B B H H H B B B B B
BPPCT001 12.7 H H H B B B B B B B H H H B B B B B
CPSCT044 17.5 H H H B B B B B B B H H H B B H B B
M1a 19.6 H H H B B B B B B B H H H B B H B B
UDP96-013 21.6 H H H B B B B B B B H H H B B H B B
CPDCT004 25.2 H H H B B B B B B B H H H B B H B B
UDP98-411 26.3 H H H B B B B B B B H H H B B H B B
pchgms1 28.6 H B H B B B B B B B H H H B B H B B
BPPCT030 32.2 H B H B B B B B B B H H H B B H B B
CPPCT043 32.2 H B H B B B B B B B H H H B B H B B
CPSCT021 38.1 B B H B B B B B B B H H H B B H B B
PceGA34 45.1 B B H B B B B B B B H H H B B H - B
CPSCT034 48.8 B B H B B B B B B B H H H B B H B B
UDA-023 49.9 B B H B B B B B B B H H H B B H B B
G3
EPPCU5990 0.0 B H B B H B B B B B B B B B H B B B
EPPCU4610 0.0 B H B B H B B B B B B B B B H B B B
UDP97-403 6.5 B H B B H B B B B B B B B B H B B B
BPPCT007 6.5 B H B B H B B B B B B B B B H B B B
BPPCT039 15.5 B H B B H B H B B B B B B B H B B B
EPDCU3083 16.6 B H B B H B H B B B B B B B H B B B
CPPCT002 28.2 B H B B H B H B B B B B B B H B B B
UDP96-008 30.6 B H B B H B H B B B B B B B H B B B
EPDCU0532 42.6 B H B B H B H B B B H B B B H B B B
cM2Marker
(SSR)
preNILs collections
110
Table 3 (continued)
G4
BPPCT010 0.0 B H H B H H B B B B B H H B H B H B
EPDCU5060 1.1 B H H B H H B B B B B H H B H B H B
pchgms2 7.9 H H H B H H H B B B B H H B H B H B
CPPCT011 14.6 H H H B H H H H H B B H H B H B H B
CPPCT005 14.6 H H H B H H H H H B B H H B H B H B
CPDCT045 24.7 H H H H H H H H H B H H H B H B H H
UDP96-003 29.5 H H H H H H H H H B H H H B H B H H
M12a 31.6 H H H H H H H H H B H H H B H B H H
EPPCU2000 37.0 H H H H H B H H H B H H H B H B H H
BPPCT015 37.0 - - H H H - - H - B H - H B - B H -
UDA-021 40.6 H B H H B B H H H B H H H B H B H H
CPPCT046 40.6 H B H H B B H H H B H H H B H B H H
UDA-027 44.3 H B H H B B H H H B H H H B H B B H
Ps12e2 44.9 H B H H B B H H H B H H H B H B B H
G5
CPPCT040 0.0 B B H B B B B B B H B B H H B H H B
BPPCT026 4.0 B B H B B B B B B H B B - H B H H B
UDP97-401 5.4 B B H B B B B B B H B B H H B H H B
BPPCT017 15.3 B B H B B B B B H H B B B H B H B B
CPSCT006 15.3 B B H B B B B B H H B B B H B H B B
BPPCT037 17.9 B B H B B B B B H H B B B H B H B B
pchgms4 19.5 B B H B B B B B H H B B B H B H B B
CPPCT013 21.2 B B H B B B B B H H B B B H B H B B
EPDCU5183 26.9 B B H B B B B B H H B B B H B B B B
EPDCU4658 28.4 B B B B B B B B H H B B B H B B B B
BPPCT038 29.4 B B B B B B B B H B B B B H B B B B
CPSCT022 36.9 B B B B B B B B H B B B B H B B B B
BPPCT014 38.1 B B B B B B B B H B B B B H B B B B
G6
CPP21413 0.0 H B B B H B B B B B B H B B B B B H
Ps7a2 1.1 H B B B H B B B B B B H B B B B B H
CPP21245 1.1 H B B B H B B B B B B H B B B B B H
CPP20836 1.1 H B B B H B B B B B B H B B B B B H
UDP96-001 10.6 H B B B H B B B B B B B B B B B B H
BPPCT008 16.0 H H B B H B B B B H B B B H B B B H
CPSCT012 17.0 H H B B H B B B H H B B B H B B B H
pchcms5 20.7 H H B B B B B B H H B B B H B B B H
BPPCT025 24.1 H H B B B B B B H H B B B H B B B H
CPPCT047 27.6 H H B B B B B B H H B B B H B B B H
UDP98-412 34.4 H H B B B B B B H H B B B H B B B H
MA040a 34.4 H H B B B B B B H H B B B H B B B H
AMPA130 34.9 H H B B B B B B H H B B B H B B B H
MA14a 34.9 - H - - B - - B H - B B B H - B B -
EPPCU4092 37.0 H H B B B B B B H H B B B H B B B H
CPPCT030 43.0 H H B B B B B B H H B B B H B B B H
CPPCT021 43.0 H H B B B B B B H H B B B H B B B H
G7
CPSCT004 5.0 H B B B B B H B B B B B B H B B B B
CPPCT039 6.7 - - - B - B - - - B - - - H B - B -
pchgms6 11.4 H B B B B B H - B B B B B H B B B B
UDP98-408 12.9 H B B B B B H B B B B B B H B B B B
CPPCT057 18.0 - - B - B B - - B B - - B - - - - B
CPPCT033 24.1 H B B B B B B H B B B B B H B B B B
MA20a 25.8 H B B B B B B H B B B B B H B B B B
PMS02 27.9 H B B B B B B H B B B B B H H B B B
EPPCU5176 30.6 H B B B B B B H B B B B B H H B B B
pchcms2 31.1 H B B B B B B H B B B B B H H B B B
CPPCT017 39.1 - - B - B B - - H B - - B - - - - B
EPDCU3392 41.9 H B B B B B B H H B B B B B H B B B
Ps5c3 45.3 H B B B B B B H H B B B B B H B B B
G8
CPSCT018 0.0 B B B B H B H H B B H B H B B H B H
BPPCT006 7.8 B B B B H B B H B B H B H H B H B B
CPPCT058 7.8 B B B B H B B H B B H B H H B H B B
CPDCT034 7.8 - - B B - B - - B B - B H - B - B B
CPPCT006 13.7 B B B B H B B H B B B B H H B H B B
M6a 21.9 - B B - H B - - - - - - H H - - B -
UDP98-409 34.7 B B B B B B B H B H B B H H B H B B
EPDCU3454 38.4 B B B B B H B H B H B B H H B H B B
EPDCU3117 43.3 B B B B B H B H B H B B H H B H B B
111
Figure 14. Graphical genotypes of 18 backcross 1 lines that cover the whole peach genome with almond introgressions. Horizontal bars represent the eight chromosomes of
Prunus. The chromosomes are segmented by each SSR used in this study. The genome of peach is represented by yellow color while the almond genome is noted by
orange-red color. The red color highlights the introgressions that have allowed covering the whole genome with almond introgressions.
112
In this set of plants were found 66 introgressed fragments from almond in the peach genetic
background (Table 11): a third of them (22 introgressions) correspond to the entire
chromosome (at least one case per chromosome), and the remaining two thirds (44
introgressions) exhibited a single recombination event. In no case more than one
recombination event occurred in a given chromosome. The distribution of the different
fragments varied from 5 in G3 till 15 in G4, although most of them showed 6 to 8
introgressions. The average length of the introgression was 31.2 cM, representing an average
of 67.8 % of the total length of a linkage group. Three small introgressions were found: one in
G6 (preNIL 412) of 0.7 cM and two in G8 (preNILs 110 and 769) of 3.9 cM each.
Table 11. Characteristics of the introgressions of the 18 preNILs selected in the T1E offspring.
Linkage group
G1 G2 G3 G4 G5 G6 G7 G8 Average
Number of introgressions 7 7 5 15 7 8 6 10 8.1
Average length (cM) per introgression
35.3 35.7 34.3 37.2 24.3 27.2 25.3 30.5 31.2
% introgression1 68.9 71.6 76.1 81.2 61.0 63.2 55.9 64.1 67.8
1Average proportion of the genetic map of each linkage group covered by the almond introgression.
5.3.2 Genetic analysis
The phenotypic and genetic analysis on the preNILs was focused in the major genes identified
in the T1E population: resistance to powdery mildew (Vr3), flesh color (Bf2), flower color (Fc2),
Juiciness (Jui) and male sterility (Rf1 and Rf2). Anther color was not included in this analysis
because male-sterile plants, the majority in this group of plants (11), did not exhibit the
phenotype associated with the major gene (Ag2) described in the Chapter 2. Two major QTLs,
maturity date (qMD.G4) and stone weight (qSW.G6), were also evaluated.
For the resistance to powdery mildew, five preNILs (3, 27, 31, 333, and 412) were phenotyped
as resistant to the disease. These plants were all heterozygous almond/peach in a region of G2
(Figure 15). In contrast, the rest of the preNILs were susceptible to the disease and
homozygous for the peach allele at this region. The presence of the introgressions of the
preNILs 498 and 769 in G2 allowed reducing the position of the resistance gene to a region of
113
11.2 cM between markers AMPA93 and EPDCU4017. This genomic region coincides with the
location of the gene described in Chapter 2 between BPPCT004 and CPDCT044 in both TxE and
T1E, although the resolution was lower (11.2 vs. 2.7 cM) in the preNIL collection.
Figure 15. Identification of the map position of the powdery mildew resistance gene (Vr3) with the
preNIL set (between violet bars). The red color corresponds to the almond/peach heterozygote and the
yellow color to the peach homozygote. The red arrow indicates Vr3 position according to Chapter 4.
For the other major genes studied in the preNILs it was also possible to identify a specific area
of the genome including the gene responsible for the trait (Table 12), confirming the possibility
to study and identify major genes with this set of plants. For the fertility restorers Rf1 and Rf2,
where a single phenotype classification defined two genes, it was also possible to identify their
position on the map: in the subset of male sterile lines only the expected two fragments in G2
and G6 were homozygous for the peach allele whereas the fertile lines had heterozygous and
homozygous individuals (Figure 16).
Vr3
114
Figure 16. Identification of the map position of the fertility restores genes with the preNIL set. The red color corresponds to the almond/peach heterozygote and the yellow color to the peach homozygote. The violet bars indicate the position of the genes according to the preNIL set of plants. The arrow indicates the position of the gene in the T1E map (Chapter 3)
For complex traits, we studied two major QTLs, one for maturity date and another for stone
weight. The other major QTLs detected in T1E belonged to traits affected by two or more
consistent QTLs as the case of petiole length and percentage of external color (Chapter 4). In
the case of maturity date the analysis did not permit to identify consistently the position of
qMD.G4. Looking specifically at the region of G4 where the QTL occurs, we found that all lines
with late maturation presented the almond genotype in the region of G4, which is consistent
with what we would have expected, but the group with early maturation showed lines with
both genotypes (Figure 17).
115
Table 12. Mapping of major genes segregating in the T1E offspring using the 18 preNIL set and comparison with results with the entire T1E mapping population.
Major gene/QTL symbol LG marker interval cM preNIL
set1
cM T1E2
Powdery mildew resistance Vr3 G2 CPPCT044-EPPCU4017 11.2 2.7
Fruit flesh color Bf2 G1 EPDCU3122-BPPCT016 39.6 2.0
Juiciness Jui G1 EPDCU3122-BPPCT016 39.6 8.3
Flower color Fc G4 pchgms2-CPDCT045 16.8 6.0
Fertility restorer 1 Rf1 G2 CPPCT044-EPPCU4017 11.2 1.1
Fertility restorer 2 Rf2 G6 CPP21413-BPPCT008 13.3 5.4
Maturity date qMD G4 -3 - 6.34
Stone weight qSW G6 CPP20836-CPPCT021 27.0 15.24
1 Distance of flanking markers in the preNIL set.
2 Distance of flanking markers in the T1E map.
3 Not determined.
4According the QTL analysis with - 1 LOD criteria.
1 Recombination point. Figure 17. Identification of the map position of the maturity date QTL with the preNIL set. The red color
corresponds to the almond/peach heterozygote and the yellow color to the peach homozygote. The
purple horizontal line indicates the qMD position interval according to Chapter 4.
On the other hand, the analysis of stone weight was successful. When the preNILs were
ordered by stone weight we found that the set of lines with stones of 4.1 g or lighter had
associated a fragment of G6 with the peach genotype, whereas the heavier stones had this
fragment heterozygous for the almond allele (Figure 18).
116
Figure 18. Identification of the map position of the stone weight QTL with the preNIL set. The red color
corresponds to the almond/peach heterozygote and the yellow color to the peach homozygote. The
violet bars indicate the position of the QTL according to the preNIL set of plants. The purple horizontal
line indicates the qSW position interval according to Chapter 4.
5.4 DISCUSSION
In Chapter 4 we described what kind of variability can be incorporated into peach coming from
almond and have discovered interesting genes of fruit quality and disease resistance that could
enrich the peach genome. Here, we try to evaluate a breeding strategy based on marker-
assisted selection that would allow introgressing these genes into the peach commercial gene
pool in the shortest possible period of time, using also this effort to select a collection of NILs
that could be a useful resource for genetic analysis in the Prunus genus. In the following
paragraphs we discuss the results of the selection with markers in a large backcross one
population of almond and peach and their consequences on various aspects of the process of
gene introgression.
5.4.1 NIL development strategy
Nine individuals with three or less introgressions were selected representing the 1.02% of the
total of 882 offspring belonging to backcross one. Assuming that a single crossover is produced
in every pair of homologous chromosomes during meiosis in the almond x peach hybrid
117
individual used, the expected proportion of individuals with one, two or three introgressions is
2.73%, implying that 24 plants were expected from the 882 original, a significantly different
number than the 9 plants ( 2=9.7; P<0.01) observed. One possible explanation is that
individuals with homozygous fragments of the peach genome would have produced seed or
germinated less frequently than others or had resulted in weak or deleterious phenotypes,
causing them to die or be discarded for further analysis. This would be more frequent in the
individuals that we sought, as they were selected to have most of its genome homozygous for
the peach alleles. Examples of this are the three plants known to have three introgressions
that we discarded because of their low vigor, or the fact that certain genomic regions
appeared much more frequently as heterozygous than others, particularly the central region of
G4 or the proximal region of G8. Another explanation is that more than one recombination per
chromosome per meiosis occurred, although in this case our scenario seems realistic based on
the mapping data of the T1E population (Chapter 3).
The six preNIL survivors with three or less introgressions allowed full coverage of the peach
genome in 6 out the 8 linkage groups of the genus (G1, G2, G3, G4, G7, and G8) and 64.5% of
coverage in the remaining two groups (G5 and G6), representing a coverage over the whole
genome of 92,3%. Nevertheless, to complete the whole coverage of the genome; to facilitate
phenotypic characterization and genetic analysis and to continue the development of a second
backcrossing process 18 individuals were finally selected, including the six original preNILs plus
12 plants from BC1 with four introgressions.
The three-stage plan of selection with SSR markers produced the expected results. In total we
obtained a total of 13,451 individual data (including 213 markers analyzed in plants that were
dismissed as selfing or open pollinated), 10,568 in the first two steps and 2,883 in the third
step. If we had chosen to run 16 markers in the first step, we would have generated a total of
17,520 individual data, 60.3% more than that we have produced, meaning that our strategy led
to considerable savings of time and effort without loss of data quality. Full genotyping of the
preNILs improved the precision on the definition of the boundaries of the introgressed
fragments of each line. The average size of the introgressions was very high, 42.2 cM for
introgression, equivalent to 11.8% of total genetic map distance of T1E. In 1/3 of the cases the
introgression comprised the entire chromosome. These data are not surprising because the
selection was made in the first backcross generation, representing a single meiosis, whereas
118
smaller introgressions would be expected if it had occurred in later generations. Another
possible reason could be the low recombination rate of the almond x peach hybrid compared
to that of peach (Chapter 3) also observed in other interspecific crosses in Prunus (Arús et al.
2005) and in other species (Gebhardt et al. 1991; Tanksley et al. 1992). The advantage of an
early selection is that unidentified small introgressed fragments are unlikely, improving the
quality of the final NIL set. Moreover, the offspring of heterozygous NILs with large
introgressions or covering the whole genome may produce series of sub-NILs suitable for more
detailed genetic analysis and identification of genes in small chromosomal fragments
(Koumproglou et al. 2002). Nevertheless, it has the disadvantage that the phenotype of each
line is affected by many almond genes simultaneously, which in some cases may complicate
genetic analysis.
5.4.2 Choice of parental lines
NIL collections developed in different crops have been obtained on the genome of an inbred
line of the recurrent parent (Eshed and Zamir, 1995, Pestsova et al. 2001, Eduardo et al. 2005,
Monforte and Tanksley, 2000, Keurentjes et al. 2007, Fletcher et al. 2013). In our case the
individual we chose as recurrent parent, 'Earlygold', is a regular peach commercial cultivar
being partially heterozygous. Although peach is a species with a low level of variability
(Aranzana et al. 2010; Li et al. 2013), and as we have seen in Chapter 3 approximately half of
its physical distance is homozygous in ‘Earlygold’, this fact introduces an element of distortion
in the genetic analysis of a NIL collection because the genetic background of peach in each
preNIL (or later in the NIL) will not be completely fixed due to the segregation of the alleles
present in 'Earlygold'. This problem could have been avoided if the selected line would have
been homozygous, as in the few dihaploid lines that exist in this species (Monet et al. 1993) or
highly homozygous, as in traditional non-melting Spanish varieties (Aranzana et al. 2010).
However, the construction the NIL collection would have been delayed for a long time, since it
would require the development of the hybrid and then 3-5 additional years in order to begin
the process as we did with the hybrid 'MB 1.37'. This decided us to start, knowing this
limitation and considering that a) many of the important genes that almond may bring into
peach would have a clear qualitative effect, and b) that we can estimate in part the effects of
the variation in the ‘Earlygold’ background using its map derived from the T1E population as
we did in Chapter 4.
119
5.4.3 Mapping major genes and QTLs
This study demonstrates that the preNIL collection can be used for mapping simple
morphological traits and for identifying molecular markers flanking them. Analysis of
Mendelian trait loci in the preNIL collection has allowed locating a set of genes (Vr3, Fc2, Bf2,
Jui, Rf1 and Rf2) in the same genome positions as in the full T1E map, although as expected
with lower precision, using the phenotype and the graphical genotype of these lines. This proof
of concept is important because it means that this approach can be used in other preNIL
collections without previous knowledge on the genetics of the characters under study. PreNILs
carrying the character of interest may be advanced to further selection generations of
introgression allowing MAS of the fragment of interest given that its genome position is known
including that of markers nearby.
When we performed this analysis with major QTLs the outcome was less effective than with
major genes. For one of the characters we were able to identify the position of the QTL (seed
weight) but not for the other (maturity date). A reason for the latter result may be that
phenotypes could be masked by the segregation in the 'Earlygold' background. A significant
QTL explaining 18.5% of the phenotypic variance was identified on the ‘Earlygold’ map at this
region at Cabrils in 2012 (Chapter 4), in agreement with this hypothesis and suggesting that
‘Earlygold’ may be heterozygous at this locus for alleles that produce a minor effect compared
to the ‘Texas’ allele.
In all these results indicate that part of the major genes and major QTLs generated by the new
variability introduced in peach by the almond genome can be identified and mapped in a
preNIL collection of only 18 plants. Excluded from this analysis are all major genes/QTLs where
the allele of the donor parent is recessive and the characters determined by various QTLs or by
one that has minor effects. This genetic analysis, although partial, is worthwhile performing
during the process of introgression assisted by markers, because it provides useful data on the
inheritance of the traits analyzed and it requires a minimal expenditure of resources and time
as the number of plants studied is small. The information acquired allows implementing more
targeted and efficient strategies in further steps of the process that conclude with the
breeding of improved varieties incorporating one or more valuable genes from the donor
parent.
120
5.4.4 A model for marker-assisted introgression (MAI)
Two basic results of our research allow us to propose a model for introgressing genes from
exotic germplasm or close wild or cultivated relatives of woody perennials. The first is that
marker selection in a sufficiently large BC1 generation is enough to identify individuals with a
low number of introgressions covering most of the donor genome allowing to obtain in one or
two more generations either lines with elite genome background of the recurrent species that
could be introduced in a commercial breeding program or a set of homozygous NILs. In our
case, six plants selected from 882 BC1 offspring had three or less introgressions, contained
92.3% of the almond genome and were vigorous enough to perform adequately as parents for
the next generation. The second is that a small (15-25) set of preNILs with a short number of
introgressions allows mapping a part of the major genes/QTLs segregating as a consequence of
the wide cross. This facilitates the understanding of the variability incorporated by the donor
parent and enables the use of markers for their selection in the following steps of the process.
In summary these results indicate that the introgression process can be efficiently done in a
much shorter period of time with the aid of marker loci. Indeed, the usual 5-8 generations
needed to extract a collection of NILs (Eshed and Zamir 1994; Monforte and Tanksley 2000;
Eduardo et al. 2005) or to obtain a new cultivar with the backcross method (Allard et al. 1961)
in herbaceous species, would make the process practically unfeasible in a species of long
intergenerational period as the peach that would require 20-30 years (three years per
generation plus five of evaluation at the end of the process). This can be performed over a
period of 10-15 years with MAI.
The model proposed in this work is based in part on those developed by Tanksley and Nelson
(1996), Eshed and Zamir (1994, 1995), and Tanksley and Fulton (2007), and adapted to woody
species with long intergenerational period. The version for MAI in a breeding program and the
NIL extraction is summarized in Figure 19. It consists essentially of three steps: 1) the creation
of a large BC1 population (>1,000 individuals) from where 15-30 individuals (preNILs) with
ideally three or less introgressions are selected with markers, 2) the analysis of the preNIL
collection for the traits of interest and the characterization of segregating major genes/QTLs
that determine their expression, and 3) the advancement to a next generation of backcross or
selfing to obtain a collection of individuals with a single introgression in the background of a
peach elite commercial germplasm. The whole process could be done for peach or species of
similar chromosome numbers (x=7-10) with a minimum of two backcross generations. The
genetic evaluation performed in step 2 does not necessarily interfere or slow the process, as
121
crosses to advance to the BC2 or BC1S1 (step 3) could be done at the same time or before the
phenotyping for the traits is performed.
Figure 19. Scheme of the method for marker-assisted introgression from relatives or wild species into peach to obtain a near-isogenic line (NIL) collection or to develop a new cultivar.
122
Several circumstances may make the process longer or more complex or laborious. The
number of individuals to be analyzed in the BC1 generation to reach the objective of preNILs
with ≥3 introgressions increases with chromosome number. For species such as apple (x=17) or
grape (x=19) the number of BC1 plants needed for having a reasonable preNIL set would be too
high, implying that at least two backcross generations would be needed. Unforeseen
circumstances, as in the case of almond x peach hybrids the discovery of a cytoplasmic male
sterility system (Chapter 3), implied the addition of one generation to recover the peach
cytoplasm and allow for selfed seed from all preNILs to be obtained. This could be avoided by
starting the process with a hybrid individual coming from the reciprocal cross (peach x
almond). For backcross breeding, the large size of the introgression may result in linkage drag,
i.e. the unwanted effects of other genes included in the introgressed fragment. These may be
eliminated by reducing the size of these fragments (Tanksley et al 1989), which requires
additional backcross steps that could be monitored with markers developed within the
introgressed fragment.
The essential reason why peach breeders have almost never used other Prunus species for the
development of new varieties is the extremely high cost in time and effort needed to integrate
the exotic alleles. The generalization of molecular markers for genetic analysis and the steady
improvement of their quality and decreased costs provide an opportunity for using them in
areas that were difficult to imagine only a few years ago. Here we propose a strategy (MAI) to
make introgressed fragments available for peach breeding in a short period of time, with an
approach that allows monitoring what part of the peach and what of the almond genome are
present in each line. When considering its use as a source of novel variability for peach, MAI
can be expanded to other species different for almond. Interspecific hybrids are available
between peach and other species (P. davidiana, P. salicina, P. cerasifera, P. kansuensis, P. mira
and others) that could be backcrossed with peach and generate a large offspring that could be
selected with markers and individuals with low numbers of introgressions identified. The
discovery of genes of step 2 of our model provides the information to allow only individuals
carrying major genes of interest for a specific breeding program to be advanced to the next
generation. In this fashion, a wave of materials with foreign DNA fragments, but in the
background of the cultivated species, will be available for breeding and may represent a new
source of variability that may be essential to incorporate needed genes of pest and disease
resistance and fruit quality in peach for the next decades.
6. DISCUSIÓN GENERAL
125
6.1 Estudios genéticos y genómicos en melocotonero
El melocotonero es uno de los árboles frutales mejor caracterizados desde el punto de vista
genético. Los estudios desarrollados desde principios del siglo XX habían permitido identificar
un conjunto de 30 genes mayores descritos y revisados por Monet et al. (1996).
Posteriormente, el desarrollo y uso generalizado de los marcadores moleculares tipo RFLP
permitió la construcción del primer mapa genético saturado descrito en Prunus, mediante la
utilización de una población interespecífica entre almendro y melocotonero (Joobeur et al.
1998). Este mapa conocido como TxE terminaría siendo aceptado por la comunidad científica
como el mapa de referencia del género Prunus. En 2003, Aranzana et al. reportaron el
aumento de densidad del mapa de TxE con la inclusión de un nuevo tipo de marcadores
altamente polimórfico y transferible: los microsatélites. Ello se tradujo en la construcción de
nuevos mapas genéticos por otros grupos de trabajo, que utilizaron marcadores situados en el
mapa de TxE en diferentes especies del genero Prunus. La ubicación de los loci del mapa de
TxE fue comparada posteriormente con la de estos mismos marcadores en otros mapas
desarrollados en P. dulcis (Joobeur et al. 2000), P. ferganensis (Dettori et al. 2001), P.
armeniaca (Lambert et al. 2004), P. davidiana (Foulongne et al. 2003) y P. avium (Dirlewanger
et al. 2004); observando en todos ellos los ocho grupos de ligamiento representativos del
género y un alto nivel de sintenia et alinealidad entre marcadores, lo que sugería según Arús et
al. (2005) que las diferentes especies de Prunus estudiadas compartían el mismo genoma. En
estudios posteriores Illa et al. (2011) y Jung et al. (2012) utilizaron la información existente en
los mapas y las secuencias de Prunus, Fragaria y Malus, encontrando una conjunto de bloques
sinténicos conservados en los tres géneros, lo que permitió proponer un modelo de evolución
cromosómica de estos tres genomas a partir de un genoma ancestral compuesto de nueve
cromosomas para la familia Rosaceae.
Paralelamente al desarrollo de los mapas genéticos, el fenotipado de diversos caracteres en
poblaciones de mapeo en Prunus permitió localizar en el mapa de referencia un conjunto de
28 genes mayores (Dirlewanger et al. 2004), entre los que se encontraban muchos de los
recopilados por Monet et al. (1996). Además, una característica importante del conjunto de
genes identificados es que varios de ellos son responsables de variantes fenotípicas con
tremendo impacto para la industria: afectando entre otros al fruto (melocotón vs. nectarina,
fruto plano vs. redondo, tipo pavía vs. prisco, fundente vs. no fundente, sabor sub-ácido vs.
ácido, pulpa amarilla vs. blanca), la arquitectura del árbol (árbol columnar vs. normal), y la
resistencia a enfermedades (nematodo agallador de la raíz) (Arús et al. 2012). Posteriormente,
126
otros genes mayores han sido mapeados en poblaciones de melocotonero y localizados en el
mapa de referencia: uno que afecta la morfología de la flor (campanulácea vs. rosacea; Sh/sh)
mapeado en G8 (Ogundiwin et al. 2010; Fan et al. 2010); un gen que afecta el desarrollo del
fruto y causa aborto temprano (fruto que no aborta vs. fruto que aborta; Af/af) mapeado en
G6 (Dirlewanger et al. 2006), co-segregando con el locus de la forma del fruto (S/s). Otro gen
identificado afecta la coloración de la pulpa (antociánico vs. no antociánico; DBF/dbf),
produciendo un fenotipo de color rojo-violáceo que ha sido mapeado en el G5 (Shen et al.
2013) y podría tener grandes implicaciones en la mejora ya que generaría una tipología de
fruto no disponible en el mercado actualmente. El locus responsable del período de
maduración de la fruta (MD) fue mapeado en G4 por Eduardo et al. (2011). Otro gen
interesante es una fuente de resistencia (Vr2/vr2) al oídio identificada por Pascal et al. (2010)
localizado cerca del punto de rotura de una translocación recíproca entre los grupos de
ligamiento seis y ocho (Jáuregui et al. 2001; Yamamoto et al. 2005). La identificación de estos
genes provenientes de diferentes especies y de cruzamientos interespecíficos y su posterior
localización en el mapa de TxE estaría posibilitada, por la similitud de los genomas de las
especies estudiadas (Arús et al. 2012). Diversos estudios filogenéticos entre diferentes
especies del género Prunus (Badenes y Parfitt, 1995; Bortiti et al. 2001; Chin et al. 2014) y el
análisis de la resecuenciación de P. ferganensis, P. kansuensis, P. mira, P. davidiana y nueve
variedades de melocotonero (Verde et al. 2013; material suplementario 7) han corroborado la
estrecha relación genética entre ellos.
El uso del chip de SNPs desarrollado por el IPSC (International Peach SNP consortium) (Verde
et al. 2012) en las poblaciones TxE y T1E, juntamente con un juego de un centenar de SSRs de
posición conocida, nos ha permitido obtener mapas de alta densidad y calidad en ambas
poblaciones. El elevado número de marcadores obtenido en cada mapa (~2.000) nos indica
que el sesgo debido a la selección de estos SNPs en colecciones de melocotonero no ha
impedido detectarlos en el almendro, lo que facilitará su uso en otros cruzamientos entre
estas dos especies, permite considerar su uso para el estudio de la variabilidad en almendro e
indica que la proximidad entre almendro y melocotonero a nivel de secuencia génomica es
muy grande.
La comparación entre los mapas obtenidos en TxE, T1E y E, este último basado en la
recombinación ocurrida en el melocotonero ‘Earlygold’, han permitido también verificar que el
nivel de recombinación a nivel interespecífico es inferior al que ocurre dentro de la misma
especie, tal como se había observado en Prunus y en otras especies (Tanksley et al. 1992; Arús
127
et al. 2005). El descubrimiento de amplias regiones monomórficas en aproximadamente la
mitad del mapa de ‘Earlygold’ indica que una parte de su genoma es idéntico por
descendencia, lo que implica que está fijado tanto para los marcadores como para cualquier
otro gen que allí se encuentre. Ya que esta parece ser la situación generalizada en las
variedades comerciales de melocotonero (Eduardo et al. 2013; Martínez-García et al. 2013), la
conclusión es que el conocimiento de cuáles son estas regiones en los parentales usados,
juntamente con la información ya existente sobre la herencia y situación de genes y QTLs
importantes, puede ser muy útil en los programas de mejora para caracterizar los parentales a
cruzar y poder predecir que caracteres van a segregar y cuáles no en las poblaciones de
mejora.
En nuestro estudio hemos identificado diez genes mayores mediante la caracterización
genotípica y fenotípica de dos poblaciones interespecificas y en tres mapas genéticos (TxE, T1E
y E), lo que es un importante avance en el conocimiento genético en Prunus. La posición en el
mapa de dos genes ya descritos con anterioridad, la forma de la flor (Sh) y el color de la antera
(Ag), se estableció con mayor precisión. Los otros ocho genes han sido identificados por
primera vez, su descripción y ubicación se presenta detalladamente en el Capitulo 4, aunque
dos de ellos merecen principal atención. En G2 se encuentra Vr3 una nueva fuente de
resistencia al oídio no alélica del gen Vr2 previamente descrito por Pascal et al. (2010) en G6.
El color antociánico de la pulpa (Bf2) mapea en G1 y presenta una tipología similar al gen DBF
descrito en G5 por Shen et al. (2013). Bf2 difiere también por su acción génica y posición del
gen bf localizado en G4 (Bf2 es dominante mientras que bf es recesivo) que determina también
el color rojo de la carne (Shen et al. 2013). Otro genes con potencial interés es el Ft que
determina el tipo de fruto (almendro vs. melocotonero) y se encuentra en G4. Ft tiene un
efecto pleiotrópico sobre el carácter peso del fruto que se comporta como superdominante en
TxE, siendo el heterocigoto de mayor peso que cualquiera de los homocigotos. En la región de
G4 donde se halla Ft se concentra un grupo de genes, como el MD (época de maduración;
Eduardo et al. 2013), el Lb (época de floración en almendro; Ballester et al. 2001) y dos genes
relacionados con la consistencia de la carne (fundente vs. no fundente; M) y la adherencia del
hueso al fruto (clingstone vs. freestone; F) Peace et al. (2005). Estos genes, particularmente el
primero, podrían tener un efecto adicional en el carácter por lo que creemos que conviene un
estudio en mayor detalle que permita establecer su posible interés comercial. Finalmente, los
QTLs mayores involucrados en el porcentaje e intensidad de coloración antociánica en la
epidermis del fruto presentan interesantes opciones para su utilización en la mejora de
variedades de melocotonero.
128
Con respecto a los QTLs, Arús et al. en el año 2003 describían un conjunto de 28 QTLs
consistentes identificados en el mapa de referencia. Más de una década después se ha
incrementado grandemente el número de QTL identificados: Salazar et al. (2014) sitúan el
número de QTLs descritos en Prunus en 760, aunque muchos de ellos sean redundantes, es
decir, el mismo QTL localizado en diferentes poblaciones o años. Este aumento es lógico
teniendo en cuenta que los muchos de los caracteres agronómicos importantes como
productividad, resistencia a estreses abióticos, duración postcosecha y calidad nutricional son
de herencia cuantitativa (Tanksley, 1993; Tanksley y Fulton, 2007). Para ello ha sido necesario
crear mapas en nuevas poblaciones segregantes y fenotipar y diseccionar genéticamente estos
caracteres usando el software apropiado. La disponibilidad de marcadores de posición
conocida en el genoma y altamente reproducibles, como los contenidos en el mapa de
referencia y otros mapas relacionados, la facilidad de transferencia de algunos de estos
marcadores, particularmente los SSR, entre diferentes especies del género Prunus (Mnneja et
al. 2010) y la accesibilidad a esta información mediante la base de datos de las rosáceas
(http://www.rosaceae.org/), han sido sin duda elementos favorables al rápido crecimiento de
la información en este ámbito no tan solo en melocotonero si no también en otros frutales de
hueso.
La mayoría de estudios de análisis de caracteres agronómicos están hechos con pocos
individuos y en mapas construidos con pocos marcadores, suficientes para la localización de
genes mayores o QTLs pero con una resolución baja si de lo que se trata es de identificar los
genes causales y entender su función. Por ello, se torna cada vez más importante el desarrollo
de mapas genéticos de alta densidad y el análisis de colecciones de materiales más amplias
para la identificación de regiones genómicas estrechas que incluyan unos pocos genes
candidatos. Durante esta Tesis hemos construido tres mapas genéticos de alta densidad
mediante la saturación de mapas desarrollados previamente con marcadores SSRs, a los que
hemos añadido los SNPs del chip 9k de Illumina. Los datos obtenidos nos han permitido situar
los genes mayores que hemos descubierto en intervalos cromosómicos en algunos casos
bastante pequeños, lo que nos permite la localización de candidatos para dichos genes con
mayor facilidad. Un ejemplo es el de los PPRs que hemos localizado en las regiones donde se
encuentran los genes responsables de la restauración de la fertilidad (Capítulo 3).
Desarrollando una estrategia similar, Pirona et al. (2013) saturaron dos mapas genéticos lo que
les permitió reducir la distancia de los marcadores flanqueantes al locus putativo responsable
de la época de maduración de la fruta (MD) de 3.56 Mb a 220 kb, identificando que
129
correspondería a un factor de transcripción de la familia NAC. La región genómica donde
hemos localizado un gen mayor en TxE y un QTL mayor en T1E para este carácter contiene
también este factor de transcripción.
En el corto plazo, será posible llevar a cabo el proceso de caracterización genética mediante la
resecuenciación de individuos o poblaciones completas. La utilización de la información
proporcionada por estos proyectos permitirá obtener una mayor cantidad de marcadores que
con cualquier otro método anteriormente empleado, lo que sustentará la construcción de
mapas genéticos de resolución superior capaces de detectar con mayor exactitud los puntos
de recombinación. En este momento se están resecuenciando los individuos de la población de
mapeo T1E (Alexiou et al. 2014) con el objetivo de estudiar con inusual precisión las regiones
cromosómicas de interés detectadas en esta investigación y el desarrollo de marcadores para
aplicarlos eficazmente en la mejora genética del melocotonero.
130
6.2 Creación de una colección de NILs de almendro en el fondo genético del melocotonero
Al mismo tiempo que los cambios producidos en las plantas domesticadas son beneficiosos
para el hombre, principalmente en términos de productividad (Grandillo et al., 2007), los
procesos de domesticación de las plantas cultivadas han producido una serie de cuellos de
botella, de manera que sólo una pequeña porción de la variabilidad genética que se encuentra
en las especies silvestres está representada en los cultivares actuales (Torres et al. 2012). En el
caso del melocotonero este problema ha sido acentuado por la condición autógama de la
especie y por la utilización de muy pocos parentales en los programas de mejora que dieron
origen a las principales variedades cultivadas en América y Europa durante el siglo pasado
(Faust y Timon, 1995; Scorza et al. 1985). Estas son las principales causas que sitúan al
melocotonero como el frutal cultivado del género Prunus con menor variabilidad genética
(Byrne et al. 1990; Mnejja et al. 2010). Considerando estos antecedentes como una limitante
de la mejora genética del melocotonero, el grupo del IRTA se propuso la construcción de una
colección de NILs en el fondo genético del melocotonero cultivado con la finalidad de utilizar
especialmente las ventajas de este tipo de poblaciones en el estudio y mapeo de QTLs y en la
introgresión de genes exóticos en las variedades comerciales.
El primer elemento de análisis para dar inicio a un proyecto de esta envergadura se basó en la
elección de la especie que se utilizaría como parental donante. Esta elección se produjo
inicialmente en 1990, cuando el objetivo era crear un mapa genético saturado para el
melocotonero, y conociendo ya la poca variabilidad genética de esta especie. Se optó, tal como
hicieran antes en tomate - otra especie poco variable - Tanksley et al. (1986) por utilizar un
cruzamiento interespecífico que garantizaba el polimorfismo de los marcadores usados (en
aquel momento RFLPs) en la totalidad del genoma. El híbrido ‘Texas’ x ‘Earlygold’ (MB1.37)
seleccionado era parte del programa de mejora de patrones de melocotonero del IRTA dirigido
por Francisco J. Vargas y se eligió por ser una planta vigorosa y muy fértil. Más adelante, y
dado que la F2 de este híbrido produjo un número reducido de plantas capaces de producir
fruto, se decidió generar una descendencia BC1 que de acuerdo con los datos entonces
disponibles sería más fértil, como así ocurrió. La especie utilizada como donante es importante
por muchos motivos, de una manera particular por su capacidad para donar caracteres
interesantes y también porque su comportamiento con respecto a su fertilidad en el híbrido y
generaciones subsiguientes es crucial para el éxito de un proyecto como el que se pretendía
iniciar. Mientras que no existían dudas sobre el interés del almendro como posible donante
dado su alto polimorfismo y su mayor resistencia a diversas enfermedades, la falta de
131
conocimientos sobre el comportamiento de los híbridos almendro x melocotonero en
diferentes generaciones introducía un elemento de riesgo en el proyecto. Anderson y Weir
(1967), presentan uno de los primeros registros en los que se detalla de forma sistemática la
producción de híbridos interespecíficos entre especies del género Prunus. Los cruzamientos de
melocotonero con P. tenella, P. domestica, P. besseyi y P. davidiana, generaron descendientes
que presentaban en su mayoría un alto grado de rusticidad y resistencia, pero a la vez, una alta
proporción de aberraciones de las estructuras florales como pistilos pequeños con tendencia al
aborto; escasez o ausencia de polen e incapacidad para producir fruta, exceptuando el cruce
realizado con P. davidiana, que produjo híbridos con características intermedias entre ambas
especies mientras que los frutos se presentaban un mesocarpo muy delgado que al madurar se
separaba del hueso. La posibilidad de cruzar exitosamente melocotonero y P. davidiana
concuerda con los resultados presentados por Foulongne et al. (2003), que encontraron
regiones genómicas asociadas a la resistencia al oídio en dicha descendencia. Por otra parte,
las descripciones de Anderson y Weir (1967) sobre el tamaño de los pistilos son congruentes
con los resultados de nuestro trabajo donde fue posible identificar plantas con pistilos
pequeños en ambas poblaciones de estudio. Específicamente, un QTL que explicó el 76,2% de
la variación fenotípica se mapeo en G6 de TxE, en una región genómica que incluye también el
gen Af (fruit abortion) descrito por Dirlewanger et al. (2006) responsable del tamaño de los
pistilos y el aborto prematuro de los frutos. En T1E dos QTLs menores responsables del tamaño
del pistilo fueron también mapeados en otras posiciones (G1 y G4) que en TxE, sugiriendo que
diferentes loci en Prunus estarían involucrados en la determinación del tamaño y funcionalidad
del pistilo. También en relación con la capacidad productiva, Anderson y Weir (1967) señalan
que en los 14 años de estudio los híbridos del cruzamiento de melocotonero con ciruelo
europeo sólo produjeron frutos una temporada, situación extrapolable a la diferente
capacidad productiva de los individuos de TxE y T1E, y al hecho que algunas plantas no
produjeran fruta todos los años del estudio.
El segundo elemento determinante del proyecto fue el diseño del proceso de introgresión. Se
trata de una parte crítica porque la colección de NILs debía obtenerse con un número de
generaciones mínimo, dado que el largo período intergeneracional del melocotonero (3-4 años
hasta que puede obtenerse un número aceptable de frutos) prolongaría excesivamente el
proceso con estrategias parecidas a las usadas en especies herbáceas como el melón (Eduardo
et al. 2005), la lechuga (Jeuken y Lindhout, 2004), el tomate (Eshed y Zamir 1994) o el trigo
(Pestova et al. 2001) que necesitaron entre 4-5 (trigo) y 8-12 (tomate) generaciones. El modelo
propuesto para melocotonero consiste en tres fases: 1) Creación de una numerosa población
132
BC1 (>1.000 individuos) y selección en la misma de individuos con tres o menos introgresiones,
2) creación de una colección de líneas (15-25) con pocas introgresiones (preNILs) y análisis
genético de los caracteres segregantes, 3) autofecundación (BC1S1) o retrocruzamiento (BC2)
de las preNILs y obtención de la colección de NILs homocigoticas o heterocigoticas,
respectivamente. La fase 2 pretende recolectar información genética que sirva para
seleccionar los parentales más interesantes y facilitar el proceso de selección en generaciones
posteriores, pero no debería retardar el proceso al poderse hacer en paralelo con la fase 3. El
modelo sería también aplicable al proceso de introgresión de un fragmento de almendro en el
fondo de variedades elite de melocotonero en un programa de mejora, en el que las líneas
obtenidas en la fase 3 podrían ser usadas ya como parentales para la obtención de nuevas
variedades.
En la fase 1 se obtuvieron 1.080 individuos de los que 882 eran efectivamente de la población
BC1. Al final del proceso quedaron 9 líneas con 3 o menos introgresiones. El bajo vigor de tres
de ellas obligó a descartarlas, pero las seis líneas restantes presentaron una cobertura
prácticamente completa (92,7%) del genoma del almendro. Complementando, por tanto, esta
colección con una línea adicional con cuatro introgresiones que cubriera las regiones faltantes
sería suficiente para continuar el proceso. Nuestros datos demuestran que esta primera fase
es factible, a pesar de que el número de líneas con tres o menos introgresiones encontradas
estuviera por debajo de las esperadas, lo que fue probablemente debido a la selección en
contra de homocigotos en determinadas regiones genómicas.
Para el desarrollo de la fase 2, seleccionamos un grupo de 18 preNILs que incluían las seis
inicialmente seleccionadas más 12 con cuatro introgresiones. El estudio de la comparación
entre su genotipo y su fenotipo nos permitió situar en el mapa todos los genes mayores ya
identificados y mapeados anteriormente (Capítulo 4), lógicamente con menor precisión, pero
en las zonas genómicas esperadas. Los resultados con dos QTLs mayores en los que habíamos
encontrado un solo QTL por carácter produjeron resultados diversos, pudiendo ser mapeados
en un caso (peso del hueso) pero no en el otro (época de maduración). En general, nuestra
conclusión es que en una situación real, sin información previa, en la que quisiéramos estudiar
genes o QTLs mayores responsables de la variación de algunos de los caracteres segregando
cualitativamente en una colección de preNILs, seríamos capaces de situar en el mapa una
buena parte de ellos. Los más interesantes en estas poblaciones, como las resistencias
dominantes a enfermedades, podrían ser sin duda mapeados. Los que no podrían encontrarse
serían todos aquellos que fueran dominantes para el alelo del melocotonero, o una fracción de
133
los QTLs posiblemente aquellos que expliquen una parte más pequeña de la variabilidad o que
interaccionen de alguna manera con otros genes segregantes en la población.
La tercera etapa está en proceso de desarrollo, pero por la información que disponemos
actualmente sabemos que requerirá cambios importantes ya que nos encontramos con un
escollo de gran magnitud. En las población T1E y, de manera especial, en la sub-colección de
preNILs, se identificó un gran número de plantas androestériles, que se manifestaron por la
ausencia total de polen en sus tecas. El estudio genético de esta población nos permitió
identificar un sistema de androesterilidad citoplasmática con dos genes provenientes del
almendro capaces individual o conjuntamente de restaurar la fertilidad de los individuos
(Capítulo 3). Una primera consecuencia importante es que muchas de las preNILs son
androestériles (11 de las 18), por lo que no pueden autofecundarse para producir NILs en
homocigosis ni tampoco cruzarse con ‘Earlygold’ como parental femenino para obtener líneas
con pocas introgresiones y con el citoplasma del melocotonero. Esto significa que han sido ya
descartadas para la producción de NILs homocigóticas y han sido substituidas por otras, la
mayoría con cuatro, pero algunas con cinco introgresiones. La segunda consecuencia es que es
imprescindible la recuperación del citoplasma del melocotonero, lo que obliga a una nueva
generación de retrocruzamiento entre las preNILs androfértiles finalmente seleccionadas y
‘Earlygold’ como parental femenino. Todo ello supondrá retrasar una generación el final del
proceso, es decir, retrasar el proyecto 3-4 años más, aunque tenga la compensación parcial de
que los fragmentos introgresados serán menores de promedio. Un importante corolario de
estos resultados es que para evitar estos problemas de androesterilidad hay que procurar que
el citoplasma de los individuos de los diferentes retrocruzamientos sea el del parental
recurrente. Sin embargo, consideramos que la estrategia diseñada para la creación de una
colección de NILs de melocotonero ha sido globalmente exitosa y nos está permitiendo
avanzar en un ámbito en el que no existía prácticamente información alguna.
134
6.3 Perspectivas de futuro
La actividad realizada dentro de este trabajo abre nuevas perspectivas dentro de la
investigación en frutales dentro del grupo del IRTA. En primer lugar, nuestros resultados han
permitido establecer con bastante precisión la posición en el genoma de varios genes mayores,
algunos especialmente interesantes y no encontrados anteriormente en el melocotonero (Jui,
Bf2, Ft, Vr3, entre otros), que sería interesante explorar en más detalle y clonar en un futuro
próximo. Quedan muchos caracteres por evaluar, en una primera instancia resistencias a
enfermedades, pero también otros relacionados con el contenido en nutrientes del fruto, la
calidad postcosecha u otros que podrían inicialmente evaluarse en la colección de preNILs y
detectar otros genes de interés. El desarrollo de la colección de NILs está actualmente en el
BC2 y algunos individuos con una sola introgresión en heterocigosis han sido ya extraídos. La
colección completa de NILs en homocigosis, que esperamos en 5-6 años, permitirá disponer de
una herramienta de gran valor para el estudio de caracteres de herencia compleja y que
finalmente contribuirá al enriquecimiento del pool genético del melocotonero con genes
procedentes del almendro. En efecto, algunos genes y QTLs (Bf2, Vr3 y los QTL de color de la
piel, entre otros) presentan un interés evidente en mejora. Las líneas actuales suponen ya un
avance notable en nuestras posibilidades de integrarlos en variedades comerciales, para lo
cual habría que cruzarlas con parentales de programas de mejora, seleccionar luego con
marcadores los fragmentos de interés y evaluar el efecto de los nuevos genes así como el
arrastre de ligamiento que otros genes ligados pueda producir.
El almendro es una de las muchas especies de Prunus que pueden intercruzarse con el
melocotonero. Existen híbridos entre el melocotonero y P. cerasifera, P. mira, P. ferganensis,
P. kansuensis, P. davidiana o P. salicina, algunos de ellos usados como portainjertos. Hay
también híbridos con otros individuos de almendro que, dada la gran variabilidad existente en
esta especie (Mnneja et al, 2010), aportarán muy probablemente nueva variación interesante
y útil. La misma estrategia usada con el almendro podría aplicarse a estos híbridos, generando
colecciones de preNILs que permitieran evaluar algunos de los genes valiosos que estas
especies puedan contener y avanzar solamente a generaciones ulteriores aquellas que
prometan la incorporación de un carácter interesante. Es evidente que pueden surgir
dificultades inesperadas, empezando por la fertilidad de los híbridos disponibles, que
seguramente serán diferentes en cada especie. Sin embargo, la única manera de avanzar en
este ámbito es empezar proyectos parecidos asumiendo la existencia de riesgos e intentar
implicar en ellos a los mejoradores que son unos de los primeros beneficiarios de esta
135
búsqueda de genes. Una ventaja de este proceso es que cada paso adelante (cada generación
de retrocruzamiento y selección con marcadores queda consolidado y supone un avance hasta
el objetivo final que es la introducción en el germoplasma élite de melocotonero de genes de
almendro de interés. Nuestra experiencia en almendro abre un camino, del que solo hemos
recorrido algunas etapas, pero que ofrece premios tanto en aspecto científico como en el
comercial.
7. CONCLUSIONES
139
1. La utilización del chip IPSC de 9K juntamente con 131 marcadores microsatélite facilitó el
desarrollo de tres mapas genéticos de alta densidad: el primero de ellos en la población F2
(TxE) y los otros dos correspondientes a los parentales de la población BC1 (T1E y E),
permitiendo mejorar el conocimiento del genoma de melocotonero al identificar segmentos
mal ensamblados y reorientar algunos ‘supercontigs’ descritos en la primera versión del
genoma.
2. La calidad de los mapas obtenidos fue alta considerando la colinealidad, sintenia y presencia
de marcadores comunes entre TxE y T1E (>92% de coincidencia). El elevado número de
marcadores segregando en estas poblaciones sugiere que el chip IPSC de 9K de melocotonero
puede ser usado con éxito en otras poblaciones interespecíficas de melocotonero por
almendro.
3. El mayor nivel de recombinación observado en el mapa de E comparado con el de los mapas
de TxE y T1E confirma la tasa de recombinación es mayor en cruzamientos intraespecíficos que
en cruzamientos interespecíficos.
4. La presencia de grandes zonas (>2 Mb) sin marcadores en el mapa genético de E (103.0 Mb
del mapa físico de T1E) sugiere que dichos fragmentos son idénticos por descendencia
representado el 50% del mapa físico cubierto por T1E.
5. Se estableció que la presencia de individuos androestériles en las poblaciones genéticas de
TxE y T1E se debe a un mecanismo de esterilidad citoplasmática causada por la interacción del
citoplasma del almendro y el genoma nuclear del melocotonero. Los alelos dominantes, Rf1 y
Rf2, de dos genes independientes son capaces de restaurar la fertilidad. La posición de Rf1 y
Rf2 se estimó en 3.4 Mb en el grupo de ligamiento dos y en 1.4 Mb en el grupo de ligamiento
seis, respectivamente. En ambos fragmentos cromosómicos se localizaron genes codificando
para proteínas PPRs (pentatricopeptidos), que suelen estar asociadas a la restauración de la
fertilidad masculina en otras especies.
6. El análisis genético de los fenotipos estudiados ha permitido identificar un total de ocho
genes mayores además de los dos restauradores de fertilidad. Seis de ellos corresponden a
genes descritos por primera vez en el genoma de Prunus (Fc2, Ag2, Bf2, Jui, Ft, Vr3), mientras
que los otros dos (Ag y Sh) eran conocidos con anterioridad habiendo sido mapeados con
mayor precisión en esta tesis.
140
7. Se identificó un conjunto de 336 QTLs totales en los tres mapas analizados para el conjunto
de caracteres evaluados en los tres años de duración del estudio. De manera consistente se
detectaron 43, 2 y 19 QTLs en los mapas de T1E, E y TxE, respectivamente.
8. La identificación de un mayor número de QTLs en el mapa de T1E con respecto al mapa de
TxE estaría determinado principalmente por el estricto criterio para considerar valido un QTL
favoreciendo a la población más numerosa, especialmente para aquellos loci que explican una
baja proporción de la variación fenotípica observada
9. El bajo número de QTLs identificados en el mapa de E es consistente con la escasa
variabilidad del melocotonero y al hecho de que ‘Earlygold’ presentaría grandes zonas del
genoma idénticas por descendencia. Sin embargo el efecto de los alelos del almendro habría
podido enmascarar la detección de algunos QTLs en E.
10. Después del análisis de 1.095 genotipos en el BC1 ‘T1E’ identificamos nueve plantas con
tres ó menos fragmentos cromosómicos de almendro. Se seleccionaron seis de estos
individuos, con una cobertura del 92,3% en el fondo genético del melocotonero, y 12
adicionales con cuatro introgresiones que constituyeron una colección de 18 líneas (a las que
llamamos preNILs, con una cobertura completa del genoma.
11. La colección de preNILs permitió la identificación de la posición de los genes mayores que
segregan en esta población. En cambio, el análisis de los caracteres cuantitativos fue menos
fiable y solo uno de los dos QTLs estudiados pudo ser mapeado. Esto demuestra que se puede
obtener información relevante sobre la herencia de algunos caracteres a nivel de primer BC, lo
que es útil para realizar una selección de los mismos en posteriores generaciones con la ayuda
de marcadores.
12. La presencia de la androesterilidad citoplásmica obliga a introducir el citoplasma de
melocotonero en las líneas seleccionadas obteniendo descendientes entre las ‘Earlygold’ como
parental femenino y las preNILs androfértiles, así como a redefinir el juego de preNILs de
modo que sean androfértiles y contengan en conjunto todo el genoma del almendro. En
conjunto esto supone el retraso de una generación en el proceso de obtención de las NILs.
8. BIBLIOGRAFÍA GENERAL
143
Abbot AG, Lecouls AC, Want Y, Georgi L, Scorza R, Reighard G (2002) Peach: the model genome for Rosaceae genomics. Acta Hort. 592: 199–203 Abbott AG, Arús P, Scorza R (2008) Genetic Engineering and Genomics. In: Layne DR, Bassi D (Eds.), The Peach: Botany, Production and Uses. CABI publishing, Oxfordshire, pp. 136. Ahmad R, Parfitt D, Fass J, Ogundiwin E, Dhingra A, Gradziel T, Lin D, Joshi N, Martínez-García PJ, Crisosto C (2011) Whole genome sequencing of peach (Prunus persica L.) for SNP identification and selection. BMC Genom. 12:569–576 Allard RW (1961) Principles of plant breeding. J Willey and Sons Ltd. London New York. Alburquerque N, Garcia-Montiel F, Carrillo A, Burgos L (2008) Chilling and heat requirements of sweet cherry cultivars and the relationship between altitude and the probability of satisfying the chill requirements. Environ. Exp. Botany 64: 162–170 Alexiou K, Ribeiro-Serra O, Donoso JM, Tormo M, Aranzana M, Howard W, Arús P (2014) In silico detection of recombination breakpoints in an almond x peach interspecific cross. Next Generation Sequencing Conference (NGS). Barcelona, Spain. 2014, 2-4 june. Alonso JM, Socias R (2003) Lack of male-sterility allelism between peach and almond. Acta Hort. 622:257–260 Alvarado QH, González RI (1999) Manual del cultivo del Melocotón. 1ª Ed. PROFRUTA-MAGA, Guatemala. p 38. Anderson ET, Weir TS (1967) Prunus hybrids, selections and cultivars, atb the University of Minnesota fruit breeding farm. Technical Bulletin 252. pp 52. Aranzana MJ, Garcia-Mas J, Carbó J, Arús P (2002) Development and variability analysis of microsatellite markers in peach. Plant breeding 121:87–92 Aranzana MJ, Pineda A, Cosson P, Dirlewanger E, Ascasibar J, Cipriani G, Ryder CD, Testolin R, Abbott A, King GJ, Iezzoni AF, Arús P (2003) A set of simple-sequence repeat (SSR) markers covering the Prunus genome. Theor. Appl. Genet. 106:819–825 Aranzana MJ, El Kadri A, Howad W, Arús P (2010) Genetic variation, population structure and linkage disequilibrium in peach commercial varieties. BMC Genetics 11:69 Aranzana MJ, Illa E, Howad W, Arús P (2012) A first insight into peach [Prunus persica (L.) Batsch] SNP variability. Tree Genet Genomes 8:1359–1369 Arús P, Verde I, Sosinski B, Zhebentyayeva T, Abbott AG (2012) The peach genome. Tree Genet Genomes 8:531–547 Arús P, T Yamamoto, E Dirlewanger, Abbott AG (2005) Synteny in the Rosaceae. Plant Breeding Reviews, volume 27. Jules Janick (ed.) pp. 175–211 Asma, BM (2008) Determination of pollen viability, germination ratios and morphology of eight apricot genotypes. African J Biotechnol. 7 : 4269–4273
144
Badenes ML, Parfitt DE (1995) Phylogenetic relationships of cultivated Prunus species from an analysis of chloroplast DNA variation. Theor. Appl. Genet. 90:1035–1041 Bai Y, Huang CC, van der Hulst R, Meijer-Dekens F, Bonnema G, Lindhout P (2003) QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicon parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes. Mol Plant-Microbe Inter. 16: 169–176 Basheer R (2007) Juvenility, maturity, and rejuvenation in woody plants. Hebron University Research Journal 3 (1):17–43 Bassi D, Monet R (2008) Botany and Taxonomy. In: Layne DR, Bassi D (Eds.), The Peach: Botany, Production and Uses. CABI publishing, Oxfordshire, p. 136. Ballester J, Socias I, Company R, Arús P, de Vicente MC (2001) Genetic mapping of a major gene delaying blooming time in almond. Plant Breed. 120:268–270 Bielenger D, Gasic K, Chaparo JX (2009) An introduction to peach (Prunus persica). In: Folta KM, Gardiner SE (eds), Genetics and Genomics of Rosaceae. New York, NY, Springer. p. 223–234. Bliss FA, Arulsekar S, Foolad MR, Becerra V, Gillen AM, Warburton ML, Dandekar AM, Kocsisne GM, Mydin KK (2002) An expanded genetic linkage map of Prunus based on an interspecifi ccross between almond and peach. Genome 45:520–529 Bonet J (2010) Desarrollo y caracterización de herramientas genómicas en Fragaria diploide para mejorar el cultivo de la fresa. Tesis doctoral, Universidad Autónoma de Barcelona. p. 231 Boophati NM (2013) Genetic mapping and marker assisted selection. New York, NY, Springer. p. 291. Bortiri E, Oh SH, Jiang J, Baggett S, Granger A, Weeks C, Buckingham M, Potter D, Parfitt DE (2001) Phylogeny and Systematics of Prunus (Rosaceae) as Determined by Sequence Analysis of ITS and the Chloroplast trnL-trnF Spacer DNA. Systematic Botany 26(4):797–807 Bouhadida M, Martín JP, Eremin G, Pinochet J, Moreno MA, Gogorcena Y (2007) Chloroplast DNA diversity in Prunus and its implication on phylogenetic relationships. J. Amer. Soc. Hort. Sci. 132, 670–679 Budar F, Pelletier G (2001) Male sterility in plants: occurrence, determinism, significance and use. C R Acad Sci Paris 324:543–550 Bus VGM, Laurens FND,Van deWeg WE, Rusholme RL, Rikkerink EHA, Gardiner SE, Bassett HCM, Plummer KM (2005). The Vh8 locus of a new gene-for-gene interaction between Venturia inaequalis and the wild apple Malus sieversii is closely linked to the Vh2 locus in Malus pumila R12740-7A. New Phytol. 166: 1035–1049 Byrne DH (1990) Isozyme variability in four diploid stone fruits compared with other woody perennial plants. J. Hered. 8:68–71.
145
Byrne DH, Sherman WB, Bacon TA (2000) Stone fruit genetic pool and its exploitation for growing under warm winter conditions. In: Erez, A. (Ed.). Temperate Fruit Crops in Warm Climates . Boston, Kluwer Academic Publishers, p. 157–230. Byrne DH (2002) Peach breeding trends: A world wide perspective. Acta Hort. 592:49–59 Byrne DH (2005) Trends in stone fruit cultivar development. Hort. Technol . 15:494–500 Byrne DH, Raseira MB, Bassi D, Piagnani MC, Gasic K, Reighard GL, Moreno MA, Pérez S (2012) Peach. In: Badenes ML, Byrne DH (eds). New York, NY, Springer. p. 513–569. Campoy JA, Ruiz D, Egea J, Rees DJG, Celton JM, Martinez-Gomez P (2011) Inheritance of flowering time in apricot (Prunus armeniaca L.) and analysis of linked quantitative trait loci (QTLs) using simple sequence repeat (SSR) Markers. Plant Mol Biol Rep. 29: 404–410 Cantín CM, Crisosto CH, Ogundiwin EA, Gradziel T, Torrents J, Moreno MA, Gogorcena Y (2010) Chilling injury susceptibility in an intraspecific peach [Prunus persica (L.) Batsch] progeny. Postharvest Biol. Technol. 58:79–87 Cantini C, Iezzoni AF, Lamboy WF, Boritzki M, Struss D (2001) DNA fingerprinting of tetraploid cherry germplasm using simple sequence repeats. J. Amer. Soc. Hort. Sci. 126:205–209 Caruso CM, Case AL, Bailey MF (2012) The evolutionary ecology of cytonuclear interactions in angiosperms. Trends Plant Sci. 17:638–643 Castro A. Delgado ZA, Ramirez FJ, Puentes MG (1998) Manejo Post-cosecha y Comercialización de Durazno (Prunus pérsica (L.) Batsch). Serie de paquete de Capacitación sobre Manejo de Post-cosecha de frutas y Hortalizas. NRI, DFID, SENA, Convenio SENA Reino Unido. OP Gráficas, Bogotá, Colombia. 372 p. Chaparro JX, Werner DJ, O`Malley D, Sederoff RR (1994) Targeted mapping and linkage analysis of morphological isozyme, and RAPD markers in peach. Theor. Appl. Genet. 87:805–815 Chen L, Liu YG (2014) Male sterility and fertility restoration in crops. Ann. Rev. Plant Biol. 65:579–606 Chin SW, Shaw J, Haberle R, Wend J, Potter D (2014) Diversification of almonds, peaches, plums and cherries – Molecular systematics and biogeographic history of Prunus (Rosaceae). Molecular Phylogenetics and Evolution 13:34–48 Churchill GA, Doerge RW (1994) Empirical threshold values for quantitative trait mapping. Genetics 138:963–971 Chitwood DH, Kumar R, Headland LR, Ranjan A, Covington MF, Ichihashi Y, Fulop D, Jiménez-Gómez JM, Peng J, Maloof JN, Sinha RS (2013) A quantitative genetic basis for leaf morphology in a set of precisely defined tomato introgression lines. The Plant Cell 25: 2465 –2481 Collard BCY, Jahufer MZZ, Brouwer JB, Pang ECK (2005) An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvement: the basic concepts. Euphytica 142:169–196
146
Connors CH (1920) Some notes on the inheritance of unit characters in the peach. Proc.Amer. Soc. Hort. Sci. 16:24–36 Connors CH (1921) Inheritance of foliar glands of the peach. Proc.Amer. Soc. Hort. Sci.18: 20–26 Crisosto CH (2002) How do we increase peach consumption? Acta Hort. 592:601–605 Dirlewanger E, Pronier V, Parvery C, Rothan C, Guye A, Monet R (1998) Genetic linkage map of peach [Prunus persica (L.) Batsch] using morphological and molecular markers. Theor. Appl. Genet. 97:888–895 Crandall CS (1926) Apple breeding at the University of Illinois. Illinois Agric. Exp. Stn. Bull. 275: 341–600 Crosby JA, J Janick, PC Pecknold, SS Korban, PA O’Connor, SM Ries, J. Goffreda, Voordeckers A (1992) Breeding apples for scab resistance: 1945-1990. Acta Hort. (Wageningen) 317: 43–70 Cui X, Wise RP, Schnable PS (1996) The rf2 nuclear restorer gene of male-sterile T-cytoplasm maize. Science 272:1334–1336 Dabov S (1983) Inheritance of powdery mildew resistance in the peach. IV. Data supporting the hypothesis about the main role of 2 loci controlling the reaction to the pathogen. Genet. Sel. 16:349–355 Dicenta F, García JE, Carbonell EA (1993) Heritability of flowering, productivity and maturity in almond. J Hortic Sci 68:113–120 Dirlewanger E, Moing A, Rothan C, Svanella L, Pronier V, Guye A, Plomion C, Monet R (1999) Mapping QTLs controlling fruit quality in peach [Prunus persica (L.) Batsch]. Theor.Appl. Genet. 98:18–31 Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arus P, Laigret F (2002) Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). Theor. Appl. Genet. 105:127–138 Dirlewanger E, Graziano E, Joobeur T, Garriga-Calderé F, Cosson P, Howad W, Arús P (2004) Comparative mapping and markerassisted selection in Rosaceae fruit crops. Proc. Natl. Acad. Sci. USA. 101:9891–9896 Dirlewanger E, Cosson P, Boudehri K, Renaud C, Capdeville G, Tauzin Y, Laigret F, Moing A (2006) Development of a second-generation genetic linkage map for peach [Prunus persica (L.) Batsch] and characterization of morphological traits affecting flower and fruit. Tree Gen. Genomes 3:1 – 13 Eduardo I, Arús P, Monforte AJ (2005) Development of a genomic library of near isogenic lines (NILs) in melon (Cucumis melo L.) from the exotic accession PI 161375. Theor. Appl. Genet. 112:139–148
147
Eduardo I, Arús P, Monforte AJ, Obando J, Fernández-Trujillo JP, Martínez JA, Alarcón AL, Álvarez jM, van der Knaap E (2007) Estimating the genetic architecture of fruit quality traits in melón using a genome library of near isogenic lines. J. Amer. Soc. Hort. Sci. 132(1): 80–89 Eduardo I, Pacheco I, Chietera G, Bassi D, Pozzi C, Vecchietti A, Rossini L (2011) QTL analysis of fruit quality traits in two peach intraspecific populations and importance of maturity date pleiotropic effect. Tree Genet Genomes 7:323–335 Eduardo I, Chietera G, Pirona R, Pacheco I, Troggio M, Banchi E, Bassi D, Rossini L, Vecchietti A, Pozzi C (2013) Genetic dissection of aroma volatile compounds from the essential oil of peach fruit: QTL analysis and identification of candidate genes using dense SNP maps. Tree Genet. Genomes 9:189–204 Edwards D, Forster JW, Chagne D, Batley J (2007) What is SNPs? In: Oraguzie NC, Rikkerink EHA, Gardiner SE, De Silva HN, (eds) Association Mapping in Plants. Springer, Berlin, pp. 41–52. Etienne C, Rothan C, Moing A, Plomion C, Bodenes C, Dumas LS, Cosson P, Pronier V, Monet R, Dirlewanger E (2002) Candidate genes and QTL for sugar and organic acid content in peach (Prunus persica (L.) Batsch). Theor. Appl. Genet. 105:145–159 Eshed Y, Zamir D (1994) A genomic library of Lycopersicon pennellii in L. esculentum: a tool for fine mapping of genes. Euphytica 79:175–179 Eshed Y, Zamir D (1995) An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141:1147 – 1162 Fan S, Bielenberg DG, Zhebentyayeva TN, Reighard GL, Okie WR, Holland D, Abbott AG (2010) Mapping quantitative trait loci associated with chilling requirement, heat requirement and bloomdate in peach (Prunus persica). New Phytol. 185:917–930 FAOSTAT (2014) FAOSTAT. http//:www.faostat.fao.org. (ingreso 22-06-2014) Faust M, Timon B (1995) Origen and dissemination of peach. Hort. reviews 331–379. Faust M, Erez A, Rowland LJ, Wang SY, Norman HA (1997) Bud dormancy in perennial fruit trees: Physiological basis for dormancy induction, maintenance, and release. Hort. Science 32(4)623–629 Felipe AJ (2009) ‘Felinem’, ‘Garnem’, and Monegro’ almond x peach hybrid rootstocks. HortScience. 44: 196–197 Felipe AJ, Gomez-Aparisi J, Socias i Company R, Carrera M (1997). The almond × peach hybrid rootstocks breeding program at Zaragoza (Spain). Acta Hort. 451: 259–262 Fernández C, Pinochet J, Esmenjaud D., Salesses G. and Felipe A (1994) Resistance among new Prunus rootstocks and selections to root-knot nematodes in Spain and France. HortScience 29: 1064–1067 Fernandez-Silva I, Moreno E, Essafi A, Fergany M, García-Mas J, Martín-Hernández AM, Álvarez JM, Monforte, AJ (2010) Shaping melons: agronomic and genetic characterization of QTLs that modify melon fruit morphology. Theo. Appl. Genet. 121:931–940
148
Fideghelli C, Della Stada G, Grassi F, Morico G (1998) The peach industry in the world, present situation and trend. Acta Hort . 465:29–40 Foolad MR, S Arulsekar, V Becerra, Bliss. FA (1995) A genetic map of Prunus based on an interspecific cross between peach and almond. Theor. Appl. Genet. 91: 262–269 Foulogne M, Pascal T, Pfeiffer F, Kevella J (2002) Introgression of a polygenic resistance to powdery mildew from a wild species Prunus davidiana into peach (Prunus persica (L.) Batsch), a case study of marker assisted selection in fruit tree. Acta Hort . 592: 259–265 Foulongne M, Pascal T, Arús P, Kervella J (2003a) The potential of Prunus davidiana for introgression into peach [Prunus persica (L) Batch] assessed by comparative mapping. Theor. Appl. Genet. 107:227–238 Foulongne M, Pascal T, Pfeiffer F, Kervella J (2003b) QTLs for powdery mildew resistance in peach × Prunus davidiana crosses: consistency across generations and environments. Mol Breeding 12:33–50 Frary A, Doganlar S, Frampton A, Fulton TM, Uhlig J, Yates HE, Tanksley SD (2003) Fine Mapping of quantitative trait loci for improved fruit characteristics from Lycopersicon chmielewskii chromosome 1. Genome 46 (2):235–243 Frett TJ, Reighard GL, Okie WR, Gasic K (2014) Mapping quantitative trait loci associated with blush in peach [Prunus persica (L.) Batsch]. Tree Genet Genomes 10:367–381 Fujii S, Toriyama K (2009) Suppressed expression of retrograde-regulated male sterility restores pollen fertility in cytoplasmic male sterile rice plants. Proc. Natl. Acad. Sci. USA 106:9513–18 Fujii S, Bond CS, Small D (2011) Selection patterns on restorer-like genes reveal a conflict between nuclear and mitochondrial genomes throughout angiosperm evolution. Proc. Natl. Acad. Sci. USA 108:1723–1728 Fulton TM, Grandillo S, Beck-Bunn T, Fridman E, Frampton A, Lopez J, Petriard V, Uhlig J, Zamir D, Tanksley SD (2000) Advanced backcross QTL analysis of a Lycopersicon esculentum × Lycopersicon parviflorum cross. Theor. Appl. Genet. 100: 1025–1042 Gillen AM, Bliss FA (2005) Identification andmapping ofmarkers linked to the Mi gene for root-not nematode resistance in peach. J Amer. Soc. Hort. Sci. 130(1):24–33 Gomez-Aparisi J, Carrera M, Felipe AJ, Socias i Company R (2001). ‘Garnem’, ‘Monegro’ and ‘Felinem’: new almond × peach hybrid rootstocks, nematode resistant and red leaved for stone fruits. ITEA Producción Vegetal 97: 282–288 Gonzalo MJ, Dirlewanger E, Moreno MA, Gogorcena Y (2012) Genetic analysis of iron chlorosis tolerance in Prunus rootstocks. Tree Genet Genomes 8:943–955 HowadW, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arús P (2005) Mapping with a few plants: using selective mapping for microsatellite saturation of the Prunus reference map. Genetics 171:1305–1309
149
Hesse CO (1975) Peaches. J Janick and JN Moore (eds) Advances in Fruit Breeding 285-335 (Purdue University Press, West Lafayette, Indiana, USA. Gage J, Stutte G (1991) Developmental indices of peach: an anatomical framework. HortScience 26, 459–463 Gessler, C., A. Patocchi, S. Sansavini, S. Tartarini, and L. Gianfranceschi (2006) Venturia inaequalis resistance in apple. Crit. Rev. Plant Sci. 25:1–31 González-Agüero M, Pavez L, Ibañez F, Pacheco I, Campos-Vargas R, Meisel LA, Orellana A, Retamales J, Silva H, González M, Cambiazo V (2008) Identification of woolliness response genes in peach fruit after post-harvest treatments. J. of Experimental Botany 59 (8):1973–1986 Gradziel TM (2003) Interspecific hybridizations and subsequent gene introgression within prunus subgenus amygdalus. Acta Hort. 622:249–255 Griffiths P, Scott J (2001). Inheritance and linkage of tomato mottle virus resistance genes derived from Lycopersicon chilense accession LA 1932. J. Amer. Soc. Hort. Sci. 126: 462–467 Hackett WP (1985) Juvenility, maturation and rejuvenation in woody plants. Hort. Rev. 7: 109–155 Hancock JF, Scorza R, Lobos GA (2008). Peaches. In: Hancock JF (Ed.) Temperate fruit crop breeding, Springer, Netherlands, 265–298. Hayward MD, Bosemark NO, Romagosa I (1993). Preface. Plant Breeding. Principles and prospects. Chapman & Hall. London. p 550. Huang H, Cheng Z, Zhang Z, Wang Y (2008) History of Cultivation and Trends in China. In: Layne DR, Bassi D (Eds.), The Peach: Botany, Production and Uses. CABI publishing, Oxfordshire, p. 37–60. Hummer KE, Janik J (2009) Rosaceae: Taxonomy, Economic Importance, Genomics. In: Folta KM, Gardiner SE (eds), Genetics and Genomics of Rosaceae. New York, NY, Springer. p. 1–17. Iglesias I (2013) Peach production in Spain: Current situation and trends, from production to consumption. In: Mlilatovíc, D. (Ed.), 4th Conference, Innovations in Fruit Growing. Belgrade, pp. 75 –98. Illa E, Sargent DJ, Lopez Girona E, Bushakra J, Cestaro A, Crowhurst R, Pindo M, Cabrera A, Van der Knapp E, Iezzoni A, Gardiner S, Velasco R, Arús P, Chagné D, Troggio M (2011) omparative analysis of rosaceous genomes and the reconstruction of a putative ancestral genome for the family. BMC Evol. Biol. 11:9 Infante R, Martínez-Gómez P, Predieri S (2008) Quality oriented fruit breeding: Peach [Prunus persica (L.) Batsch]. J. of Food Agriculture & Enviroment 6(2):342–356 Itabashi E, Iwata N, Fujii S, Kazama T, Toriyama K (2011) The fertility restorer gene, Rf2, for Lead Rice-type cytoplasmic male sterility of rice encodes a mitochondrial glycine-rich protein. The Plant Journal 65:359–367
150
Janick J (2005) The origin of fruits, fruit growing and fruit breeding. Plant Breeding Review 25:255–320. Jansen RC, Stam P (1994) High resoluction of quantitative traits into multiple loci via interval mapping. Genetics 136:1447–1455 Jáuregui, B (1998) Localización de marcadores moleculares ligados a caracteres agronómicos en un cruzamiento interespecífi co almendro × melocotonero. PhD thesis, Universitat de Barcelona, Barcelona, Spain. Jáuregui B, de Vicente MC, Messeguer R, Felipe A, Bonnet A, Salesses G, Arús P (2001) A reciprocal translocation between ‘Garfi ’ almond and ‘Nemared’ peach. Theo. Appl. Genet. 102:1169–1176 Jelenkovic G, Harrington E (1972) Morphology of the pachytene chromosomes in Prunus persica. Canadian Journal of Gentics and Citology 14:317–324 Jeuken MJW, Lindhout P (2004) The development of lettuce backcross inbred lines (BILs) for exploitation of the Lactuca saligna (wild lettuce) germplasm. Theor. Appl. Genet. 109:394–401 Joobeur T, Periam N, de Vicente MC, Jáuregui B, Ballester J, Dettori MT, Verde I, Truco MJ, Messeguer R, Batlle I, Quarta R, Dirlewanger E, Arús P (1998) Construction of a saturated linkage map for Prunus using an almond x peach F2 progeny. Theor. Appl. Genet. 97:1034–1041 Joobeur T (1998) Construcción de un mapa de marcadores moleculares y análisis genético de caracteres agronómicos en Prunus. Tesis doctoral. Universitat de Lleida, España. p 161. Jung S and Main D (2014) Genomics and bioinformatics resources for translational science in Rosaceae. Plant Biotechnol Rep. 8(2):49–64 Kempe K, Gils M (2011) Pollination control technologies for hybrid breeding. Mol. Breeding 27:417–437 Kester D E, Raddi P, Asay R (1973) Correlation among chilling requirements for germination, blooming and leafing in almond (Prunus amygdalus Batsch). Genetics 74: s135. Keurentjes JJB, Bentsink L, Alonso-Blanco C, Hanhart CJ, Blankestijn-De Vries H, Effgen S, Vreugdenhil D, Koornneef M (2007) Development of a Near-Isogenic Line population of Arabidopsis thaliana and comparison of mapping power with a Recombinant Inbred Line population. Genetics 175:891–905 Kasambi DD (1944) The estimation of map distance from recombination values. Annals of Eugenics 12: 172 –175. Lammerts WE (1945) The breeding of ornamental edible peaches for mild climates. I. Inheritance of tree and fl ower characters. American Journal of Botany 32, 53–61 Lander ES, Botstein D (1989) Mapping Mendelian factors underlying quantitative traits using RFLP linkage maps. Genetics 121:185–199
151
Lebreton CH, Visscher PM, Haley CS, Semikhodskii A, Quarrie SA. (1998). A nonparametric bootstrap method for testing close linkage vs. pleiotrophy of coincident quantitative trait loci. Genetics 150:931–943 Lev-Yadun S, Gopher A, Abbo S (2000) The cradle of agriculture. Science 288: 1602–1603. Li XW, Meng XQ, Jia HJ, Yu ML, Ma RJ, Wang LR, Cao K, Shen ZJ, Niu L, Tian JB, Chen MJ, Xie M, Arús P, Gao ZS, Aranzana MJ (2013) Peach genetic resources: diversity, population structure and linkage disequilibrium. BMC Genetics 14:84 Linné (Linnaei), C (1758) Systema Naturae, 10th edn. Laurentii Salvii, Holmae, Stockholm. p 916. Llácer G (2005) Situación actual del cultivo del melocotonero. Tendencias. Agrícola Vergel 279:133–141 Lincoln SE, Daly MJ, Lander ES (1992) Constructing genetic maps with MAPMAKER/EXP 3.0, 3rd ed. Whitehead Institute Technical Report, Cambridge, Mass. Lu ZX, Reighard GL, Nyczepir AP, Beckman TG, Ramming DW (1998) Inheritance of resistance to root-knot nematodes in peach rootstocks. Acta Hort. 465:111–116 Luo D, Xu H, Liu Z, Guo J, Li H, Chen L, Fang C, Zhang Q, Bai M, Yao N, Wu H, Wu H, Ji C, Zheng H, Chen Y, Ye S, Li X, Zhao X, Li R, Liu Y-G (2013) A detrimental mitochondrial-nuclear interaction causes cytoplasmic male sterility in rice. Nat. Genet. 45:573–77 Lurin C, Andres C, Aubourg S, Bellaoui M, Bitton F, Bruyere C, Caboche M, Debast C, Gualberto J, Hoffmann B, Lecharny A, Le Ret M, Martin-Magniette ML, Mireau H, Peeters N, Renou JP, Szurek B, Taconnat L, Small I (2004) Genome-wide analysis of Arabidopsis pentatricopeptide repeat proteins reveals their essential role in organelle biogenesis. Plant Cell 16: 2089–2103 Matsuhira H, Kagami H, Kurata M, Kitazaki K, Matsunaga M, Hamaguchi Y, Hagihara E, Ueda M, Harada M, Muramatsu A, Yui-Kurino R, Taguchi K, Tamagake H, Mikami T, Kubo T (2012) Unusual and Typical Features of a Novel Restorer-of-Fertility Gene of Sugar Beet (Beta vulgaris L.). Genetics 192:1347–1358 Marini P, Reighard GL (2008) Crop Load Management. In: Layne DR, Bassi D (Eds.), The Peach: Botany, Production and Uses. CABI publishing, p. 289 - 302. Martínez-Gómez P, Gradziel TM (2002) New approaches to almond breeding at the University of California – Davis program. Acta Hort. 591: 253–256 Martínez-García PJ, Parfitt DE,Ogundiwin EA, Fass J, Chan HM, Ahmad R, Lurie S, Dandekar A, Gradziel TM, Crisosto CH (2012) Influencia of year and genetic factors on chilling injury susceptible in peach (Prunus persica L.) Batsch). Euphytica 185(2):267–280 Martínez-García PJ, Fresnedo-Ramírez J, Parfitt DE, Gradziel TM, Crisosto CH (2013) Effect prediction of identified SNPs linked to fruit quality and chilling injury in peach [Prunus persica (L.) Batsch]. Plant Mol. Biol. 81:175–188
152
Melchinger AE, Utz HF, Schön CC (1998) Quantitative trait locus (QTL) mapping using different testers and independent population samples in Maize reveals low power of QTL detection and large Bias in estimates of QTL effects. Genetics 149: 388–403 Messina R, Lain O, Marrazzo MT, Cipriani G, Testolin R (2004) New set of microsatellite loci isolated in apricot. Mol. Ecol. Notes 4:432–434 Mnejja M, Garcia-Mas J, Howad W, Arus P (2005) Development and transportability across Prunus species of 42 polymorphic almond microsatellites. Mol. Ecol. Notes 5:531–535 Mnejja M, Garcia-Mas J, Audergon JM, Arús P (2010) Prunus microsatellite marker transferability across rosaceous crops. Tree Genet Genomes 6:689–700 Moing A, Pöessel JL, Svanella-Dumas L, Loonis M. Kervella J (2003) Biochemical basis of low fruit quality of Prunus davidiana, a pest and disease donor for peach breeding. Journal of the American Society for Horticultural Science 128:55–62 Moyle LC, Nakazato T (2008) Comparative genetics of hybrid incompatibility: Sterility in two Solanum species crosses. Genetics 179: 1437–1453 Monet R, Guye A, Roy M, Dachary N (1996) Peach mendelian genetics: A short review and new results. Agronomie 16:321–329 Monforte AJ, Friedman E, Zamir D, Tanksley SD (2001) Comparison of a set of allelic QTL-NILs for chromosome 4 of tomato: deductions about natural variation and implications for germplasm utilization. Theor. Appl. Genet. 102:572–590 Moreno MA (2004) Breeding and selection of Prunus rootstocks at the Estación Experimental de Aula Dei, Zaragoza, Spain. Acta Hort . 658: 519–528 Ogundiwin E, Martı C, Forment J, Pons C, Granell A, Gradziel TM, Peace CP, Crisosto CH (2008) Development of ChillPeach genomic tools and identification of cold-responsive genes in peach fruit. Plant Mol. Biol. 68:379–397 Ogundiwin EA, Peace CP, Gradziel TM, Parfitt DE, Bliss FA, Crisosto CH (2009) A fruit quality gene map of Prunus. BMC Genomics 10:587 Olukolu B, Trainin T, Fan S, Kole C, Bielenberg D, Reighard G, Abbott A, Holland D (2009) Genetic linkage mapping for molecular dissection of chilling requirement and budbreak in apricot (Prunus armeniaca L.). Genome 52:819–828 Okie WR (1988) USDA peach and nectarine breeding at Byron, Georgia. In: Childers, N. and Sherman, W. (eds) The Peach. Horticultural Publications, Gainesville, Florida, pp. 51–56. Okie W, Blackburn B (2008). Interaction of chill and heat in peach flower bud dormancy. Hortscience 43: 1161–1161 Okie W, Bacon T, Bassi D (2008) Fresh marker cultivar development. In: Layne DR, Bassi D (Eds.), The Peach: Botany, Production and Uses. CABI publishing, Oxfordshire, p. 136. Ohta S, Nishitani C, Yamamoto T (2005) Chloroplast microsatellites in Prunus, Rosaceae. Mol. Ecol. Notes 5:837–840
153
Pacheco I, Eduardo I, Rossini L, Vecchieti A, Bassi D (2009) QTL mapping for peach (Prunus persica (L.) Batsch) resistance to powdery mildew and brown rot. Proceedings of the 53rd Italian Society of Agricultural Genetics Annual Congress Torino, Italy – 16/19 September, 2009 Paterson AH, Lander ES, Hewitt JD, Peterson S, Lincoln SE, Tanksley SD (1988) Resolution of quantitative traits into Mendelian factors by using a complete linkage map of restriction fragment length polymorphisms. Nature 335:721–726 Paterson AH (1996) Making genetic maps. In: Paterson AH (ed.) Genome mapping in plants, San Diego, California: Academic Press, Austin, Texas. p. 23–39. Pascal T, Pfeiffer F, Kervella J (2010) Powdery mildew resistance in the peach cultivar Pamirskij 5 is genetically linked with the Gr gene for leaf color. HortScience 45:150–152 Pelletier G, Budar F (2007) The molecular biology of cytoplasmically inherited male sterility and prospects for its engineering. Curr. Opin. Biotechnol. 18:121–125 Peace CP, Crisosto CH, Gradziel TM (2005) Endopolygalacturonase: a candidate gene for Freestone and Melting flesh in peach. Mol. Breed. 16:21–31 Pérez S (1989) Characterization of Mexican peach population from tropical and subtropical regions. Acta Hort . 254, 139–144 Pérez S, Montez S, Mejía C (1993) Analysis of peach germplasm in Mexico. J. Am. Soc. Hort. Sci. 118, 145, 519–524 Pestsova EG, Börner A, Röder MS (2001) Development of a set of Triticum aestivum – Aegilops tauschii introgression lines. Hereditas 135(2-3):139–143 Picañol R, Howad W, Alegre S, Batlle I, Arús P (2007) Introgressing genes from new sources into peach using whole-genome selection: Analysis of a large BC1 population (almond x peach) x peach. In: Twelfth Eucarpia Symposium on Fruit Breeding and Genetics. Zaragoza (España) septiembre 2007, p. 161 Picañol R, Eduardo I, Aranzana MJ, Howad W, Batlle I, Iglesias I, Alonso JM, Arús (2013) Combining linkage and association mapping to search for markers linked to the flat fruit character in peach. Euphytica 190:279–288 Pinochet J (2009) ‘Greenpac’ a new peach hybrid rootstock adapted to Mediterranean conditions. HortScience 44: 1456–1457 Pirona R, Eduardo I, Pacheco I, Linge C, Miculan M, Verde I, Tartarini E, Dondini L, Pea G, Bassi D, Rossini L (2013) Fine mapping and identification of a candidate gene for a major locus controlling maturity date in peach. BMC Plant Biol. 13:166–179 Potter D, Eriksson T, Evan, RC, Oh SH, Smedmark JEE, Morgan DR, Kerr M, Robertson KR, Arsenault M, Dickinson TA, Campbell CS (2007) Phylogeny and classification of Rosaceae. Plant Syst. Evol. 266:5–43. Potter D (2011) Prunus. In: C Kole (ed), Wild Crop Relatives: Genomic and Breeding Resources New York, NY, Springer. p. 129 –145
154
Quarta R, Dettori M T, Sartori A, Verde I (2000) Genetic linkage map and QTL analysis in peach. Acta Hort. 521, 233–241 Quilot B,Wu BH, Kervella J,GénardM, FoulongneM,Moreau K (2004) QTL analysis of quality traits in an advanced backcross between Prunus persica cultivars and the wild relative species P. davidiana. Theor. Appl. Genet. 109:884–897 Raga V, Bernet GP, Carbonell EA, Asins MJ (2012) Segregation and linkage analyses in two complex populations derived from the citrus rootstock Cleopatra mandarin. Inheritance of seed reproductive traïts. Tree Genet. Genomes 8:1061–1071 Rajapakse S, Bethoff LE, He G, Estager AE, Scorza R, Verde I, Ballard RE, Baird WV, Callahan A, Monet R, Abbott AG (1995) Genetic linkage mapping in peach using morphological, RFLP and RAPD markers. Theor. Appl. Genet. 90:503–510 Rieger M (2006) Peach (Prunus persica). In: Introduction to fruit crops. The Haworth Press, Inc., New York, p. 311-323. Rodriguez J, Sherman WB, Scorza R, Wisniewski M, Okie WR (1994) Evergreen peach, its inheritance and dormant behavior. J. Amer. Soc. Hort. Sci. 119:789–792 Romeu JF, Monforte AJ, Sánchez G, Granell A, García-Brunton J, Badenes ML, Ríos G (2014) Quantitative trait loci affecting reproductive phenology in peach. BMC Plant Biol. 14:52-68 Ruiz D, Campoy JA, Egea J (2007) Chilling and heat requirements of apricot cultivars for flowering. Environ Exp Bot 61: 254–263 Salazar JA, Ruiz D, Egea J, Martínez-Gómez P (2013) Inheritance of fruit quality traits in apricot (Prunus armeniaca L.) and analysis of linked quantitative trait loci (QTLs) using simple sequence repeat (SSR) markers. Plant Mol. Biol. Rep. 31. doi: 10.1007/s11105-013-0625-9 Salazar JA, Ruiz D, Campoy JA, Sánchez-Pérez R, Crisosto CH, Martínez-García PJ, Blenda A, Jung S, Main D, Martínez-Gómez P, Rubio M (2014) Quantitative Trait Loci (QTL) and Mendelian Trait Loci (MTL) Analysis in Prunus : a Breeding Perspective and Beyond. Plant Mol Biol Rep 32:1–18 Sanchez-Perez R, Howad W, Dicenta F, Arus P, Martinez-Gomez P (2007) Mapping major genes and quantitative trait loci controlling agronomic traits in almond. Plant Breed. 126:310–318. Sánchez-Pérez R, Dicenta F, Martínez-Gómez P (2012) Inheritance of chilling and heat requirements for flowering in almond and QTL analysis. Tree Genet Genomes 8:379–389 Sansavini S, Gamberini A, Bassi D (2006) Peach breeding, genetics and new cultivar trends. Acta Hort. 713: 23–48 Savala J, Polák J, Oukropec I (2013) Evaluation of the Prunus Interspecific Progenies for Resistance to Plum Pox Virus. Czech J. Genet. Plant Breed. 49(2): 65–69 Scott D H, Weinberger JH (1938) Inheritance of pollen sterility in some peach varieties. Proc. Am. Soc. Hort. Sci. 45:229–232
155
Scorza R, Mehlenbacher SA, Lightner GW (1985) Inbreeding and coancestry of freestone peach cultivars of the eastern United States and implications for peach germplasm improvement . J. Amer. Soc. Hort. Sci. 110:547–552 Scorza R. Okie WR (1990) Peaches (Prunus). In: Moore, J.N. and R.B. Ballington (eds) Genetic Resources of Temperate Fruit and Nut Crops 1. Acta Hort. 290 (2): 177–231 Scorza R. Sherman WB (1996) Peaches. In: Janick J, JN Moore (eds) Fruit Breeding Vol I: Tree and Tropical Fruit. New York, NY, Wiley & Sonc Inc. p. 177–231 Schnable PS, Wise RP (1998) The molecular basis of cytoplasmic male sterility and fertility restoration. Trends Plant Sci. 3:175–180 Scorza R, Melnicenco L, Dang P, Abbott AG (2002) Testing a microsatellite marker for selection of columnar growth habit in peach (Prunus persica (L.) Batsch). Acta Hort. 592:285–289 Shapiro SS, Wilk MB (1965) An analysis of variance test for normality (complete samples). Biometrika 52 (3-4): 591–611 Shen Z, Confolent C, Lambert P, Poëssel J-L, Quilot-Turion B, Yu M, Ma R, Pascal T (2013) Characterization and genetic mapping of a new blood-flesh trait controlled by the single dominant locus DBF in peach. Tree Genet Genomes (2013) 9:1435–1446 Shulaev V, Korban SS, Sosinski B, Abbott AG, Aldwinckle HS, Folta KM, Iezzoni A, Main D, Arús P, Dandekar AM, Lewers K, Brown SK, Davis TM, Gardiner SE, Potter D, Veilleux RE (2008) Multiple models for Rosaceae genomic. Plant Physiology 147:985–1003 Shulaev V, Sargent DJ, Crowhurst RN, Mockler T, Veilleux RE, Folkerts O, L. Delcher AL, Jaiswal P, Liston A, Mane SP, Burns P, Mockaitis K, Davis TM, Slovin JP, Bassil N, Hellens RP, Evans C, Jensen RV, Allan AC, Michael TP, Setubal JC, Celton JC, Rees DJG, Williams K, Holt SH, Dickerman A, Ruiz Rojas JJ, Chatterjee M, Liu B, Silva H, Meisel L, Filichkin AAS, Velasco R, Troggio M, Viola R, Borodovsky M, Ashman TL, Aharoni A, Bennetzen J, Dharmawardhana P, Elser J, Raja R, Priest HD, Bryant Jr. DW, Fox SE, Givan SA, Naithani S, Christoffels A, Salama DY, Carter J, Lopez Girona E, Zdepski A, Wang W, Kerstetter RA, Salzberg SL, Schwab W, Korban SS, Davik J, Monfort A, Denoyes-Rothan B, Arus P, Mittler R, Flinn B, Folta KM (2011) The genome of woodland strawberry (Fragaria vesca). Natur Gen. 43(2):109–116 Socquet-Juglard D, Christen D, Devènes G, Gessler C, Duffy B, Patocchi A (2013) Mapping architectural, phonological, and fruit quality QTLs in apricot. Plant Mol. Biol. Rep. 31:387–397 Tanskley SD, Young ND, Paterson AH, Bonierbale MW (1989) RFLP mapping in plant breeding: new tools for and old science. Biotechnology 7: 257–264 Tanksley SD (1993) Mapping polygenes. Annu. Rev. Genet. 27:205–233 Tanksley SD, Grandillo S, Fulton TM, Zamir D, Eshed T, Petiard V, Lopez J, Beck-Bunn T (1996) Advanced backcross QTL analysis in a cross between an elite processing line of tomato and its wild relative L. pimpinellifolium. Theor. Appl. Genet. 92:213–224.
156
Tanksley SD, Nelson JC (1996) Advanced backcross QTL analysis: a method for the simultaneous discovery and transfer of valuable QTLs from unadapted germplasm into elite breeding lines. Theor. Appl. Genet. 92: 191–203
Tanksley SD, McCouch SR (1997) Seed banks and molecular maps: Unlocking genetic potential from the wild. Science 277:1063–1066 Tanksley SO, Ganal MW, Prince JP, DVicente MC, Bonierbale MW, Broun P, Fulton TM, Giovannoni JJ, Grandillo S, Martin GB, Messeguer R, Miller JC, Miller L, Paterson AH, Pineda O, Riider MS, Wing RA, Wu W, Young ND (1992) High density molecular linkage maps of the tomato and potato genomes. Genetics 132: 1141-1160 Tanksley SD, Fulton TM (2007) Dissecting quantitative trait variation - examples from the tomato. Euphytica 154:365–370 Testolin R, Marrazzo T, Cipriani G, Quarta R, Verde I, Dettori MT, Pancaldi M, Sansavini S (2000) Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome 43(3):512–520 Tennessen JA, Govindarajulu R, Liston A, Ashman TL (2013) Targeted Sequence Capture Provides Insight into Genome Structure and Genetics of Male Sterility in a Gynodioecious Diploid Strawberry, Fragaria vesca ssp. bracteata (Rosaceae). G3. 3:1341-1351 Thompson JM, Vanderwet T, Draper AD, Blake RC (1976) Evidence of cytoplasmic and genetic male-sterility in pears. J. Hered. 67:339–346 Torres AM, Monforte AJ, Millán T, Satovic Z (2012) Análisis de QTLs para la mejora genética vegetal. En: Ferrer JJ, Ordás A, Pérez de la Vega (eds) La genética de los caracteres cuantitativos en la mejora vegetal del siglo XXI. SERIDA e INIA. p. 177 – 215. Van Ooijen (1992) Accuracy of mapping quantitative trait loci in autogamous species: Theor. Appl. Genet. 8410: 803–811 Van Ooijen JW, Boer MP, Jansen RC, Maliepaard C (2002) MapQTL® 4.0 Software for the calculation of QTL positions on genetic maps. Plant Research International, Wageningen, the Netherlands. Van Ooijen JW (2006) JoinMap ® 4, software for the calculation of genetic linkage maps in experimental populations. Kyazma BV, Wageningen, Netherlands Van Ooijen JW, Jansen J (2013) Genetic mapping in experimental populations. USA, Cambridge University Press, NY. p 157. Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D,
157
Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R (2010) The genome of the domesticated apple (Malus × domesticaBorkh.). Nature genetics 42(10):833–842 Verde I, Quarta R, Cerdrola C, Dettori MT (2002) QTL analysis of agronomic traits in a BC1 peach population. Acta Hort. 592:291–297 Verde I, Lauria M, Dettori MT, Vendramin E, Balconi C, Micali S, Wang Y, Marrazzo M T, Cipriani G, Hartings H, Testolin R, Abbott A G, Motto M, Quarta R (2005) Microsatellite and AFLP markers in the [Prunus persica (L.) Batsch] x P. ferganensis BC1 linkage map, saturation and coverage improvement. Theor. Appl. Genet. 111:1013–1021 Verde I, Bassil N, Scalabrin S, Gilmore B, Lawley CT, GasicK, Micheleti D, Rosyara UR, Cattonaro F, Vendramin E, Main D, Aramini V, Blas AL,Mockler TC, BryantDW, Whilelm L, TroggioM, Sosinski B, Aranzana MJ, Arús P, Iezzoni A, Morgante N, Peace C (2012) Development and evaluation of a 9K SNP array for peach by internationallly coordinated SNP detection and validation in breeding germplasm. PLoS ONE 7:e35668. Verde I, Abbott AG, Scalabrin S, Jung S, Shu S, Marroni F, Zhebentyayeva T, Dettori MT, Grimwood J, Cattonaro F, Zuccolo A, Rossini L, Jenkins J, Vendramin E, Meisel LA, Decroocq V, Sosinski B, Prochnik S, Mitros T, Policriti A, Cipriani G, Dondini L, Ficklin S, MGoodstein D, Xuan P, Del Fabbro C, Aramini V, Copetti D, González S, Horner DS, Falchi R, Lucas S, Mica E, Maldonado J, Lazzari B, Bielenberg D, Pirona R, Miculan M, Barakat A, Testolin R, Stella A, Tartarini S, Tonutti P, Arús P, Orellana A, Wells C, Main D, Vizzotto G, Silva H, Salamini F, Schmutz J, Morgante M, Rokhsar DS (2013) The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nature Genet. 45:487–494 Verlaan MG, Hutton SF, Ibrahem RM, Kormelink R, Visser RGF, Scott JW, Edwards JD, Bai Y (2013) The tomato yellow leaf curl virus resistance genes Ty-1 and Ty-3 are allelic and code for DFDGD-class RNA–dependent RNA polymerases. PLoS Genet. 9(3): e1003399. doi:10.1371/journal.pgen.1003399 Voorrips RE (2002) MapChart: Software for the graphical presentation of linkage maps and QTLs. The Journal of Heredity 93 (1): 77–78. Wang D, Karle R, Iezzoni AF (2000) QTL analysis of flower and fruit traits in sour cherry. Theor. Appl. Genet. 100:535–544 Wang Y (1985) Peaches growing and germplasm in China. Acta Hort. 173:51–55 Wang Y, Georgi LL, Reighard GL, Scorza R, Abbott AG (2002) Genetic mapping of the evergrowing gene in peach (Prunus persica (L.) Batsch). Journal of Heredity 93, 352–358. Wen IC, Koch KE, Sherman WB (1995) Comparing fruit and tree characteristics of two peaches and their nectarine mutants. J. Amer. Soc. Hort. Sci. 120, 101–106 Wen J, Berggren ST, Lee CH, Ickert-Bond S, Yi TS, Yoo KO, Xie L, Shaw J,Potter D (2008) Phylogenetic inferences in Prunus (Rosaceae) using chloroplast ndhF and ribosomal ITS sequences. J. Syst. Evol. 46:322–332
158
Weinberger JH (1944) Characteristics of the progeny of certain peach varieties. Proc. Amer. Soc. Hort. Sci. 45:233–238 Werner D, Creller MA (1997) Genetic studies in peach: inheritance of sweet kernel and male sterility. J. Amer. Soc. Hort. Sci. 122(2):215–217 Yamamoto T, Shimada T, Imai T, Yaegaki H, Haji T, Matsuta N, Yamaguchi M, Hayashi T (2001) Characterization of morphological traits based on a genetic linkage map in peach. Breeding Science 51:271–278 Yamamoto T, Mochida K, Hayashi T (2003) Shanhai Suimitsuto, one of the origins ofJapanese peach cultivars. J. Japan. Soc. Hort. Sci. 72:116–121 Yazbek M, Oh S-H (2013) Peaches and almonds: phylogeny of Prunus subg. Amygdalus (Rosaceae) based on DNA sequences and morphology. Plant Syst. Evol. 299:1403–1418 Yoon J, Lui D, Song W, Zhang A, Li S (2006) Genetic diversity and ecogeogragraphical phylogenetic relationships among peach and nectarines cultivars based on simple sequence repeat (SSR) markers. J. Amer. Soc. Hort. Sci. 131: 513–521 Young ND (2000) Constructing a plant genetic linkage map with DNA markers. In: Phillips RL, Vasil JK (eds.) DNA-Based Markers in Plants. Kluwer Academic Publishers, p. 31-47. Xu Y (2010) Molecular plant breeding. First edition. CABI. pp 734. Yaegaki H, Miyake M. Haji T, Yamaguchi M (2003) Inheritance of male sterility in Japanese apricot (Prunus mume). HortSci. 38:1422–1423 Yu H, Xie W, Wang J, Xing Y, Xu C, Li X, Xiao J, Zhang Q (2011) Gains in QTL detection using an ultra-high density snp map based on population sequencing relative to traditional RFLP/SSR markers. PLoS ONE 6(3):e17595. oi:10.1371/journal. pone.0017595 Zamir D, Ekstein Michelson I, Zakay Y, Navot N, Zeidan M (1994) Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, Ty-1. Theor. Appl. Genet. 88: 141–146 Zarrouk O, Gogorcena Y, Gómez-Aparisi J, Betrán JA, Moreno MA (2005) Infl uence ofpeach x almond hybrids rootstocks on fl ower and leaf mineral concentration, yield and vigourof two peach cultivars. Sci. Hort. 106(4): 502–514. Zhang JB, Sebolt AM, Wang D, Bink M, Olmstead JW, Iezzoni AF (2010) Fruit size QTL analysis of an F1 population derived from a cross between a domesticated sweet cherry cultivar and a wild forest sweet cherry. Tree Genet Genomes 6:25–36 Zhang Q, Chen W, Sun L, Zhao F, Huang B, Yang W, Tao Y, ang J, Yuan Z, Fan G, Xing Z, Han C, Pan H, Zhong X, Shi W, Liang X, Du D, Sun F, Xu Z, Hao R, Lv T, Lv Y, Zheng Z, Sun M, Luo L, Cai M, Gao Y, Wang J, Yin Y, Xu X, Cheng T, Wang J (2014). The genome of Prunus mume. Nature Comun. 3:1318 | DOI: 10.1038/ncomms2290 Zhebentyayeva T, Fan S, Chandra A, Bielenberg DG, Reighard GL, Okie WR, Abbott AG (2014) Dissection of chilling requirement and bloom date QTLs in peach using a whole genome sequencing of sibling trees from an F2 mapping population. Tree Gen Genomes 10:35–51
9. ANEXOS
161
Annex 1. Characteristics of the microsatellites used for the construction of the maps with the almond x peach F2 (TxE) and backcross 1 (T1E) populations.
Map reference4
Marker LG cM2Physical position
(bp)3TxE T1E E
CPPCT016 G1 1.3 579,334 x Dirlewanger et al. (2004)
EPDCU3122 G1 2.5 1,207,146 x x x Dirlewanger et al. (2004)
UDP96-018 G1 1.4 1,298,998 x Present work
CPPCT010 G1 11.6 1,298,998 x Dirlewanger et al. (2004)
CPPCT004 G1 11.6 ? x Dirlewanger et al. (2004)
M16a G1 1:14 8,491,350 x Howad et al. (2005)
EPPCU5331 G1 1:26 11,172,303 x x Howad et al. (2005)
PaCITA005 G1 17.3 11,321,910 x x Present work
CPPCT027 G1 23.1 12,409,450 x x Dirlewanger et al. (2004)
EPPCU1090 G1 1:34 22,653,653 x x x Howad et al. (2005)
UDP96-005 G1 29.2 ? x x Dirlewanger et al. (2004)
CPPCT003 G1 33.2 ? x Howad et al. (2005)
CPDCT024 G1 37.2 27,190,581 x Dirlewanger et al. (2004)
EPPCU1945 G1 1:50 29,356,873 x Present work
CPPCT026 G1 33.9 31,792,329 x x Dirlewanger et al. (2004)
EPDCU3489 G1 46.7 33,027,380 x x Dirlewanger et al. (2004)
BPPCT020 G1 52.6 33,281,418 x Dirlewanger et al. (2004)
BPPCT016 G1 55.2 36,075,308 x x Dirlewanger et al. (2004)
CPPCT019 G1 46.7 38,032,452 x Present work
CPPCT042 G1 62.5 39,307,938 x x Dirlewanger et al. (2004)
EPDCU2862 G1 66.5 39,371,824 x x Dirlewanger et al. (2004)
CPPCT029 G1 65.1 40,195,426 x x Dirlewanger et al. (2004)
CPPCT053 G1 70.8 ? x x Present work
BPPCT028 G1 77.4 45,685,797 x x Dirlewanger et al. (2004)
CPPCT044 G2 7.2 9,968,143 x x x Dirlewanger et al. (2004)
CPP8062 G2 0.0 10,246,874 x Present work
UDP98-025 G2 9.6 10,872,238 x Dirlewanger et al. (2004)
AMPA93 G2 1.4 9,100,912 x x Present work
MA024a G2 2:13 7,279,019 x x Howad et al. (2005)
CPDCT044 G2 12.5 ? x x Dirlewanger et al. (2004)
BPPCT004 G2 20.2 11,922,357 x x Dirlewanger et al. (2004)
EPDCU4017 G2 20.9 15,974,268 x x Dirlewanger et al. (2004)
BPPCT001 G2 20.9 16,133,969 x x Dirlewanger et al. (2004)
CPSCT044 G2 23.6 17,217,107 x x Dirlewanger et al. (2004)
M1a G2 2:25 18,412,524 x Howad et al. (2005)
UDP96-013 G2 27.8 18,895,941 x x Dirlewanger et al. (2004)
CPDCT004 G2 27.8 19,912,907 x x Dirlewanger et al. (2004)
UDP98-411 G2 27.8 20,172,861 x x Dirlewanger et al. (2004)
pchgms1 G2 35.1 21,255,417 x x Dirlewanger et al. (2004)
BPPCT030 G2 38.0 22,248,468 x x Dirlewanger et al. (2004)
CPPCT043 G2 38.0 22,248,469 x x Dirlewanger et al. (2004)
CPSCT021 G2 39.4 23,734,599 x x Dirlewanger et al. (2004)
PceGA34 G2 43.9 25,199,001 x x Dirlewanger et al. (2004)
CPSCT034 G2 48.6 26,348,777 x x Dirlewanger et al. (2004)
UDA-023 G2 2:50 26,348,970 x x Howad et al. (2005)
Map
position1Mapped in
162
Annex 1 (continued)
EPPCU5990 G3 3:04 527,238 x x Howad et al. (2005)
EPDCU4610 G3 0.7 ? x Present work
UDP97-403 G3 11.9 2,557,069 x x Dirlewanger et al. (2004)
BPPCT007 G3 11.2 2,741,897 x x x Dirlewanger et al. (2004)
BPPCT039 G3 18.0 5,802,960 x x x Dirlewanger et al. (2004)
EPDCU3083 G3 19.8 6,458,850 x x Dirlewanger et al. (2004)
CPPCT002 G3 31.9 16,205,250 x x x Dirlewanger et al. (2004)
UDP96-008 G3 36.4 16,946,780 x x Dirlewanger et al. (2004)
EPDCU0532 G3 43.7 ? x x x Present work
BPPCT010 G4 2.1 227,708 x x Dirlewanger et al. (2004)
EPDCU5060 G4 1.8 484,115 x x Dirlewanger et al. (2004)
pchgms2 G4 7.0 2,086,474 x x x Dirlewanger et al. (2004)
CPPCT005 G4 10.4 ? x x x Dirlewanger et al. (2004)
CPPCT011 G4 12.1 ? x x x Present work
CPDCT045 G4 16.8 6,205,903 x x x Dirlewanger et al. (2004)
UDP96-003 G4 28.3 8,757,479 x x Dirlewanger et al. (2004)
EPPCU1106 G4 4:46 9,586,328 x Howad et al. (2005)
M12a G4 4:46 9,208,608 x x x Howad et al. (2005)
EPDCU3832 G4 4:46 10,362,508 x Howad et al. (2005)
EPPCU2000 G4 4:46 12,467,623 x x Howad et al. (2005)
BPPCT015 G4 44.0 12,546,880 x x x Dirlewanger et al. (2004)
UDA-021 G4 4:46 14,074,659 x x Howad et al. (2005)
CPPCT046 G4 45.4 14,476,745 x x Dirlewanger et al. (2004)
BPPCT023 G4 45.4 14,731,686 x Dirlewanger et al. (2004)
UDA-027 G4 4:63 18,639,915 x x Howad et al. (2005)
EPPCU1775 G4 4:63 22,684,552 x Howad et al. (2005)
CPPCT051 G4 48.2 ? x Present work
Ps12e2 G4 45.8 ? x Howad et al. (2005)
CPPCT040 G5 1.5 993,617 x x Dirlewanger et al. (2004)
AMPA112 G5 4.6 2,761,133 x Present work
BPPCT026 G5 5.2 4,388,739 x Dirlewanger et al. (2004)
UDP97-401 G5 11.0 5,940,393 x x Dirlewanger et al. (2004)
PaCITA021 G5 20.0 10,778,022 x Present work
BPPCT017 G5 20.1 11,174,144 x x Dirlewanger et al. (2004)
CPSCT006 G5 21.7 11,533,644 x x Dirlewanger et al. (2004)
BPPCT037 G5 25.6 12,312,049 x x x Dirlewanger et al. (2004)
pchgms4 G5 26.7 12,665,818 x x Dirlewanger et al. (2004)
CPPCT013 G5 29.2 12,835,904 x x Dirlewanger et al. (2004)
EPDCU5183 G5 35.2 13,859,578 x x Dirlewanger et al. (2004)
EPDCU4658 G5 33.1 14,489,300 x x x Present work
BPPCT038 G5 32.9 14,658,198 x x Dirlewanger et al. (2004)
CPSCT022 G5 40.7 16,626,112 x x Dirlewanger et al. (2004)
BPPCT014 G5 44.0 16,626,126 x x Dirlewanger et al. (2004)
163
Annex 1 (continued)
CPP21413 G6 0.0 4,150,445 x x Present work
Ps7a2 G6 7.0 2,165,426 x x Dirlewanger et al. (2004)
CPP21245 G6 1.1 3,108,930 x x Present work
CPP20836 G6 1.1 1,141,321 x x Present work
UDP96-001 G6 17.5 7,040,897 x x Dirlewanger et al. (2004)
EPPCU9300 G6 6:25 7,282,736 x Howad et al. (2005)
BPPCT008 G6 30.1 10,280,037 x x Dirlewanger et al. (2004)
CPSCT012 G6 36.2 16,098,467 x x Dirlewanger et al. (2004)
pchcms5 G6 44.7 19,166,407 x x Dirlewanger et al. (2004)
BPPCT025 G6 56.4 21,129,944 x x x Dirlewanger et al. (2004)
CPPCT047 G6 58.9 21,583,770 x x Dirlewanger et al. (2004)
UDP98-412 G6 72.0 24,753,513 x x Dirlewanger et al. (2004)
MA040a G6 6:74 24,857,835 x x x Howad et al. (2005)
AMPA130 G6 67.7 25,322,083 x x Present work
MA14a G6 6:74 ? x x x Howad et al. (2005)
EPPCU4092 G6 6:80 25,943,449 x x Howad et al. (2005)
CPPCT030 G6 80.2 26,851,012 x x Dirlewanger et al. (2004)
CPPCT021 G6 83.7 27,604,841 x x Dirlewanger et al. (2004)
CPSCT004 G7 9.5 6,681,998 x x x Dirlewanger et al. (2004)
CPPCT039 G7 14.1 8,338,791 x x x Dirlewanger et al. (2004)
CPPCT022 G7 18.6 10225365 x Dirlewanger et al. (2004)
pchgms6 G7 10.7 10,439,275 x x Present work
UDP98-408 G7 23.7 12,216,663 x x Dirlewanger et al. (2004)
UDAp-432 G7 7:31 13,499,331 x Howad et al. (2005)
UDAp-407 G7 21.4 ? x Present work
CPPCT057 G7 21.4 15,854,584 x x x Present work
CPPCT033 G7 38.9 16,846,940 x x Dirlewanger et al. (2004)
MA20a G7 7:41 17,253,269 x x Howad et al. (2005)
PMS02 G7 7:48 18,106,108 x x x Howad et al. (2005)
EPPCU5176 G7 7:56 18,772,878 x x x Howad et al. (2005)
pchcms2 G7 51.4 19,089,997 x x x Dirlewanger et al. (2004)
CPPCT017 G7 61.8 20,899,157 x x x Dirlewanger et al. (2004)
EPDCU3392 G7 64.7 21,681,912 x x Dirlewanger et al. (2004)
Ps5c3 G7 70.6 22,285,603 x x x Dirlewanger et al. (2004)
CPSCT018 G8 0.0 123,201 x x Dirlewanger et al. (2004)
BPPCT006 G8 14.1 ? x x x Dirlewanger et al. (2004)
CPPCT058 G8 14.6 7,943,526 x x x Present work
CPDCT034 G8 16.8 ? x x x Dirlewanger et al. (2004)
CPPCT006 G8 24.8 13,659,021 x x x Dirlewanger et al. (2004)
M6a G8 8:41 15,033,895 x x Howad et al. (2005)
UDP98-409 G8 44.5 17,783,855 x x x Dirlewanger et al. (2004)
EPDCU3454 G8 46.7 18,639,388 x x Dirlewanger et al. (2004)
EPDCU3117 G8 54.7 20,218,634 x x Dirlewanger et al. (2004)
3 According to the peach sequence v1.0 (http://www.rosaceae.org/species/prunus_persica/genome_v1.0 )
1As in Dirlewanger et al (2004) or Howad et al. (2005). In the latter case, the position corresponds to the
bin where the marker was found.2 map position as in the map reference. Markers are ordered according to their position in the maps
presented in this paper.
4 Reference where the marker was mapped in the TxE map. For the markers mapped here, their position is
that of the TxE map and if not mapped in TxE in T1E map
165
Annex 2. Summary of phenotypic data of ‘Texas’, ‘Earlygold’, their F1 hybrid MB1.37 and the TxE population (mean, maximum, minimum, standard deviation and Shapiro-Wilk test). The table includes trait names and acronyms, year, location and number of individuals (N) for which data was obtained.
Trait
familyTrait Acronym Location Year N Texas Earlygold MB 1.37 Mean Max Min Std Dev
Shapiro-
Wilk
Pistil length PiL Gimenells 2011-2013 86 3.00 3.00 3.00 2.28 3.00 1.00 0.86 <,0001*
2012 71 5.00 3.00 4.00 3.32 5.00 1.00 1.26 <,0001*
2013 83 5.00 3.00 4.00 3.05 5.00 1.00 1.47 <,0001*
2012 80 74.00 79.00 78.00 72.96 81.00 65.00 2.68 0,0037*
2013 81 71.00 69.00 68.00 69.11 75.00 58.00 2.87 0,0001*
2012 77 71.00 72.00 70.00 69.38 75.00 64.00 2.93 0,0049*
2013 77 70.00 66.00 68.00 65.27 73.00 57.00 3.28 0,0662
2012 77 80.00 81.00 77.00 76.47 84.00 72.00 2.82 0,0032*
2013 75 78.00 75.00 74.00 72.79 83.00 65.00 3.67 0,0043*
2012 77 9.00 9.00 7.00 7.10 11.00 4.00 1.66 0,0031*
2013 73 8.00 9.00 6.00 10.90 17.00 6.00 2.55 0,0757
Fruit
productionFP Gimenells 2011-2013 86 4.00 4.00 4.00 2.16 4.00 1.00 1.16 <,0001*
2011 29 - 160.00 214.00 222.03 270.00 156.00 36.48 0,0222*
2012 38 259.00 164.00 226.00 227.74 261.00 164.00 27.53 0,0074*
2013 33 263.00 167.00 224.00 232.70 274.00 168.00 27.78 0.3049
2012 36 191.00 90.00 162.00 151.97 187.00 87.00 28.23 0,0223*
2013 29 185.00 89.00 139.00 159.03 204.00 95.00 29.84 0.3191
Juiciness Jui Gimenells 2011-2013 39 2.00 1.00 2.00 1.74 2.00 1.00 0.44 <,0001*
Blood flesh Bf Gimenells 2011-2013 37 - 1.00 2.00 1.32 2.00 1.00 0.47 <,0001*
2011 21 - 2.00 3.00 1.48 3.00 1.00 0.58 0,0007*
2012 30 - 2.00 3.00 1.90 3.00 1.00 0.82 0,0001*
2013 27 - 2.00 3.00 1.81 3.00 1.00 0.75 0,0004*
2011 23 1.00 2.00 3.00 2.35 4.00 1.00 1.23 0,0005*
2012 37 1.00 3.00 4.00 2.43 4.00 1.00 1.39 <,0001*
2013 31 1.00 2.00 4.00 2.56 4.00 1.00 1.37 <,0001*
2011 16 - 15.40 no juicy 14.23 17.60 10.40 2.04 0,6659
2012 24 - 16.00 no juicy 14.08 17.40 9.50 1.81 0,7435
2013 28 - 12.40 no juicy 12.83 18.00 8.50 2.59 0,6361
2011 14 - 6.39 10.99 8.23 15.21 4.95 2.73 0,0181*
2012 24 - 6.50 11.42 9.04 18.48 3.95 3.48 0,0017*
2013 28 - 7.26 12.06 12.15 24.85 5.63 5.25 0,0257
2011 28 - 127.80 87.50 42.34 91.95 9.70 21.56 0,2680
2012 38 14.25 132,1 76.49 47.81 124.80 11.57 26.07 0,0879
2013 33 - 141.54 128.18 58.30 135.07 15.11 28.65 0,1856
2011 28 - 7.57 7.51 4.97 7.41 2.40 1.29 0,8876
2012 36 5.17 7.90 5.72 5.56 11.24 1.99 2.13 0,0929
2013 33 - 7.12 9.65 6.33 17.06 2.20 2.90 0,0003*
2011 28 - 120.23 79.99 37.37 84.74 6.49 20.83 0,2179
2012 36 9.08 124.20 70.77 41.36 114.19 6.32 25.82 0,0741
2013 33 - 134.42 118.54 51.97 125.30 10.34 26.76 0.1739
2011 28 - 5.42 6.11 4.70 5.87 2.76 0.83 0,4323
2012 38 3.78 5.39 5.85 4.85 6.59 3.26 0.83 0,8557
2013 31 - 6.05 6.95 5.13 7.33 3.54 0.87 0,9353
2011 28 - 5.53 5.33 4.00 5.56 2.28 0.99 0,0553
2012 38 2.72 5.50 5.49 4.27 6.53 2.42 0.97 0,1993
2013 31 - 6.71 6.23 4.51 6.46 2.37 0.96 0,3139
2011 28 - 5.78 5.09 4.00 5.32 2.41 0.82 0,1112
2012 38 - 5.80 5.36 4.30 6.31 2.73 0.88 0,5114
2013 31 2.82 6.24 5.98 4.56 6.21 2.57 0.90 0.8684
2011 28 - 3.27 4.03 3.34 4.68 2.42 0.45 0,4104
2012 36 3.18 3.30 3.71 3.49 4.49 2.83 0.45 0,2149
2013 32 - 3.10 4.27 3.58 4.78 2.78 0.48 0,4070
2011 28 - 2.47 2.47 2.14 2.98 1.67 0.28 0,1338
2012 36 2.07 2.49 2.46 2.20 2.73 1.66 0.27 0,4583
2013 32 - 2.15 2.75 2.24 3.15 1.59 0.33 0,6521
2011 28 - 1.93 1.70 1.54 1.99 1.14 0.17 0,6238
2012 36 1.65 1.82 1.80 1.65 2.34 1.25 0.25 0,0229
2013 32 - 1.97 1.92 1.67 2.45 1.16 0.29 0,1009
2011 28 - 2.15 2.08 1.36 2.36 0.27 0.64 0.1014
2012 36 0.60 2.09 2.14 1.38 2.64 0.34 0.63 0.1719
2013 31 - 2.95 2.68 1.54 2.62 0.24 0.63 0.5553
2011 28 - 3.06 2.86 1.88 3.39 0.33 0.95 0,0117*
2012 36 0.65 3.01 3.03 2.10 3.95 0.28 0.90 0.4769
2013 31 - 4.56 3.48 2.27 3.89 0.76 0.77 0.8519
2011 28 - 3.85 3.39 2.46 3.52 0.93 0.79 0,0290*
2012 36 1.17 3.98 3.56 2.68 3.97 1.33 0.80 0.0562
2013 31 - 4.27 4.07 2.88 4.24 0.41 0.79 0.1513
2012 77 3071.13 3169.17 2906.91 2574.64 3322.92 1584.39 362.81 0,1774
2013 77 3109.05 3147.63 2784.93 2654.34 3383.95 1786.95 323.29 0,1724
2012 77 290.29 279.26 190.84 182.00 295.93 67.26 49.60 0,3470
2013 77 296.94 275.64 195.80 197.41 306.84 87.20 48.07 0,2158
2012 77 394.00 331.00 259.00 285.91 368.67 174.00 40.27 0,2787
2013 77 389.00 340.25 272.88 297.42 402.75 190.00 37.86 0,3244
2012 77 1310.00 1369.00 1258.00 1088.60 1395.40 672.50 153.12 0,1208
2013 77 1314.00 1362.75 1228.75 1139.41 1451.71 766.67 145.13 0,4721
2012 77 1096.00 1241.00 1089.00 946.92 1234.25 579.00 137.42 0,3187
2013 77 1112.14 1201.25 1053.38 975.21 1262.00 620.67 130.38 0,7166
2012 77 214.00 128.00 169.00 141.68 255.25 71.33 39.46 0,0188*
2013 77 201.86 161.50 175.38 164.21 244.57 90.67 35.92 0,3607
2012 79 0.28 0.28 0.31 0.23 0.57 0.09 0.07 <,0001*
2013 75 0.37 0.33 0.24 0.26 0.44 0.12 0.07 0,1818
2011 83 39.60 37.60 42.00 39.22 48.70 28.10 3.96 0,9476
2012 79 39.00 40.70 37.40 37.92 45.70 29.50 3.10 0,9992
2013 81 39.20 42.20 46.00 37.51 45.60 27.10 3.97 0,2963
Flo
we
rBlooming
densityBD Gimenells
Ph
en
olo
gy
Beginning of
shooting BS Gimenells
Begining of
flowering BFT Gimenells
End of
flowering EFT Gimenells
Flowering
durationFD Gimenells
Gimenells
Soluble
solid
content
SSC Gimenells
Madurity
dateMD Gimenells
Fruit
developmeFDP Gimenells
Titratable
acidityTA Gimenells
Fruit weight FW Gimenells
Stone
weightSW Gimenells
Flesh
weightFlW Gimenells
Fruit polar
diameterFpD Gimenells
Fruit cheeck
diameterFcD Gimenells
Fruit suture
diameterFsD Gimenells
Stone polar
diameterSpD Gimenells
Stone check
diameterScD Gimenells
Stone
suture
diameter
SsD Gimenells
Flesh polar
diameterFlpD Gimenells
Flesh check
diameterFlcD Gimenells
Flesh suture
diameterFlsD Gimenells
Leaf
Leaf
perimeterLP Gimenells
Leaf surface LS Gimenells
Fru
it
Intensity
skin colorISC Gimenells
Percentage
skin colorPSC
Leaf blade
widthLBW Gimenells
Leaf length LL Gimenells
Leaf blade
lengthLBL Gimenells
Petiole
lengthPL Gimenells
Leaf weight LW Gimenells
Chlorophyll
content CC Gimenells
167
Annex 3. Summary of phenotypic data of ‘Texas’, ‘Earlygold’, their F1 hybrid MB1.37 and the T1E population (mean, maximum, minimum, standard deviation and Shapiro-Wilk test). The table includes trait names and acronyms, year, location and number of individuals (N) for which data was obtained.
Trait
familyTrait Acronym Location Year N Texas Earlygold MB 1.37 Mean Max Min Std Dev Shapiro-Wilk
Pistil length PiL Gimenells 2011-2013 161 3.00 3.00 3.00 2.81 3.00 1.00 0.52 < ,0001*
2012 149 5.00 3.00 4.00 3.17 5.00 1.00 1.22 < ,0001*
2013 137 5.00 3.00 4.00 3.28 5.00 1.00 1.32 < ,0001*
2012 104 5.00 3.00 4.00 3.53 5.00 1.00 1.07 < ,0001*
2013 128 5.00 3.00 4.00 3.14 5.00 1.00 1.27 < ,0001*
2011 159 67.00 76.00 71.00 60.25 80.00 50.00 5.37 < ,0001*
2012 150 73.00 80.00 72.00 71.60 81.00 62.00 4.00 0,0377*
2013 141 72.00 62.00 65.00 63.40 79.00 48.00 7.28 < ,0001*
2012 131 74.00 79.00 78.00 72.54 80.00 66.00 3.44 < ,0001*
2013 145 71.00 69.00 68.00 68.76 73.00 59.00 2.68 < ,0001*
2011 137 41.00 55.00 50.00 54.09 63.00 39.00 4.84 < ,0001*
2012 150 65.00 70.00 70.00 68.19 79.00 57.00 4.37 0,0329*
2013 137 50.00 58.00 59.00 53.31 70.00 35.00 9.01 0,0001*
2012 130 71.00 72.00 70.00 69.56 78.00 59.00 3.20 0,0043*
2013 139 70.00 66.00 68.00 65.62 72.00 55.00 3.24 < ,0001*
2011 131 61.00 69.00 63.00 65.34 74.00 52.00 4.93 < ,0001*
2012 150 74.00 81.00 78.00 76.57 86.00 64.00 4.08 0,0082*
2013 136 68.00 74.00 64.00 68.19 82.00 46.00 7.11 0,0001*
2012 120 80.00 81.00 77.00 76.70 84.00 71.00 2.49 0,0016*
2013 138 78.00 75.00 74.00 72.67 82.00 66.00 3.80 < ,0001*
2011 113 20.00 14.00 13.00 11.61 24.00 2.00 3.75 0,0309*
2012 149 9.00 11.00 8.00 8.43 14.00 4.00 1.87 0,0038*
2013 135 18.00 16.00 5.00 15.04 25.00 7.00 3.84 0,0024*
2012 113 9.00 9.00 7.00 7.43 13.00 3.00 1.80 0,0493*
2013 137 8.00 9.00 6.00 6.93 13.00 3.00 2.18 < ,0001*
Fruit
productionFP Gimenells 2011-2013 161 4.00 4.00 4.00 2.42 4.00 1.00 1.03 < ,0001*
2011 65 - 145.00 210.00 174.48 223.00 138.00 23.24 0,0147*
2012 125 - 159.00 211.00 191.43 241.00 152.00 23.13 0,0041*
2013 54 - 164.00 213.00 181.28 225.00 161.00 15.50 0,0010*
2011 58 - 160.00 214.00 196.41 242.00 156.00 26.50 < ,0001*
2012 100 259.00 164.00 226.00 200.81 252.00 167.00 24.30 0,0036*
2013 75 263.00 167.00 224.00 203.61 257.00 158.00 24.51 0,0057*
2011 58 - 76.00 147.00 108.90 156.00 76.00 22.56 0,0124*
2012 123 - 79.00 136.00 115.18 167.00 73.00 23.10 0,0036*
2013 52 - 78.00 134.00 113.44 157.00 85.00 17.12 0,2373
2012 83 191.00 90.00 162.00 125.71 176.00 86.00 24.63 0,0004*
2013 72 185.00 89.00 139.00 131.76 187.00 84.00 25.02 0,0097*
2011 151 359.00 341.00 324.00 327.52 358.00 293.00 18.36 < ,0001*
2012 165 369.00 348.00 348.00 345.67 381.00 292.00 17.84 < ,0001*
2013 149 365.00 339.00 341.00 344.64 365.00 295.00 14.64 < ,0001*
Juvenility Juv Cabrils 2008-2013 135 - - - 3.61 6.00 3.00 0.86 < ,0001*
2011 49 - 2.00 3.00 1.84 4.00 1.00 0.83 < ,0001*
2012 90 - 2.00 3.00 1.87 4.00 1.00 0.83 < ,0001*
2013 42 - 2.00 3.00 1.92 3.50 1.00 0.85 < ,0001*
2011 54 - 2.00 3 2.10 4.00 1.00 0.89 < ,0001*
2012 101 - 2.00 3 2.11 4.00 1.00 0.93 0,0001*
2013 80 - 2.00 3.00 1.96 4.00 1.00 0.86 < ,0001*
2011 53 1 3.00 3.00 2.82 4.00 1.00 1.00 < ,0001*
2012 87 1 2.00 4.00 3.25 4.00 1.00 0.89 < ,0001*
2013 43 1 2.00 4.00 3.16 4.00 1.00 1.00 < ,0001*
2011 54 1 2 3 3.18 4.00 1.00 0.97 < ,0001*
2012 101 1 3 4 3.19 4.00 1.00 0.98 < ,0001*
2013 79 1 2.00 4.00 3.13 4.00 1.00 1.04 < ,0001*
2011 51 - 17.00 no juicy 13.37 19.20 6.80 2.99 0,7514
2012 75 - 14.20 no juicy 14.76 23.10 7.10 3.64 0,4727
2013 36 - 16.30 no juicy 13.46 16.20 9.40 1.91 0,0519
2011 55 - 15.40 no juicy 13.96 21.20 8.00 2.67 0,0711
2012 88 - 16.00 no juicy 14.28 23.95 8.20 2.62 0,0335
2013 62 - 12.40 no juicy 12.95 17.40 7.40 2.18 0.5410
2011 51 - 4.10 9.67 8.13 17.70 3.00 3.00 0,0136*
2012 76 - 6.66 10.50 9.83 25.08 3.69 4.50 < ,0001*
2013 46 - 6.20 11.66 8.65 23.40 4.60 3.72 < ,0001*
2011 53 - 6.39 10.99 7.95 18.48 2.57 3.97 0,0004*
2012 82 - 6.50 11.42 11.14 29.97 3.49 4.96 < ,0001*
2013 77 - 7.26 12.06 10.38 24.15 4.29 4.28 0,0009*
2011 53 - 100.28 82.31 59.96 120.30 8.86 25.68 0,9297
2012 96 - 130.31 68.16 61.28 140.10 9.70 26.47 0,2184
2013 42 - 121.23 106.86 86.74 167.87 28.05 34.10 0,2716
2011 52 - 127.80 87.50 75.47 134.98 21.87 26.80 0,1327
2012 100 14.25 132.10 76.49 82.94 156.92 21.61 30.74 0,3952
2013 79 - 141.54 128.18 99.69 184.71 33.78 32.22 0,7564
2011 51 - 3.73 7.35 5.06 9.90 1.07 2.25 0,0853
2012 92 - 6.43 6.44 5.01 12.11 1.81 2.45 < ,0001*
2013 40 - 6.48 11.30 5.37 12.49 1.64 2.34 0,0167*
2011 48 - 7.57 7.51 6.37 11.03 2.35 2.39 0,1416
2012 95 5.17 7.90 5.72 5.71 12.19 1.37 2.73 0,0002*
2013 78 - 7.12 9.65 7.17 13.65 2.62 2.95 0,0115*
2011 51 - 96.56 74.96 55.76 112.00 7.79 24.26 0,9456
2012 92 - 123.88 61.72 55.72 135.82 10.67 24.13 0,1028
2013 40 - 114.75 95.57 79.43 159.50 23.75 32.20 0,2295
2011 48 - 120.23 79.99 72.06 124.08 35.84 23.94 0,0579
2012 95 9.08 124.20 70.77 76.60 145.64 19.85 28.94 0,3483
2013 78 - 134.42 118.54 92.17 173.46 30.37 30.27 0,6791
Begining of
flowering
time
BFT
Cabrils
Gimenells
End of
flowering
time
EFT
Cabrils
Gimenells
Flo
we
rBloming
densityBD
Cabrils
Gimenells
Ph
en
olo
gy
Beginning
of shooting BS
Cabrils
Gimenells
Fruit
developme
nt period
FDP
Cabrils
Gimenells
Leaf fall LF Cabrils
Flowering
durationFD
Cabrils
Gimenells
Madurity
dateMD
Cabrils
Gimenells
Fruit weight FW
Cabrils
Gimenells
Stone weight SW
Cabrils
Gimenells
SSC
Cabrils
Gimenells
Titratable
acidityTA
Cabrils
Gimenells
Soluble
solid
content
Flesh weight FlW
Cabrils
Gimenells
Fru
it
Intensity
skin colorISC
Cabrils
Gimenells
Percentage
skin colorPSC
Cabrils
Gimenells
168
Annex 3 (continued)
Trait
familyTrait Acronym Location Year N Texas Earlygold MB 1.37 Mean Max Min Std Dev Shapiro-Wilk
2011 52 - 5.23 6.23 5.02 6.35 2.85 0.87 0,0103*
2012 95 - 6.56 5.41 5.24 7.19 3.02 0.83 0.7440
2013 41 - 6.41 5.56 5.68 7.35 4.12 0.79 0,6973
2011 54 - 5.42 6.11 5.33 7.21 3.37 0.79 0,9174
2012 100 3.78 5.39 5.85 5.56 7.36 3.30 0.71 0.1060
2013 78 - 6.05 6.95 5.83 7.21 4.23 0.72 0.0780
2011 52 - 5.13 5.79 4.49 6.35 2.05 0.90 0,0851
2012 95 - 6.35 5.13 4.64 6.30 2.34 0.80 0,1332
2013 42 - 6.24 5.04 5.27 7.04 3.31 0.83 0,9685
2011 54 - 5.53 5.33 4.95 6.29 2.97 0.74 0,3477
2012 100 2.72 5.50 5.49 5.29 6.61 3.17 0.71 0,0644
2013 77 - 6.71 6.23 5.53 6.91 4.01 0.67 0,5005
2011 52 - 5.15 5.55 4.56 5.99 2.38 0.87 0,0279*
2012 95 - 5.91 4.95 4.68 6.21 2.47 0.78 0.1930
2013 41 - 5.63 5.39 5.26 6.71 3.81 0.73 0,3269
2011 54 - 5.78 5.09 4.91 6.88 3.00 0.80 0,8886
2012 100 2.82 5.80 5.36 5.25 6.56 3.30 0.67 0,1429
2013 78 - 6.24 5.98 5.54 6.95 3.75 0.68 0,7643
2011 50 - 2.36 3.94 3.12 4.26 1.70 0.51 0,0716
2012 93 - 3.49 3.81 3.29 4.58 2.26 0.51 0,1507
2013 40 - 3.54 3.39 3.22 4.23 2.27 0.40 0,9797
2011 50 - 3.27 4.03 3.43 4.64 2.20 0.49 0,9964
2012 99 3.18 3.30 3.71 3.43 4.57 2.08 0.53 0,6013
2013 79 - 3.10 4.27 3.49 4.82 2.38 0.53 0,4505
2011 50 - 1.83 2.32 2.01 2.78 1.20 0.34 0,3834
2012 93 - 1.94 2.20 2.01 2.95 1.25 0.35 0,3324
2013 40 - 2.37 2.45 2.17 2.71 1.59 0.28 0,736
2011 50 - 2.47 2.47 2.27 2.94 1.41 0.37 0,0806
2012 99 2.07 2.49 2.46 2.22 3.02 1.43 0.36 0,1523
2013 79 - 2.15 2.75 2.37 3.44 1.55 0.38 0,7578
2011 49 - 1.59 1.83 1.53 2.15 0.80 0.31 0,8288
2012 93 - 2.24 1.75 1.65 2.64 1.13 0.33 0,0023*
2013 40 - 1.67 1.83 1.69 2.27 1.28 0.26 0,0258*
2011 50 - 1.93 1.70 1.61 2.03 1.02 0.26 0,1811
2012 99 1.65 1.82 1.80 1.68 2.32 0.89 0.31 0,0547
2013 79 - 1.97 1.92 1.72 2.40 1.26 0.28 0.0590
2011 50 - 2.87 2.29 1.93 3.11 0.97 0.57 0,0063*
2012 92 - 3.07 1.60 1.92 2.97 0.25 0.56 0.5399
2013 39 - 2.87 2.17 2.40 3.68 1.53 0.51 0.5787
2011 50 - 2.15 2.08 1.99 2.70 1.14 0.35 0.7612
2012 99 0.60 2.09 2.14 2.14 3.40 1.15 0.39 0.1311
2013 78 - 2.95 2.68 2.33 3.66 1.25 0.47 0.7429
2011 50 - 3.30 3.47 2.49 3.68 0.70 0.75 0.0285
2012 92 - 4.41 2.93 2.59 4.02 0.40 0.64 0.0314
2013 39 - 3.87 2.59 3.05 4.41 1.19 0.68 0.9064
2011 50 - 3.06 2.86 2.77 3.56 1.15 0.45 0.0501
2012 99 0.65 3.01 3.03 3.09 4.49 1.74 0.52 0.1244
2013 77 - 4.56 3.48 3.16 4.27 2.03 0.49 0.6347
2011 49 - 3.56 3.72 3.04 4.54 1.57 0.73 0.1527
2012 92 - 3.67 3.20 2.98 4.53 0.83 0.65 0.1018
2013 39 - 3.96 3.56 3.55 5.13 2.22 0.67 0.4121
2011 50 - 3.85 3.39 3.40 4.85 2.13 0.56 0.9510
2012 99 1.17 3.98 3.56 3.57 4.61 2.20 0.50 0.1357
2013 78 - 4.27 4.07 3.81 5.15 2.27 0.54 0.8620
2012 128 2659.85 2768.26 3091.12 2900.48 4504.56 1925.89 395.92 0,0008*
2013 130 2824.36 2836.30 2861.35 3108.87 4343.02 2041.08 394.81 0,4011
2012 135 3071.13 3169.17 2906.91 3119.58 4378.58 2515.62 295.68 0,0065*
2013 141 3109.05 3147.63 2784.93 3022.84 3755.84 2382.69 294.15 0,632
2012 128 178.83 208.92 221.45 234.26 369.87 115.98 52.05 0,2974
2013 130 189.44 246.01 215.38 296.10 578.41 95.13 72.63 0,0361*
2012 135 290.29 279.26 190.84 267.04 408.68 160.78 50.99 0,1203
2013 141 296.94 275.64 195.80 269.73 436.96 122.33 52.10 0,1114
2012 128 292.00 285.00 284.00 317.31 411.00 217.25 36.47 0,8563
2013 130 285.50 315.25 289.50 355.11 503.33 175.25 45.15 0,0154*
2012 135 394.00 331.00 259.00 335.77 455.50 242.00 36.94 0,1756
2013 141 389.00 340.25 272.88 339.67 439.33 257.50 34.33 0,0076*
2012 128 1127.75 1194.86 1354.00 1204.99 1496.75 818.80 142.78 0,4331
2013 130 1229.83 1252.25 1261.88 1340.68 1846.50 873.25 172.54 0,4766
2012 135 1310.00 1369.00 1258.00 1316.12 1783.50 1064.00 121.42 0,0175*
2013 141 1314.00 1362.75 1228.75 1302.61 1608.83 940.00 131.10 0,8946
2012 128 903.50 1111.00 1148.00 1096.81 1373.00 758.20 128.64 0,6056
2013 130 961.50 1172.71 1087.63 1215.48 1657.25 778.75 158.87 0,8313
2012 132 1096.00 1241.00 1089.00 1185.62 1649.00 931.67 111.99 0,0309*
2013 141 1112.14 1201.25 1053.38 1172.61 1482.83 881.50 118.45 0,9197
2012 128 224.25 83.86 206.00 108.18 191.25 59.90 27.31 0,0325*
2013 130 268.33 89.16 174.25 125.21 192.00 33.00 26.75 0,2933
2012 132 214.00 128.00 169.00 129.51 196.50 58.60 25.69 0,4593
2013 141 201.86 161.50 175.38 130.00 240.75 58.50 25.75 0,0170*
2012 117 0.25 0.23 0.24 0.32 0.51 0.17 0.08 0,0028*
2013 130 0.32 0.30 0.29 0.38 0.75 0.12 0.10 0,0644
2012 131 0.28 0.28 0.31 0.33 0.50 0.19 0.07 0,1088
2013 141 0.37 0.33 0.24 0.33 0.65 0.18 0.07 < ,0001*
2011 157 40.10 38.20 43.10 40.98 51.00 23.10 5.39 < ,0001*
2012 145 35.90 39.80 40.70 41.43 51.40 23.60 4.81 < ,0001*
2013 146 41.60 37.60 39.10 42.35 51.60 27.60 4.40 0,0013*
2011 143 39.60 37.60 42.00 38.42 47.50 24.80 3.64 < ,0001*
2012 150 39.00 40.70 37.40 38.32 46.20 24.80 3.61 < ,0001*
2013 159 39.20 42.20 46.00 36.84 47.60 26.30 3.65 0,3237
Fru
it
Fruit polar
diameterFpD
Cabrils
Gimenells
Fruit cheek
diameter
Stone polar
diameterSpD
Cabrils
Gimenells
Stone cheek
diameterScD
Cabrils
Gimenells
FcD
Cabrils
Gimenells
Fruit suture
diameterFsD
Cabrils
Gimenells
Flesh cheek
diameterFlcD
Cabrils
Gimenells
Flesh suture
diameterFlsD
Cabrils
Gimenells
Stone
suture
diameter
SsD
Cabrils
Gimenells
Flesh polar
diameterFlpD
Cabrils
Gimenells
LBW
Cabrils
Gimenells
Leaf length LL
Cabrils
Gimenells
Leaf
Leaf
perimeterLP
Cabrils
Gimenells
Leaf surface LS
Cabrils
Gimenells
Leaf blade
width
Leaf weight LW
Cabrils
Gimenells
Chlorophyll
content CC
Cabrils
Gimenells
Leaf blade
lengthLBL
Cabrils
Gimenells
Petiole
lengthPL
Cabrils
Gimenells
169
Annex 4. Pictures of flowers, fruits, stones and leaves of the parentals (‘Texas’, ‘Earlygold’ and the hybrid ‘MB1.37’) and some individuals of TxE and T1E progenies.
Texas EG
F1
Parental Flowers
22
53 5655 57
6160 16759
31 39 47
TxE - Flowers
170
T1E - Flowers
33 93 8 13
23 26 20 27
Parental fruits
171
TxE - Fruits
F2 31
F2 27
F2 44F2 47
F2 04 F2 17
F2 43
F2 55 F2 72 F2 85
F2 91 F2 94 F2 98
F2 40F2 32
172
T1E - Fruits
173
T1E- Percent skin color (PSC)
T1E- Intensity skin color (IEC)
174
T1E - Fruit weight (FW)
T1E - Stones 2010 (84 individuals, Texas, Earlygold and MB1.37)
175
Texas EG
F1
Parental Leaves
T1E - Leaves
176
TxE - Leaves
Annex 5.
Distributions of all traits evaluated in TxE and T1E progenies during 2012 in Gimenells represented as histograms. Arrows indicate the position of values detected for ‘Texas’(T), ‘Earlygold’(E) and ‘MB1.37’(MB) .
179
T-E-MB TE MB T E MB MB T E MB T E
T-MB-E E MB TMB T E E MB T MB E
E MB E MB MBET E MB E
T MB E T MB ET MB E T MB E T MB E
TxE
his
togr
ams
T MB E T E MB T MB E T MB E T MB E
T MB E T E MB MB T E MB E T MB E T
MB T E MBT E E MB T MBET T E MB
TxE
his
togr
ams
180
T
T MB E
MB T EE
T-MB-E
E MB
T-E-MB MB T E MB
E MBE
MB T E
E MB TMB T E
T E MB T MB E
T MB E T MB E T MB E T MB E
E MB T
T1E
his
togr
ams
T E MB T MB E T MB E T MB E T MB E
T E MB MB T E MB E T MB E T MB T E
MBT E E MB T MB E T TE MB
T1E
his
togr
ams
181
Annex 6. Correlation coefficients between all quantitative traits measured during 2011, 2012 and 2013 for TxE progeny. The correlation coefficients were calculated with one mean value per genotype by Pearson test. The green color represents positive correlation values, the yellow color shows uncorrelated values and the red-orange color represents negative correlation.
PiL BD12 BD13 BS12 BS13 BFT12 BFT13 EFT12 EFT13 FD12 FD13 FP MD11 MD12 MD13 FDP12 FDP13 Jui Bf ISC11 ISC12 ISC13 PSC11 PSC12 PSC13 SSC11 SSC12 SSC13 TA11 TA12 TA13 FW11 FW12 FW13 SW11 SW12 SW13 FlW11 FlW12 FlW13 FpD11 FpD12 FpD13 FcD11 FcD12 FcD13 FsD11 FsD12 FsD13 SpD11 SpD12 SpD13 ScD11 ScD12 ScD13 SsD11 SsD12 SsD13 FlpD11 FlpD12 FlpD13 FlcD11 FlcD12 FlcD13 FlsD11 FlsD12 FlsD13 LP12 LP13 LS12 LS13 LBW12 LBW13 LL12 LL13 LBL12 LBL13 PL12 PL13 LW12 LW13 CC11 CC12 CC13
1 PiL 1 0.1564 0.0905 0.4069 0.3098 0.1581 0.2034 0.2186 0.2369 0.1085 -0.1199 0.6548 0.1456 0.1201 0.2122 0.0138 0.1832 -0.0075 0.0538 0.188 0.1991 -0.1398 0.0456 0.1022 -0.2128 -0.3953 -0.1339 -0.1514 0.2473 0.3942 0.3821 -0.1122 -0.0429 -0.0754 0.2557 0.3178 0.2569 -0.132 -0.0429 -0.1086 -0.2519 -0.0333 -0.0184 -0.0731 -0.006 -0.1091 -0.107 0.0205 -0.0886 -0.0041 0.231 0.2981 0.2893 0.3022 0.1772 0.2217 0.3272 0.2753 -0.3224 -0.1289 -0.2616 -0.151 -0.0491 -0.2158 -0.159 -0.0362 -0.205 0.064 0.1476 0.1039 0.1676 0.1338 0.1455 0.0697 0.1287 0.0428 0.1021 0.1225 0.1537 0.0442 0.1566 -0.0612 0.0887 -0.0556
BD12 0.1564 1 0.8313 0.257 0.1022 -0.0497 -0.189 0.0732 -0.0355 0.2192 0.3853 0.0441 0.2274 0.1502 -0.0468 0.1351 -0.0896 0.2111 -0.0219 -0.2397 -0.0105 0.0703 -0.1568 -0.1922 -0.0149 -0.0204 -0.0571 -0.1336 0.1261 0.1736 0.0118 -0.1754 -0.204 -0.2783 -0.0622 -0.1799 -0.15 -0.1777 -0.1936 -0.2809 0.0018 -0.1249 -0.0433 0.0242 -0.1417 -0.2362 -0.1246 -0.1869 -0.2813 0.1642 0.1435 0.0663 -0.1438 -0.1111 -0.2795 -0.1645 -0.1669 -0.1456 -0.1176 -0.2216 -0.1152 0.0596 -0.085 -0.184 -0.0942 -0.1282 -0.2588 -0.0803 -0.0999 -0.0974 -0.1338 -0.156 -0.1759 -0.0452 -0.0595 -0.0404 -0.1001 -0.032 0.115 -0.0741 -0.0821 -0.0549 -0.0698 -0.1008
BD13 0.0905 0.8313 1 0.1956 0.075 -0.1489 -0.3443 -0.02 -0.1197 0.23 0.4418 0.0916 0.032 0.062 -0.1136 0.0597 -0.1183 0.2238 -0.0283 -0.1492 0.1253 0.1346 -0.0864 -0.0971 0.0276 -0.1006 -0.2217 -0.0104 0.0866 -0.1084 -0.0976 -0.0611 -0.214 -0.2969 -0.0591 -0.1477 -0.2601 -0.0596 -0.2134 -0.2897 0.1104 -0.1456 -0.1118 0.1153 -0.0971 -0.199 -0.0234 -0.1779 -0.2678 0.127 -0.0091 -0.1122 -0.4357 -0.128 -0.3707 -0.1758 -0.1132 -0.2631 0.0539 -0.1932 -0.0769 0.1958 -0.0728 -0.0893 0.0131 -0.172 -0.2048 -0.1509 -0.195 -0.2187 -0.2696 -0.2876 -0.3371 -0.1237 -0.1488 -0.0924 -0.1708 -0.15 0.0155 -0.2289 -0.1664 0.0874 -0.178 -0.0026
BS12 0.4069 0.257 0.1956 1 0.5521 0.3574 0.1783 0.4295 0.2797 0.088 0.224 0.1981 -0.1417 0.0053 -0.0075 -0.047 -0.0445 0.343 -0.1091 -0.1118 -0.0966 0.1769 -0.0264 -0.1675 -0.1689 -0.3734 -0.2557 -0.2867 0.4573 -0.0847 -0.1645 -0.0845 -0.2253 -0.2083 -0.0103 -0.0853 -0.066 -0.0868 -0.185 -0.2154 0.132 -0.0729 -0.0001 0.0834 -0.1255 -0.0505 0.0431 -0.1237 -0.0787 0.3245 0.0735 0.1784 -0.0007 -0.0217 -0.0148 0.0146 -0.1555 -0.0315 -0.0562 -0.1326 -0.1237 0.0756 -0.1356 -0.0535 0.0419 -0.0987 -0.0753 0.2695 0.1893 0.1614 0.1307 0.0394 0.0247 0.2817 0.2464 0.2586 0.1983 0.1923 0.2816 0.1333 0.1502 -0.0046 -0.0874 -0.0189
BS13 0.3098 0.1022 0.075 0.5521 1 0.3117 0.3147 0.3129 0.3793 -0.0274 -0.0843 0.2674 -0.1383 -0.162 -0.1436 -0.1981 -0.1911 0.1632 0.0169 0.2139 0.0307 0.5401 0.2137 0.1189 0.0715 -0.1694 -0.08 -0.1092 0.1114 0.1026 -0.2421 0.0534 0.0654 0.0688 0.1886 0.2034 0.1441 0.0436 0.0867 0.058 0.1732 0.1091 0.1613 0.1007 0.0984 0.1879 0.0999 0.1537 0.1737 0.3101 0.2007 0.173 0.192 0.1759 0.1897 0.2666 0.1474 0.2285 0.007 0.116 0.033 0.046 0.1103 0.1273 0.0475 0.1748 0.0952 0.2059 0.2479 0.1983 0.253 0.126 0.1266 0.2318 0.2986 0.2438 0.3069 0.055 0.0942 0.0188 0.2212 0.0443 -0.0656 0.0661
BFT12 0.1581 -0.0497 -0.1489 0.3574 0.3117 1 0.7238 0.8364 0.7818 -0.3412 -0.0453 -0.0405 -0.108 -0.1067 0.019 -0.173 -0.1041 -0.1966 -0.2105 -0.3089 -0.4633 -0.3029 -0.2716 -0.3619 -0.5033 0.1673 0.2155 0.0841 0.4352 0.0111 0.0513 0.1271 0.0768 -0.0911 0.175 0.2714 -0.0222 0.1207 0.1018 -0.0949 0.1638 0.1383 0.0626 0.0379 0.0221 0.0499 0.1059 0.0756 0.0062 0.387 0.2936 0.2449 0.3005 0.2715 0.1588 0.2423 0.1263 0.1255 -0.0588 -0.0182 -0.1065 -0.0368 -0.0595 -0.0104 0.0589 0.0416 -0.0413 0.4091 0.1967 0.3608 0.198 0.2521 0.133 0.3978 0.1933 0.351 0.1967 0.3284 0.0741 0.3445 0.1396 -0.0204 0.0573 -0.0788
BFT13 0.2034 -0.189 -0.3443 0.1783 0.3147 0.7238 1 0.6836 0.839 -0.1411 -0.5787 0.1256 -0.0242 -0.0648 0.0264 -0.1423 -0.1041 -0.201 -0.0381 -0.1542 -0.2991 -0.018 -0.1049 -0.1599 -0.4158 0.3462 0.3796 0.2873 0.3803 0.2046 0.1478 0.1466 0.1881 0.0702 0.295 0.3579 0.149 0.1334 0.267 0.0595 0.1265 0.1696 0.2463 0.0169 0.1029 0.1766 0.0644 0.1583 0.0902 0.3903 0.3364 0.3502 0.3973 0.3791 0.3365 0.4633 0.2734 0.3677 -0.1093 0.0951 0.058 -0.0963 0.0657 0.0674 -0.0316 0.16 -0.0309 0.2831 0.178 0.3327 0.2083 0.297 0.1886 0.2574 0.1578 0.2129 0.1575 0.2564 0.0675 0.25 0.1113 -0.0782 0.092 -0.0755
EFT12 0.2186 0.0732 -0.02 0.4295 0.3129 0.8364 0.6836 1 0.7966 0.2256 0.1706 0.012 -0.0373 -0.0848 0.012 -0.1764 -0.1507 -0.1408 -0.1667 -0.2787 -0.3719 -0.2138 -0.3334 -0.3063 -0.4539 0.1128 0.1342 0.1582 0.5494 0.1097 0.1067 0.0181 0.0589 -0.0124 0.2163 0.3058 0.111 0.0053 0.0722 -0.025 0.0382 0.0592 0.1771 -0.0312 0.0034 0.1262 -0.0147 0.0782 0.0692 0.311 0.3303 0.3464 0.2714 0.3813 0.1714 0.3539 0.2381 0.3203 -0.168 -0.0038 -0.0272 -0.121 -0.0112 0.0815 -0.0909 0.1063 -0.0414 0.363 0.1482 0.3114 0.1099 0.2388 0.0409 0.3453 0.1521 0.3084 0.1347 0.2719 0.1311 0.2365 0.1167 -0.0358 0.0656 -0.0789
EFT13 0.2369 -0.0355 -0.1197 0.2797 0.3793 0.7818 0.839 0.7966 1 -0.0767 -0.2748 0.0343 -0.0348 -0.0809 -0.045 -0.1731 -0.1832 -0.1462 -0.1301 -0.2473 -0.2253 -0.1665 -0.1826 -0.2432 -0.4369 0.2262 0.3162 0.3532 0.546 0.1526 0.0654 0.0719 0.0694 -0.0744 0.1901 0.2489 0.0277 0.0626 0.1188 -0.0826 0.08 0.1232 0.1239 0.0131 0.069 0.0805 0.0555 0.1036 0.0006 0.3706 0.3295 0.2656 0.3461 0.3687 0.2015 0.2475 0.1486 0.1583 -0.1691 -0.0417 -0.0569 -0.0903 -0.0206 0.0044 0.0044 0.0823 -0.0649 0.2423 0.1783 0.2405 0.1558 0.1928 0.1134 0.2212 0.1611 0.1726 0.1505 0.2558 0.1071 0.1113 0.114 -0.1392 0.0717 -0.1352
FD12 0.1085 0.2192 0.23 0.088 -0.0274 -0.3412 -0.1411 0.2256 -0.0767 1 0.339 0.0962 0.1047 0.0341 -0.0072 -0.0036 -0.0852 0.0985 0.0699 0.0262 0.3077 0.1925 -0.1027 0.1349 0.0567 -0.0665 -0.1203 0.1411 0.2233 0.1654 0.1064 -0.1394 -0.0046 0.1489 0.0857 0.0467 0.2309 -0.1496 -0.0219 0.1344 -0.1674 -0.1013 0.2156 -0.0866 0.0122 0.14 -0.1605 0.0371 0.1096 -0.0675 0.0443 0.1816 -0.0098 0.1596 0.0144 0.2094 0.2049 0.3337 -0.1691 0.0696 0.1529 -0.1208 0.1479 0.1718 -0.2123 0.1496 0.0001 -0.1165 -0.0934 -0.118 -0.1619 -0.0465 -0.1582 -0.1255 -0.0846 -0.1075 -0.1213 -0.1146 0.0953 -0.2079 -0.0536 -0.0415 -0.0018 -0.019
FD13 -0.1199 0.3853 0.4418 0.224 -0.0843 -0.0453 -0.5787 0.1706 -0.2748 0.339 1 -0.2393 -0.0247 -0.019 -0.1462 -0.0104 -0.1451 0.0694 -0.2425 -0.1706 0.1029 0.0051 -0.3232 -0.1047 0.1202 -0.3212 -0.3459 0.0082 0.1627 -0.3217 -0.2968 -0.173 -0.2202 -0.1372 -0.1362 -0.2873 -0.2706 -0.1706 -0.2808 -0.1188 -0.115 -0.2131 -0.2093 -0.0896 -0.1637 -0.1 -0.1306 -0.1834 -0.1 -0.0987 -0.2113 -0.2194 -0.225 -0.2665 -0.3324 -0.199 -0.2881 -0.2035 -0.0795 -0.1216 -0.1004 -0.0394 -0.0796 0.0237 -0.094 -0.0997 -0.0378 -0.0552 -0.0747 -0.1673 -0.1269 -0.2268 -0.154 -0.0303 -0.0433 -0.0005 -0.0429 -0.115 -0.0208 -0.1448 -0.0067 0.1088 -0.0617 0.0676
7 FP 0.6548 0.0441 0.0916 0.1981 0.2674 -0.0405 0.1256 0.012 0.0343 0.0962 -0.2393 1 0.0333 0.0684 0.181 0.0188 0.1812 0.037 0.4125 0.2181 -0.011 0.1207 0.2142 0.1965 -0.018 0.0626 -0.1898 0.0067 -0.3729 0.4085 0.551 0.1868 0.1517 0.2524 0.3573 0.413 0.4223 0.1712 0.1642 0.2245 0.0711 0.0951 0.1909 0.1646 0.1736 0.1267 0.1161 0.1629 0.1263 -0.0929 0.1448 0.0955 -0.0598 0.3242 0.1482 0.2973 0.475 0.4117 0.1567 0.1689 0.1929 0.1506 0.1951 0.0952 0.0579 0.129 -0.0116 0.246 0.3077 0.2974 0.3618 0.2963 0.3213 0.2351 0.3035 0.2456 0.3074 0.0574 0.1104 0.1846 0.2698 0.2185 0.0412 0.2155
MD11 0.1456 0.2274 0.032 -0.1417 -0.1383 -0.108 -0.0242 -0.0373 -0.0348 0.1047 -0.0247 0.0333 1 0.9725 0.952 0.9685 0.9497 0.1212 -0.42 -0.3663 -0.4521 -0.2803 -0.7099 -0.552 -0.5719 0.2339 0.444 0.5116 0.1628 0.3609 0.6779 -0.6105 -0.5395 -0.3173 -0.0862 0.0696 0.0569 -0.6265 -0.5611 -0.3464 -0.61 -0.5596 -0.3332 -0.6602 -0.6105 -0.4629 -0.7043 -0.6218 -0.4466 -0.0379 0.151 0.2362 0.1724 0.0631 -0.0567 -0.0878 -0.033 0.1266 -0.7612 -0.7623 -0.6208 -0.6999 -0.6409 -0.5654 -0.7168 -0.65 -0.5509 -0.1666 -0.1374 -0.1681 -0.1616 -0.142 -0.0713 -0.1125 -0.1489 -0.1936 -0.2361 0.2565 0.2692 -0.1572 -0.098 0.1073 0.0258 0.0964
MD12 0.1201 0.1502 0.062 0.0053 -0.162 -0.1067 -0.0648 -0.0848 -0.0809 0.0341 -0.019 0.0684 0.9725 1 0.9639 0.9952 0.9547 0.2208 -0.4597 -0.3405 -0.3545 -0.1372 -0.7123 -0.5213 -0.5197 0.1927 0.2792 0.4385 0.07 0.0873 0.5206 -0.5758 -0.5722 -0.2807 -0.005 0.0627 0.064 -0.5944 -0.5838 -0.3072 -0.5619 -0.4987 -0.1811 -0.6078 -0.59 -0.3723 -0.6667 -0.6124 -0.3939 0.0924 0.1557 0.3005 0.2071 0.0883 -0.0198 -0.0543 -0.0582 0.128 -0.741 -0.7323 -0.4875 -0.6556 -0.634 -0.4601 -0.6851 -0.6366 -0.4861 -0.1554 -0.2243 -0.192 -0.2608 -0.161 -0.1765 -0.1281 -0.2326 -0.215 -0.3586 0.2862 0.4288 -0.1761 -0.1844 -0.0645 -0.1139 -0.0665
MD13 0.2122 -0.0468 -0.1136 -0.0075 -0.1436 0.019 0.0264 0.012 -0.045 -0.0072 -0.1462 0.181 0.952 0.9639 1 0.9559 0.9909 -0.0536 -0.3842 -0.2138 -0.3005 -0.2759 -0.7165 -0.3973 -0.5244 0.2805 0.3797 0.3774 0.2057 0.1254 0.5173 -0.4073 -0.3476 -0.2308 0.0888 0.1256 0.0352 -0.4278 -0.3708 -0.2514 -0.4777 -0.2882 -0.1967 -0.4997 -0.3659 -0.323 -0.5355 -0.3819 -0.3149 0.1662 0.2448 0.2971 0.1792 0.1296 0.0396 -0.0822 0.0442 0.0222 -0.6982 -0.5966 -0.4971 -0.5708 -0.4279 -0.4188 -0.5386 -0.4173 -0.3641 0.0662 -0.0576 0.0249 -0.0735 -0.0028 -0.0558 0.0727 -0.0722 0.0111 -0.1554 0.2358 0.2916 0.081 0.0293 0.051 0.1076 0.1603
FDP12 0.0138 0.1351 0.0597 -0.047 -0.1981 -0.173 -0.1423 -0.1764 -0.1731 -0.0036 -0.0104 0.0188 0.9685 0.9952 0.9559 1 0.9596 0.2534 -0.5004 -0.3184 -0.4092 -0.1577 -0.7626 -0.5507 -0.4896 0.2385 0.3381 0.515 -0.0482 0.0491 0.5039 -0.5732 -0.5558 -0.2946 -0.0703 0.006 0.0307 -0.5891 -0.5655 -0.3177 -0.5544 -0.5254 -0.2677 -0.6019 -0.5792 -0.4018 -0.6653 -0.6145 -0.4221 0.0631 0.1257 0.2577 0.14 0.0159 -0.0581 -0.1115 -0.0901 0.0855 -0.713 -0.7308 -0.5299 -0.6339 -0.6119 -0.4783 -0.6738 -0.6385 -0.5005 -0.1966 -0.3017 -0.2154 -0.3091 -0.1745 -0.2162 -0.1656 -0.3044 -0.2386 -0.4175 0.2325 0.3907 -0.198 -0.2235 -0.0371 -0.1359 -0.0487
FDP13 0.1832 -0.0896 -0.1183 -0.0445 -0.1911 -0.1041 -0.1041 -0.1507 -0.1832 -0.0852 -0.1451 0.1812 0.9497 0.9547 0.9909 0.9596 1 -0.0806 -0.3682 -0.1197 -0.2443 -0.2528 -0.6782 -0.3006 -0.4555 0.1648 0.2796 0.3617 0.1254 0.0906 0.5015 -0.4271 -0.3104 -0.1917 0.0429 0.0835 0.0362 -0.4494 -0.3412 -0.2097 -0.523 -0.2542 -0.1855 -0.5115 -0.3213 -0.3249 -0.5729 -0.3436 -0.2917 0.0867 0.1856 0.2685 0.0982 0.0574 0.0607 -0.1608 -0.0005 -0.0583 -0.6937 -0.5516 -0.4803 -0.5715 -0.3914 -0.4177 -0.5758 -0.4 -0.339 0.0665 -0.0664 0.0168 -0.0852 -0.0134 -0.089 0.071 -0.0678 0.0252 -0.1407 0.1848 0.2567 0.08 0.0319 0.0884 0.1441 0.1924
10 Jui -0.0075 0.2111 0.2238 0.343 0.1632 -0.1966 -0.201 -0.1408 -0.1462 0.0985 0.0694 0.037 0.1212 0.2208 -0.0536 0.2534 -0.0806 1 0.1361 0.1914 0.0436 0.1821 0.0983 -0.2528 -0.0361 0.104 -0.2186 -0.3874 -0.34 0.29 0.0207 -0.2892 -0.472 -0.246 -0.1976 -0.0075 0.0184 -0.2864 -0.4658 -0.2651 -0.0521 -0.2211 -0.0461 -0.1405 -0.3546 -0.1999 -0.2337 -0.3629 -0.2164 0.0543 0.0449 0.0899 -0.1124 0.018 -0.1008 -0.2079 0.0004 -0.0227 -0.0988 -0.3135 -0.143 -0.0947 -0.3773 -0.2119 -0.1964 -0.3923 -0.2355 -0.1329 -0.3703 -0.2543 -0.4247 -0.2214 -0.3308 -0.0986 -0.3678 -0.1338 -0.4127 0.1054 0.1117 -0.129 -0.2975 0.1382 -0.0373 0.1289
11 Bf 0.0538 -0.0219 -0.0283 -0.1091 0.0169 -0.2105 -0.0381 -0.1667 -0.1301 0.0699 -0.2425 0.4125 -0.42 -0.4597 -0.3842 -0.5004 -0.3682 0.1361 1 0.4476 0.4408 0.2439 0.7004 0.6161 0.613 0.036 -0.0861 -0.3637 0.0138 0.3686 0.2253 0.3477 0.2777 0.3836 -0.0039 0.1499 0.3017 0.3591 0.2994 0.3764 0.1776 0.3351 0.4008 0.3891 0.3652 0.3962 0.3752 0.3546 0.3959 -0.2834 -0.0549 0.0598 -0.2027 0.0158 0.2067 -0.1533 0.1999 0.0709 0.4243 0.4319 0.4884 0.4406 0.3608 0.3924 0.4184 0.3092 0.402 0.3143 0.2591 0.3759 0.2941 0.3914 0.2579 0.2989 0.2794 0.3591 0.3984 -0.1679 -0.3712 0.2538 0.1719 0.3731 0.2845 0.3729
ISC11 0.188 -0.2397 -0.1492 -0.1118 0.2139 -0.3089 -0.1542 -0.2787 -0.2473 0.0262 -0.1706 0.2181 -0.3663 -0.3405 -0.2138 -0.3184 -0.1197 0.1914 0.4476 1 0.7351 0.5181 0.6582 0.7087 0.7156 0.1781 -0.0849 -0.3213 0.3281 0.4874 0.0884 0.2229 0.2249 0.2343 0.1583 0.0063 0.1499 0.2208 0.2408 0.2348 0.0988 0.1681 0.1845 0.2616 0.2703 0.254 0.2434 0.3129 0.3391 -0.2507 -0.2224 -0.0998 -0.0483 -0.0543 0.1445 0.0191 0.0431 -0.008 0.2504 0.2738 0.2625 0.2453 0.253 0.226 0.2477 0.2982 0.3604 0.4653 0.3196 0.5188 0.2595 0.5395 0.0753 0.4376 0.3628 0.5154 0.4265 -0.1434 -0.1844 0.4317 0.3268 0.5022 0.6169 0.3559
ISC12 0.1991 -0.0105 0.1253 -0.0966 0.0307 -0.4633 -0.2991 -0.3719 -0.2253 0.3077 0.1029 -0.011 -0.4521 -0.3545 -0.3005 -0.4092 -0.2443 0.0436 0.4408 0.7351 1 0.5484 0.6787 0.8582 0.8403 -0.1919 -0.2241 -0.1188 0.1644 0.1127 -0.2183 -0.0006 0.0532 0.0362 -0.1401 -0.2113 -0.0621 0.0086 0.0265 0.0457 -0.0865 0.1457 0.1464 0.0916 0.2297 0.0517 0.0861 0.2303 0.1552 -0.2648 -0.1252 -0.0207 -0.1187 -0.1097 -0.106 -0.2917 -0.1325 -0.177 0.058 0.284 0.2135 0.1296 0.28 0.1047 0.1704 0.2964 0.2693 -0.0565 0.2581 -0.0593 0.0917 -0.0061 -0.0442 -0.0707 0.3107 0.0116 0.3116 -0.3149 0.0908 -0.207 0.1595 0.2431 0.2227 0.4357
ISC13 -0.1398 0.0703 0.1346 0.1769 0.5401 -0.3029 -0.018 -0.2138 -0.1665 0.1925 0.0051 0.1207 -0.2803 -0.1372 -0.2759 -0.1577 -0.2528 0.1821 0.2439 0.5181 0.5484 1 0.5446 0.6016 0.7109 -0.0238 -0.2045 -0.1515 -0.4334 -0.1474 -0.3595 0.1178 0.1591 0.3293 -0.0229 -0.2291 0.0782 0.1247 0.2161 0.3458 0.2335 0.2915 0.5304 0.2061 0.3043 0.435 0.1985 0.3407 0.4774 0.0557 -0.0462 0.0959 -0.003 -0.1838 0.0949 0.1703 -0.2337 0.104 0.258 0.4465 0.6318 0.2211 0.4087 0.4678 0.1684 0.4868 0.5614 0.1195 0.1272 0.1162 -0.0047 0.0343 -0.1348 0.1717 0.1969 0.219 0.1948 -0.1364 0.0468 -0.0553 0.1445 0.2475 0.0271 0.1667
PSC11 0.0456 -0.1568 -0.0864 -0.0264 0.2137 -0.2716 -0.1049 -0.3334 -0.1826 -0.1027 -0.3232 0.2142 -0.7099 -0.7123 -0.7165 -0.7626 -0.6782 0.0983 0.7004 0.6582 0.6787 0.5446 1 0.8559 0.968 -0.5416 -0.474 -0.7137 -0.0762 0.0469 -0.448 0.3341 0.317 0.3042 0.078 0.0373 0.128 0.3395 0.3228 0.3121 0.2746 0.3759 0.3097 0.4363 0.414 0.3455 0.4565 0.4369 0.4467 -0.3368 -0.1114 -0.2041 -0.2313 0.0277 0.1646 -0.0416 0.0972 -0.1106 0.5104 0.4615 0.5181 0.4679 0.3812 0.3576 0.4789 0.416 0.5257 0.3531 0.3656 0.3955 0.3337 0.4369 0.1942 0.324 0.4134 0.4117 0.4961 -0.2072 -0.2183 0.3311 0.2248 0.3486 0.4831 0.3264
PSC12 0.1022 -0.1922 -0.0971 -0.1675 0.1189 -0.3619 -0.1599 -0.3063 -0.2432 0.1349 -0.1047 0.1965 -0.552 -0.5213 -0.3973 -0.5507 -0.3006 -0.2528 0.6161 0.7087 0.8582 0.6016 0.8559 1 0.9612 -0.3059 -0.2724 -0.2005 -0.2004 0.0299 -0.2087 0.2049 0.3684 0.3485 -0.1452 -0.128 0.1085 0.2207 0.3634 0.36 0.0187 0.3311 0.3094 0.2628 0.4916 0.3217 0.2843 0.4896 0.4224 -0.4999 -0.2128 -0.1054 -0.3097 -0.148 0.0919 -0.2604 -0.0537 -0.1406 0.3713 0.5762 0.5083 0.3355 0.5622 0.3554 0.3569 0.5504 0.5105 0.1789 0.3686 0.2119 0.2924 0.1892 0.1086 0.177 0.4199 0.2775 0.502 -0.337 -0.2199 0.1018 0.2569 0.1986 0.2872 0.2948
PSC13 -0.2128 -0.0149 0.0276 -0.1689 0.0715 -0.5033 -0.4158 -0.4539 -0.4369 0.0567 0.1202 -0.018 -0.5719 -0.5197 -0.5244 -0.4896 -0.4555 -0.0361 0.613 0.7156 0.8403 0.7109 0.968 0.9612 1 -0.1756 -0.2645 -0.2811 -0.2949 -0.0052 -0.339 0.1812 0.2992 0.4052 -0.2852 -0.2384 0.1302 0.2073 0.3024 0.4204 0.1425 0.3159 0.3836 0.2904 0.439 0.3798 0.3027 0.4518 0.4778 -0.481 -0.2299 -0.1078 -0.3899 -0.2731 0.0652 -0.3169 -0.2015 -0.0719 0.5441 0.5549 0.5997 0.4099 0.5292 0.4387 0.4012 0.524 0.567 0.1158 0.2344 0.1648 0.1502 0.16 -0.0323 0.1405 0.3246 0.2404 0.4022 -0.3426 -0.2423 0.0262 0.145 0.2954 0.263 0.2305
SSC11 -0.3953 -0.0204 -0.1006 -0.3734 -0.1694 0.1673 0.3462 0.1128 0.2262 -0.0665 -0.3212 0.0626 0.2339 0.1927 0.2805 0.2385 0.1648 0.104 0.036 0.1781 -0.1919 -0.0238 -0.5416 -0.3059 -0.1756 1 0.8697 0.7922 0.2026 0.1323 0.3517 0.5888 0.5048 0.3581 0.1645 0.1068 -0.0303 0.6073 0.5478 0.3945 0.7587 0.5805 0.5607 0.5196 0.4863 0.4889 0.4804 0.4284 0.3061 0.5067 0.4068 0.3151 0.1424 0.131 0.0612 0.1031 0.1465 0.0752 0.4218 0.4524 0.5463 0.5111 0.5346 0.627 0.5308 0.5222 0.4016 0.1922 0.0403 0.3265 0.1585 0.3113 0.2009 0.2015 -0.0006 0.222 0.0371 -0.0209 -0.1314 0.1995 0.227 0.3509 0.2199 0.2143
SSC12 -0.1339 -0.0571 -0.2217 -0.2557 -0.08 0.2155 0.3796 0.1342 0.3162 -0.1203 -0.3459 -0.1898 0.444 0.2792 0.3797 0.3381 0.2796 -0.2186 -0.0861 -0.0849 -0.2241 -0.2045 -0.474 -0.2724 -0.2645 0.8697 1 0.7091 0.5097 0.0748 0.1878 0.4263 0.4346 0.173 0.134 -0.0196 -0.0419 0.4393 0.4716 0.1926 0.5914 0.38 0.1284 0.3959 0.3643 0.2621 0.3268 0.3194 0.0798 0.5772 0.2657 0.1331 0.2245 0.0075 -0.0199 0.1255 0.0264 0.079 0.1895 0.3361 0.0654 0.3664 0.425 0.3567 0.3338 0.4058 0.0619 0.1047 0.1157 0.2367 0.1994 0.279 0.2169 0.1391 0.0639 0.0848 0.0465 0.2282 0.074 0.0986 0.2248 -0.0951 -0.0158 -0.2606
SSC13 -0.1514 -0.1336 -0.0104 -0.2867 -0.1092 0.0841 0.2873 0.1582 0.3532 0.1411 0.0082 0.0067 0.5116 0.4385 0.3774 0.515 0.3617 -0.3874 -0.3637 -0.3213 -0.1188 -0.1515 -0.7137 -0.2005 -0.2811 0.7922 0.7091 1 0.3149 -0.1628 0.164 -0.0508 0.0328 -0.0021 0.152 -0.1052 -0.1844 -0.0647 0.0151 0.0197 -0.0077 -0.1918 -0.1381 -0.2212 -0.0791 -0.0111 -0.2292 -0.153 -0.0895 0.346 -0.0605 -0.0922 0.1841 -0.0865 -0.0774 0.0426 -0.125 -0.0993 -0.2996 -0.2166 -0.1317 -0.2979 -0.0472 0.0227 -0.2703 -0.1229 -0.0658 -0.0247 0.1618 0.0838 0.2051 0.1081 0.2278 -0.0517 0.1254 -0.0209 0.0981 -0.167 0.1714 -0.1592 0.2436 -0.0317 -0.3825 -0.0169
TA11 0.2473 0.1261 0.0866 0.4573 0.1114 0.4352 0.3803 0.5494 0.546 0.2233 0.1627 -0.3729 0.1628 0.07 0.2057 -0.0482 0.1254 -0.34 0.0138 0.3281 0.1644 -0.4334 -0.0762 -0.2004 -0.2949 0.2026 0.5097 0.3149 1 0.1332 0.3793 0.092 0.0759 -0.0402 0.3723 0.2637 0.109 0.0618 0.0607 -0.0536 0.0314 0.1619 0.0449 0.1107 -0.0288 0.2023 0.0655 0.0909 0.1243 0.6241 0.5039 0.4881 0.5611 0.4471 0.287 0.256 0.2514 0.2356 -0.5892 -0.2508 -0.3091 -0.1399 -0.2551 0.1182 -0.0328 0.0363 0.0596 0.1116 0.3868 0.1839 0.3848 0.281 0.4378 0.0971 0.3123 0.009 0.272 0.3179 0.2273 0.3111 0.6354 0.0919 0.2093 -0.105
TA12 0.3942 0.1736 -0.1084 -0.0847 0.1026 0.0111 0.2046 0.1097 0.1526 0.1654 -0.3217 0.4085 0.3609 0.0873 0.1254 0.0491 0.0906 0.29 0.3686 0.4874 0.1127 -0.1474 0.0469 0.0299 -0.0052 0.1323 0.0748 -0.1628 0.1332 1 0.8603 -0.0269 -0.0268 0.1027 0.1297 0.4913 0.4979 -0.0395 -0.0368 0.0493 -0.2602 -0.1373 0.1526 -0.0335 -0.0459 0.1183 -0.1053 0.0994 0.2199 -0.0983 0.0276 0.2338 0.3024 0.3767 0.3565 0.1703 0.4581 0.4149 -0.2694 -0.2579 -0.1022 -0.1769 -0.248 -0.1197 -0.211 -0.117 0.0081 0.1292 -0.0361 0.1382 -0.0848 0.2646 -0.1675 0.0947 -0.0111 0.0978 0.0739 0.0076 -0.2689 0.0745 -0.1466 0.2443 0.479 0.2593
TA13 0.3821 0.0118 -0.0976 -0.1645 -0.2421 0.0513 0.1478 0.1067 0.0654 0.1064 -0.2968 0.551 0.6779 0.5206 0.5173 0.5039 0.5015 0.0207 0.2253 0.0884 -0.2183 -0.3595 -0.448 -0.2087 -0.339 0.3517 0.1878 0.164 0.3793 0.8603 1 -0.2389 -0.1196 0.0369 0.1341 0.5309 0.4998 -0.2607 -0.1697 -0.0199 -0.5297 -0.1791 -0.007 -0.3509 -0.2278 -0.0037 -0.4131 -0.1936 0.0286 -0.2005 0.1596 0.2444 0.1761 0.3879 0.3887 0.0445 0.51 0.4289 -0.5058 -0.4233 -0.2505 -0.4354 -0.4441 -0.2028 -0.4762 -0.462 -0.199 0.2573 0.2215 0.3492 0.2736 0.4524 0.3314 0.2253 0.1963 0.2024 0.2152 0.2093 -0.0225 0.2118 0.2059 0.5484 0.3769 0.4929
FW11 -0.1122 -0.1754 -0.0611 -0.0845 0.0534 0.1271 0.1466 0.0181 0.0719 -0.1394 -0.173 0.1868 -0.6105 -0.5758 -0.4073 -0.5732 -0.4271 -0.2892 0.3477 0.2229 -0.0006 0.1178 0.3341 0.2049 0.1812 0.5888 0.4263 -0.0508 0.092 -0.0269 -0.2389 1 0.9262 0.7807 0.5837 0.3091 0.2609 0.9987 0.9414 0.8101 0.8599 0.8459 0.7302 0.9484 0.9261 0.8655 0.9604 0.8946 0.7505 0.4306 0.347 0.2478 0.1991 0.3226 0.3769 0.4106 0.3889 0.2284 0.8095 0.8148 0.7907 0.8929 0.9162 0.9212 0.9154 0.9017 0.7524 0.3908 0.4476 0.4261 0.461 0.3038 0.2761 0.3937 0.4501 0.4237 0.5226 0.0362 -0.1576 0.3249 0.4001 -0.0362 0.0778 0.0453
FW12 -0.0429 -0.204 -0.214 -0.2253 0.0654 0.0768 0.1881 0.0589 0.0694 -0.0046 -0.2202 0.1517 -0.5395 -0.5722 -0.3476 -0.5558 -0.3104 -0.472 0.2777 0.2249 0.0532 0.1591 0.317 0.3684 0.2992 0.5048 0.4346 0.0328 0.0759 -0.0268 -0.1196 0.9262 1 0.847 0.5665 0.3095 0.4266 0.9212 0.9969 0.8593 0.8257 0.8548 0.6716 0.8381 0.9387 0.834 0.8662 0.9446 0.8007 0.3003 0.3223 0.3011 0.2299 0.299 0.5294 0.5131 0.3936 0.3933 0.7847 0.8497 0.7236 0.7672 0.8909 0.8212 0.7889 0.9036 0.7469 0.3281 0.4351 0.4255 0.4906 0.3824 0.3555 0.3384 0.4287 0.3504 0.5109 0.0316 -0.2128 0.3097 0.4477 0.0192 0.1429 0.0182
FW13 -0.0754 -0.2783 -0.2969 -0.2083 0.0688 -0.0911 0.0702 -0.0124 -0.0744 0.1489 -0.1372 0.2524 -0.3173 -0.2807 -0.2308 -0.2946 -0.1917 -0.246 0.3836 0.2343 0.0362 0.3293 0.3042 0.3485 0.4052 0.3581 0.173 -0.0021 -0.0402 0.1027 0.0369 0.7807 0.847 1 0.6107 0.4731 0.6822 0.7682 0.8426 0.9969 0.6143 0.7638 0.8174 0.6705 0.8324 0.9421 0.7327 0.8633 0.9487 0.1648 0.3598 0.424 0.5511 0.4727 0.7051 0.5433 0.5118 0.5537 0.618 0.6543 0.7966 0.5566 0.7008 0.868 0.6309 0.7572 0.8644 0.5329 0.5328 0.6012 0.5608 0.5898 0.3971 0.521 0.5211 0.5152 0.5837 0.0978 -0.1875 0.4675 0.521 0.0994 0.1686 0.191
SW11 0.2557 -0.0622 -0.0591 -0.0103 0.1886 0.175 0.295 0.2163 0.1901 0.0857 -0.1362 0.3573 -0.0862 -0.005 0.0888 -0.0703 0.0429 -0.1976 -0.0039 0.1583 -0.1401 -0.0229 0.078 -0.1452 -0.2852 0.1645 0.134 0.152 0.3723 0.1297 0.1341 0.5837 0.5665 0.6107 1 0.7379 0.5695 0.542 0.5318 0.5949 0.4539 0.474 0.5312 0.4981 0.4885 0.5843 0.5037 0.5094 0.5554 0.5907 0.6675 0.6576 0.6267 0.7945 0.6185 0.762 0.671 0.7207 0.1734 0.2183 0.2423 0.3189 0.3744 0.452 0.3636 0.4759 0.3509 0.4713 0.633 0.4849 0.621 0.4161 0.5222 0.493 0.6035 0.4245 0.547 0.4345 0.3143 0.4563 0.6165 -0.0271 -0.0113 0.0638
SW12 0.3178 -0.1799 -0.1477 -0.0853 0.2034 0.2714 0.3579 0.3058 0.2489 0.0467 -0.2873 0.413 0.0696 0.0627 0.1256 0.006 0.0835 -0.0075 0.1499 0.0063 -0.2113 -0.2291 0.0373 -0.128 -0.2384 0.1068 -0.0196 -0.1052 0.2637 0.4913 0.5309 0.3091 0.3095 0.4731 0.7379 1 0.7763 0.2727 0.2338 0.4216 0.1553 0.3499 0.4495 0.1477 0.2727 0.4258 0.1914 0.3188 0.4526 0.264 0.671 0.6705 0.5081 0.9065 0.7352 0.7316 0.9269 0.8332 0.003 0.0046 0.1234 -0.0093 0.0269 0.2153 0.0317 0.0728 0.1959 0.236 0.41 0.2759 0.4577 0.3523 0.5042 0.2206 0.3408 0.1285 0.3086 0.3864 0.1936 0.2327 0.3652 -0.0076 0.0001 0.1225
SW13 0.2569 -0.15 -0.2601 -0.066 0.1441 -0.0222 0.149 0.111 0.0277 0.2309 -0.2706 0.4223 0.0569 0.064 0.0352 0.0307 0.0362 0.0184 0.3017 0.1499 -0.0621 0.0782 0.128 0.1085 0.1302 -0.0303 -0.0419 -0.1844 0.109 0.4979 0.4998 0.2609 0.4266 0.6822 0.5695 0.7763 1 0.2328 0.3951 0.6221 0.114 0.4694 0.602 0.2145 0.4199 0.6051 0.2482 0.5096 0.6787 0.046 0.5521 0.6354 0.5769 0.7742 0.8692 0.4955 0.7654 0.8543 0.1034 0.1151 0.339 0.0704 0.1368 0.3762 0.1357 0.2826 0.4458 0.4295 0.6586 0.4885 0.6758 0.6049 0.5936 0.4182 0.6193 0.3388 0.6005 0.3682 0.1366 0.4508 0.5804 0.1306 0.2287 0.2443
FlW11 -0.132 -0.1777 -0.0596 -0.0868 0.0436 0.1207 0.1334 0.0053 0.0626 -0.1496 -0.1706 0.1712 -0.6265 -0.5944 -0.4278 -0.5891 -0.4494 -0.2864 0.3591 0.2208 0.0086 0.1247 0.3395 0.2207 0.2073 0.6073 0.4393 -0.0647 0.0618 -0.0395 -0.2607 0.9987 0.9212 0.7682 0.542 0.2727 0.2328 1 0.9391 0.7997 0.8618 0.844 0.7198 0.9506 0.926 0.8562 0.9627 0.8922 0.7392 0.409 0.3168 0.2137 0.1671 0.2833 0.3495 0.3777 0.3601 0.1897 0.827 0.8308 0.8011 0.9043 0.9258 0.9223 0.9249 0.9043 0.7544 0.3752 0.4242 0.411 0.4388 0.2886 0.2535 0.3769 0.4286 0.4122 0.5072 0.0105 -0.1825 0.3084 0.3729 -0.0358 0.0815 0.043
FlW12 -0.0429 -0.1936 -0.2134 -0.185 0.0867 0.1018 0.267 0.0722 0.1188 -0.0219 -0.2808 0.1642 -0.5611 -0.5838 -0.3708 -0.5655 -0.3412 -0.4658 0.2994 0.2408 0.0265 0.2161 0.3228 0.3634 0.3024 0.5478 0.4716 0.0151 0.0607 -0.0368 -0.1697 0.9414 0.9969 0.8426 0.5318 0.2338 0.3951 0.9391 1 0.8584 0.8426 0.8481 0.6663 0.8607 0.9367 0.8314 0.8842 0.9399 0.7835 0.2886 0.2916 0.2611 0.2003 0.2414 0.5003 0.4777 0.333 0.3533 0.8112 0.8655 0.7514 0.797 0.9085 0.834 0.8151 0.9179 0.747 0.3477 0.3881 0.448 0.4539 0.3997 0.3253 0.3544 0.3829 0.371 0.4759 0.0229 -0.2963 0.3275 0.3918 -0.0077 0.13 -0.0266
FlW13 -0.1086 -0.2809 -0.2897 -0.2154 0.058 -0.0949 0.0595 -0.025 -0.0826 0.1344 -0.1188 0.2245 -0.3464 -0.3072 -0.2514 -0.3177 -0.2097 -0.2651 0.3764 0.2348 0.0457 0.3458 0.3121 0.36 0.4204 0.3945 0.1926 0.0197 -0.0536 0.0493 -0.0199 0.8101 0.8593 0.9969 0.5949 0.4216 0.6221 0.7997 0.8584 1 0.6471 0.7656 0.8095 0.6968 0.8444 0.9425 0.7599 0.8677 0.9416 0.172 0.3231 0.3853 0.5302 0.4189 0.6607 0.5305 0.4619 0.5004 0.6522 0.6885 0.8155 0.5899 0.7359 0.8878 0.6627 0.7798 0.8765 0.5236 0.509 0.5902 0.5371 0.5659 0.3712 0.5121 0.4997 0.5143 0.5671 0.0657 -0.208 0.4507 0.498 0.0922 0.1558 0.1782
FpD11 -0.2519 0.0018 0.1104 0.132 0.1732 0.1638 0.1265 0.0382 0.08 -0.1674 -0.115 0.0711 -0.61 -0.5619 -0.4777 -0.5544 -0.523 -0.0521 0.1776 0.0988 -0.0865 0.2335 0.2746 0.0187 0.1425 0.7587 0.5914 -0.0077 0.0314 -0.2602 -0.5297 0.8599 0.8257 0.6143 0.4539 0.1553 0.114 0.8618 0.8426 0.6471 1 0.8659 0.7555 0.891 0.8599 0.775 0.8861 0.8299 0.6362 0.6405 0.4627 0.3063 0.0999 0.2447 0.2576 0.3107 0.2639 0.0838 0.8438 0.7377 0.7944 0.8664 0.8441 0.8685 0.8592 0.8427 0.682 0.3691 0.2657 0.3785 0.2497 0.2278 0.1004 0.4028 0.2777 0.3995 0.2757 0.1617 0.0624 0.212 0.2359 -0.1404 -0.1824 -0.2011
FpD12 -0.0333 -0.1249 -0.1456 -0.0729 0.1091 0.1383 0.1696 0.0592 0.1232 -0.1013 -0.2131 0.0951 -0.5596 -0.4987 -0.2882 -0.5254 -0.2542 -0.2211 0.3351 0.1681 0.1457 0.2915 0.3759 0.3311 0.3159 0.5805 0.38 -0.1918 0.1619 -0.1373 -0.1791 0.8459 0.8548 0.7638 0.474 0.3499 0.4694 0.844 0.8481 0.7656 0.8659 1 0.849 0.8011 0.8916 0.8081 0.8232 0.8978 0.7949 0.4034 0.607 0.5918 0.1344 0.4075 0.5994 0.3765 0.4006 0.324 0.7611 0.8277 0.7597 0.7516 0.7953 0.7612 0.7752 0.8456 0.7681 0.3182 0.4555 0.3858 0.4943 0.3606 0.412 0.3337 0.4398 0.3066 0.4736 0.1719 -0.024 0.3722 0.4974 0.0035 0.1341 0.0101
FpD13 -0.0184 -0.0433 -0.1118 -0.0001 0.1613 0.0626 0.2463 0.1771 0.1239 0.2156 -0.2093 0.1909 -0.3332 -0.1811 -0.1967 -0.2677 -0.1855 -0.0461 0.4008 0.1845 0.1464 0.5304 0.3097 0.3094 0.3836 0.5607 0.1284 -0.1381 0.0449 0.1526 -0.007 0.7302 0.6716 0.8174 0.5312 0.4495 0.602 0.7198 0.6663 0.8095 0.7555 0.849 1 0.6941 0.7509 0.8487 0.7061 0.7839 0.8318 0.4151 0.6014 0.6961 0.4914 0.5584 0.6969 0.5103 0.4238 0.4465 0.6198 0.554 0.8349 0.5952 0.5422 0.7545 0.6203 0.6769 0.7722 0.5141 0.3951 0.5936 0.4055 0.5748 0.2984 0.5171 0.3805 0.5023 0.4019 0.1337 -0.0503 0.3915 0.3592 0.0061 0.0898 0.0197
FcD11 -0.0731 0.0242 0.1153 0.0834 0.1007 0.0379 0.0169 -0.0312 0.0131 -0.0866 -0.0896 0.1646 -0.6602 -0.6078 -0.4997 -0.6019 -0.5115 -0.1405 0.3891 0.2616 0.0916 0.2061 0.4363 0.2628 0.2904 0.5196 0.3959 -0.2212 0.1107 -0.0335 -0.3509 0.9484 0.8381 0.6705 0.4981 0.1477 0.2145 0.9506 0.8607 0.6968 0.891 0.8011 0.6941 1 0.8966 0.8269 0.9694 0.8521 0.6908 0.4196 0.2812 0.1796 0.0895 0.2048 0.2833 0.2871 0.2522 0.0985 0.8573 0.7829 0.7913 0.9739 0.9063 0.917 0.9512 0.8771 0.7351 0.3588 0.3909 0.3491 0.3321 0.2046 0.1135 0.3842 0.4186 0.4022 0.4645 0.0763 -0.073 0.2279 0.3017 -0.0407 0.0897 -0.0184
FcD12 -0.006 -0.1417 -0.0971 -0.1255 0.0984 0.0221 0.1029 0.0034 0.069 0.0122 -0.1637 0.1736 -0.6105 -0.59 -0.3659 -0.5792 -0.3213 -0.3546 0.3652 0.2703 0.2297 0.3043 0.414 0.4916 0.439 0.4863 0.3643 -0.0791 -0.0288 -0.0459 -0.2278 0.9261 0.9387 0.8324 0.4885 0.2727 0.4199 0.926 0.9367 0.8444 0.8599 0.8916 0.7509 0.8966 1 0.8597 0.9165 0.9765 0.8298 0.2799 0.33 0.3647 0.0999 0.2864 0.5471 0.3572 0.3734 0.2778 0.84 0.873 0.7854 0.8534 0.9569 0.845 0.8772 0.9439 0.8219 0.2885 0.4082 0.3334 0.4135 0.2663 0.2593 0.31 0.4096 0.3098 0.4758 0.0697 -0.1557 0.2364 0.3725 0.013 0.1236 0.0451
FcD13 -0.1091 -0.2362 -0.199 -0.0505 0.1879 0.0499 0.1766 0.1262 0.0805 0.14 -0.1 0.1267 -0.4629 -0.3723 -0.323 -0.4018 -0.3249 -0.1999 0.3962 0.254 0.0517 0.435 0.3455 0.3217 0.3798 0.4889 0.2621 -0.0111 0.2023 0.1183 -0.0037 0.8655 0.834 0.9421 0.5843 0.4258 0.6051 0.8562 0.8314 0.9425 0.775 0.8081 0.8487 0.8269 0.8597 1 0.8391 0.8704 0.9564 0.3608 0.3884 0.4136 0.5516 0.4685 0.6847 0.5429 0.4912 0.4723 0.6839 0.6597 0.8444 0.7189 0.7035 0.9484 0.7536 0.7549 0.9034 0.5238 0.4932 0.5494 0.4696 0.5144 0.3033 0.5133 0.4797 0.4955 0.5322 0.145 -0.1581 0.3905 0.4658 0.0712 0.1155 0.0606
FsD11 -0.107 -0.1246 -0.0234 0.0431 0.0999 0.1059 0.0644 -0.0147 0.0555 -0.1605 -0.1306 0.1161 -0.7043 -0.6667 -0.5355 -0.6653 -0.5729 -0.2337 0.3752 0.2434 0.0861 0.1985 0.4565 0.2843 0.3027 0.4804 0.3268 -0.2292 0.0655 -0.1053 -0.4131 0.9604 0.8662 0.7327 0.5037 0.1914 0.2482 0.9627 0.8842 0.7599 0.8861 0.8232 0.7061 0.9694 0.9165 0.8391 1 0.9 0.7583 0.4026 0.2804 0.2038 0.1464 0.2643 0.3763 0.3058 0.2826 0.1207 0.863 0.8121 0.7947 0.9285 0.9094 0.8903 0.9792 0.9279 0.8037 0.4253 0.4445 0.4287 0.4286 0.2928 0.2325 0.4406 0.4598 0.4526 0.5187 0.1195 -0.1091 0.3331 0.3476 -0.071 0.06 -0.0077
FsD12 0.0205 -0.1869 -0.1779 -0.1237 0.1537 0.0756 0.1583 0.0782 0.1036 0.0371 -0.1834 0.1629 -0.6218 -0.6124 -0.3819 -0.6145 -0.3436 -0.3629 0.3546 0.3129 0.2303 0.3407 0.4369 0.4896 0.4518 0.4284 0.3194 -0.153 0.0909 0.0994 -0.1936 0.8946 0.9446 0.8633 0.5094 0.3188 0.5096 0.8922 0.9399 0.8677 0.8299 0.8978 0.7839 0.8521 0.9765 0.8704 0.9 1 0.8845 0.2856 0.3571 0.4261 0.1907 0.3537 0.624 0.429 0.4136 0.3693 0.8 0.8689 0.7812 0.7852 0.9102 0.8226 0.8435 0.9587 0.8481 0.3457 0.4326 0.3982 0.4537 0.3465 0.3025 0.362 0.4315 0.3644 0.5106 0.0713 -0.1999 0.31 0.4154 0.0121 0.1712 0.055
FsD13 -0.0886 -0.2813 -0.2678 -0.0787 0.1737 0.0062 0.0902 0.0692 0.0006 0.1096 -0.1 0.1263 -0.4466 -0.3939 -0.3149 -0.4221 -0.2917 -0.2164 0.3959 0.3391 0.1552 0.4774 0.4467 0.4224 0.4778 0.3061 0.0798 -0.0895 0.1243 0.2199 0.0286 0.7505 0.8007 0.9487 0.5554 0.4526 0.6787 0.7392 0.7835 0.9416 0.6362 0.7949 0.8318 0.6908 0.8298 0.9564 0.7583 0.8845 1 0.2355 0.3862 0.414 0.5553 0.516 0.7406 0.5049 0.4927 0.4928 0.6065 0.64 0.821 0.5733 0.6432 0.8697 0.6773 0.7733 0.9449 0.5437 0.5895 0.5808 0.5719 0.5776 0.4016 0.5338 0.5864 0.5224 0.6409 0.1234 -0.1574 0.474 0.5667 0.1428 0.2135 0.1699
SpD11 -0.0041 0.1642 0.127 0.3245 0.3101 0.387 0.3903 0.311 0.3706 -0.0675 -0.0987 -0.0929 -0.0379 0.0924 0.1662 0.0631 0.0867 0.0543 -0.2834 -0.2507 -0.2648 0.0557 -0.3368 -0.4999 -0.481 0.5067 0.5772 0.346 0.6241 -0.0983 -0.2005 0.4306 0.3003 0.1648 0.5907 0.264 0.046 0.409 0.2886 0.172 0.6405 0.4034 0.4151 0.4196 0.2799 0.3608 0.4026 0.2856 0.2355 1 0.6859 0.6065 0.513 0.4249 0.245 0.4502 0.2266 0.2409 0.1283 0.0238 0.1177 0.294 0.1762 0.3425 0.3244 0.2649 0.1717 0.2212 0.2455 0.1802 0.1863 0.0649 0.1541 0.274 0.2173 0.1818 0.0953 0.4404 0.4607 0.1091 0.3179 -0.2392 -0.3301 -0.2861
SpD12 0.231 0.1435 -0.0091 0.0735 0.2007 0.2936 0.3364 0.3303 0.3295 0.0443 -0.2113 0.1448 0.151 0.1557 0.2448 0.1257 0.1856 0.0449 -0.0549 -0.2224 -0.1252 -0.0462 -0.1114 -0.2128 -0.2299 0.4068 0.2657 -0.0605 0.5039 0.0276 0.1596 0.347 0.3223 0.3598 0.6675 0.671 0.5521 0.3168 0.2916 0.3231 0.4627 0.607 0.6014 0.2812 0.33 0.3884 0.2804 0.3571 0.3862 0.6859 1 0.8733 0.4608 0.7578 0.6262 0.4761 0.5775 0.598 0.0519 0.0564 0.1477 0.1418 0.1147 0.2038 0.1865 0.2081 0.2175 0.1798 0.4471 0.272 0.463 0.3261 0.4798 0.2104 0.3982 0.0865 0.2968 0.509 0.5146 0.2785 0.4784 -0.166 -0.0827 -0.1061
SpD13 0.2981 0.0663 -0.1122 0.1784 0.173 0.2449 0.3502 0.3464 0.2656 0.1816 -0.2194 0.0955 0.2362 0.3005 0.2971 0.2577 0.2685 0.0899 0.0598 -0.0998 -0.0207 0.0959 -0.2041 -0.1054 -0.1078 0.3151 0.1331 -0.0922 0.4881 0.2338 0.2444 0.2478 0.3011 0.424 0.6576 0.6705 0.6354 0.2137 0.2611 0.3853 0.3063 0.5918 0.6961 0.1796 0.3647 0.4136 0.2038 0.4261 0.414 0.6065 0.8733 1 0.7244 0.8059 0.7554 0.5543 0.5656 0.5498 -0.0746 0.0218 0.186 -0.0158 0.0613 0.1875 0.0747 0.2632 0.2613 0.3157 0.3089 0.3902 0.3484 0.4506 0.3751 0.3297 0.2457 0.2282 0.1509 0.4338 0.3602 0.401 0.3094 -0.1725 0.0091 -0.0277
ScD11 0.2893 -0.1438 -0.4357 -0.0007 0.192 0.3005 0.3973 0.2714 0.3461 -0.0098 -0.225 -0.0598 0.1724 0.2071 0.1792 0.14 0.0982 -0.1124 -0.2027 -0.0483 -0.1187 -0.003 -0.2313 -0.3097 -0.3899 0.1424 0.2245 0.1841 0.5611 0.3024 0.1761 0.1991 0.2299 0.5511 0.6267 0.5081 0.5769 0.1671 0.2003 0.5302 0.0999 0.1344 0.4914 0.0895 0.0999 0.5516 0.1464 0.1907 0.5553 0.513 0.4608 0.7244 1 0.6057 0.6749 0.5545 0.4356 0.7022 -0.2294 -0.1308 0.1394 -0.1162 -0.0543 0.3824 0.0346 0.1297 0.3575 0.3446 0.2944 0.3054 0.3014 0.294 0.2852 0.3509 0.2495 0.2594 0.2156 0.4663 0.1662 0.2848 0.2567 -0.3096 -0.1779 -0.2121
ScD12 0.3022 -0.1111 -0.128 -0.0217 0.1759 0.2715 0.3791 0.3813 0.3687 0.1596 -0.2665 0.3242 0.0631 0.0883 0.1296 0.0159 0.0574 0.018 0.0158 -0.0543 -0.1097 -0.1838 0.0277 -0.148 -0.2731 0.131 0.0075 -0.0865 0.4471 0.3767 0.3879 0.3226 0.299 0.4727 0.7945 0.9065 0.7742 0.2833 0.2414 0.4189 0.2447 0.4075 0.5584 0.2048 0.2864 0.4685 0.2643 0.3537 0.516 0.4249 0.7578 0.8059 0.6057 1 0.844 0.7064 0.8386 0.8318 -0.019 -0.0232 0.1435 0.0115 -0.0043 0.204 0.1135 0.1228 0.2784 0.199 0.4181 0.2387 0.4455 0.3547 0.5037 0.1785 0.3398 0.059 0.286 0.4847 0.3088 0.2286 0.3892 -0.095 0.0291 0.0284
ScD13 0.1772 -0.2795 -0.3707 -0.0148 0.1897 0.1588 0.3365 0.1714 0.2015 0.0144 -0.3324 0.1482 -0.0567 -0.0198 0.0396 -0.0581 0.0607 -0.1008 0.2067 0.1445 -0.106 0.0949 0.1646 0.0919 0.0652 0.0612 -0.0199 -0.0774 0.287 0.3565 0.3887 0.3769 0.5294 0.7051 0.6185 0.7352 0.8692 0.3495 0.5003 0.6607 0.2576 0.5994 0.6969 0.2833 0.5471 0.6847 0.3763 0.624 0.7406 0.245 0.6262 0.7554 0.6749 0.844 1 0.5239 0.7269 0.681 0.1346 0.1343 0.376 0.1085 0.1512 0.4182 0.266 0.3522 0.5811 0.4732 0.5797 0.5513 0.6423 0.6546 0.6173 0.4512 0.521 0.3724 0.5188 0.3619 0.0388 0.5701 0.5387 0.0076 0.1393 0.1011
SsD11 0.2217 -0.1645 -0.1758 0.0146 0.2666 0.2423 0.4633 0.3539 0.2475 0.2094 -0.199 0.2973 -0.0878 -0.0543 -0.0822 -0.1115 -0.1608 -0.2079 -0.1533 0.0191 -0.2917 0.1703 -0.0416 -0.2604 -0.3169 0.1031 0.1255 0.0426 0.256 0.1703 0.0445 0.4106 0.5131 0.5433 0.762 0.7316 0.4955 0.3777 0.4777 0.5305 0.3107 0.3765 0.5103 0.2871 0.3572 0.5429 0.3058 0.429 0.5049 0.4502 0.4761 0.5543 0.5545 0.7064 0.5239 1 0.754 0.8316 0.0867 0.3111 0.2926 0.1214 0.3177 0.4461 0.1061 0.424 0.2535 0.2195 0.2821 0.2873 0.3402 0.3158 0.3428 0.2104 0.225 0.1506 0.1823 0.2976 0.1908 0.283 0.3132 -0.1273 -0.0921 -0.0095
SsD12 0.3272 -0.1669 -0.1132 -0.1555 0.1474 0.1263 0.2734 0.2381 0.1486 0.2049 -0.2881 0.475 -0.033 -0.0582 0.0442 -0.0901 -0.0005 0.0004 0.1999 0.0431 -0.1325 -0.2337 0.0972 -0.0537 -0.2015 0.1465 0.0264 -0.125 0.2514 0.4581 0.51 0.3889 0.3936 0.5118 0.671 0.9269 0.7654 0.3601 0.333 0.4619 0.2639 0.4006 0.4238 0.2522 0.3734 0.4912 0.2826 0.4136 0.4927 0.2266 0.5775 0.5656 0.4356 0.8386 0.7269 0.754 1 0.8796 0.1528 0.0955 0.1448 0.1138 0.1355 0.2827 0.1217 0.1375 0.2282 0.1195 0.2303 0.1734 0.2769 0.2793 0.3142 0.0945 0.1683 0.0119 0.158 0.3283 0.0879 0.0721 0.1872 0.0009 0.0132 0.0962
SsD13 0.2753 -0.1456 -0.2631 -0.0315 0.2285 0.1255 0.3677 0.3203 0.1583 0.3337 -0.2035 0.4117 0.1266 0.128 0.0222 0.0855 -0.0583 -0.0227 0.0709 -0.008 -0.177 0.104 -0.1106 -0.1406 -0.0719 0.0752 0.079 -0.0993 0.2356 0.4149 0.4289 0.2284 0.3933 0.5537 0.7207 0.8332 0.8543 0.1897 0.3533 0.5004 0.0838 0.324 0.4465 0.0985 0.2778 0.4723 0.1207 0.3693 0.4928 0.2409 0.598 0.5498 0.7022 0.8318 0.681 0.8316 0.8796 1 -0.0761 0.1476 0.1899 -0.0957 0.182 0.2924 -0.0849 0.2937 0.1809 0.2702 0.4674 0.3339 0.4801 0.4406 0.4679 0.2691 0.4152 0.1722 0.3463 0.4082 0.2758 0.3184 0.3967 0.047 0.0747 0.1921
FlpD11 -0.3224 -0.1176 0.0539 -0.0562 0.007 -0.0588 -0.1093 -0.168 -0.1691 -0.1691 -0.0795 0.1567 -0.7612 -0.741 -0.6982 -0.713 -0.6937 -0.0988 0.4243 0.2504 0.058 0.258 0.5104 0.3713 0.5441 0.4218 0.1895 -0.2996 -0.5892 -0.2694 -0.5058 0.8095 0.7847 0.618 0.1734 0.003 0.1034 0.827 0.8112 0.6522 0.8438 0.7611 0.6198 0.8573 0.84 0.6839 0.863 0.8 0.6065 0.1283 0.0519 -0.0746 -0.2294 -0.019 0.1346 0.0867 0.1528 -0.0761 1 0.8837 0.8882 0.9133 0.8997 0.8124 0.8828 0.8315 0.7101 0.3195 0.1718 0.3615 0.1924 0.2492 0.0221 0.3249 0.2069 0.3877 0.2894 -0.1098 -0.2404 0.1977 0.0753 -0.0141 0.0042 -0.0598
FlpD12 -0.1289 -0.2216 -0.1932 -0.1326 0.116 -0.0182 0.0951 -0.0038 -0.0417 0.0696 -0.1216 0.1689 -0.7623 -0.7323 -0.5966 -0.7308 -0.5516 -0.3135 0.4319 0.2738 0.284 0.4465 0.4615 0.5762 0.5549 0.4524 0.3361 -0.2166 -0.2508 -0.2579 -0.4233 0.8148 0.8497 0.6543 0.2183 0.0046 0.1151 0.8308 0.8655 0.6885 0.7377 0.8277 0.554 0.7829 0.873 0.6597 0.8121 0.8689 0.64 0.0238 0.0564 0.0218 -0.1308 -0.0232 0.1343 0.3111 0.0955 0.1476 0.8837 1 0.7979 0.8074 0.9181 0.7558 0.7985 0.9155 0.7384 0.2294 0.2912 0.2928 0.3375 0.2173 0.2281 0.2422 0.3016 0.3012 0.4009 -0.1595 -0.3089 0.2628 0.2819 0.1143 0.1918 0.1708
FlpD13 -0.2616 -0.1152 -0.0769 -0.1237 0.033 -0.1065 0.058 -0.0272 -0.0569 0.1529 -0.1004 0.1929 -0.6208 -0.4875 -0.4971 -0.5299 -0.4803 -0.143 0.4884 0.2625 0.2135 0.6318 0.5181 0.5083 0.5997 0.5463 0.0654 -0.1317 -0.3091 -0.1022 -0.2505 0.7907 0.7236 0.7966 0.2423 0.1234 0.339 0.8011 0.7514 0.8155 0.7944 0.7597 0.8349 0.7913 0.7854 0.8444 0.7947 0.7812 0.821 0.1177 0.1477 0.186 0.1394 0.1435 0.376 0.2926 0.1448 0.1899 0.8882 0.7979 1 0.8004 0.7411 0.8888 0.7712 0.7666 0.8565 0.422 0.2864 0.474 0.2796 0.4116 0.1357 0.4113 0.3049 0.4615 0.3865 -0.1338 -0.2803 0.2114 0.2309 0.1209 0.0911 0.0375
FlcD11 -0.151 0.0596 0.1958 0.0756 0.046 -0.0368 -0.0963 -0.121 -0.0903 -0.1208 -0.0394 0.1506 -0.6999 -0.6556 -0.5708 -0.6339 -0.5715 -0.0947 0.4406 0.2453 0.1296 0.2211 0.4679 0.3355 0.4099 0.5111 0.3664 -0.2979 -0.1399 -0.1769 -0.4354 0.8929 0.7672 0.5566 0.3189 -0.0093 0.0704 0.9043 0.797 0.5899 0.8664 0.7516 0.5952 0.9739 0.8534 0.7189 0.9285 0.7852 0.5733 0.294 0.1418 -0.0158 -0.1162 0.0115 0.1085 0.1214 0.1138 -0.0957 0.9133 0.8074 0.8004 1 0.9101 0.8636 0.9438 0.8265 0.6775 0.2682 0.2866 0.2604 0.2267 0.1132 0.0109 0.2948 0.3282 0.3376 0.388 -0.0477 -0.1387 0.1325 0.1926 0.0008 0.095 -0.0124
FlcD12 -0.0491 -0.085 -0.0728 -0.1356 0.1103 -0.0595 0.0657 -0.0112 -0.0206 0.1479 -0.0796 0.1951 -0.6409 -0.634 -0.4279 -0.6119 -0.3914 -0.3773 0.3608 0.253 0.28 0.4087 0.3812 0.5622 0.5292 0.5346 0.425 -0.0472 -0.2551 -0.248 -0.4441 0.9162 0.8909 0.7008 0.3744 0.0269 0.1368 0.9258 0.9085 0.7359 0.8441 0.7953 0.5422 0.9063 0.9569 0.7035 0.9094 0.9102 0.6432 0.1762 0.1147 0.0613 -0.0543 -0.0043 0.1512 0.3177 0.1355 0.182 0.8997 0.9181 0.7411 0.9101 1 0.7998 0.9015 0.9479 0.7258 0.2074 0.3264 0.264 0.3276 0.1509 0.1544 0.2471 0.3492 0.2868 0.4249 -0.087 -0.2023 0.1617 0.2645 0.0472 0.1103 0.1193
FlcD13 -0.2158 -0.184 -0.0893 -0.0535 0.1273 -0.0104 0.0674 0.0815 0.0044 0.1718 0.0237 0.0952 -0.5654 -0.4601 -0.4188 -0.4783 -0.4177 -0.2119 0.3924 0.226 0.1047 0.4678 0.3576 0.3554 0.4387 0.627 0.3567 0.0227 0.1182 -0.1197 -0.2028 0.9212 0.8212 0.868 0.452 0.2153 0.3762 0.9223 0.834 0.8878 0.8685 0.7612 0.7545 0.917 0.845 0.9484 0.8903 0.8226 0.8697 0.3425 0.2038 0.1875 0.3824 0.204 0.4182 0.4461 0.2827 0.2924 0.8124 0.7558 0.8888 0.8636 0.7998 1 0.8333 0.7725 0.873 0.4455 0.3826 0.446 0.3321 0.3605 0.1396 0.4399 0.3866 0.4489 0.4483 0.03 -0.2 0.2382 0.3508 0.0791 0.0687 0.0267
FlsD11 -0.159 -0.0942 0.0131 0.0419 0.0475 0.0589 -0.0316 -0.0909 0.0044 -0.2123 -0.094 0.0579 -0.7168 -0.6851 -0.5386 -0.6738 -0.5758 -0.1964 0.4184 0.2477 0.1704 0.1684 0.4789 0.3569 0.4012 0.5308 0.3338 -0.2703 -0.0328 -0.211 -0.4762 0.9154 0.7889 0.6309 0.3636 0.0317 0.1357 0.9249 0.8151 0.6627 0.8592 0.7752 0.6203 0.9512 0.8772 0.7536 0.9792 0.8435 0.6773 0.3244 0.1865 0.0747 0.0346 0.1135 0.266 0.1061 0.1217 -0.0849 0.8828 0.7985 0.7712 0.9438 0.9015 0.8333 1 0.8957 0.7909 0.3978 0.4044 0.3871 0.3757 0.2391 0.1705 0.4157 0.4325 0.4408 0.5029 0.062 -0.154 0.2902 0.2957 -0.047 0.0844 -0.0061
FlsD12 -0.0362 -0.1282 -0.172 -0.0987 0.1748 0.0416 0.16 0.1063 0.0823 0.1496 -0.0997 0.129 -0.65 -0.6366 -0.4173 -0.6385 -0.4 -0.3923 0.3092 0.2982 0.2964 0.4868 0.416 0.5504 0.524 0.5222 0.4058 -0.1229 0.0363 -0.117 -0.462 0.9017 0.9036 0.7572 0.4759 0.0728 0.2826 0.9043 0.9179 0.7798 0.8427 0.8456 0.6769 0.8771 0.9439 0.7549 0.9279 0.9587 0.7733 0.2649 0.2081 0.2632 0.1297 0.1228 0.3522 0.424 0.1375 0.2937 0.8315 0.9155 0.7666 0.8265 0.9479 0.7725 0.8957 1 0.8394 0.3073 0.4062 0.366 0.4184 0.2696 0.2528 0.3427 0.4229 0.3748 0.502 -0.036 -0.1946 0.3005 0.3669 0.0197 0.1769 0.1109
FlsD13 -0.205 -0.2588 -0.2048 -0.0753 0.0952 -0.0413 -0.0309 -0.0414 -0.0649 0.0001 -0.0378 -0.0116 -0.5509 -0.4861 -0.3641 -0.5005 -0.339 -0.2355 0.402 0.3604 0.2693 0.5614 0.5257 0.5105 0.567 0.4016 0.0619 -0.0658 0.0596 0.0081 -0.199 0.7524 0.7469 0.8644 0.3509 0.1959 0.4458 0.7544 0.747 0.8765 0.682 0.7681 0.7722 0.7351 0.8219 0.9034 0.8037 0.8481 0.9449 0.1717 0.2175 0.2613 0.3575 0.2784 0.5811 0.2535 0.2282 0.1809 0.7101 0.7384 0.8565 0.6775 0.7258 0.873 0.7909 0.8394 1 0.5072 0.4844 0.5261 0.4613 0.4841 0.2792 0.4957 0.4979 0.5175 0.579 -0.0111 -0.2635 0.4156 0.4658 0.1396 0.2296 0.1178
LP12 0.064 -0.0803 -0.1509 0.2695 0.2059 0.4091 0.2831 0.363 0.2423 -0.1165 -0.0552 0.246 -0.1666 -0.1554 0.0662 -0.1966 0.0665 -0.1329 0.3143 0.4653 -0.0565 0.1195 0.3531 0.1789 0.1158 0.1922 0.1047 -0.0247 0.1116 0.1292 0.2573 0.3908 0.3281 0.5329 0.4713 0.236 0.4295 0.3752 0.3477 0.5236 0.3691 0.3182 0.5141 0.3588 0.2885 0.5238 0.4253 0.3457 0.5437 0.2212 0.1798 0.3157 0.3446 0.199 0.4732 0.2195 0.1195 0.2702 0.3195 0.2294 0.422 0.2682 0.2074 0.4455 0.3978 0.3073 0.5072 1 0.7164 0.9363 0.6802 0.8077 0.5278 0.9849 0.7217 0.9645 0.7335 0.4628 0.273 0.7518 0.5914 0.2695 0.2778 0.1725
LP13 0.1476 -0.0999 -0.195 0.1893 0.2479 0.1967 0.178 0.1482 0.1783 -0.0934 -0.0747 0.3077 -0.1374 -0.2243 -0.0576 -0.3017 -0.0664 -0.3703 0.2591 0.3196 0.2581 0.1272 0.3656 0.3686 0.2344 0.0403 0.1157 0.1618 0.3868 -0.0361 0.2215 0.4476 0.4351 0.5328 0.633 0.41 0.6586 0.4242 0.3881 0.509 0.2657 0.4555 0.3951 0.3909 0.4082 0.4932 0.4445 0.4326 0.5895 0.2455 0.4471 0.3089 0.2944 0.4181 0.5797 0.2821 0.2303 0.4674 0.1718 0.2912 0.2864 0.2866 0.3264 0.3826 0.4044 0.4062 0.4844 0.7164 1 0.7164 0.9314 0.6469 0.7825 0.7402 0.9874 0.7117 0.9623 0.4038 0.4965 0.5262 0.8647 0.3092 0.2678 0.2022
LS12 0.1039 -0.0974 -0.2187 0.1614 0.1983 0.3608 0.3327 0.3114 0.2405 -0.118 -0.1673 0.2974 -0.1681 -0.192 0.0249 -0.2154 0.0168 -0.2543 0.3759 0.5188 -0.0593 0.1162 0.3955 0.2119 0.1648 0.3265 0.2367 0.0838 0.1839 0.1382 0.3492 0.4261 0.4255 0.6012 0.4849 0.2759 0.4885 0.411 0.448 0.5902 0.3785 0.3858 0.5936 0.3491 0.3334 0.5494 0.4287 0.3982 0.5808 0.1802 0.272 0.3902 0.3054 0.2387 0.5513 0.2873 0.1734 0.3339 0.3615 0.2928 0.474 0.2604 0.264 0.446 0.3871 0.366 0.5261 0.9363 0.7164 1 0.7691 0.9269 0.6675 0.9168 0.7055 0.9267 0.7432 0.3304 0.1692 0.7757 0.626 0.2546 0.2248 0.1485
LS13 0.1676 -0.1338 -0.2696 0.1307 0.253 0.198 0.2083 0.1099 0.1558 -0.1619 -0.1269 0.3618 -0.1616 -0.2608 -0.0735 -0.3091 -0.0852 -0.4247 0.2941 0.2595 0.0917 -0.0047 0.3337 0.2924 0.1502 0.1585 0.1994 0.2051 0.3848 -0.0848 0.2736 0.461 0.4906 0.5608 0.621 0.4577 0.6758 0.4388 0.4539 0.5371 0.2497 0.4943 0.4055 0.3321 0.4135 0.4696 0.4286 0.4537 0.5719 0.1863 0.463 0.3484 0.3014 0.4455 0.6423 0.3402 0.2769 0.4801 0.1924 0.3375 0.2796 0.2267 0.3276 0.3321 0.3757 0.4184 0.4613 0.6802 0.9314 0.7691 1 0.7483 0.9258 0.6857 0.9025 0.684 0.9196 0.288 0.3082 0.6008 0.8828 0.2741 0.1927 0.2148
LBW12 0.1338 -0.156 -0.2876 0.0394 0.126 0.2521 0.297 0.2388 0.1928 -0.0465 -0.2268 0.2963 -0.142 -0.161 -0.0028 -0.1745 -0.0134 -0.2214 0.3914 0.5395 -0.0061 0.0343 0.4369 0.1892 0.16 0.3113 0.279 0.1081 0.281 0.2646 0.4524 0.3038 0.3824 0.5898 0.4161 0.3523 0.6049 0.2886 0.3997 0.5659 0.2278 0.3606 0.5748 0.2046 0.2663 0.5144 0.2928 0.3465 0.5776 0.0649 0.3261 0.4506 0.294 0.3547 0.6546 0.3158 0.2793 0.4406 0.2492 0.2173 0.4116 0.1132 0.1509 0.3605 0.2391 0.2696 0.4841 0.8077 0.6469 0.9269 0.7483 1 0.7475 0.7588 0.6122 0.7684 0.6559 0.2683 0.1053 0.7405 0.623 0.2269 0.1812 0.0993
LBW13 0.1455 -0.1759 -0.3371 0.0247 0.1266 0.133 0.1886 0.0409 0.1134 -0.1582 -0.154 0.3213 -0.0713 -0.1765 -0.0558 -0.2162 -0.089 -0.3308 0.2579 0.0753 -0.0442 -0.1348 0.1942 0.1086 -0.0323 0.2009 0.2169 0.2278 0.4378 -0.1675 0.3314 0.2761 0.3555 0.3971 0.5222 0.5042 0.5936 0.2535 0.3253 0.3712 0.1004 0.412 0.2984 0.1135 0.2593 0.3033 0.2325 0.3025 0.4016 0.1541 0.4798 0.3751 0.2852 0.5037 0.6173 0.3428 0.3142 0.4679 0.0221 0.2281 0.1357 0.0109 0.1544 0.1396 0.1705 0.2528 0.2792 0.5278 0.7825 0.6675 0.9258 0.7475 1 0.5155 0.7242 0.5154 0.7463 0.2125 0.2172 0.5717 0.806 0.1819 0.0662 0.1307
LL12 0.0697 -0.0452 -0.1237 0.2817 0.2318 0.3978 0.2574 0.3453 0.2212 -0.1255 -0.0303 0.2351 -0.1125 -0.1281 0.0727 -0.1656 0.071 -0.0986 0.2989 0.4376 -0.0707 0.1717 0.324 0.177 0.1405 0.2015 0.1391 -0.0517 0.0971 0.0947 0.2253 0.3937 0.3384 0.521 0.493 0.2206 0.4182 0.3769 0.3544 0.5121 0.4028 0.3337 0.5171 0.3842 0.31 0.5133 0.4406 0.362 0.5338 0.274 0.2104 0.3297 0.3509 0.1785 0.4512 0.2104 0.0945 0.2691 0.3249 0.2422 0.4113 0.2948 0.2471 0.4399 0.4157 0.3427 0.4957 0.9849 0.7402 0.9168 0.6857 0.7588 0.5155 1 0.7513 0.9689 0.7527 0.5063 0.3253 0.7099 0.5833 0.2931 0.2833 0.1721
LL13 0.1287 -0.0595 -0.1488 0.2464 0.2986 0.1933 0.1578 0.1521 0.1611 -0.0846 -0.0433 0.3035 -0.1489 -0.2326 -0.0722 -0.3044 -0.0678 -0.3678 0.2794 0.3628 0.3107 0.1969 0.4134 0.4199 0.3246 -0.0006 0.0639 0.1254 0.3123 -0.0111 0.1963 0.4501 0.4287 0.5211 0.6035 0.3408 0.6193 0.4286 0.3829 0.4997 0.2777 0.4398 0.3805 0.4186 0.4096 0.4797 0.4598 0.4315 0.5864 0.2173 0.3982 0.2457 0.2495 0.3398 0.521 0.225 0.1683 0.4152 0.2069 0.3016 0.3049 0.3282 0.3492 0.3866 0.4325 0.4229 0.4979 0.7217 0.9874 0.7055 0.9025 0.6122 0.7242 0.7513 1 0.725 0.9717 0.4002 0.5135 0.5018 0.8289 0.3439 0.2995 0.2418
LBL12 0.0428 -0.0404 -0.0924 0.2586 0.2438 0.351 0.2129 0.3084 0.1726 -0.1075 -0.0005 0.2456 -0.1936 -0.215 0.0111 -0.2386 0.0252 -0.1338 0.3591 0.5154 0.0116 0.219 0.4117 0.2775 0.2404 0.222 0.0848 -0.0209 0.009 0.0978 0.2024 0.4237 0.3504 0.5152 0.4245 0.1285 0.3388 0.4122 0.371 0.5143 0.3995 0.3066 0.5023 0.4022 0.3098 0.4955 0.4526 0.3644 0.5224 0.1818 0.0865 0.2282 0.2594 0.059 0.3724 0.1506 0.0119 0.1722 0.3877 0.3012 0.4615 0.3376 0.2868 0.4489 0.4408 0.3748 0.5175 0.9645 0.7117 0.9267 0.684 0.7684 0.5154 0.9689 0.725 1 0.7678 0.277 0.1586 0.6748 0.5697 0.3133 0.244 0.1988
LBL13 0.1021 -0.1001 -0.1708 0.1983 0.3069 0.1967 0.1575 0.1347 0.1505 -0.1213 -0.0429 0.3074 -0.2361 -0.3586 -0.1554 -0.4175 -0.1407 -0.4127 0.3984 0.4265 0.3116 0.1948 0.4961 0.502 0.4022 0.0371 0.0465 0.0981 0.272 0.0739 0.2152 0.5226 0.5109 0.5837 0.547 0.3086 0.6005 0.5072 0.4759 0.5671 0.2757 0.4736 0.4019 0.4645 0.4758 0.5322 0.5187 0.5106 0.6409 0.0953 0.2968 0.1509 0.2156 0.286 0.5188 0.1823 0.158 0.3463 0.2894 0.4009 0.3865 0.388 0.4249 0.4483 0.5029 0.502 0.579 0.7335 0.9623 0.7432 0.9196 0.6559 0.7463 0.7527 0.9717 0.7678 1 0.2572 0.2961 0.506 0.8214 0.3813 0.2911 0.2822
PL12 0.1225 -0.032 -0.15 0.1923 0.055 0.3284 0.2564 0.2719 0.2558 -0.1146 -0.115 0.0574 0.2565 0.2862 0.2358 0.2325 0.1848 0.1054 -0.1679 -0.1434 -0.3149 -0.1364 -0.2072 -0.337 -0.3426 -0.0209 0.2282 -0.167 0.3179 0.0076 0.2093 0.0362 0.0316 0.0978 0.4345 0.3864 0.3682 0.0105 0.0229 0.0657 0.1617 0.1719 0.1337 0.0763 0.0697 0.145 0.1195 0.0713 0.1234 0.4404 0.509 0.4338 0.4663 0.4847 0.3619 0.2976 0.3283 0.4082 -0.1098 -0.1595 -0.1338 -0.0477 -0.087 0.03 0.062 -0.036 -0.0111 0.4628 0.4038 0.3304 0.288 0.2683 0.2125 0.5063 0.4002 0.277 0.2572 1 0.7127 0.3944 0.2907 0.0462 0.2426 -0.0247
PL13 0.1537 0.115 0.0155 0.2816 0.0942 0.0741 0.0675 0.1311 0.1071 0.0953 -0.0208 0.1104 0.2692 0.4288 0.2916 0.3907 0.2567 0.1117 -0.3712 -0.1844 0.0908 0.0468 -0.2183 -0.2199 -0.2423 -0.1314 0.074 0.1714 0.2273 -0.2689 -0.0225 -0.1576 -0.2128 -0.1875 0.3143 0.1936 0.1366 -0.1825 -0.2963 -0.208 0.0624 -0.024 -0.0503 -0.073 -0.1557 -0.1581 -0.1091 -0.1999 -0.1574 0.4607 0.5146 0.3602 0.1662 0.3088 0.0388 0.1908 0.0879 0.2758 -0.2404 -0.3089 -0.2803 -0.1387 -0.2023 -0.2 -0.154 -0.1946 -0.2635 0.273 0.4965 0.1692 0.3082 0.1053 0.2172 0.3253 0.5135 0.1586 0.2961 0.7127 1 0.1892 0.3848 0.0108 0.1463 -0.0438
LW12 0.0442 -0.0741 -0.2289 0.1333 0.0188 0.3445 0.25 0.2365 0.1113 -0.2079 -0.1448 0.1846 -0.1572 -0.1761 0.081 -0.198 0.08 -0.129 0.2538 0.4317 -0.207 -0.0553 0.3311 0.1018 0.0262 0.1995 0.0986 -0.1592 0.3111 0.0745 0.2118 0.3249 0.3097 0.4675 0.4563 0.2327 0.4508 0.3084 0.3275 0.4507 0.212 0.3722 0.3915 0.2279 0.2364 0.3905 0.3331 0.31 0.474 0.1091 0.2785 0.401 0.2848 0.2286 0.5701 0.283 0.0721 0.3184 0.1977 0.2628 0.2114 0.1325 0.1617 0.2382 0.2902 0.3005 0.4156 0.7518 0.5262 0.7757 0.6008 0.7405 0.5717 0.7099 0.5018 0.6748 0.506 0.3944 0.1892 1 0.5476 0.0504 0.2094 0.0448
LW13 0.1566 -0.0821 -0.1664 0.1502 0.2212 0.1396 0.1113 0.1167 0.114 -0.0536 -0.0067 0.2698 -0.098 -0.1844 0.0293 -0.2235 0.0319 -0.2975 0.1719 0.3268 0.1595 0.1445 0.2248 0.2569 0.145 0.227 0.2248 0.2436 0.6354 -0.1466 0.2059 0.4001 0.4477 0.521 0.6165 0.3652 0.5804 0.3729 0.3918 0.498 0.2359 0.4974 0.3592 0.3017 0.3725 0.4658 0.3476 0.4154 0.5667 0.3179 0.4784 0.3094 0.2567 0.3892 0.5387 0.3132 0.1872 0.3967 0.0753 0.2819 0.2309 0.1926 0.2645 0.3508 0.2957 0.3669 0.4658 0.5914 0.8647 0.626 0.8828 0.623 0.806 0.5833 0.8289 0.5697 0.8214 0.2907 0.3848 0.5476 1 0.2135 0.1804 0.1693
CC11 -0.0612 -0.0549 0.0874 -0.0046 0.0443 -0.0204 -0.0782 -0.0358 -0.1392 -0.0415 0.1088 0.2185 0.1073 -0.0645 0.051 -0.0371 0.0884 0.1382 0.3731 0.5022 0.2431 0.2475 0.3486 0.1986 0.2954 0.3509 -0.0951 -0.0317 0.0919 0.2443 0.5484 -0.0362 0.0192 0.0994 -0.0271 -0.0076 0.1306 -0.0358 -0.0077 0.0922 -0.1404 0.0035 0.0061 -0.0407 0.013 0.0712 -0.071 0.0121 0.1428 -0.2392 -0.166 -0.1725 -0.3096 -0.095 0.0076 -0.1273 0.0009 0.047 -0.0141 0.1143 0.1209 0.0008 0.0472 0.0791 -0.047 0.0197 0.1396 0.2695 0.3092 0.2546 0.2741 0.2269 0.1819 0.2931 0.3439 0.3133 0.3813 0.0462 0.0108 0.0504 0.2135 1 0.57 0.7491
CC12 0.0887 -0.0698 -0.178 -0.0874 -0.0656 0.0573 0.092 0.0656 0.0717 -0.0018 -0.0617 0.0412 0.0258 -0.1139 0.1076 -0.1359 0.1441 -0.0373 0.2845 0.6169 0.2227 0.0271 0.4831 0.2872 0.263 0.2199 -0.0158 -0.3825 0.2093 0.479 0.3769 0.0778 0.1429 0.1686 -0.0113 0.0001 0.2287 0.0815 0.13 0.1558 -0.1824 0.1341 0.0898 0.0897 0.1236 0.1155 0.06 0.1712 0.2135 -0.3301 -0.0827 0.0091 -0.1779 0.0291 0.1393 -0.0921 0.0132 0.0747 0.0042 0.1918 0.0911 0.095 0.1103 0.0687 0.0844 0.1769 0.2296 0.2778 0.2678 0.2248 0.1927 0.1812 0.0662 0.2833 0.2995 0.244 0.2911 0.2426 0.1463 0.2094 0.1804 0.57 1 0.5573
CC13 -0.0556 -0.1008 -0.0026 -0.0189 0.0661 -0.0788 -0.0755 -0.0789 -0.1352 -0.019 0.0676 0.2155 0.0964 -0.0665 0.1603 -0.0487 0.1924 0.1289 0.3729 0.3559 0.4357 0.1667 0.3264 0.2948 0.2305 0.2143 -0.2606 -0.0169 -0.105 0.2593 0.4929 0.0453 0.0182 0.191 0.0638 0.1225 0.2443 0.043 -0.0266 0.1782 -0.2011 0.0101 0.0197 -0.0184 0.0451 0.0606 -0.0077 0.055 0.1699 -0.2861 -0.1061 -0.0277 -0.2121 0.0284 0.1011 -0.0095 0.0962 0.1921 -0.0598 0.1708 0.0375 -0.0124 0.1193 0.0267 -0.0061 0.1109 0.1178 0.1725 0.2022 0.1485 0.2148 0.0993 0.1307 0.1721 0.2418 0.1988 0.2822 -0.0247 -0.0438 0.0448 0.1693 0.7491 0.5573 1
1 = 13 = 25 =2 = 14 = 26 =3 = 15 = 27 =4 = 16 = 28 =5 = 17 = 29 =6 = 18 = 30 =7 = 19 = 31 =8 = Maturity date 20 32 =9 = Fruit development period 21 = 33 =
10 = Juiciness 22 = 34 =11 = Blood flesh 23 = 35 =12 = 24 =
Petiole lengthLeaf weightChlorophyll content
Flesh polar diameterFlesh cheek diameterFlesh suture Leaf perimeterLeaf surfaceLeaf blede widthLeaf lengthLeaf blade length
Stone polar diameterStone cheek Stone suture
Percentage skin colorSolid soluble contentTitratable acidityFruit weightStone weightFlesh weight
Beginning of shooting
End of floweringBeginning of
Fruit productionFlowering duration
Intensity skin color
34
35
Pistil SizeBlooming density
31
32
33
26
27
28
23
24
25
18
19
20
13
14
15
5
6
8
2
3
4
Fruit polar diameterFruit cheek diameterFruit suture diameter
2 3 4
29
30
21
22
16
17
9
12
34 357 28 29 30 31 32 3322 23 24 25 26 2716 17 18 19 20 2110 11 12 13 14 151 6 8 95
182
Annex 7. Correlation coefficients between all quantitative traits measured during 2011, 2012 and 2013 for T1E progeny. The correlation coefficients were calculated with one mean value per genotype by Pearson test. The green color represents positive correlation values, the yellow color shows uncorrelated values and the red-orange color represents negative correlation.
PiL BD12C BD13C BD12G BD13G BS11C BS12C BS12G BS13C BS13G BFT11C BFT12C BFT12G BFT13C BFT13G EFT11C EFT12C EFT12G EFT13C EFT13G FD11C FD12C FD12G FD13C FD13G FP MD11C MD11G MD12C MD12G MD13C MD13G FDP11C FDP12C FDP13C FDP12G FDP13G LF11C LF12C LF13C ISC11C ISC12C ISC13C ISC11G ISC12G ISC13G PSC11C PSC12C PSC13C PSC11G PSC12G PSC13G SSC11C SSC11G SSC12C SSC12G SSC13C SSC13G TA11C TA11G TA12C TA12G TA13C TA13G FW11C FW12C FW13C FW11G FW12G FW13G SW11C SW12C SW13C SW11G SW12G SW13G FlW11C FlW12C FlW13C FlW11G FlW12G FlW13G FpD11C FpD11G FpD12C FpD12G FpD13C FpD13G FcD11C FcD12C FcD13C FcD11G FcD12G FcD13G FsD11C FsD12C FsD13C FsD11G FsD12G FsD13G SpD11C SpD12C SpD13C SpD11G SpD12G SpD13G ScD11C ScD12C ScD13C ScD11G ScD12G ScD13G SsD11C SsD12C SsD13C SsD11G SsD12G SsD13G FlpD11C FlpD12C FlpD13C FlpD11G FlpD12G FlpD13G FlcD11C FlcD12C FlcD13C FlcD11G FlcD12G FlcD13G FlsD11C FlsD12C FlsD13C FlsD11G FlsD12G FlsD13G LP12C LP13C LP12G LP13G LS12C LS13C LS12G LS13G LBW12C LBW13C LBW12G LBW13G LL12C LL13C LL12G LL13G LBL12C LBL13C LBL12G LBL13G PL12C PL12G PL13C PL13G LW12C LW13C LW12G LW13G CC11C CC12C CC13C CC11G CC12G CC13G
PiL 1 0.1922 0.0374 -0.0697 -0.1519 -0.102 -0.2219 0.0035 -0.003 -0.1047 -0.0779 0.0482 0.249 0.1282 0.2137 -0.1047 0.0166 0.1519 0.1209 0.1209 -0.0419 -0.0689 -0.2382 -0.1205 -0.1366 0.013 -0.0408 0.3627 0.2401 -0.002 0.156 -0.0506 -0.0182 0.2547 0.2077 -0.0042 -0.0679 0.0349 0.1176 0.0612 -0.5422 -0.1973 0 -0.1061 -0.24 -0.1077 -0.356 -0.2141 -0.2323 -0.073 -0.2235 -0.2757 0.0081 0.1614 0.0433 -0.0533 0.2266 -0.1965 -0.035 0.1278 -0.1113 -0.0236 -0.2301 -0.2386 0.026 -0.0844 -0.0453 -0.0811 -0.0375 -0.1068 0.275 -0.0951 -0.0217 0.0085 0.0634 -0.0198 0.0171 -0.0461 0.0101 -0.0447 0.012 -0.1165 -0.1651 -0.1202 -0.2226 -0.1327 -0.2217 -0.158 -0.0823 -0.1218 -0.1784 -0.0087 -0.0721 -0.1493 -0.1219 -0.1582 -0.0535 -0.1276 -0.0835 -0.1515 0.0525 -0.1614 0.0487 0.0113 0.0275 -0.0523 0.1871 -0.0588 -0.0588 0.0237 0.0934 0.0146 0.239 -0.2342 -0.2924 -0.0655 0.0872 -0.0167 -0.2782 -0.1289 -0.3059 -0.1927 -0.2751 -0.1836 -0.1789 -0.0716 -0.067 0.0476 -0.1559 -0.208 -0.2392 -0.0197 0.0807 -0.0848 -0.1621 -0.1837 0.1247 0.0344 0.0727 0.1525 0.102 0.0595 0.0892 0.1866 0.1332 0.0846 0.0639 0.1744 0.0934 0.0015 0.0579 0.1201 0.0853 0.0202 0.0808 0.1553 0.0842 -0.0715 -0.1108 -0.0961 0.0834 0.0291 0.1357 0.1536 -0.1023 0.0581 -0.0306 -0.0162 -0.1418 -0.0759
BD12C 0.1922 1 0.7479 0.5323 0.4868 -0.1419 -0.0719 -0.1386 -0.1072 -0.0265 -0.2133 -0.3067 -0.1883 -0.3048 -0.2104 0.0088 -0.1919 -0.1253 -0.1725 -0.1518 0.2751 0.2754 0.1643 0.2485 0.089 -0.0264 0.0562 0.0446 0.0973 0.0202 0.1908 0.1479 0.0199 0.1194 0.3168 0.0414 0.1739 0.1277 0.1197 0.0271 -0.0797 -0.0945 -0.0892 -0.0146 -0.0726 -0.0162 -0.2192 -0.0913 -0.2439 -0.0717 -0.0688 -0.1664 -0.0626 0.0946 -0.166 0.0264 0.2385 0.0169 -0.1553 -0.1275 0.0472 -0.1009 -0.3775 0.0874 -0.1988 -0.0408 -0.1852 -0.0501 -0.1685 -0.1394 -0.2061 -0.0793 -0.1617 -0.0651 -0.1278 -0.0839 -0.1578 -0.0499 -0.1602 -0.0614 -0.1609 -0.1404 -0.1391 0.0209 0.0322 -0.081 -0.1941 -0.0203 -0.156 -0.0142 -0.2846 -0.0678 -0.2041 -0.2184 -0.1858 -0.0238 -0.1645 -0.1425 -0.1786 -0.2085 0.0654 0.0816 0.0632 0.0925 0.0145 0.0665 0.0296 0.0088 -0.1202 -0.0825 -0.0614 -0.0683 -0.1042 -0.1919 -0.2434 -0.0234 -0.1116 -0.1186 -0.2209 -0.049 -0.272 -0.131 -0.1791 -0.1105 -0.1665 -0.0443 -0.2549 -0.0283 -0.2389 -0.2495 -0.1515 0.0464 -0.0821 -0.1801 -0.1732 -0.1991 0.0288 -0.0608 -0.1901 0.0218 0.0228 -0.0464 -0.0977 0.0625 0.0623 -0.03 -0.0167 0.1186 -0.0002 -0.0654 -0.1853 0.0111 -0.0356 -0.0802 -0.2382 -0.0298 0.1652 0.1158 0.0532 0.1997 0.0446 -0.0109 -0.1874 0.1081 -0.1378 -0.0413 -0.0392 -0.1929 -0.0893 -0.0636
BD13C 0.0374 0.7479 1 0.5445 0.5733 -0.0502 -0.0298 -0.0622 -0.0632 -0.0425 -0.2044 -0.3276 -0.2964 -0.196 -0.2576 0.037 -0.1792 -0.171 -0.2214 -0.1569 0.284 0.359 0.2811 0.1661 0.1721 -0.0595 0.0272 0.0664 0.0936 -0.02 0.228 0.1571 0.062 0.1121 0.2769 0.0288 0.18 0.0918 0.1064 0.0082 0.009 -0.0815 -0.2967 -0.1069 -0.0749 -0.0318 -0.1522 -0.0149 -0.0779 -0.074 0.016 0.0292 -0.1123 0.1738 -0.1292 0.1138 0.0255 -0.1494 -0.0344 -0.0229 0.0446 -0.0003 -0.2005 0.1611 -0.0388 0.0991 0.0868 0.0555 -0.1315 0.0018 -0.1118 0.0198 -0.0097 0.0429 -0.0824 -0.0203 0.0144 0.0687 0.1252 0.0331 -0.1232 0.0039 0.0295 0.1218 0.1295 -0.0851 -0.004 0.0718 0.074 0.1314 0.0692 0.1014 -0.1286 -0.1074 -0.0492 0.0788 0.0838 0.045 -0.1355 -0.0758 0.0568 0.1803 -0.0408 0.17 -0.0201 0.0723 -0.0057 0.0993 -0.0623 0.1091 -0.051 -0.0421 -0.1308 -0.085 0.0038 0.091 -0.05 0.0108 0.0249 0.0036 0.1025 -0.0208 -0.128 0.0288 0.1053 0.0655 0.1754 0.0292 -0.1374 -0.1134 0.0024 0.1005 0.1071 -0.0215 -0.1474 -0.1 0.0736 -0.097 -0.1027 -0.0485 0.0148 -0.1334 -0.066 -0.0788 -0.0286 -0.1719 -0.0111 -0.0736 0.0564 -0.0847 -0.0989 -0.0458 0.0448 -0.0982 -0.1222 -0.063 0.0814 0.0019 0.0351 0.0532 0.0364 -0.1283 -0.1616 0.0253 -0.0976 -0.0539 0.0022 -0.0986 -0.1729 -0.0607
BD12G -0.0697 0.5323 0.5445 1 0.7692 -0.0502 -0.0892 0.0748 0.0026 -0.0461 -0.3299 -0.3989 -0.377 -0.3603 -0.3782 -0.112 -0.2511 -0.1651 -0.2915 -0.3784 0.1983 0.3531 0.3035 0.2939 -0.0034 -0.1287 -0.0066 0.0631 -0.0082 -0.0435 0.0887 -0.0846 0.0556 0.0397 0.2592 -0.0369 -0.047 0.0156 0.0314 0.3369 -0.0142 0.1756 0.2642 0.1629 0.1743 0.3347 -0.0118 0.2343 0.3381 -0.0593 0.1711 0.0413 0.026 -0.2726 -0.1665 0.1599 -0.0807 -0.2201 -0.1568 0.1339 0.2534 0.1321 -0.0857 0.0731 -0.0247 -0.0208 -0.5449 -0.0473 -0.1455 -0.1299 -0.198 0.0154 -0.2772 -0.0325 0.0331 0.0909 -0.0071 -0.0282 -0.5482 -0.0061 -0.1371 -0.1472 -0.0006 0.0648 0.1514 -0.0428 -0.3737 -0.0769 -0.0566 0.0608 -0.5468 0.0528 -0.1889 -0.2052 -0.0827 0.1064 -0.5865 -0.0407 -0.1368 -0.1662 0.001 0.2473 -0.076 0.1179 0.0976 -0.0194 0.0951 0.1841 -0.4215 0.1473 0.0365 0.0658 -0.1895 0.0974 -0.178 0.0115 0.0213 -0.0765 -0.0262 -0.0091 -0.5008 0.1331 -0.2313 -0.0905 -0.1065 -0.0073 -0.5111 0.019 -0.2955 -0.3226 -0.0048 0.089 -0.5916 -0.0076 -0.2003 -0.1584 0.1153 -0.1421 0.0311 -0.0109 0.0695 -0.1262 0.0884 -0.0191 0.0873 -0.084 0.0621 0.008 0.061 -0.1331 0.0619 -0.0014 0.0346 -0.1473 0.0162 -0.0289 0.162 0.1709 0.0265 0.14 0.0463 -0.174 -0.0248 0.104 0.1828 0.0866 0.2118 0.1196 -0.0044 0.0833
BD13G -0.1519 0.4868 0.5733 0.7692 1 -0.075 -0.152 -0.0746 -0.1949 -0.1175 -0.2893 -0.4808 -0.4618 -0.3936 -0.4938 -0.0483 -0.357 -0.2787 -0.4003 -0.4511 0.2189 0.3682 0.3536 0.3833 0.0101 0.0059 -0.1145 -0.1098 -0.0687 -0.118 0.1813 -0.054 -0.1427 0.0076 0.3827 -0.1422 0.0071 0.0623 0.026 0.1587 -0.0825 0.0646 0.0954 0.1562 0.1384 0.3564 -0.0112 0.0901 0.0778 -0.0616 0.1421 0.0545 0.0057 -0.3062 -0.144 0.1429 -0.038 0.0067 0.0115 0.1918 0.2658 0.1401 0.2226 0.1594 0.143 0.0755 -0.3338 0.0784 -0.1159 -0.2492 -0.0656 0.0514 -0.2338 0.152 -0.0223 -0.136 0.1558 0.0306 -0.3303 0.0806 -0.0932 -0.2523 0.1971 0.1796 0.1526 -0.0317 -0.264 -0.076 0.2053 0.1161 -0.3876 0.0816 -0.1483 -0.2651 0.2479 0.137 -0.4329 0.0339 -0.1351 -0.2665 0.1328 0.1429 -0.2023 0.1502 0.0121 -0.1254 0.1553 0.1587 -0.3489 0.0862 -0.0447 -0.123 0.0982 0.1146 -0.1983 0.059 -0.0336 -0.1379 0.1773 0.0783 -0.2317 0.1724 -0.0198 0.0271 0.1682 0.0585 -0.3453 0.0322 -0.1414 -0.2618 0.2485 0.1044 -0.3976 -0.0079 -0.1436 -0.2589 -0.095 -0.2096 -0.0409 -0.0787 -0.1148 -0.2124 0.0093 -0.079 -0.073 -0.1657 0.0065 -0.0583 -0.111 -0.1952 0.0117 -0.0642 -0.1359 -0.2193 -0.0326 -0.0821 0.0693 0.1438 0.0708 0.0539 -0.086 -0.2099 -0.0762 0.0183 0.1839 0.1132 0.1744 0.14 0.0495 0.1797
BS11C -0.102 -0.1419 -0.0502 -0.0502 -0.075 1 0.5855 0.3679 0.527 0.4048 0.3261 0.3275 0.1435 0.3003 0.1345 0.3364 0.3529 0.2019 0.1936 0.1296 0.0248 0.0228 0.1214 -0.1852 0.0117 -0.0592 0.3247 0.1615 0.0681 0.1043 0.1807 -0.0154 0.3354 -0.0244 0.09 -0.0095 -0.0457 0.0302 -0.196 -0.0457 0.5038 0.3949 0.3928 0.1196 0.2513 0.2077 0.417 0.3238 0.4739 0.0496 0.3052 0.3471 0.2311 -0.1769 0.1366 -0.0745 -0.1436 -0.1462 -0.067 0.0776 0.005 0.1254 0.5074 0.1081 -0.0592 0.1594 0.2355 0.3934 0.0977 0.04 0.0208 0.1767 0.3267 0.2057 0.0637 0.1382 -0.1149 0.1714 0.2269 0.4426 0.0942 0.0349 0.1291 0.4006 0.1413 0.147 0.1431 0.1284 0.0091 0.1323 0.1635 0.3626 0.1523 0.0863 0.069 0.1255 0.0876 0.4061 0.1209 0.1249 0.1035 0.1503 0.0976 0.3456 0.0748 0.0175 0.0412 0.1348 0.1735 0.2604 0.1343 0.0429 0.0522 0.1725 0.1745 0.2656 0.1361 0.072 0.0583 0.0809 0.1182 0.506 0.1829 0.1782 -0.0439 0.1044 0.1446 0.4067 0.1196 0.0876 0.0304 0.0784 0.0649 0.4799 0.0831 0.122 0.2466 0.1525 0.1691 0.0887 0.1558 0.1129 0.1315 0.0363 0.0325 0.0749 0.0919 0.0029 0.2694 0.1723 0.1793 0.1068 0.2686 0.1586 0.1896 0.0775 0.1443 0.056 0.1757 0.1893 0.067 0.0921 0.033 0.0934 0.0159 -0.0367 0.0718 0.0803 -0.0196 0.1637
BS12C -0.2219 -0.0719 -0.0298 -0.0892 -0.152 0.5855 1 0.4629 0.6964 0.5199 0.5033 0.5453 0.2599 0.3805 0.1913 0.5181 0.5813 0.3091 0.3943 0.2521 0.0808 -0.0346 0.013 -0.182 0.1248 0.1347 0.4932 0.2272 0.1134 0.3025 0.0001 0.1534 0.3794 0.0064 -0.1475 0.2749 0.1279 0.0902 0.0375 0.0019 0.3435 0.2227 -0.0976 0.1131 0.0481 -0.0655 0.2107 0.1919 0.1836 0.2087 0.0927 0.2783 0.056 -0.3642 -0.0986 -0.0916 -0.0138 -0.1391 0.0311 -0.0773 -0.0657 0.1834 0.0796 0.0456 0.1142 0.2162 0.4458 0.2012 0.1758 0.1608 0.0247 0.257 0.4588 -0.0309 0.1771 0.1583 0.1 0.1867 0.4158 0.2779 0.1782 0.152 0.3273 0.152 0.2429 0.2935 0.4737 0.1551 0.2045 0.1597 0.4585 0.0792 0.1757 0.1924 0.1468 0.1564 0.3288 0.1113 0.1904 0.2165 0.1767 0.2198 0.3449 0.252 0.2631 0.1342 0.0775 0.186 0.3663 0.1252 0.2482 0.1072 0.0962 0.2701 0.3518 0.1764 0.221 0.0757 0.3218 0.1292 0.354 0.3332 0.1969 0.0798 0.1969 0.0598 0.3741 0.2923 0.0743 0.1636 0.1358 0.0182 0.2477 0.3243 0.1247 0.2253 0.1261 0.2063 0.0743 0.17 0.0469 0.1708 0.052 0.1424 -0.0597 0.1456 0.024 0.0825 0.1274 0.2112 0.0778 0.1963 0.1398 0.1884 0.0726 0.1576 0.008 0.0749 0.2397 0.2718 0.1088 0.1439 0.0316 0.1567 0.021 -0.1112 -0.0957 0.0216 -0.0562 0.1148
BS12G 0.0035 -0.1386 -0.0622 0.0748 -0.0746 0.3679 0.4629 1 0.44 0.4721 0.241 0.3643 0.24 0.358 0.1426 0.2122 0.3572 0.1894 0.3574 0.1695 -0.0474 -0.0528 -0.1237 -0.1649 0.0605 -0.0496 0.4292 0.2557 0.1213 0.2148 0.1803 0.2071 0.3896 0.0677 -0.0461 0.1867 0.1737 0.1375 0.1675 0.1709 -0.2007 -0.0346 -0.0253 0.1362 -0.1034 -0.1395 0.1099 0.1826 -0.0169 0.0968 -0.0492 0.0476 -0.131 -0.2018 -0.1419 -0.1333 -0.3384 -0.0004 0.0876 0.1118 -0.1436 0.123 0.3651 -0.0272 0.1357 0.1976 0.0929 0.319 0.2253 0.1029 0.1562 0.2037 0.1949 -0.1431 0.1896 0.0541 0.1687 0.2619 0.0831 0.2429 0.2102 0.1042 0.2065 0.3681 0.1869 0.2657 0.2363 0.0934 0.1912 0.1162 0.0871 0.2222 0.1859 0.0967 0.0496 0.1296 -0.0386 0.2668 0.1675 0.139 0.0945 0.1986 0.2474 0.23 0.2732 0.1689 0.0446 0.1341 0.1445 0.1298 0.2348 0.0715 0.0516 0.2259 0.124 0.0317 0.189 -0.0024 0.2066 0.0946 0.1602 0.2343 0.0672 -0.055 0.1959 0.1067 0.0215 0.1103 0.0765 0.0579 0.0452 0.0844 -0.0841 0.2409 0.1017 0.1644 0.288 0.2429 0.1248 0.1921 0.2114 0.1846 0.056 0.1995 0.1343 0.1489 0.0165 0.1753 0.2713 0.2378 0.1198 0.1961 0.2608 0.2158 0.1075 0.1721 0.2027 0.0778 0.2492 0.2142 0.271 0.0595 0.0829 0.255 0.0092 -0.0521 0.0213 0.0492 0.0427 -0.0324
BS13C -0.003 -0.1072 -0.0632 0.0026 -0.1949 0.527 0.6964 0.44 1 0.4471 0.4444 0.547 0.3016 0.4641 0.2384 0.5114 0.554 0.3088 0.4793 0.2618 0.0997 -0.0686 -0.0814 -0.315 0.0441 0.0018 0.2447 0.1627 0.087 0.1487 -0.0498 0.0223 0.1667 0.0135 -0.2424 0.093 -0.0123 0.2129 0.1099 0.0816 0.2107 0.1509 -0.177 0.0337 0.0623 -0.0897 0.0983 0.0921 0.0281 0.1324 0.0498 0.1616 -0.1546 -0.2453 -0.0331 -0.0387 0.0053 -0.0447 -0.1753 -0.0393 -0.1105 0.0978 -0.1137 -0.0053 0.3221 0.317 0.3858 0.1161 0.1957 0.1827 0.0392 0.2439 0.4119 -0.3239 0.1904 0.1014 0.3187 0.2872 0.3484 0.2254 0.1843 0.1784 0.4285 0.1161 0.34 0.3087 0.4148 0.0993 0.3895 0.2953 0.4025 0.0564 0.2187 0.1795 0.3246 0.2827 0.3592 0.0999 0.2132 0.2207 0.1692 0.2197 0.4298 0.108 0.2296 0.0938 0.0882 0.1083 0.2722 -0.0376 0.2305 0.1084 0.08 0.2608 0.2576 -0.0116 0.2185 -0.0119 0.4649 0.3079 0.2053 0.3037 0.2528 0.0431 0.4035 0.2893 0.3245 0.2635 0.1369 0.1486 0.3641 0.1894 0.2902 0.2909 0.1496 0.2745 0.256 0.2893 0.226 0.2486 0.1903 0.2521 0.214 0.2222 0.0287 0.1677 0.1219 0.1199 0.2957 0.297 0.2485 0.2629 0.3323 0.2897 0.2412 0.2586 -0.0091 0.127 0.2034 0.1603 0.2205 0.2318 0.1165 0.2508 0.0726 -0.0958 -0.0824 0.0968 -0.0439 0.1478
BS13G -0.1047 -0.0265 -0.0425 -0.0461 -0.1175 0.4048 0.5199 0.4721 0.4471 1 0.2293 0.3363 0.1349 0.3085 0.14 0.3034 0.3794 0.0434 0.2708 0.2132 0.1151 0.0271 -0.115 -0.241 0.1316 -0.0458 0.2373 0.2919 0.06 0.1019 -0.0572 0.1294 0.2072 -0.0178 -0.1489 0.1065 0.1088 -0.1528 -0.0847 -0.0804 0.2553 0.0333 0.0501 0.0073 0.045 -0.1246 0.2169 0.1592 0.3364 0.0472 0.2834 0.2282 -0.26 -0.1204 -0.0675 -0.2312 -0.3242 -0.1497 -0.0081 0.1558 -0.0085 0.1442 0.1464 0.0414 -0.0218 0.2286 0.4025 0.2775 0.1885 0.1323 0.0704 0.084 0.2499 -0.1261 0.1932 0.1478 -0.0267 0.2617 0.4011 0.3487 0.1837 0.1263 0.184 0.2153 0.206 0.2237 0.4343 0.1229 0.0087 0.1876 0.3777 0.2342 0.2461 0.1678 -0.0325 0.1227 0.3431 0.1916 0.2433 0.1631 0.2016 0.18 0.3221 0.2782 0.1567 0.1177 0.0553 0.0812 0.2527 0.0881 0.2044 0.1531 -0.0248 0.0658 0.2654 0.2292 0.2283 0.126 0.0942 0.1204 0.3894 0.1827 0.2355 0.0476 -0.0069 0.1691 0.3653 0.32 0.2161 0.0925 -0.0109 0.0975 0.2905 0.1716 0.1973 0.1298 0.2024 0.0937 -0.0066 0.0781 0.1267 0.0273 -0.1313 0.0128 0.0129 -0.0704 -0.2237 -0.0714 0.2401 0.1146 0.0065 0.0948 0.2661 0.1151 0.0117 0.0965 -0.0014 -0.0298 0.0527 0.0401 0.171 0.0328 -0.0266 0.0686 -0.0989 -0.1925 -0.1239 -0.0573 -0.0622 -0.1155
BFT11C -0.0779 -0.2133 -0.2044 -0.3299 -0.2893 0.3261 0.5033 0.241 0.4444 0.2293 1 0.7426 0.5317 0.5021 0.4583 0.6848 0.7007 0.5418 0.5697 0.4585 -0.3605 -0.163 -0.2161 -0.2642 0.0126 -0.0712 0.3076 0.0148 0.1025 0.1532 -0.0598 0.0073 0.1763 -0.0291 -0.303 0.1076 -0.0253 0.1767 0.2617 0.0418 0.0691 0.1082 0.0106 -0.1858 -0.0369 -0.275 -0.1651 0.0401 -0.0305 -0.3486 -0.1485 -0.0468 -0.0295 -0.0755 -0.1652 -0.0577 -0.3683 0.1088 0.1891 -0.271 -0.1874 0.1202 0.1004 -0.0043 0.2047 0.2702 0.3171 -0.1101 0.1904 0.3286 0.0997 0.2973 0.3286 -0.0511 0.1497 0.1184 0.2205 0.249 0.2593 0.038 0.181 0.3338 0.2375 -0.2448 0.186 0.1099 0.2586 0.1433 0.2058 0.2443 0.3648 -0.2641 0.1518 0.3414 0.2113 0.2546 0.2901 -0.2095 0.1481 0.3286 0.0717 0.082 0.0197 -0.1496 0.0827 0.104 0.0938 0.279 0.0832 -0.2407 0.1498 0.1963 0.0844 0.2096 0.2213 -0.0661 0.128 0.1032 0.2171 0.2061 0.2885 0.0045 0.0726 0.1223 0.1505 0.1452 0.3325 0.0559 0.0943 0.3296 0.1938 0.2 0.2116 -0.0237 0.1151 0.3628 0.089 0.2346 0.1668 0.1671 0.0962 0.2459 0.1466 0.1805 0.0334 0.2447 0.1285 0.1544 0.1021 0.2318 0.1584 0.1741 0.1044 0.2251 0.1492 0.1517 0.0385 0.1127 0.1483 0.19 0.0494 0.1347 0.1362 0.1909 0.0855 0.0043 0.0259 0.1951 -0.0279 0.1574
BFT12C 0.0482 -0.3067 -0.3276 -0.3989 -0.4808 0.3275 0.5453 0.3643 0.547 0.3363 0.7426 1 0.6782 0.6937 0.6072 0.5009 0.9041 0.6017 0.7895 0.5948 -0.2104 -0.3426 -0.3465 -0.3469 0.0125 -0.0859 0.2351 0.1535 0.1089 0.2173 -0.052 0.131 0.1161 -0.0527 -0.3949 0.2114 0.0896 0.2285 0.2974 0.0723 0.1748 -0.0981 -0.062 -0.1882 -0.1906 -0.3006 -0.0805 -0.0398 0.0718 -0.2326 -0.1606 -0.0726 0.0301 -0.1019 -0.054 -0.1554 -0.2257 0.0304 0.088 -0.1222 -0.1941 0.0408 -0.0009 -0.043 0.1362 0.2427 0.4428 -0.0384 0.2698 0.2195 0.0089 0.169 0.2026 -0.1947 0.1712 0.1682 0.1211 0.218 0.3917 0.0088 0.2452 0.2023 0.2204 -0.1574 0.1517 0.2432 0.3653 0.0811 0.1617 0.2159 0.4045 -0.1277 0.2374 0.2529 0.1207 0.2127 0.3332 -0.0847 0.2503 0.2069 -0.0143 0.0508 0.0612 -0.1354 0.1897 0.1249 -0.0529 0.0744 0.095 -0.1832 0.1984 0.1606 -0.0245 0.1291 0.098 -0.1342 0.1645 0.0911 0.3051 0.226 0.3638 0.0321 0.1454 -0.0163 0.1851 0.2409 0.4084 0.0595 0.1594 0.2295 0.1237 0.2096 0.3145 0.0505 0.2222 0.2135 0.1203 0.287 0.2258 0.2485 0.1158 0.255 0.1887 0.2236 -0.0117 0.155 0.1065 0.1509 0.1777 0.2765 0.2086 0.2357 0.198 0.2915 0.2295 0.2477 -0.0024 0.0144 0.051 0.0603 0.1086 0.1813 0.2302 0.1723 0.1128 -0.0037 0.0004 0.1446 0.0196 0.0756
BFT12G 0.249 -0.1883 -0.2964 -0.377 -0.4618 0.1435 0.2599 0.24 0.3016 0.1349 0.5317 0.6782 1 0.5167 0.6795 0.3163 0.6341 0.8413 0.5752 0.7239 -0.1468 -0.1566 -0.5825 -0.2834 0.1385 -0.0697 0.1547 0.1718 0.1016 0.1421 -0.0522 0.0186 0.069 -0.0094 -0.309 0.0821 -0.0625 0.2828 0.4042 0.2096 -0.3152 -0.076 -0.3277 -0.2596 -0.3437 -0.4344 -0.3487 -0.1707 -0.3691 -0.1989 -0.3118 -0.2689 -0.1295 -0.0959 -0.2821 -0.2409 -0.1705 0.0164 0.0934 -0.107 -0.0392 0.016 -0.0329 -0.0148 0.2271 0.1922 0.5136 0.0632 0.2411 0.2154 0.213 0.2311 0.3806 0.0217 0.2273 0.1733 0.3095 0.1555 0.5073 0.1297 0.2244 0.213 0.1243 -0.0461 0.1473 0.139 0.4169 0.0153 0.2247 0.176 0.4734 0.0893 0.2297 0.1919 0.1555 0.1872 0.4952 0.0801 0.1988 0.1353 -0.127 0.0303 0.2451 0.0291 0.1537 0.0246 0.0521 0.0887 0.5098 0.066 0.2288 0.1207 0.0431 0.1794 0.358 0.1267 0.2147 0.0429 0.3123 0.2134 0.4268 -0.0699 0.0029 -0.011 0.2535 0.1666 0.3844 0.092 0.1395 0.1674 0.209 0.1381 0.4096 0.0547 0.1259 0.1402 0.2658 0.288 0.1918 0.3334 0.2796 0.2951 0.1476 0.351 0.1794 0.2745 0.0652 0.2858 0.3154 0.252 0.1545 0.3065 0.3365 0.2707 0.1857 0.3185 0.0691 -0.0676 0.0139 0.0957 0.222 0.2739 0.2161 0.3001 0.0384 0.1363 0.0383 0.0807 -0.1612 -0.0414
BFT13C 0.1282 -0.3048 -0.196 -0.3603 -0.3936 0.3003 0.3805 0.358 0.4641 0.3085 0.5021 0.6937 0.5167 1 0.5659 0.4399 0.648 0.5163 0.741 0.6163 -0.1568 -0.1796 -0.308 -0.6191 0.0939 0.0171 -0.0031 0.1123 -0.0376 0.0484 -0.053 0.0017 -0.1161 -0.1161 -0.4111 0.0454 -0.0624 0.1096 0.2486 0.0772 0.0727 -0.0158 -0.0419 -0.2181 -0.1436 -0.108 -0.082 -0.105 -0.0429 -0.2875 -0.0301 0.1121 0.0637 -0.1416 -0.0311 -0.1498 -0.215 -0.2746 0.0777 -0.1524 -0.2355 0.1126 -0.0412 -0.0328 0.0874 0.3399 0.2538 -0.0002 0.1242 -0.0365 0.1544 0.2309 0.2589 0.0021 0.1553 0.1208 0.086 0.3026 0.2205 0.0702 0.1256 -0.0617 0.0175 -0.1956 0.183 0.1344 0.177 -0.0891 0.0467 0.2588 0.232 -0.0919 0.1087 -0.0249 0.0022 0.2689 0.2032 -0.0779 0.1096 0.0304 -0.3246 0.0386 0.0604 -0.1285 0.1212 -0.002 -0.1047 0.0353 0.0671 -0.0075 0.1688 0.1361 0.0195 0.2184 0.1841 -0.013 0.1954 0.1582 0.2034 0.2639 0.1602 -0.085 0.118 -0.135 0.0472 0.2876 0.243 0.0067 0.0526 -0.1525 -0.0232 0.1954 0.1464 0.0406 0.0398 -0.0553 0.2467 0.3211 0.2259 0.1942 0.1938 0.2888 0.1707 0.1741 0.0939 0.1798 0.0675 0.1005 0.2754 0.3071 0.2261 0.1865 0.2897 0.3251 0.2616 0.1916 0.0763 -0.0392 0.0574 0.0758 0.2289 0.263 0.1793 0.132 0.0068 -0.0502 -0.1598 0.128 -0.1145 -0.029
BFT13G 0.2137 -0.2104 -0.2576 -0.3782 -0.4938 0.1345 0.1913 0.1426 0.2384 0.14 0.4583 0.6072 0.6795 0.5659 1 0.303 0.5229 0.5912 0.7132 0.7952 -0.2209 -0.2865 -0.4192 -0.2435 -0.1595 0.0232 0.036 0.0206 0.0529 0.0499 -0.1166 0.1078 -0.015 -0.028 -0.4357 0.0175 -0.0089 0.0509 0.2118 0.0636 -0.2106 -0.2006 -0.1107 -0.1496 -0.3252 -0.427 -0.2344 -0.0854 -0.1831 -0.2748 -0.2571 -0.2096 -0.3175 -0.1791 -0.2901 -0.1696 0.0322 -0.0526 0.2402 -0.0952 -0.0902 0.0285 -0.181 -0.0104 0.2295 0.1694 0.1224 0.1087 0.2699 0.2662 0.3614 0.2992 0.1535 0.2566 0.2957 0.3511 0.2277 0.1405 0.1163 0.1764 0.2409 0.249 0.0987 -0.0821 0.109 0.1871 0.1209 0.0575 0.0694 0.1084 0.0623 -0.0118 0.2423 0.2479 0.1316 0.1311 0.0995 0.029 0.2448 0.2741 0.0441 0.175 0.1545 0.0532 0.2225 0.2237 0.2257 0.2154 0.1418 0.1317 0.2945 0.3514 0.2003 0.2715 0.1546 0.2007 0.2569 0.2622 0.1212 0.0616 0.0558 -0.0613 0.0161 -0.165 -0.0177 0.0387 0.0592 -0.0043 0.1093 0.0585 0.0935 0.0476 0.0412 0.0651 0.156 0.1948 0.253 0.3011 0.2681 0.3157 0.2626 0.2987 0.2443 0.3129 0.2073 0.2444 0.1818 0.274 0.2735 0.2775 0.2322 0.2756 0.2949 0.2943 0.2559 0.2831 0.0345 -0.0121 0.0298 0.1002 0.2058 0.3101 0.3065 0.2616 -0.0821 -0.0467 -0.1511 -0.0082 -0.0894 -0.2368
EFT11C -0.1047 0.0088 0.037 -0.112 -0.0483 0.3364 0.5181 0.2122 0.5114 0.3034 0.6848 0.5009 0.3163 0.4399 0.303 1 0.5605 0.4307 0.5245 0.2984 0.4247 0.0681 -0.0745 -0.1777 0.0186 -0.0011 0.2111 0.0387 0.1549 0.1005 0.1924 0.1225 -0.0008 0.0542 -0.0438 0.0339 0.0638 0.1636 0.2189 0.1005 0.1277 0.06 -0.0883 -0.1083 -0.085 -0.2962 0.0175 0.0613 0.0696 -0.0903 -0.0574 0.056 -0.003 -0.1549 -0.2303 -0.0791 -0.0764 -0.1668 0.1348 -0.1395 -0.0714 0.1201 -0.1014 0.1488 0.1052 0.2903 0.2456 -0.0135 0.2193 0.2285 -0.1413 0.2634 0.3764 -0.1817 0.1413 0.138 0.1214 0.2414 0.2419 0.0579 0.2041 0.2362 0.1885 -0.1201 0.239 0.2563 0.2775 0.2071 0.1463 0.2167 0.2229 -0.1614 0.2014 0.1516 0.1818 0.2387 0.2282 -0.1258 0.2126 0.2033 -0.0739 0.2162 0.2205 -0.1507 0.1765 0.197 -0.1379 0.1767 0.2546 -0.1809 0.1907 0.1644 -0.1214 0.2232 0.3316 -0.119 0.1508 0.0811 0.2955 0.1673 0.252 0.0532 0.1825 0.1094 0.1871 0.1589 0.1947 -0.0442 0.1134 0.0955 0.2316 0.1662 0.1648 -0.0538 0.1772 0.2202 0.1327 0.314 0.1708 0.1621 0.1739 0.336 0.1968 0.1699 0.0784 0.3075 0.1771 0.1178 0.1979 0.3202 0.1522 0.1735 0.2057 0.314 0.1467 0.1581 0.064 0.0631 0.1918 0.1639 0.1525 0.3098 0.1078 0.2156 0.1232 0.0047 -0.011 0.0544 -0.1398 0.1023
EFT12C 0.0166 -0.1919 -0.1792 -0.2511 -0.357 0.3529 0.5813 0.3572 0.554 0.3794 0.7007 0.9041 0.6341 0.648 0.5229 0.5605 1 0.5753 0.7695 0.584 -0.0398 0.0807 -0.3107 -0.2549 0.1497 -0.0672 0.2861 0.1426 0.0971 0.204 -0.0004 0.0893 0.1449 -0.0803 -0.3425 0.1826 0.0447 0.2639 0.3434 0.136 0.3015 -0.0097 -0.1227 -0.169 -0.1533 -0.2677 -0.0055 -0.0304 0.0948 -0.1633 -0.1329 -0.0235 0.0393 -0.1302 -0.1099 -0.1439 -0.1666 -0.0577 0.1247 -0.0766 -0.1339 0.0989 -0.0125 0.0025 0.0762 0.2977 0.4217 0.0488 0.2749 0.2249 -0.026 0.1887 0.1878 -0.1124 0.1789 0.2077 0.0613 0.2711 0.3871 0.1214 0.2534 0.2076 0.239 -0.0719 0.2499 0.3069 0.3583 0.1411 0.1617 0.2963 0.4168 -0.0666 0.246 0.2429 0.1069 0.2876 0.3483 -0.017 0.2577 0.2184 0.0134 0.1132 0.0915 -0.048 0.2195 0.2081 -0.0474 0.116 0.0707 -0.0868 0.1962 0.1846 -0.0352 0.1617 0.0922 -0.1117 0.156 0.1288 0.3021 0.2709 0.3721 0.1209 0.219 -0.019 0.1785 0.2942 0.4263 0.1058 0.1663 0.1941 0.1087 0.2541 0.3325 0.1607 0.2349 0.209 0.1546 0.2493 0.1715 0.2066 0.1455 0.2094 0.1326 0.1804 0.0075 0.1058 0.0646 0.102 0.2179 0.2503 0.1557 0.2038 0.237 0.2663 0.1765 0.2176 0.0249 -0.0315 0.0364 0.0342 0.1293 0.1224 0.1468 0.1507 0.1645 0.0393 0.0162 0.1623 -0.0161 0.1222
EFT12G 0.1519 -0.1253 -0.171 -0.1651 -0.2787 0.2019 0.3091 0.1894 0.3088 0.0434 0.5418 0.6017 0.8413 0.5163 0.5912 0.4307 0.5753 1 0.4979 0.6692 -0.0755 -0.094 -0.059 -0.2877 0.162 -0.0589 0.1076 0.117 0.0465 0.0744 -0.0213 -0.0296 0.0438 -0.0569 -0.2688 -0.019 -0.1079 0.177 0.3109 0.185 -0.0958 0.0719 -0.0405 -0.069 -0.2204 -0.2485 -0.006 0.0003 -0.034 -0.0402 -0.1965 -0.0905 -0.2215 -0.2895 -0.3954 -0.2027 -0.0778 -0.2549 0.0699 -0.0634 0.0528 0.1126 0.0273 0.1233 0.1032 0.2405 0.4517 0.0234 0.1429 0.1361 0.0942 0.3033 0.3676 0.1047 0.2132 0.1274 0.1231 0.213 0.4457 0.0793 0.1284 0.1323 0.1324 -0.0253 0.239 0.139 0.3306 0.0883 0.1922 0.2341 0.4642 0.0202 0.1345 0.1593 0.2836 0.2914 0.4599 0.1207 0.1453 0.1277 -0.1722 0.1024 0.1459 0.0592 0.183 0.0809 -0.0283 0.1939 0.4834 0.0879 0.2212 0.0907 0.0857 0.273 0.5037 0.1009 0.1798 0.0297 0.3411 0.2834 0.3706 -0.0423 -0.0291 0.0417 0.2245 0.1992 0.3569 -0.0818 0.0163 0.1367 0.328 0.2262 0.3022 0.0991 0.0763 0.1367 0.2204 0.3601 0.2746 0.3035 0.2551 0.3702 0.2951 0.3673 0.1643 0.3493 0.2293 0.3394 0.2798 0.3313 0.2494 0.2866 0.3001 0.36 0.2963 0.3 0.0796 -0.0886 -0.0124 0.0843 0.1251 0.3319 0.3021 0.3179 0.0117 0.0576 -0.0517 -0.0201 -0.1907 -0.0219
EFT13C 0.1209 -0.1725 -0.2214 -0.2915 -0.4003 0.1936 0.3943 0.3574 0.4793 0.2708 0.5697 0.7895 0.5752 0.741 0.7132 0.5245 0.7695 0.4979 1 0.6989 -0.1145 -0.1376 -0.3635 -0.2019 0.0136 -0.001 0.1404 0.047 0.0475 0.1117 0.0445 0.1419 0.0254 -0.0538 -0.4124 0.0575 0.052 0.3296 0.4559 0.1974 0.0542 -0.1449 -0.0967 -0.2888 -0.3217 -0.4166 -0.1933 -0.1885 -0.0545 -0.3386 -0.2572 -0.1589 0.0366 -0.1541 -0.1279 -0.1776 -0.1506 0.0532 -0.0051 -0.1113 -0.1235 0.1214 -0.0743 0.1073 0.2665 0.382 0.2349 0.0879 0.346 0.2411 0.275 0.35 0.1851 0.191 0.3466 0.3475 0.2543 0.3508 0.2182 0.1441 0.3136 0.2195 0.254 -0.1382 0.2981 0.391 0.1921 0.0836 0.2442 0.3455 0.2098 -0.0431 0.3248 0.2445 0.2892 0.3663 0.1865 -0.0419 0.3482 0.2812 0.044 0.2011 0.086 -0.0956 0.341 0.2213 0.1983 0.2234 0.0189 0.0514 0.3709 0.3396 0.296 0.3041 0.1386 0.0298 0.3522 0.2749 0.2879 0.2766 0.1765 0.035 0.1916 -0.1132 0.1679 0.2956 0.2369 0.0528 0.1538 0.0569 0.2393 0.2692 0.1522 0.0868 0.2349 0.1974 0.2361 0.3083 0.2259 0.3313 0.1907 0.2767 0.2306 0.3241 0.0829 0.1988 0.1739 0.2653 0.2647 0.2895 0.2152 0.3045 0.2887 0.3062 0.2392 0.3183 0.0262 -0.0183 0.0573 0.0951 0.2544 0.2434 0.2143 0.2639 0.1929 0.1582 -0.0473 0.1417 -0.0009 -0.0117
EFT13G 0.1209 -0.1518 -0.1569 -0.3784 -0.4511 0.1296 0.2521 0.1695 0.2618 0.2132 0.4585 0.5948 0.7239 0.6163 0.7952 0.2984 0.584 0.6692 0.6989 1 -0.1294 -0.0913 -0.3669 -0.296 0.4663 0.011 -0.0504 -0.0288 -0.0548 -0.0679 -0.0677 0.0139 -0.0905 -0.1527 -0.427 -0.106 -0.13 0.0252 0.1993 -0.0201 -0.1665 -0.1199 -0.289 -0.2506 -0.3013 -0.3519 -0.2629 -0.0626 -0.1539 -0.2396 -0.205 -0.1333 -0.2444 -0.119 -0.3415 -0.107 -0.1628 -0.0915 0.1948 -0.1082 -0.0604 -0.0777 -0.0679 0.0312 0.0389 0.2132 0.1496 0.0989 0.1735 0.165 0.2583 0.3598 0.1005 0.2409 0.1864 0.3446 0.0487 0.1628 0.1485 0.1892 0.1355 0.142 -0.0657 -0.1252 0.2071 0.1115 0.1509 0.0577 -0.08 0.1943 0.177 -0.0287 0.1212 0.1563 -0.0423 0.1947 0.1058 0.0144 0.1205 0.1823 -0.1895 0.2468 0.0492 0.0749 0.1109 0.279 0.0186 0.2328 0.0397 0.1314 0.147 0.3214 0.0479 0.3473 0.1422 0.1652 0.1143 0.2988 0.0669 0.099 0.1872 -0.0516 0.0331 -0.2176 -0.104 0.1098 0.2002 0.0251 0.0499 -0.0298 -0.0316 0.059 0.0424 0.1256 0.0817 0.0678 0.2128 0.1961 0.154 0.2072 0.1577 0.1891 0.149 0.2147 0.0932 0.1299 0.1183 0.2018 0.182 0.1779 0.1126 0.1662 0.204 0.1962 0.1411 0.1718 -0.014 -0.072 -0.0253 0.0564 0.1305 0.1815 0.2378 0.1612 -0.0976 -0.0831 -0.2233 -0.0437 -0.127 -0.262
FD11C -0.0419 0.2751 0.284 0.1983 0.2189 0.0248 0.0808 -0.0474 0.0997 0.1151 -0.3605 -0.2104 -0.1468 -0.1568 -0.2209 0.4247 -0.0398 -0.0755 -0.1145 -0.1294 1 0.3961 0.1762 0.1526 0.1446 -0.0857 -0.1771 -0.0682 0.0107 -0.0866 0.1609 -0.0678 -0.2844 0.0324 0.247 -0.1111 -0.0434 -0.0149 -0.0704 0.0463 0.0829 0.0017 -0.215 -0.0528 0.0185 0.0777 0.2046 0.0437 0.1602 0.2004 0.0669 0.093 0.0888 -0.0352 -0.0565 0.0585 0.2219 -0.2296 0.0253 0.1086 0.1203 0.0552 -0.2649 0.0756 -0.2305 0.0334 0.2786 0.0016 -0.0374 -0.1067 -0.3883 -0.0828 0.0497 -0.1692 -0.0192 -0.0983 -0.2332 0.0007 0.2869 0.0243 -0.0434 -0.1046 -0.1904 0.0361 0.0769 0.0543 0.429 0.0479 -0.2261 -0.0141 0.1875 -0.0246 -0.0551 -0.1723 -0.1929 -0.0154 0.2475 -0.019 -0.0319 -0.1513 -0.3225 0.1281 0.3959 -0.0884 0.0364 0.0333 -0.3975 -0.1156 0.3276 -0.0335 0.0033 -0.158 -0.3886 -0.0121 0.1601 -0.0584 -0.0383 -0.1169 0.0369 0.0059 0.3538 0.1586 0.0169 0.0448 -0.0572 0.0407 0.0866 -0.0631 -0.0969 -0.1253 -0.0453 -0.0168 0.2266 -0.0423 -0.0311 -0.132 0.0297 0.1278 0.0034 -0.0441 0.1038 0.1396 0.0493 -0.0345 0.0055 0.074 0.0609 -0.046 0.1267 0.1398 -0.0349 -0.0526 0.1498 0.1708 -0.0159 -0.0244 -0.0586 -0.1577 -0.1529 -0.1581 0.1149 0.2005 -0.0322 -0.0309 0.0427 -0.0204 -0.0408 -0.1984 -0.2544 -0.0157
FD12C -0.0689 0.2754 0.359 0.3531 0.3682 0.0228 -0.0346 -0.0528 -0.0686 0.0271 -0.163 -0.3426 -0.1566 -0.1796 -0.2865 0.0681 0.0807 -0.094 -0.1376 -0.0913 0.3961 1 0.1053 0.2366 0.2977 0.0477 0.0743 -0.0411 -0.0457 -0.0572 0.179 -0.144 0.0474 -0.0654 0.2027 -0.0985 -0.1437 0.0446 0.053 0.1268 0.248 0.1676 -0.143 0.0586 0.1047 0.1666 0.1556 0.0055 0.0449 0.163 0.0454 0.1279 0.0112 -0.0155 -0.1542 0.0786 0.1409 -0.2049 0.0689 0.1074 0.1871 0.1374 -0.0358 0.1228 -0.1317 0.0755 -0.0563 0.1708 -0.0172 -0.0202 -0.072 0.0059 -0.0238 0.2136 -0.0093 0.0659 -0.1283 0.0778 -0.0137 0.2001 -0.0061 -0.0186 0.0258 0.194 0.1776 0.1039 -0.0095 0.131 -0.0021 0.1385 0.0094 0.1501 -0.0098 -0.0661 -0.0307 0.1253 0.0386 0.1467 -0.0156 -0.0073 0.0622 0.1216 0.0727 0.2168 0.0357 0.1627 0.0254 0.0758 -0.0423 0.2441 -0.0338 0.0236 -0.0133 0.0419 -0.0074 0.0951 -0.0421 0.0696 -0.0319 0.0734 0.0182 0.1139 0.1247 0.016 -0.0219 0.0984 0.0455 0.0604 -0.0032 -0.1243 -0.035 0.0821 0.0508 0.1776 -0.0029 -0.0439 0.0703 -0.114 -0.1191 -0.1309 0.0665 -0.11 -0.1091 -0.1087 0.0688 -0.0882 -0.0722 -0.103 0.0845 -0.0947 -0.116 -0.1064 0.0764 -0.0909 -0.1166 -0.0962 0.0819 -0.0993 -0.0728 -0.102 0.04 -0.1409 -0.1934 -0.0535 0.1034 0.096 0.0389 0.0182 -0.1056 0.1012
FD12G -0.2382 0.1643 0.2811 0.3035 0.3536 0.1214 0.013 -0.1237 -0.0814 -0.115 -0.2161 -0.3465 -0.5825 -0.308 -0.4192 -0.0745 -0.3107 -0.059 -0.3635 -0.3669 0.1762 0.1053 1 0.1572 0.0362 -0.0098 -0.0603 -0.1241 -0.1457 -0.1161 0.0236 -0.0279 0.0333 -0.0872 0.1945 -0.1486 0.0165 -0.2115 -0.308 -0.3203 0.5939 0.3113 0.4677 0.285 0.2919 0.3478 0.46 0.3433 0.5963 0.1765 0.2416 0.1756 0.0232 -0.1614 0.0527 0.1336 0.0059 -0.2434 -0.4478 0.1047 0.0921 0.0295 0.112 0.1578 -0.4004 -0.0882 -0.0524 -0.0181 -0.2205 -0.1489 -0.349 -0.0543 -0.2584 0.1296 -0.1404 -0.0289 -0.4143 -0.0631 -0.0356 -0.0481 -0.205 -0.1551 -0.118 0.0857 -0.0088 -0.1028 0.0037 0.0188 -0.1957 -0.1069 -0.0374 -0.0765 -0.2212 -0.1439 -0.1169 -0.0593 -0.0432 0.0719 -0.1469 -0.1267 -0.0635 0.0848 -0.0112 0.0222 -0.0536 0.0551 -0.2907 0.0109 -0.1935 0.0293 -0.169 -0.0745 -0.25 -0.0184 -0.0211 -0.067 -0.2125 -0.0582 -0.2084 -0.0857 0.0127 0.1656 -0.0967 -0.0106 -0.1513 -0.1093 -0.0218 -0.1981 -0.1784 -0.1017 -0.1035 -0.0316 -0.0613 0.0947 -0.0605 -0.1035 -0.1497 -0.0691 0.0023 -0.219 -0.1054 -0.0588 0.1128 -0.134 -0.1031 -0.0384 0.1915 -0.0383 -0.1343 -0.0511 0.0163 -0.2003 -0.1347 -0.0349 0.053 -0.1874 -0.0792 -0.1317 -0.1297 -0.1609 -0.1842 -0.0498 -0.0191 -0.1585 -0.0818 -0.1549 -0.1395 -0.1481 -0.0074 0.0662
FD13C -0.1205 0.2485 0.1661 0.2939 0.3833 -0.1852 -0.182 -0.1649 -0.315 -0.241 -0.2642 -0.3469 -0.2834 -0.6191 -0.2435 -0.1777 -0.2549 -0.2877 -0.2019 -0.296 0.1526 0.2366 0.1572 1 -0.0886 -0.019 0.1403 -0.0365 -0.0244 -0.0296 0.092 -0.0135 0.2056 -0.0181 0.2229 -0.0391 -0.0087 0.0868 -0.0231 -0.0171 -0.1136 -0.0792 -0.059 -0.0565 -0.0962 -0.036 0.0117 0.0035 0.007 0.0031 -0.1224 -0.1545 0.1523 -0.0333 -0.0144 0.0341 0.2265 0.2035 0.0345 0.15 0.2637 -0.1227 0.0075 0.2261 0.0216 -0.1837 -0.1982 0.2266 -0.0389 0.009 -0.0749 -0.1977 -0.2938 0.265 -0.0736 -0.1066 -0.0103 -0.1344 -0.1522 0.1725 -0.0269 0.0382 0.0175 0.2335 -0.0527 -0.0039 -0.0696 0.0302 0.0483 -0.0957 -0.1958 0.1758 -0.0003 0.0221 0.1867 -0.1221 -0.1779 0.1703 0.0233 -0.0535 0.2559 0.0063 0.0199 0.1536 0.0017 0.0069 0.1606 -0.041 -0.1515 0.116 -0.0716 -0.1282 0.1535 -0.1155 -0.2143 0.0633 -0.1234 -0.1188 -0.1193 -0.1185 -0.0591 0.2632 -0.0167 0.0483 0.0265 -0.0765 -0.172 0.1171 0.0451 0.154 0.1841 -0.0791 -0.1031 0.1473 0.1026 0.0122 -0.2111 -0.1803 -0.0543 -0.111 -0.1987 -0.1768 -0.0447 -0.1323 -0.1262 -0.1322 -0.0256 -0.0939 -0.2461 -0.1616 -0.0424 -0.1121 -0.2554 -0.1731 -0.0651 -0.0988 -0.0834 0.013 -0.0187 -0.1163 -0.2171 -0.1622 0.0262 -0.0647 0.1077 0.1955 0.1873 -0.1075 0.0588 -0.0435
FD13G -0.1366 0.089 0.1721 -0.0034 0.0101 0.0117 0.1248 0.0605 0.0441 0.1316 0.0126 0.0125 0.1385 0.0939 -0.1595 0.0186 0.1497 0.162 0.0136 0.4663 0.1446 0.2977 0.0362 -0.0886 1 -0.0082 -0.0829 -0.0506 -0.1586 -0.1687 0.0735 -0.1272 -0.0653 -0.1942 -0.0534 -0.18 -0.1698 -0.0103 0.0324 -0.1465 0.0655 0.0967 -0.326 -0.1322 0.0035 0.1353 -0.0577 0.0373 -0.0583 0.0314 0.0705 0.1244 0.1318 0.0576 -0.1118 0.0992 -0.3178 -0.0393 -0.044 -0.0343 0.0539 -0.1695 0.0788 0.0751 -0.2705 0.0859 0.0835 -0.0132 -0.1253 -0.1847 -0.1672 0.1041 -0.0251 -0.0661 -0.1757 -0.0553 -0.2625 0.0459 0.089 -0.0008 -0.1528 -0.1911 -0.2167 -0.08 0.1725 -0.0839 0.0945 -0.0095 -0.1929 0.1451 0.164 -0.0391 -0.1658 -0.1728 -0.2437 0.102 0.0293 -0.0367 -0.1769 -0.1734 -0.3291 0.1491 -0.1204 0.0293 -0.1541 0.0558 -0.2947 0.0473 -0.161 -0.0272 -0.2205 -0.0887 -0.208 0.1247 0.0199 -0.0657 -0.2124 0.0159 -0.0575 0.0633 0.2443 0.0298 0.0608 -0.0637 -0.1015 0.1149 0.2405 0.0623 -0.0694 -0.1515 -0.1809 0.0211 0.0066 0.0849 -0.1014 -0.2134 -0.0055 -0.1333 -0.1463 -0.1325 -0.1117 -0.139 -0.1108 -0.1161 -0.1343 -0.1551 -0.0661 -0.0769 -0.0901 -0.1294 -0.1616 -0.1437 -0.0855 -0.1268 -0.1491 -0.1442 -0.0666 -0.1144 -0.0835 -0.0683 -0.0554 -0.1647 -0.0538 -0.1221 -0.0246 -0.072 -0.15 -0.0449 -0.0832 -0.0653
FP 0.013 -0.0264 -0.0595 -0.1287 0.0059 -0.0592 0.1347 -0.0496 0.0018 -0.0458 -0.0712 -0.0859 -0.0697 0.0171 0.0232 -0.0011 -0.0672 -0.0589 -0.001 0.011 -0.0857 0.0477 -0.0098 -0.019 -0.0082 1 0.1189 0.0681 -0.0239 0.1655 -0.207 0.0312 0.0943 -0.0309 -0.1686 0.0877 0.0109 -0.009 0.0819 -0.0098 -0.0085 0.0809 0.0299 0.1422 -0.0392 0.0694 -0.0134 -0.0501 0.0646 0.1276 -0.0007 -0.0977 0.1391 -0.2617 -0.037 0.0369 0.0493 0.0155 -0.1253 -0.0192 0.3108 0.216 0.258 0.2693 0.1691 0.1086 0.0657 -0.0432 0.1604 0.1553 0.3715 0.4668 0.4608 0.2766 0.3142 0.4166 0.1115 0.0489 0.0534 -0.0123 0.139 0.1374 0.0263 -0.0825 0.0929 0.243 -0.004 0.1845 0.0934 0.07 0.1144 -0.0282 0.1483 0.2027 0.1625 0.1324 0.0997 -0.0779 0.1737 0.2097 0.115 0.2741 0.0852 -0.0273 0.2925 0.2804 0.3708 0.3656 0.5041 0.1677 0.3653 0.4338 0.4073 0.5069 0.5286 0.1846 0.3338 0.5239 -0.0479 -0.1459 -0.0859 -0.1125 0.0562 -0.0295 -0.0629 -0.1536 -0.0616 -0.0875 -0.0418 -0.0525 0.0306 -0.1382 -0.0744 -0.1204 0.0321 -0.0057 0.0968 0.1676 0.0664 0.192 0.0539 0.1547 0.0871 0.2159 0.1029 0.1697 0.0985 0.2296 0.0698 0.1599 0.0762 0.177 0.048 0.126 0.0754 0.1385 0.1408 0.0964 0.2819 0.2649 0.1938 0.2051 0.1135 0.1832 0.1198 -0.0007 -0.1212 0.1521 0.0347 0.1268
MD11C -0.0408 0.0562 0.0272 -0.0066 -0.1145 0.3247 0.4932 0.4292 0.2447 0.2373 0.3076 0.2351 0.1547 -0.0031 0.036 0.2111 0.2861 0.1076 0.1404 -0.0504 -0.1771 0.0743 -0.0603 0.1403 -0.0829 0.1189 1 0.851 0.7901 0.9235 0.9386 0.91 0.9773 0.7352 0.8999 0.9099 0.8986 0.1933 0.2999 0.2023 -0.0388 -0.2066 -0.1014 -0.0994 -0.165 -0.4873 -0.2233 -0.0022 -0.1259 0.0358 -0.2075 -0.3135 0.4082 0.2064 0.0541 0.1908 0.3822 0.1663 0.058 0.4022 0.1197 0.3805 0.6138 0.5361 0.1353 0.1289 0.2284 0.0386 0.366 0.0937 0.1588 0.2579 0.2183 -0.0899 0.1548 0.0667 0.1145 0.2185 0.222 0.0133 0.3784 0.0938 0.2088 0.0883 0.0731 0.323 0.3765 0.0948 0.2276 0.1045 0.076 0.0272 0.3649 0.0939 0.1185 0.079 0.1272 -0.1042 0.2804 0.0747 0.3758 0.3384 0.3953 0.2932 0.4303 0.337 0.3344 0.4761 -0.0473 0.1988 0.284 0.0328 0.2947 -0.1245 -0.1089 0.1256 0.1857 -0.0985 -0.0571 -0.1867 0.2523 -0.0288 0.0578 -0.2023 0.1134 -0.125 0.1115 0.1203 0.333 0.1109 0.0021 0.1706 0.1882 -0.0121 0.2714 0.146 0.1836 0.0154 0.0038 0.0766 0.1455 0.0514 0.044 0.1139 0.2383 0.2135 0.1339 0.1723 0.1451 0.0056 0.012 0.0868 0.0795 -0.054 -0.0254 0.0183 0.3925 0.2037 0.407 0.3448 0.1176 0.0208 0.0622 0.3015 0.249 0.2528 0.3216 0.1816 0.1598 0.2081
MD11G 0.3627 0.0446 0.0664 0.0631 -0.1098 0.1615 0.2272 0.2557 0.1627 0.2919 0.0148 0.1535 0.1718 0.1123 0.0206 0.0387 0.1426 0.117 0.047 -0.0288 -0.0682 -0.0411 -0.1241 -0.0365 -0.0506 0.0681 0.851 1 0.8356 0.9129 0.9074 0.9222 0.8814 0.8012 0.8277 0.9322 0.9011 -0.0967 -0.0653 0.0266 -0.4344 -0.3825 0.1733 -0.3372 -0.2997 -0.3949 -0.5226 -0.1569 0.1763 -0.2636 -0.3019 -0.5793 0.5986 0.1921 0.2707 0.3786 0.0891 0.137 0.1156 0.3623 0.1479 0.2995 0.6697 0.4577 -0.1144 -0.1403 0.5487 0.2317 0.355 -0.0616 0.226 0.0931 0.8113 0.1581 0.1059 0.0131 -0.1663 -0.015 0.5138 0.1961 0.3635 -0.0672 -0.1626 0.1188 -0.3109 0.1584 0.3053 -0.1432 -0.1544 -0.184 0.1362 0.1888 0.3539 -0.0634 -0.2974 -0.2168 0.0256 0.0402 0.265 -0.1735 0.1767 0.2148 0.4033 0.2767 0.2627 0.1709 0.1983 0.3009 0.5682 0.245 0.2726 -0.0087 0.1579 -0.2664 0.3594 0.2217 0.2033 -0.0184 -0.4776 -0.555 0.0001 -0.0877 -0.0932 -0.3846 -0.2694 -0.3124 0.0848 0.1823 0.3008 -0.0628 -0.4751 -0.0926 -0.0119 0.0121 0.2115 -0.2121 0.0979 -0.0295 -0.2117 -0.0845 0.2006 0.0662 -0.1322 -0.0346 0.3531 0.1977 -0.0135 0.083 0.1294 -0.0662 -0.2136 -0.1223 0.1241 -0.0908 -0.2019 -0.1189 0.1018 -0.1029 0.1291 -0.0809 0.1558 0.0102 -0.0383 0.2467 0.17 0.0567 0.1604 0.1685 -0.0682 -0.0674
MD12C 0.2401 0.0973 0.0936 -0.0082 -0.0687 0.0681 0.1134 0.1213 0.087 0.06 0.1025 0.1089 0.1016 -0.0376 0.0529 0.1549 0.0971 0.0465 0.0475 -0.0548 0.0107 -0.0457 -0.1457 -0.0244 -0.1586 -0.0239 0.7901 0.8356 1 0.7983 0.8343 0.7942 0.7541 0.9845 0.8017 0.815 0.8101 0.1801 0.2075 0.3051 -0.0692 -0.2735 0.173 -0.1584 -0.202 -0.4086 -0.2805 -0.0602 0.1395 -0.039 -0.209 -0.3543 0.4092 0.3284 0.2392 0.23 0.1791 0.1318 0.0696 0.3875 -0.0518 0.3784 0.4454 0.3689 0.0111 -0.1013 0.2402 0.1106 0.3708 -0.0679 0.1402 -0.0247 0.1901 -0.0065 0.1913 -0.0392 -0.0189 -0.0568 0.2482 0.0566 0.3691 -0.0629 0.1081 0.1926 -0.1718 0.2997 0.1193 -0.107 0.038 -0.1153 0.0731 0.151 0.3291 -0.0734 -0.0276 -0.1479 0.0145 0.005 0.27 -0.1239 0.4018 0.1366 0.1568 0.3106 0.3829 0.1592 0.291 0.187 -0.0542 0.1726 0.2879 -0.0224 0.239 -0.3191 -0.0843 0.1086 0.1911 -0.0825 -0.2419 -0.3696 0.0574 -0.1867 0.0302 -0.3374 -0.1149 -0.2267 0.1781 0.0922 0.2523 -0.0728 -0.1666 0.0034 0.109 -0.0728 0.245 -0.1076 0.1305 0.0796 0.0245 -0.0022 0.1761 0.0971 0.0704 -0.0151 0.2394 0.19 0.1424 0.0002 0.1636 0.059 0.0091 0.0051 0.127 0.0242 -0.0285 -0.0251 0.2624 0.1395 0.2388 0.1329 0.1715 0.0505 0.0553 0.1816 0.1397 0.0964 0.1295 0.0768 -0.0004 0.0265
MD12G -0.002 0.0202 -0.02 -0.0435 -0.118 0.1043 0.3025 0.2148 0.1487 0.1019 0.1532 0.2173 0.1421 0.0484 0.0499 0.1005 0.204 0.0744 0.1117 -0.0679 -0.0866 -0.0572 -0.1161 -0.0296 -0.1687 0.1655 0.9235 0.9129 0.7983 1 0.8237 0.9098 0.896 0.7642 0.8107 0.9955 0.915 0.1136 0.0564 0.0323 0.0899 -0.1921 0.1457 -0.2708 -0.1696 -0.332 -0.2028 -0.0101 -0.0294 -0.2202 -0.2097 -0.2857 0.5253 0.1922 0.3542 0.2665 0.3095 0.2865 -0.0045 0.3079 0.1486 0.3188 0.5667 0.4877 0.0389 -0.0687 0.2069 0.1477 0.369 0.1798 0.1523 0.1238 0.1853 0.118 0.1037 0.1472 -0.0055 0.0121 0.203 0.1362 0.3695 0.1769 0.0894 0.0338 -0.1861 0.2466 -0.1107 0.0728 0.0426 -0.159 -0.1865 0.081 0.3673 0.2364 -0.0224 -0.1575 -0.1344 -0.0207 0.2754 0.1395 0.2995 0.2462 0.07 0.2543 0.2958 0.2624 0.2954 0.303 0.0269 0.2474 0.2277 0.1172 0.2306 -0.1665 -0.1187 0.1849 0.1315 0.0552 -0.1536 -0.4636 -0.2363 -0.2016 0.0334 -0.2311 -0.0717 -0.3228 -0.1541 0.102 0.3494 0.2229 -0.119 -0.0766 -0.0174 0.0209 0.286 0.1342 0.0024 0.0339 -0.0732 0.0205 0.0247 0.0507 0.001 0.0463 0.1205 0.1266 0.1165 0.1082 0.0113 -0.0011 -0.0825 -0.0191 -0.025 -0.0215 -0.0961 -0.0381 0.1975 0.0484 0.1335 0.0767 0.054 -0.0133 0.0503 0.292 0.1882 0.0886 0.1408 0.1408 -0.0489 0.0892
MD13C 0.156 0.1908 0.228 0.0887 0.1813 0.1807 0.0001 0.1803 -0.0498 -0.0572 -0.0598 -0.052 -0.0522 -0.053 -0.1166 0.1924 -0.0004 -0.0213 0.0445 -0.0677 0.1609 0.179 0.0236 0.092 0.0735 -0.207 0.9386 0.9074 0.8343 0.8237 1 0.8749 0.8949 0.8259 0.8917 0.8136 0.8461 0.232 0.195 0.37 -0.3569 -0.412 -0.164 -0.2718 -0.4134 -0.4746 -0.3644 -0.1999 -0.1692 0.0548 -0.2514 -0.2845 0.3675 0.5367 0.0543 0.4993 0.3685 0.1645 0.4277 0.5229 0.1954 0.5383 0.3979 0.6085 0.1058 0.1966 0.0926 -0.0028 0.5541 -0.1482 0.0757 0.0678 0.1017 -0.0971 0.2039 -0.1789 0.0856 0.2457 0.1065 -0.0445 0.5426 -0.1383 0.1891 0.1715 0.2198 0.4481 0.0679 0.0014 0.1911 0.2296 -0.096 0.1035 0.5107 -0.2105 0.1443 0.2735 -0.094 -0.091 0.4228 -0.2624 0.2328 0.2711 0.1913 0.5141 0.4534 0.0678 0.1843 0.3144 -0.2615 0.3791 0.2196 -0.2865 0.218 -0.2928 -0.2645 0.2402 0.1315 -0.2922 -0.029 0.0866 -0.0252 -0.2051 0.2201 -0.073 0.0829 0.1607 0.0686 -0.1553 0.4793 -0.0756 -0.0094 0.4812 0.0584 -0.2236 0.4055 -0.1396 0.2838 0.2041 -0.0106 -0.0922 0.3489 0.2832 0.0265 -0.1024 0.4131 0.3304 0.1109 -0.0942 0.3616 0.1993 0.0159 -0.0641 0.3186 0.1764 -0.0348 -0.0927 0.4355 0.2247 0.2841 0.0776 0.3397 0.2459 0.0227 0.0144 0.2277 0.274 0.2092 0.1726 0.1334 0.0948
MD13G -0.0506 0.1479 0.1571 -0.0846 -0.054 -0.0154 0.1534 0.2071 0.0223 0.1294 0.0073 0.131 0.0186 0.0017 0.1078 0.1225 0.0893 -0.0296 0.1419 0.0139 -0.0678 -0.144 -0.0279 -0.0135 -0.1272 0.0312 0.91 0.9222 0.7942 0.9098 0.8749 1 0.8992 0.7758 0.7751 0.9048 0.9896 0.2304 0.0861 0.1463 -0.1136 -0.3527 0.1049 -0.3188 -0.2858 -0.5166 -0.232 -0.127 -0.0486 -0.083 -0.1769 -0.3888 0.332 0.1548 0.1049 0.2792 0.2954 0.0235 -0.1169 0.2745 0.2463 0.3575 0.4819 0.4323 -0.1115 -0.0717 0.3587 0.0574 0.341 -0.0492 0.1289 0.2203 0.2428 -0.0909 0.1598 0.0424 -0.1333 0.0072 0.4112 0.0185 0.3367 -0.0458 -0.0602 0.0436 -0.1527 0.2568 0.1836 -0.0833 -0.0236 -0.1262 0.0438 0.0047 0.3072 -0.0623 -0.1399 -0.1124 0.1723 -0.0864 0.2697 -0.1017 0.1868 0.2879 0.1295 0.148 0.3304 0.2083 0.2097 0.3075 0.0979 0.1466 0.2475 0.0631 0.219 -0.0422 -0.1372 0.1037 0.2012 -0.0091 -0.2752 -0.4532 0.2237 -0.1495 0.0083 -0.3487 -0.1261 -0.3005 0.1156 -0.0471 0.2504 -0.1182 -0.2557 -0.0895 0.3574 -0.1183 0.2394 -0.118 0.2116 -0.0132 -0.0673 0.1003 0.236 0.0199 -0.0254 0.1166 0.2652 0.0942 0.02 0.1292 0.2205 -0.0322 -0.067 0.0849 0.1705 -0.0737 -0.1109 0.0401 0.3536 0.1715 0.2498 0.2495 0.3258 0.0493 0.0446 0.2214 0.1337 0.0753 0.1805 -0.0382 0.026 -0.1289
FDP11C -0.0182 0.0199 0.062 0.0556 -0.1427 0.3354 0.3794 0.3896 0.1667 0.2072 0.1763 0.1161 0.069 -0.1161 -0.015 -0.0008 0.1449 0.0438 0.0254 -0.0905 -0.2844 0.0474 0.0333 0.2056 -0.0653 0.0943 0.9773 0.8814 0.7541 0.896 0.8949 0.8992 1 0.7179 0.9312 0.8941 0.9012 0.1208 0.2542 0.21 -0.0371 -0.1303 -0.0396 -0.1805 -0.2011 -0.4007 -0.2426 -0.0241 -0.0909 -0.0221 -0.2433 -0.3578 0.4149 0.2869 0.0061 0.291 0.4185 0.2854 -0.101 0.5392 0.183 0.4115 0.5937 0.4995 0.0902 0.0523 0.1151 0.1556 0.3998 0.0979 0.2146 0.2777 0.3259 0.033 0.2248 0.1076 0.0583 0.1553 0.0968 0.1193 0.408 0.0945 0.1035 0.1079 0.0044 0.3093 0.2361 0.0444 0.1604 0.0289 0.0224 0.1345 0.3994 0.0684 0.0321 0.0091 -0.005 -0.0363 0.3227 0.0763 0.3566 0.3066 0.3952 0.3329 0.4459 0.2863 0.3269 0.4609 0.0042 0.2232 0.3101 0.0373 0.2849 -0.0821 -0.0419 0.1551 0.2268 -0.0562 -0.201 -0.2473 0.046 -0.0649 -0.0033 -0.2282 0.0236 -0.204 0.0255 0.1284 0.3526 0.0718 -0.1052 0.0728 0.0094 -0.0413 0.2955 0.125 0.1994 0.0125 0.0781 0.0614 0.102 0.0415 0.1013 0.0678 0.1848 0.2012 0.1525 0.1072 0.1423 0.0012 0.1035 0.0762 0.0854 -0.0549 0.0647 0.0188 0.3534 0.2328 0.4004 0.2987 0.0435 -0.0093 0.1438 0.2796 0.2079 0.2601 0.2932 0.1687 0.1431 0.2353
FDP12C 0.2547 0.1194 0.1121 0.0397 0.0076 -0.0244 0.0064 0.0677 0.0135 -0.0178 -0.0291 -0.0527 -0.0094 -0.1161 -0.028 0.0542 -0.0803 -0.0569 -0.0538 -0.1527 0.0324 -0.0654 -0.0872 -0.0181 -0.1942 -0.0309 0.7352 0.8012 0.9845 0.7642 0.8259 0.7758 0.7179 1 0.8614 0.7881 0.7991 0.139 0.1677 0.322 -0.1535 -0.2664 0.1736 -0.1393 -0.1853 -0.3601 -0.282 -0.0598 0.0497 -0.0201 -0.1918 -0.3546 0.3764 0.2907 0.258 0.2389 0.209 0.1574 0.023 0.375 -0.0068 0.3627 0.4097 0.3703 -0.0119 -0.1495 0.1198 0.0708 0.3118 -0.1048 0.1472 -0.0224 0.2035 0.013 0.1536 -0.0738 -0.0273 -0.1002 0.1443 0.036 0.3092 -0.0962 0.0529 0.1816 -0.2049 0.224 0.0177 -0.1354 -0.012 -0.1694 -0.0504 0.1411 0.2707 -0.1145 -0.0618 -0.205 -0.0802 -0.0105 0.2039 -0.1622 0.3723 0.1401 0.178 0.2957 0.3362 0.124 0.2921 0.1801 -0.0292 0.1884 0.2518 -0.052 0.2446 -0.3224 -0.0697 0.1149 0.1589 -0.1005 -0.2898 -0.419 -0.06 -0.2437 -0.0482 -0.3407 -0.1732 -0.2857 0.0426 0.0336 0.1944 -0.1076 -0.1852 -0.0659 0.0037 -0.1286 0.1745 -0.1468 0.0708 0.0479 -0.0177 -0.0025 0.1468 0.0748 0.0338 -0.0034 0.2309 0.1799 0.1154 0.0085 0.123 0.0235 -0.0281 0.003 0.0843 -0.0135 -0.0713 -0.0424 0.2474 0.1475 0.2344 0.212 0.133 0.0523 -0.0174 0.174 0.1344 0.0897 0.1473 0.0551 0.0154 0.0099
FDP13C 0.2077 0.3168 0.2769 0.2592 0.3827 0.09 -0.1475 -0.0461 -0.2424 -0.1489 -0.303 -0.3949 -0.309 -0.4111 -0.4357 -0.0438 -0.3425 -0.2688 -0.4124 -0.427 0.247 0.2027 0.1945 0.2229 -0.0534 -0.1686 0.8999 0.8277 0.8017 0.8107 0.8917 0.7751 0.9312 0.8614 1 0.8255 0.8324 0.0985 -0.0605 0.2528 -0.3662 -0.4001 -0.064 -0.1879 -0.3105 -0.2305 -0.2919 -0.1022 -0.111 0.169 -0.1665 -0.2144 0.3669 0.6086 0.0611 0.6077 0.4013 0.0733 0.3319 0.5447 0.3136 0.5346 0.3966 0.5334 0.0781 0.0097 -0.0413 0.0116 0.4915 -0.1261 0.0083 -0.0387 0.0099 -0.134 0.1691 -0.2676 0.0447 0.0742 -0.0186 -0.056 0.5138 -0.1062 0.1346 0.2086 0.038 0.3287 -0.0353 0.1116 0.1889 0.0422 -0.1928 0.2055 0.4434 -0.2065 0.099 0.0879 -0.16 -0.0671 0.4073 -0.253 0.3659 0.207 0.1393 0.5342 0.4155 0.1022 0.2535 0.2815 -0.1938 0.4518 0.1954 -0.3499 0.2271 -0.3975 -0.2774 0.2625 0.0895 -0.377 -0.1144 -0.1172 -0.1197 -0.1685 0.1286 0.0624 0.0761 -0.0327 -0.0783 -0.1007 0.4492 -0.0285 -0.0817 0.3589 -0.0173 -0.2155 0.4375 -0.0776 0.2568 0.1071 -0.0881 -0.1534 0.3407 0.1966 -0.0442 -0.1444 0.4435 0.3024 0.0904 -0.0957 0.3028 0.0997 -0.0767 -0.1198 0.2366 0.0728 -0.1363 -0.1472 0.5052 0.225 0.2371 0.0394 0.2895 0.2202 -0.1116 0.0273 0.1656 0.2191 0.2606 0.0173 0.0831 0.0916
FDP12G -0.0042 0.0414 0.0288 -0.0369 -0.1422 -0.0095 0.2749 0.1867 0.093 0.1065 0.1076 0.2114 0.0821 0.0454 0.0175 0.0339 0.1826 -0.019 0.0575 -0.106 -0.1111 -0.0985 -0.1486 -0.0391 -0.18 0.0877 0.9099 0.9322 0.815 0.9955 0.8136 0.9048 0.8941 0.7881 0.8255 1 0.9124 0.064 0.0363 0.0399 0.141 -0.1579 0.187 -0.317 -0.205 -0.3481 -0.2977 0.0429 0.0649 -0.2144 -0.1986 -0.2874 0.5423 0.2624 0.3586 0.2683 0.1758 0.2495 0.0896 0.3539 0.0124 0.2834 0.5465 0.4225 0 -0.1239 0.1877 0.1318 0.2914 0.0585 0.1185 0.0251 0.2174 0.0391 0.0175 -0.0084 -0.0253 -0.0242 0.1807 0.1133 0.2933 0.0627 0.0387 0.0638 -0.2401 0.2001 -0.11 -0.0103 -0.0406 -0.2302 -0.1628 0.0764 0.3074 0.0993 -0.1468 -0.2258 -0.2017 -0.0383 0.2139 0.0121 0.2632 0.2233 0.0493 0.2714 0.2349 0.2335 0.2198 0.2289 -0.0603 0.22 0.1414 0.0097 0.0942 -0.2536 -0.2205 0.1453 0.0318 -0.0863 -0.223 -0.5095 -0.2117 -0.2409 0.0102 -0.3159 -0.1335 -0.3537 -0.0653 0.0892 0.3192 0.1133 -0.2171 -0.1199 -0.0431 -0.0084 0.2615 0.0515 -0.0678 0.0252 -0.1408 -0.056 -0.0315 0.0444 -0.0535 -0.0295 0.068 0.1041 0.0802 0.041 -0.041 -0.0062 -0.1538 -0.0915 -0.0784 -0.024 -0.1693 -0.1075 0.1604 0.042 0.1133 0.0201 -0.002 -0.0292 0.0226 0.2301 0.1705 0.1062 0.1292 0.104 -0.101 -0.0198
FDP13G -0.0679 0.1739 0.18 -0.047 0.0071 -0.0457 0.1279 0.1737 -0.0123 0.1088 -0.0253 0.0896 -0.0625 -0.0624 -0.0089 0.0638 0.0447 -0.1079 0.052 -0.13 -0.0434 -0.1437 0.0165 -0.0087 -0.1698 0.0109 0.8986 0.9011 0.8101 0.915 0.8461 0.9896 0.9012 0.7991 0.8324 0.9124 1 0.2294 0.0511 0.1544 -0.1018 -0.3238 0.1866 -0.2841 -0.2137 -0.4758 -0.197 -0.0831 0.0113 -0.0542 -0.0934 -0.3777 0.3993 0.1683 0.3078 0.3124 0.2742 0.0587 -0.168 0.2897 0.288 0.3869 0.5021 0.4202 -0.1383 -0.0944 0.3687 0.0547 0.3105 -0.074 0.0739 0.1521 0.2165 -0.1021 0.126 -0.0241 -0.1533 -0.0053 0.3716 0.0131 0.3078 -0.0762 -0.0735 0.0675 -0.1795 0.2459 0.1704 -0.1072 -0.0405 -0.1553 -0.0204 0.0169 0.2954 -0.0801 -0.1648 -0.1463 0.1356 -0.0754 0.257 -0.1341 0.1824 0.2437 0.0853 0.1451 0.301 0.1481 0.1899 0.2723 0.0961 0.1419 0.2265 0.0015 0.1999 -0.1103 -0.1723 0.0951 0.1875 -0.0748 -0.3004 -0.4627 0.1722 -0.1412 0.0221 -0.3159 -0.1351 -0.3182 0.0126 -0.0514 0.2448 -0.0943 -0.2761 -0.1001 0.3191 -0.1259 0.2271 -0.1237 0.1761 -0.0374 -0.1374 0.0632 0.2085 -0.0018 -0.0994 0.0856 0.2456 0.0751 -0.0395 0.1077 0.1879 -0.0517 -0.1316 0.0522 0.135 -0.0886 -0.1691 0.0096 0.3576 0.1456 0.2184 0.2286 0.2989 0.0138 -0.0123 0.1778 0.1413 0.0668 0.2 -0.044 0.0395 -0.087
LF11C 0.0349 0.1277 0.0918 0.0156 0.0623 0.0302 0.0902 0.1375 0.2129 -0.1528 0.1767 0.2285 0.2828 0.1096 0.0509 0.1636 0.2639 0.177 0.3296 0.0252 -0.0149 0.0446 -0.2115 0.0868 -0.0103 -0.009 0.1933 -0.0967 0.1801 0.1136 0.232 0.2304 0.1208 0.139 0.0985 0.064 0.2294 1 0.6011 0.4381 0.1155 -0.0381 -0.232 -0.16 -0.174 -0.2187 -0.0667 -0.0231 -0.1213 -0.2473 -0.1841 -0.121 0.0934 -0.1519 -0.0315 0.087 0.1556 0.1063 0.0354 -0.191 0.1361 0.2672 0.115 0.2487 0.5194 0.3142 -0.0483 0.174 0.3518 0.1772 0.2078 0.2895 -0.1391 -0.0776 0.2637 0.1039 0.5199 0.2675 -0.0402 0.1373 0.3509 0.1796 0.5319 0.0975 0.321 0.3931 0.0415 0.1394 0.579 0.3024 -0.0448 0.1567 0.3533 0.1644 0.5419 0.3202 0.0206 0.1287 0.3476 0.161 0.336 0.2752 -0.1186 0.0615 0.2891 0.0717 0.298 0.2616 -0.2321 0.0116 0.253 0.0957 0.3195 0.2219 -0.3378 0.0627 0.243 0.0517 0.5357 0.2178 0.1574 0.1371 0.3038 0.1406 0.5668 0.205 0.019 0.2171 0.3048 0.1722 0.5106 0.2554 0.1334 0.1324 0.3204 0.1867 0.3615 0.2715 0.3359 0.366 0.3076 0.2608 0.3213 0.3123 0.2012 0.2086 0.2508 0.2262 0.3759 0.2676 0.3309 0.3698 0.3712 0.2523 0.2936 0.355 0.2251 0.28 0.2453 0.2705 0.3006 0.3162 0.243 0.3777 0.367 0.3256 0.1975 0.1373 0.0601 0.1862
LF12C 0.1176 0.1197 0.1064 0.0314 0.026 -0.196 0.0375 0.1675 0.1099 -0.0847 0.2617 0.2974 0.4042 0.2486 0.2118 0.2189 0.3434 0.3109 0.4559 0.1993 -0.0704 0.053 -0.308 -0.0231 0.0324 0.0819 0.2999 -0.0653 0.2075 0.0564 0.195 0.0861 0.2542 0.1677 -0.0605 0.0363 0.0511 0.6011 1 0.5349 -0.0008 -0.1484 -0.3318 -0.0028 -0.3377 -0.3506 -0.3042 -0.3632 -0.4349 -0.1246 -0.3785 -0.2616 -0.0598 -0.1644 -0.1801 -0.0475 0.1483 0.1275 0.2125 -0.1309 -0.0203 0.2098 0.0425 0.1358 0.502 0.3939 0.1658 -0.1009 0.3322 0.2613 0.4113 0.3719 0.3033 -0.1146 0.3257 0.2114 0.5182 0.3655 0.18 -0.0647 0.3158 0.2576 0.4405 -0.1496 0.3892 0.3082 0.14 0.1739 0.4814 0.4538 0.2109 -0.1263 0.2959 0.2015 0.4367 0.4335 0.226 -0.1881 0.2723 0.2035 0.2881 0.2653 0.1363 -0.0433 0.3198 0.1648 0.381 0.3683 0.1391 -0.0887 0.3081 0.2136 0.37 0.2194 0.0629 -0.065 0.2887 0.1924 0.3927 0.309 0.1641 -0.1087 0.0891 0.087 0.4041 0.3547 0.2379 -0.03 0.1719 0.1207 0.3851 0.3928 0.23 -0.1396 0.1779 0.1652 0.4019 0.2441 0.2574 0.365 0.3404 0.2354 0.2335 0.3427 0.2854 0.2175 0.1573 0.2604 0.3643 0.2272 0.2356 0.3441 0.3502 0.1963 0.2244 0.3246 0.2672 0.1445 0.2997 0.2608 0.3397 0.2188 0.2634 0.3825 0.3323 0.3594 0.1865 0.129 -0.0105 0.1509
LF13C 0.0612 0.0271 0.0082 0.3369 0.1587 -0.0457 0.0019 0.1709 0.0816 -0.0804 0.0418 0.0723 0.2096 0.0772 0.0636 0.1005 0.136 0.185 0.1974 -0.0201 0.0463 0.1268 -0.3203 -0.0171 -0.1465 -0.0098 0.2023 0.0266 0.3051 0.0323 0.37 0.1463 0.21 0.322 0.2528 0.0399 0.1544 0.4381 0.5349 1 -0.0525 0.0705 -0.0523 0.108 -0.1151 -0.1504 -0.0385 -0.0098 -0.1858 0.1646 -0.1305 -0.1463 -0.0892 -0.2129 -0.0782 -0.0141 0.1575 0.1994 0.0378 -0.0058 -0.1259 0.2251 0.1631 0.0306 0.2351 0.0715 -0.0232 0.2294 0.2583 0.1075 0.0378 0.1813 0.4337 0.0989 0.2848 0.0457 0.328 0.0975 -0.0176 0.3068 0.2321 0.1156 0.1265 0.3299 0.187 0.3327 0.1293 0.0274 0.1992 0.1274 0.052 0.3205 0.221 0.043 0.136 0.1663 0.104 0.2825 0.2226 0.1273 -0.0409 0.1106 0.3183 0.2469 0.3805 0.0809 -0.0074 0.1464 0.207 0.2147 0.3164 0.0616 -0.0196 0.1378 0.2083 0.1623 0.2703 -0.0377 0.1481 0.1352 0.0477 0.0337 0.0122 -0.0558 0.1999 0.086 0.0452 0.1088 0.0416 -0.0068 0.1629 0.126 0.06 0.088 0.1121 0.1758 0.2479 0.2911 0.275 0.4008 0.3353 0.2889 0.3172 0.3298 0.2787 0.2523 0.2796 0.2323 0.3626 0.2937 0.2756 0.4038 0.3234 0.2471 0.2334 0.3495 0.3679 0.2762 0.4227 0.4347 0.3263 0.2633 0.2619 0.4112 0.4355 0.3317 0.3232 0.352 0.0697 0.2898
ISC11C -0.5422 -0.0797 0.009 -0.0142 -0.0825 0.5038 0.3435 -0.2007 0.2107 0.2553 0.0691 0.1748 -0.3152 0.0727 -0.2106 0.1277 0.3015 -0.0958 0.0542 -0.1665 0.0829 0.248 0.5939 -0.1136 0.0655 -0.0085 -0.0388 -0.4344 -0.0692 0.0899 -0.3569 -0.1136 -0.0371 -0.1535 -0.3662 0.141 -0.1018 0.1155 -0.0008 -0.0525 1 0.7227 0.556 0.5973 0.5937 0.5426 0.5825 0.3762 0.4723 0.3431 0.4698 0.4146 0.171 -0.2846 0.3001 0.053 -0.1954 -0.0003 -0.1249 0.0995 -0.059 0.034 0.0065 0.1493 -0.1705 -0.1099 0.1136 0.1238 -0.2398 -0.1938 -0.1278 -0.0714 0.3395 0.1469 -0.1763 0.0428 -0.2094 -0.1318 0.0901 0.1024 -0.2409 -0.2087 0.0439 0.3527 0.0099 -0.0168 -0.0011 0.0068 -0.0696 -0.0943 0.2139 0.1129 -0.1689 -0.1252 0.02 -0.0823 0.1609 0.244 -0.128 -0.026 0.0147 -0.0025 0.0525 0.138 -0.1015 0.0319 -0.0999 -0.1841 0.1621 0.1686 -0.1907 0.0469 -0.0949 0.0059 0.2092 0.0548 -0.1622 0.1069 0.0202 0.0181 -0.0414 0.4118 0.1003 -0.0208 -0.0707 -0.0146 0.195 -0.0964 -0.111 -0.2098 0.0345 -0.1021 0.0913 0.2066 -0.0773 -0.087 -0.1277 0.0313 0.1516 0.06 -0.0948 -0.0612 0.175 -0.0195 -0.2753 -0.2015 0.1855 -0.0836 0.0081 0.0744 0.1808 0.0994 0.0191 0.0502 0.1675 0.0542 -0.0446 0.1141 0.1954 0.202 -0.1002 0.1932 0.0977 0.0577 0.227 0.0572 0.1127 0.1884 0.3941 0.4003
ISC12C -0.1973 -0.0945 -0.0815 0.1756 0.0646 0.3949 0.2227 -0.0346 0.1509 0.0333 0.1082 -0.0981 -0.076 -0.0158 -0.2006 0.06 -0.0097 0.0719 -0.1449 -0.1199 0.0017 0.1676 0.3113 -0.0792 0.0967 0.0809 -0.2066 -0.3825 -0.2735 -0.1921 -0.412 -0.3527 -0.1303 -0.2664 -0.4001 -0.1579 -0.3238 -0.0381 -0.1484 0.0705 0.7227 1 0.6006 0.5524 0.6936 0.6827 0.4739 0.5806 0.4139 0.28 0.5502 0.4622 0.2403 -0.0801 0.0931 -0.0703 -0.2265 -0.1871 -0.3413 -0.3316 -0.1202 -0.2403 -0.0083 -0.2259 -0.247 -0.1764 0.0126 -0.1208 -0.4693 -0.2788 -0.2014 -0.0428 0.3904 -0.186 -0.2524 -0.1701 -0.2681 -0.177 0.0035 -0.1763 -0.4707 -0.2745 -0.0855 0.143 -0.0096 -0.1973 0.0481 -0.1659 -0.192 -0.156 0.1263 0.0046 -0.3663 -0.2219 -0.0515 -0.1071 0.0924 0.1003 -0.3225 -0.1188 -0.1553 -0.0719 0.1565 -0.0768 -0.2715 -0.2011 -0.198 -0.1323 0.3109 -0.05 -0.2553 -0.1282 -0.1722 0.171 0.2738 -0.1269 -0.2182 -0.1195 -0.0743 -0.0133 -0.0291 0.1421 -0.026 -0.0281 -0.1866 -0.1377 0.0294 -0.1043 -0.3168 -0.2289 -0.0125 -0.2317 0.0048 0.0498 -0.2947 -0.1018 -0.1074 0.0507 0.2393 0.1383 -0.0854 0.0156 0.1417 0.1055 -0.1656 -0.0127 0.0526 0.0333 -0.0111 0.0731 0.2504 0.1715 -0.0077 0.0478 0.2463 0.1481 -0.0223 0.1537 0.1823 0.1643 -0.1731 0.1037 0.0393 0.0593 0.1342 0.025 0.0449 0.0714 0.1733 0.1944
ISC13C 0 -0.0892 -0.2967 0.2642 0.0954 0.3928 -0.0976 -0.0253 -0.177 0.0501 0.0106 -0.062 -0.3277 -0.0419 -0.1107 -0.0883 -0.1227 -0.0405 -0.0967 -0.289 -0.215 -0.143 0.4677 -0.059 -0.326 0.0299 -0.1014 0.1733 0.173 0.1457 -0.164 0.1049 -0.0396 0.1736 -0.064 0.187 0.1866 -0.232 -0.3318 -0.0523 0.556 0.6006 1 0.6677 0.7573 0.6571 0.5454 0.5841 0.6291 0.4335 0.7077 0.4674 0.3288 -0.0367 0.5449 -0.1638 -0.1453 -0.2107 -0.3723 0.2313 0.18 0.221 0.3058 0.119 -0.3468 -0.454 -0.1567 0.1494 -0.4545 -0.4325 0.0197 -0.1058 0.0604 0.4826 -0.0432 -0.0273 -0.3818 -0.4795 -0.2001 -0.1346 -0.52 -0.4714 -0.2299 0.3262 -0.4851 -0.314 -0.2582 -0.1955 -0.3093 -0.4164 -0.2476 0.0925 -0.391 -0.2302 -0.1765 -0.4225 -0.1694 0.0347 -0.2942 -0.2694 0.0947 -0.2558 -0.2761 0.448 -0.2168 -0.4489 0.3011 0.052 0.0028 0.3817 -0.0049 0.0329 0.4409 -0.0289 0.1209 0.3818 0.0971 0.0934 -0.4647 -0.4974 -0.2206 -0.0039 -0.3166 0.1878 -0.5062 -0.5481 -0.3164 -0.2911 -0.4358 -0.248 -0.4636 -0.4079 -0.2308 -0.2964 -0.3837 -0.3398 -0.3176 -0.3151 -0.1189 -0.1946 -0.264 -0.2914 -0.1431 -0.1539 -0.1257 -0.1125 -0.0084 0.0257 -0.2615 -0.3094 -0.0611 -0.1553 -0.2969 -0.3453 -0.0988 -0.1829 0.049 0.1911 0.0253 0.0159 -0.4148 -0.2246 -0.2539 -0.2366 0.0766 -0.0364 0.0613 0.0648 0.3047 0.1359
ISC11G -0.1061 -0.0146 -0.1069 0.1629 0.1562 0.1196 0.1131 0.1362 0.0337 0.0073 -0.1858 -0.1882 -0.2596 -0.2181 -0.1496 -0.1083 -0.169 -0.069 -0.2888 -0.2506 -0.0528 0.0586 0.285 -0.0565 -0.1322 0.1422 -0.0994 -0.3372 -0.1584 -0.2708 -0.2718 -0.3188 -0.1805 -0.1393 -0.1879 -0.317 -0.2841 -0.16 -0.0028 0.108 0.5973 0.5524 0.6677 1 0.6414 0.5991 0.5576 0.4564 0.5096 0.6496 0.5556 0.4997 -0.1705 -0.2766 0.2561 -0.2319 0.1982 0.0012 -0.1742 -0.0147 -0.1297 -0.0226 0.2801 -0.1587 -0.1852 -0.2241 -0.4808 -0.1755 -0.4509 -0.3555 0.0754 -0.2563 0.1132 -0.0792 -0.1003 -0.1639 -0.2092 -0.268 -0.5062 -0.2191 -0.4748 -0.3631 0.0168 0.0939 -0.0244 -0.1346 -0.5184 0.0321 -0.1697 -0.1533 -0.5327 -0.1201 -0.4064 -0.3833 -0.0366 -0.1497 -0.6203 -0.0049 -0.3462 -0.0839 0.1938 -0.2809 -0.0489 -0.005 -0.1074 -0.1074 0.0094 -0.2317 -0.0793 -0.0577 -0.1436 -0.1597 0.0576 -0.1091 0.0096 0.041 -0.0602 -0.18 -0.1463 0.0428 -0.6458 0.1509 -0.0863 0.1594 -0.2123 -0.1585 -0.71 -0.2073 -0.468 -0.4278 -0.0916 -0.2055 -0.6497 -0.0666 -0.4054 0.0046 -0.125 -0.2125 -0.0251 0.0312 -0.1783 -0.2854 -0.0522 -0.059 -0.1917 -0.2931 -0.0994 -0.1469 -0.1249 -0.1827 -0.0062 0.0627 -0.1701 -0.2204 -0.0422 0.0257 0.1338 0.1197 0.1598 0.1857 -0.1182 -0.1823 -0.2194 -0.0728 0.0489 -0.1164 0.3044 0.1098 -0.0178 0.2695
ISC12G -0.24 -0.0726 -0.0749 0.1743 0.1384 0.2513 0.0481 -0.1034 0.0623 0.045 -0.0369 -0.1906 -0.3437 -0.1436 -0.3252 -0.085 -0.1533 -0.2204 -0.3217 -0.3013 0.0185 0.1047 0.2919 -0.0962 0.0035 -0.0392 -0.165 -0.2997 -0.202 -0.1696 -0.4134 -0.2858 -0.2011 -0.1853 -0.3105 -0.205 -0.2137 -0.174 -0.3377 -0.1151 0.5937 0.6936 0.7573 0.6414 1 0.8097 0.4687 0.623 0.6183 0.4842 0.6994 0.5884 0.1079 -0.2759 0.2971 -0.0932 -0.3381 -0.0591 -0.272 -0.0592 -0.0644 -0.1898 -0.0905 -0.1823 -0.2366 -0.345 -0.1196 -0.3369 -0.4679 -0.4132 -0.1808 -0.269 -0.0143 -0.2921 -0.2904 -0.3013 -0.2921 -0.3603 -0.205 -0.3464 -0.4976 -0.4263 -0.0477 -0.0289 -0.1587 -0.2587 -0.1637 -0.3169 -0.1072 -0.2508 0.04 -0.1954 -0.3921 -0.3363 -0.0025 -0.2461 -0.0932 -0.1414 -0.3713 -0.2629 0.0436 -0.2654 -0.1487 -0.1858 -0.3483 -0.3637 -0.0114 -0.2664 0.0206 -0.1898 -0.3053 -0.2928 -0.0639 -0.0476 0.0935 -0.0911 -0.2257 -0.2611 -0.1117 -0.0306 -0.2592 0.1474 -0.0029 -0.0366 -0.1303 -0.1732 -0.0729 -0.1207 -0.3261 -0.2494 0.0162 -0.2746 -0.2182 -0.1145 -0.3586 -0.1927 -0.2843 -0.2412 -0.1122 -0.184 -0.2974 -0.2741 -0.1678 -0.2775 -0.32 -0.2949 -0.1953 -0.3069 -0.2744 -0.2068 -0.0705 -0.1359 -0.2901 -0.2276 -0.1045 -0.1691 -0.0788 0.1404 0.0286 0.0833 -0.3077 -0.1511 -0.2768 -0.2376 0.0292 -0.1293 0.1769 0.0983 0.1313 0.3966
ISC13G -0.1077 -0.0162 -0.0318 0.3347 0.3564 0.2077 -0.0655 -0.1395 -0.0897 -0.1246 -0.275 -0.3006 -0.4344 -0.108 -0.427 -0.2962 -0.2677 -0.2485 -0.4166 -0.3519 0.0777 0.1666 0.3478 -0.036 0.1353 0.0694 -0.4873 -0.3949 -0.4086 -0.332 -0.4746 -0.5166 -0.4007 -0.3601 -0.2305 -0.3481 -0.4758 -0.2187 -0.3506 -0.1504 0.5426 0.6827 0.6571 0.5991 0.8097 1 0.5407 0.6377 0.6064 0.3521 0.6172 0.5865 0.2651 -0.275 0.2881 -0.1239 -0.1996 -0.1009 -0.452 0.1932 -0.0391 -0.1267 0.0006 -0.1373 -0.3351 -0.2893 -0.1998 -0.0843 -0.5294 -0.2565 -0.42 -0.3231 -0.1085 -0.0798 -0.364 -0.2391 -0.3635 -0.2947 -0.4156 -0.1005 -0.5142 -0.2907 -0.2886 0.1006 -0.2217 -0.3745 -0.1458 -0.0276 -0.3336 -0.2743 -0.1053 0.029 -0.47 -0.1852 -0.1978 -0.2594 -0.2961 0.0562 -0.4345 -0.121 -0.323 -0.3264 -0.1589 -0.1714 -0.4568 -0.2742 -0.3503 -0.391 -0.1578 -0.1238 -0.3777 -0.2006 -0.3257 -0.1099 -0.0574 -0.0989 -0.2842 -0.167 -0.1676 -0.0449 -0.4573 0.2951 -0.0055 0.2607 -0.2407 -0.1384 -0.339 0.0424 -0.3591 -0.114 -0.1115 -0.257 -0.5076 0.0252 -0.3934 -0.0731 -0.4054 -0.1738 0.0178 -0.1199 -0.4009 -0.238 -0.0551 -0.1867 -0.4152 -0.2913 -0.1029 -0.2054 -0.3466 -0.1369 0.0653 -0.076 -0.3492 -0.1428 0.0641 -0.081 -0.1582 0.0281 -0.0142 -0.0107 -0.4788 -0.2384 -0.2872 -0.2153 0.0079 -0.1331 0.0667 0.1324 0.1566 0.2839
PSC11C -0.356 -0.2192 -0.1522 -0.0118 -0.0112 0.417 0.2107 0.1099 0.0983 0.2169 -0.1651 -0.0805 -0.3487 -0.082 -0.2344 0.0175 -0.0055 -0.006 -0.1933 -0.2629 0.2046 0.1556 0.46 0.0117 -0.0577 -0.0134 -0.2233 -0.5226 -0.2805 -0.2028 -0.3644 -0.232 -0.2426 -0.282 -0.2919 -0.2977 -0.197 -0.0667 -0.3042 -0.0385 0.5825 0.4739 0.5454 0.5576 0.4687 0.5407 1 0.6251 0.7778 0.4626 0.6006 0.791 -0.0374 -0.4189 0.2624 0.0563 0.1746 -0.0742 -0.237 -0.0454 0.1779 0.0326 0.2286 -0.0227 -0.134 -0.1068 0.0035 0.2312 -0.2414 0.0694 -0.2081 -0.2258 0.0534 0.0923 -0.217 -0.0299 -0.1817 -0.0864 -0.0008 0.247 -0.2382 0.0761 -0.0052 0.4202 0.015 -0.0342 0.239 0.3142 -0.0821 -0.1275 -0.0161 0.264 -0.1616 0.1941 0.0283 -0.1216 0.0317 0.4553 -0.1468 0.1941 -0.111 -0.1797 0.1072 0.0598 -0.1617 0.0444 -0.2314 -0.27 0.0013 0.1251 -0.2053 0.0067 -0.1751 0.0165 0.0931 0.0622 -0.1181 0.112 0.0946 0.1785 0.2673 0.5311 0.1428 0.4657 -0.0135 -0.0076 -0.0194 0.073 -0.0922 0.2631 0.0876 -0.1534 -0.0014 0.4018 -0.1293 0.1827 -0.1342 0.0922 0.2922 0.1805 -0.0792 -0.0121 0.2224 0.0843 -0.15 -0.211 0.1736 -0.0403 -0.0016 0.1418 0.2954 0.2223 0.0019 0.1394 0.3036 0.2171 -0.016 0.042 0.074 0.1007 -0.0715 0.1862 0.0093 0.0184 -0.0085 -0.2204 -0.0684 -0.0345 0.1326 0.1213
PSC12C -0.2141 -0.0913 -0.0149 0.2343 0.0901 0.3238 0.1919 0.1826 0.0921 0.1592 0.0401 -0.0398 -0.1707 -0.105 -0.0854 0.0613 -0.0304 0.0003 -0.1885 -0.0626 0.0437 0.0055 0.3433 0.0035 0.0373 -0.0501 -0.0022 -0.1569 -0.0602 -0.0101 -0.1999 -0.127 -0.0241 -0.0598 -0.1022 0.0429 -0.0831 -0.0231 -0.3632 -0.0098 0.3762 0.5806 0.5841 0.4564 0.623 0.6377 0.6251 1 0.7282 0.5885 0.7984 0.7303 0.1267 -0.0445 0.1007 -0.0885 -0.2438 -0.2185 -0.286 0.0562 0.0173 -0.2003 0.138 -0.1954 -0.1942 -0.2381 -0.0455 0.1165 -0.3529 -0.1326 -0.2187 -0.1131 -0.0324 -0.3482 -0.2087 -0.1478 -0.2213 -0.1774 -0.1239 -0.1115 -0.3597 -0.1427 -0.038 0.4158 -0.0798 -0.1417 0.0559 0.067 -0.14 -0.2846 0.0137 0.3417 -0.2663 -0.0353 -0.0459 -0.2429 -0.1176 0.4111 -0.1983 -0.0575 0.0675 0.0204 -0.0354 0.1672 -0.1987 -0.0559 -0.063 -0.0569 -0.0667 0.09 -0.1665 -0.1316 -0.1131 0.0623 0.0244 0.1802 -0.1449 -0.1626 -0.1241 -0.134 -0.0002 0.3553 -0.018 0.1649 -0.1714 -0.2719 -0.0551 0.2696 -0.2411 0.0408 -0.0505 -0.2699 -0.1821 0.2816 -0.173 0.0016 -0.1436 0.0559 0.1822 0.0483 -0.11 0.0146 0.1207 -0.0108 -0.1435 -0.0415 0.1198 -0.0467 -0.0801 0.0819 0.1803 0.0963 -0.0865 0.0728 0.1697 0.0901 -0.0147 0.11 0.095 0.0657 -0.1349 -0.0258 -0.0812 0.0044 0.095 -0.0483 0.0879 0.0357 0.0227 0.158
PSC13C -0.2323 -0.2439 -0.0779 0.3381 0.0778 0.4739 0.1836 -0.0169 0.0281 0.3364 -0.0305 0.0718 -0.3691 -0.0429 -0.1831 0.0696 0.0948 -0.034 -0.0545 -0.1539 0.1602 0.0449 0.5963 0.007 -0.0583 0.0646 -0.1259 0.1763 0.1395 -0.0294 -0.1692 -0.0486 -0.0909 0.0497 -0.111 0.0649 0.0113 -0.1213 -0.4349 -0.1858 0.4723 0.4139 0.6291 0.5096 0.6183 0.6064 0.7778 0.7282 1 0.2679 0.7976 0.7763 0.1572 0.2998 0.2759 -0.0744 -0.2198 -0.3403 -0.4871 0.367 0.2785 0.2634 0.3006 0.1296 -0.1873 -0.1986 0.0843 0.3361 -0.1141 -0.08 0.1045 -0.0732 0.0741 0.3976 0.1841 0.1616 -0.2481 -0.2569 0.0326 0.2784 -0.1634 -0.1278 0.0086 0.2705 -0.2063 -0.0389 0.0539 0.0401 -0.1519 -0.1784 0.1182 0.4506 -0.0535 0.1084 -0.0212 -0.1687 0.0543 0.3597 0.0143 0.05 0.2519 -0.0305 -0.1192 0.4255 -0.0077 -0.2055 0.1595 0.0666 0.0984 0.3876 0.1553 0.0543 0.3124 0.1389 0.2603 0.4789 0.301 0.2877 -0.1276 -0.3014 0.0748 0.2667 -0.06 0.2677 -0.2321 -0.299 0.0428 0.3056 -0.144 0.0797 -0.2196 -0.2861 -0.0603 0.2385 -0.156 -0.1079 -0.1327 -0.1119 0.0503 -0.0766 -0.1885 -0.2097 -0.0499 -0.2425 -0.2054 -0.289 -0.1554 -0.3112 -0.0807 -0.0639 0.104 -0.0312 -0.0876 -0.071 0.0986 -0.0119 -0.0054 0.0682 0.0033 -0.0879 -0.2545 -0.201 -0.0599 -0.2929 0.1128 -0.0442 0.0993 0.0939 -0.0208 0.1217
PSC11G -0.073 -0.0717 -0.074 -0.0593 -0.0616 0.0496 0.2087 0.0968 0.1324 0.0472 -0.3486 -0.2326 -0.1989 -0.2875 -0.2748 -0.0903 -0.1633 -0.0402 -0.3386 -0.2396 0.2004 0.163 0.1765 0.0031 0.0314 0.1276 0.0358 -0.2636 -0.039 -0.2202 0.0548 -0.083 -0.0221 -0.0201 0.169 -0.2144 -0.0542 -0.2473 -0.1246 0.1646 0.3431 0.28 0.4335 0.6496 0.4842 0.3521 0.4626 0.5885 0.2679 1 0.6692 0.5536 -0.0161 -0.0838 0.046 -0.3774 0.1395 -0.2543 -0.1628 0.0737 -0.0021 -0.0763 0.1886 -0.0621 -0.2671 -0.4411 -0.1912 -0.2204 -0.3816 -0.4762 -0.1036 -0.2616 0.1761 -0.2221 -0.0277 -0.3687 -0.2854 -0.4218 -0.2103 -0.2701 -0.4139 -0.4708 -0.1087 0.0884 -0.2388 -0.0225 -0.6396 -0.1137 -0.0814 -0.328 -0.3021 -0.0288 -0.3032 -0.4086 0.0111 -0.3354 -0.2868 0.0387 -0.2464 -0.2635 0.0151 -0.4579 -0.6343 -0.0554 -0.0588 -0.3599 -0.093 -0.3627 0.2252 -0.0294 -0.0361 -0.3666 0.0131 -0.1974 0.2903 0.1232 0.0245 -0.3388 -0.1564 -0.0364 -0.4431 0.1597 0.0406 0.2212 -0.0642 -0.2527 -0.3964 -0.0902 -0.3964 -0.2629 -0.023 -0.323 -0.3904 -0.0624 -0.3299 -0.1268 -0.1537 -0.3116 -0.1249 -0.1134 -0.1128 -0.3538 -0.1087 -0.1816 -0.1708 -0.3671 -0.0517 -0.2444 -0.0513 -0.2767 -0.1086 -0.0721 -0.0639 -0.2878 -0.1099 -0.0975 0.0278 -0.0695 -0.0632 0.0733 -0.0851 -0.305 -0.1871 -0.1719 0.0359 0.0827 0.1628 0.0266 -0.055 0.2375
PSC12G -0.2235 -0.0688 0.016 0.1711 0.1421 0.3052 0.0927 -0.0492 0.0498 0.2834 -0.1485 -0.1606 -0.3118 -0.0301 -0.2571 -0.0574 -0.1329 -0.1965 -0.2572 -0.205 0.0669 0.0454 0.2416 -0.1224 0.0705 -0.0007 -0.2075 -0.3019 -0.209 -0.2097 -0.2514 -0.1769 -0.2433 -0.1918 -0.1665 -0.1986 -0.0934 -0.1841 -0.3785 -0.1305 0.4698 0.5502 0.7077 0.5556 0.6994 0.6172 0.6006 0.7984 0.7976 0.6692 1 0.749 -0.0262 -0.2813 0.2131 -0.2006 -0.3394 -0.2864 -0.2747 0.1599 0.1759 -0.0295 0.1553 0.0294 -0.2402 -0.2396 0.1062 0.0839 -0.4037 -0.351 -0.0605 -0.1876 0.1716 -0.0951 -0.1467 -0.2292 -0.269 -0.2166 0.057 0.0696 -0.4388 -0.3637 -0.0863 0.3415 -0.1049 -0.177 0.0125 -0.125 -0.1519 -0.2071 0.1333 0.287 -0.3122 -0.2406 -0.0741 -0.1955 0.0565 0.3452 -0.2652 -0.212 0.0365 -0.1862 -0.038 0.1286 -0.2772 -0.3536 0.0666 -0.2059 0.2288 0.1699 -0.1576 -0.2336 0.0192 0.0145 0.3326 0.3017 -0.0272 -0.1531 -0.1621 -0.018 -0.0269 0.4575 0.0731 0.2344 -0.2245 -0.1574 0.0167 0.2581 -0.305 -0.1636 -0.102 -0.2501 -0.1074 0.2876 -0.3307 -0.1879 -0.1402 -0.1699 -0.1013 -0.1392 -0.2204 -0.2412 -0.1814 -0.2427 -0.2618 -0.3226 -0.2098 -0.288 -0.1531 -0.115 -0.0535 -0.0927 -0.1786 -0.1351 -0.0593 -0.1242 0.0392 0.0099 0.0707 0.0962 -0.1932 -0.1699 -0.2418 -0.2577 -0.0379 -0.1566 0.037 0.0323 0.0946 0.2263
PSC13G -0.2757 -0.1664 0.0292 0.0413 0.0545 0.3471 0.2783 0.0476 0.1616 0.2282 -0.0468 -0.0726 -0.2689 0.1121 -0.2096 0.056 -0.0235 -0.0905 -0.1589 -0.1333 0.093 0.1279 0.1756 -0.1545 0.1244 -0.0977 -0.3135 -0.5793 -0.3543 -0.2857 -0.2845 -0.3888 -0.3578 -0.3546 -0.2144 -0.2874 -0.3777 -0.121 -0.2616 -0.1463 0.4146 0.4622 0.4674 0.4997 0.5884 0.5865 0.791 0.7303 0.7763 0.5536 0.749 1 -0.0191 -0.1207 0.1088 -0.2366 -0.0504 -0.3382 -0.2355 -0.0729 0.0088 -0.0037 0.1922 -0.1563 -0.0033 -0.016 0.0531 0.0305 -0.2924 -0.0173 -0.1334 -0.25 0.0507 -0.0825 -0.1437 -0.101 -0.0445 0.0147 0.0048 0.061 -0.2977 -0.0188 0.0763 0.1402 0.024 -0.1317 0.0284 0.1736 0.0345 -0.0126 0.0688 0.1619 -0.17 0.0654 0.1075 -0.0317 -0.1101 0.2523 -0.1509 0.1206 -0.0664 -0.2631 -0.1894 -0.0705 -0.2527 -0.1926 -0.1155 -0.2591 -0.0007 -0.0551 -0.1378 -0.0941 -0.0422 -0.0449 0.2339 0.1205 -0.0287 -0.0337 0.1844 0.2215 0.1099 0.3389 0.1463 0.4723 0.0986 0.0713 0.0376 0.2744 -0.1206 0.1477 0.1421 -0.0645 -0.2635 0.2798 -0.1761 0.1631 -0.1109 -0.106 0.059 -0.109 -0.2392 -0.2462 -0.1131 -0.2884 -0.329 -0.3833 -0.1688 -0.4023 -0.0773 -0.0455 0.0947 -0.0252 -0.0839 -0.0459 0.0977 -0.0322 -0.0096 0.0162 -0.0129 0.0224 -0.2724 -0.2562 -0.2486 -0.3255 -0.0769 -0.1849 -0.0551 -0.0461 0.0559 0.1006
SSC11C 0.0081 -0.0626 -0.1123 0.026 0.0057 0.2311 0.056 -0.131 -0.1546 -0.26 -0.0295 0.0301 -0.1295 0.0637 -0.3175 -0.003 0.0393 -0.2215 0.0366 -0.2444 0.0888 0.0112 0.0232 0.1523 0.1318 0.1391 0.4082 0.5986 0.4092 0.5253 0.3675 0.332 0.4149 0.3764 0.3669 0.5423 0.3993 0.0934 -0.0598 -0.0892 0.171 0.2403 0.3288 -0.1705 0.1079 0.2651 -0.0374 0.1267 0.1572 -0.0161 -0.0262 -0.0191 1 0.6631 0.625 0.3682 0.3391 0.0301 -0.126 0.4107 -0.09 -0.0383 0.0549 0.2104 -0.239 -0.2788 -0.1295 -0.0757 -0.0544 -0.3209 -0.1846 -0.1734 0.0043 -0.094 -0.184 -0.2811 -0.3315 -0.2624 -0.1356 -0.1241 -0.0407 -0.3138 -0.2873 -0.1964 -0.3591 -0.0775 -0.0542 -0.2669 -0.2777 -0.3469 -0.2865 -0.0986 -0.0036 -0.2216 -0.1883 -0.2879 -0.1645 -0.2173 -0.0355 -0.2054 -0.1799 -0.2048 0.0321 -0.1861 -0.1407 -0.2014 -0.1121 -0.1007 -0.0325 -0.1186 -0.0881 -0.2526 -0.0589 -0.2539 -0.337 -0.1377 -0.1262 -0.2407 -0.3355 -0.3887 -0.1009 -0.222 0.0285 -0.2423 -0.3085 -0.384 -0.3257 -0.0671 0.0556 -0.1086 -0.2326 -0.2233 -0.0456 -0.249 0.0302 -0.1301 -0.1867 -0.3463 0.0751 -0.4009 -0.2043 -0.3477 0.0553 -0.4463 -0.1449 -0.2316 0.1476 -0.323 -0.2173 -0.3464 0.0723 -0.4095 -0.2386 -0.3615 0.0399 -0.4198 -0.0094 0.188 -0.0572 -0.1135 -0.1448 -0.172 0.0634 -0.2939 0.2692 0.3282 0.3816 0.1896 -0.0075 0.2206
SSC11G 0.1614 0.0946 0.1738 -0.2726 -0.3062 -0.1769 -0.3642 -0.2018 -0.2453 -0.1204 -0.0755 -0.1019 -0.0959 -0.1416 -0.1791 -0.1549 -0.1302 -0.2895 -0.1541 -0.119 -0.0352 -0.0155 -0.1614 -0.0333 0.0576 -0.2617 0.2064 0.1921 0.3284 0.1922 0.5367 0.1548 0.2869 0.2907 0.6086 0.2624 0.1683 -0.1519 -0.1644 -0.2129 -0.2846 -0.0801 -0.0367 -0.2766 -0.2759 -0.275 -0.4189 -0.0445 0.2998 -0.0838 -0.2813 -0.1207 0.6631 1 0.4557 0.3471 0.0545 0.3066 0.0963 0.1371 -0.1867 -0.1386 0.1982 -0.0887 -0.1245 -0.1812 0.1835 -0.1659 0.1282 -0.085 0.1041 -0.2133 -0.2366 -0.2323 -0.0229 -0.2582 -0.2225 -0.2013 0.2091 -0.2544 0.1455 -0.0641 -0.3783 -0.22 -0.2705 -0.0384 0.1205 -0.2131 -0.2757 -0.1646 0.3319 -0.1307 0.1626 -0.1159 -0.3738 -0.1137 0.3971 -0.1938 0.1221 -0.209 -0.0606 -0.1527 0.0301 -0.1716 0.0108 -0.0962 0.0036 -0.1198 0.0841 -0.1654 -0.0021 -0.2305 -0.0604 -0.5363 -0.1094 -0.1507 -0.0661 -0.2244 -0.5274 -0.2725 0.1496 -0.3543 -0.0829 -0.1995 -0.3321 -0.172 0.3229 -0.1005 0.2291 0.0389 -0.5719 0.051 0.4413 -0.2409 0.2009 -0.1273 -0.2211 -0.2211 -0.0703 -0.2564 -0.2474 -0.2437 -0.178 -0.3041 -0.261 -0.2306 -0.1236 -0.2549 -0.1825 -0.2242 -0.11 -0.2543 -0.2114 -0.2301 -0.1435 -0.2332 0.031 0.1136 -0.0785 -0.2235 -0.1593 -0.1347 -0.0186 -0.1728 -0.0038 0.1257 0.2591 -0.0615 -0.0501 -0.1586
SSC12C 0.0433 -0.166 -0.1292 -0.1665 -0.144 0.1366 -0.0986 -0.1419 -0.0331 -0.0675 -0.1652 -0.054 -0.2821 -0.0311 -0.2901 -0.2303 -0.1099 -0.3954 -0.1279 -0.3415 -0.0565 -0.1542 0.0527 -0.0144 -0.1118 -0.037 0.0541 0.2707 0.2392 0.3542 0.0543 0.1049 0.0061 0.258 0.0611 0.3586 0.3078 -0.0315 -0.1801 -0.0782 0.3001 0.0931 0.5449 0.2561 0.2971 0.2881 0.2624 0.1007 0.2759 0.046 0.2131 0.1088 0.625 0.4557 1 0.2596 0.3608 0.1987 0.067 -0.0052 -0.1373 0.0215 0.0509 0.021 0.0053 -0.1719 -0.0523 0.1168 -0.0686 -0.1222 -0.0728 -0.2729 -0.123 0.0038 -0.2115 -0.1392 -0.0721 -0.172 -0.088 0.0093 -0.0636 -0.1283 -0.0159 0.0587 -0.3152 -0.0762 -0.1515 -0.1764 -0.082 -0.2517 -0.1749 -0.0307 0.0205 -0.0395 0.0611 -0.2807 -0.0563 -0.021 -0.0044 -0.0561 -0.0077 -0.2163 -0.2045 0.231 -0.1588 -0.2298 0.0742 -0.1346 -0.1908 0.0449 -0.1343 -0.0791 0.1782 -0.3178 -0.3385 0.1041 -0.1285 -0.1052 -0.1158 -0.2848 -0.1302 -0.1422 0.0497 0.0165 -0.1798 -0.2715 -0.1734 -0.08 0.1027 0.0115 -0.0201 -0.1689 0.0488 -0.0744 0.0617 -0.019 -0.2752 -0.2908 -0.0662 -0.0269 -0.3051 -0.3388 -0.1002 -0.0447 -0.219 -0.3344 -0.0617 0.0496 -0.3594 -0.284 -0.0267 -0.016 -0.3303 -0.2987 -0.0383 -0.018 -0.3081 0.0592 -0.0421 0.0005 -0.196 -0.2167 -0.1337 -0.0693 0.2832 0.091 0.2714 0.2454 0.2645 0.2729
SSC12G -0.0533 0.0264 0.1138 0.1599 0.1429 -0.0745 -0.0916 -0.1333 -0.0387 -0.2312 -0.0577 -0.1554 -0.2409 -0.1498 -0.1696 -0.0791 -0.1439 -0.2027 -0.1776 -0.107 0.0585 0.0786 0.1336 0.0341 0.0992 0.0369 0.1908 0.3786 0.23 0.2665 0.4993 0.2792 0.291 0.2389 0.6077 0.2683 0.3124 0.087 -0.0475 -0.0141 0.053 -0.0703 -0.1638 -0.2319 -0.0932 -0.1239 0.0563 -0.0885 -0.0744 -0.3774 -0.2006 -0.2366 0.3682 0.3471 0.2596 1 0.4733 0.241 -0.0166 0.1329 0.103 0.1344 0.213 0.081 -0.0724 0.1528 -0.0725 0.1372 0.1259 0.073 -0.1554 0.0507 -0.0873 -0.0779 -0.0864 -0.1131 -0.1572 0.1654 -0.0196 0.0932 0.1468 0.1038 -0.1012 -0.0029 0.0957 0.0386 0.0314 -0.0072 -0.1094 0.0588 -0.144 -0.0665 -0.0181 -0.0195 -0.1375 0.1456 -0.1202 -0.1109 -0.0169 -0.0109 -0.1809 0.2146 0.1044 0.0974 0.0671 0.051 -0.1969 0.1696 -0.2119 -0.0248 -0.1066 -0.0947 -0.2111 -0.0864 -0.3764 -0.0217 -0.1736 -0.0894 -0.0144 -0.0587 0.0369 0.0412 -0.0202 -0.0794 -0.0391 -0.015 -0.0411 0.0559 0.0468 0.0479 -0.1009 0.2254 0.0626 -0.0217 0.082 0.0349 0.1868 0.0936 0.0886 -0.0048 0.2828 0.1341 0.1459 0.0459 0.3311 0.1809 0.1436 0.1368 0.1892 0.067 0.0767 -0.0358 0.1705 0.0547 0.048 -0.04 0.2056 0.1495 0.1143 0.0015 0.2987 0.1655 0.048 0.2205 0.2166 -0.0101 0.1596 0.1429 -0.1367 -0.0349
SSC13C 0.2266 0.2385 0.0255 -0.0807 -0.038 -0.1436 -0.0138 -0.3384 0.0053 -0.3242 -0.3683 -0.2257 -0.1705 -0.215 0.0322 -0.0764 -0.1666 -0.0778 -0.1506 -0.1628 0.2219 0.1409 0.0059 0.2265 -0.3178 0.0493 0.3822 0.0891 0.1791 0.3095 0.3685 0.2954 0.4185 0.209 0.4013 0.1758 0.2742 0.1556 0.1483 0.1575 -0.1954 -0.2265 -0.1453 0.1982 -0.3381 -0.1996 0.1746 -0.2438 -0.2198 0.1395 -0.3394 -0.0504 0.3391 0.0545 0.3608 0.4733 1 0.3059 -0.2072 0.548 0.1069 0.3444 -0.0701 0.0733 -0.1289 -0.0763 0.1087 0.1776 0.0605 0.2023 -0.454 -0.2286 0.0516 -0.3347 -0.3196 -0.1302 -0.1301 -0.0204 0.1238 0.1566 0.0584 0.2191 -0.2047 0.0454 -0.0985 0.1357 0.1119 0.1662 -0.218 -0.1768 -0.0537 0.2076 0.0227 0.1894 -0.1717 -0.2091 0.0874 0.04 -0.0057 0.2924 -0.2126 -0.0846 0.2286 -0.2321 0.0264 -0.0987 -0.369 -0.15 0.1352 -0.4044 -0.2307 -0.0979 -0.2253 -0.273 -0.0861 -0.2417 -0.2191 -0.0916 -0.1433 -0.0518 0.0185 0.3467 0.2338 0.3371 -0.1186 -0.1151 -0.0752 0.501 0.1445 0.2461 -0.1766 -0.0223 0.1618 0.1791 0.1142 0.3697 0.0339 0.1444 0.1999 0.1668 -0.0034 0.1211 0.1794 0.1717 0.0702 0.1724 0.1066 0.1377 -0.0289 0.1137 0.2138 0.2083 -0.0329 0.1242 0.1894 0.2241 0.0047 0.2108 0.0133 0.0571 0.0311 0.1809 0.1625 0.4047 0.2236 0.2121 0.124 -0.3568 -0.1823 0.0348
SSC13G -0.1965 0.0169 -0.1494 -0.2201 0.0067 -0.1462 -0.1391 -0.0004 -0.0447 -0.1497 0.1088 0.0304 0.0164 -0.2746 -0.0526 -0.1668 -0.0577 -0.2549 0.0532 -0.0915 -0.2296 -0.2049 -0.2434 0.2035 -0.0393 0.0155 0.1663 0.137 0.1318 0.2865 0.1645 0.0235 0.2854 0.1574 0.0733 0.2495 0.0587 0.1063 0.1275 0.1994 -0.0003 -0.1871 -0.2107 0.0012 -0.0591 -0.1009 -0.0742 -0.2185 -0.3403 -0.2543 -0.2864 -0.3382 0.0301 0.3066 0.1987 0.241 0.3059 1 -0.2876 0.1868 0.0218 0.1264 0.3108 0.1283 0.1655 0.0527 0.114 0.1014 0.1508 0.089 0.0532 0.1252 0.0293 -0.0299 -0.0822 -0.1022 0.2161 0.0419 0.0379 0.1735 0.1491 0.092 0.1979 0.0616 0.1182 0.1334 0.3797 -0.0278 0.1433 0.0514 0.1173 -0.0905 0.1287 0.102 0.1079 0.0302 0.08 -0.0249 0.04 0.0394 0.3202 0.2767 0.4495 0.0687 0.0998 0.0621 0.0206 0.0992 -0.0651 -0.1284 -0.1095 -0.0872 -0.051 -0.0049 -0.0797 -0.1056 -0.1348 -0.1161 0.0226 -0.116 0.1158 -0.0302 0.0532 -0.107 0.1685 -0.0143 0.0293 -0.0275 0.226 0.2008 0.1449 0.0129 0.0602 0.0181 0.109 0.1014 -0.1949 0.017 -0.0295 0.0684 -0.1018 0.0063 0.0431 0.1179 -0.0359 -0.0011 0.0977 0.1986 -0.18 0.0048 -0.0359 0.0093 -0.1685 -0.0276 -0.0792 -0.0059 -0.1419 0.1811 0.1955 0.0803 -0.0549 0.0517 -0.0297 0.1718 0.2798 -0.0795 0.2654 0.4345 0.1558 0.2625
TA11C -0.035 -0.1553 -0.0344 -0.1568 0.0115 -0.067 0.0311 0.0876 -0.1753 -0.0081 0.1891 0.088 0.0934 0.0777 0.2402 0.1348 0.1247 0.0699 -0.0051 0.1948 0.0253 0.0689 -0.4478 0.0345 -0.044 -0.1253 0.058 0.1156 0.0696 -0.0045 0.4277 -0.1169 -0.101 0.023 0.3319 0.0896 -0.168 0.0354 0.2125 0.0378 -0.1249 -0.3413 -0.3723 -0.1742 -0.272 -0.452 -0.237 -0.286 -0.4871 -0.1628 -0.2747 -0.2355 -0.126 0.0963 0.067 -0.0166 -0.2072 -0.2876 1 -0.0038 -0.03 0.3587 0.1181 0.1721 0.3554 0.2328 -0.0594 0.2009 0.3141 0.2385 0.3042 0.0999 -0.1619 0.1397 0.206 0.2144 0.3483 0.193 -0.0479 0.1658 0.3174 0.2339 0.2792 0.1855 0.1408 0.1608 -0.1225 0.2323 0.2013 0.1971 -0.0998 0.2203 0.2233 0.2277 0.2227 0.2205 -0.0984 0.1418 0.1775 0.1558 0.2462 0.2775 -0.1563 0.3603 0.2095 0.3687 0.287 0.2479 -0.2111 0.2989 0.2036 0.2631 0.2509 -0.0212 -0.2534 0.1864 0.1404 0.1269 0.2065 -0.0296 -0.0623 -0.0623 0.0417 0.0164 0.1298 0.0975 -0.0363 0.1493 0.1828 0.1217 0.1862 0.285 -0.0008 0.1362 0.1606 0.1298 -0.0387 0.0305 -0.0762 -0.1894 -0.077 0.0773 -0.0387 -0.1561 0.0604 0.1429 0.0699 -0.0604 -0.1912 0.0191 -0.0941 -0.1998 -0.1635 0.0194 -0.1282 -0.2011 -0.2191 0.1344 0.0076 -0.0671 -0.1871 0.0623 0.1679 -0.074 -0.0731 -0.0156 -0.2079 -0.0851 -0.0931 -0.4042
TA11G 0.1278 -0.1275 -0.0229 0.1339 0.1918 0.0776 -0.0773 0.1118 -0.0393 0.1558 -0.271 -0.1222 -0.107 -0.1524 -0.0952 -0.1395 -0.0766 -0.0634 -0.1113 -0.1082 0.1086 0.1074 0.1047 0.15 -0.0343 -0.0192 0.4022 0.3623 0.3875 0.3079 0.5229 0.2745 0.5392 0.375 0.5447 0.3539 0.2897 -0.191 -0.1309 -0.0058 0.0995 -0.3316 0.2313 -0.0147 -0.0592 0.1932 -0.0454 0.0562 0.367 0.0737 0.1599 -0.0729 0.4107 0.1371 -0.0052 0.1329 0.548 0.1868 -0.0038 1 0.1494 0.4295 0.8749 0.5262 -0.1562 -0.1467 0.0744 0.3013 0.0491 -0.1061 0.0342 0.0618 0.4491 0.2659 0.1278 -0.041 -0.211 -0.0288 0.0417 0.2938 0.0349 -0.1095 -0.0877 0.3704 -0.2126 -0.0191 0.2128 0.0872 -0.184 -0.1765 -0.2642 0.3996 0.1 -0.0849 -0.2356 -0.2368 -0.4821 0.2966 0.0569 -0.1407 0.1492 0.1189 0.2876 0.2432 -0.0098 -0.003 -0.121 0.0611 0.1203 0.29 0.0932 -0.0469 -0.1315 -0.0961 0.1636 0.238 0.1308 0.0256 -0.3407 -0.3009 0.0559 0.3418 -0.0195 0.1281 -0.1819 -0.1636 -0.2866 0.3291 0.0741 -0.0529 -0.2852 -0.1567 -0.4779 0.2103 -0.011 -0.2008 -0.2526 -0.2639 -0.1423 -0.3324 -0.1433 -0.2207 -0.1104 -0.3031 -0.0748 -0.1407 -0.0444 -0.2161 -0.1656 -0.244 -0.1194 -0.3195 -0.175 -0.2374 -0.0942 -0.3071 -0.0585 -0.1579 -0.1789 -0.2215 -0.1996 -0.2566 -0.0927 -0.1262 0.0309 0.0992 0.1401 0.0903 -0.1173 -0.0155
TA12C -0.1113 0.0472 0.0446 0.2534 0.2658 0.005 -0.0657 -0.1436 -0.1105 -0.0085 -0.1874 -0.1941 -0.0392 -0.2355 -0.0902 -0.0714 -0.1339 0.0528 -0.1235 -0.0604 0.1203 0.1871 0.0921 0.2637 0.0539 0.3108 0.1197 0.1479 -0.0518 0.1486 0.1954 0.2463 0.183 -0.0068 0.3136 0.0124 0.288 0.1361 -0.0203 -0.1259 -0.059 -0.1202 0.18 -0.1297 -0.0644 -0.0391 0.1779 0.0173 0.2785 -0.0021 0.1759 0.0088 -0.09 -0.1867 -0.1373 0.103 0.1069 0.0218 -0.03 0.1494 1 0.4368 0.4932 0.6508 0.1618 0.2374 -0.1279 -0.0595 0.2106 0.2675 0.3074 0.3904 0.0207 0.0765 0.326 0.4332 0.1047 0.2195 -0.1663 -0.0511 0.2022 0.2345 0.2086 -0.1 0.2787 0.2743 -0.0354 0.4137 0.1364 0.231 -0.1336 -0.0836 0.2414 0.3449 0.1722 0.2307 -0.1427 -0.1406 0.206 0.2241 0.2797 0.3711 0.0332 -0.0047 0.2773 0.2874 0.3638 0.3536 0.2047 0.1311 0.2467 0.3504 0.322 0.3305 0.2666 0.0789 0.2917 0.3291 0.255 0.0968 -0.0919 0.0318 0.1679 0.3605 0.1211 0.0962 -0.2402 -0.1152 0.1683 0.1847 0.1933 0.0949 -0.2763 -0.0887 0.1087 0.122 0.2186 0.0691 -0.0931 0.0495 0.178 0.1423 -0.0756 0.1297 0.2118 0.2469 -0.0192 0.2356 0.2114 0.0738 -0.0428 0.0515 0.1513 0.0581 -0.068 0.0588 0.3689 0.1013 0.1158 -0.008 0.0716 0.0354 -0.1655 -0.0307 -0.0743 -0.0145 -0.0488 -0.2344 -0.078 -0.0966
TA12G -0.0236 -0.1009 -0.0003 0.1321 0.1401 0.1254 0.1834 0.123 0.0978 0.1442 0.1202 0.0408 0.016 0.1126 0.0285 0.1201 0.0989 0.1126 0.1214 -0.0777 0.0552 0.1374 0.0295 -0.1227 -0.1695 0.216 0.3805 0.2995 0.3784 0.3188 0.5383 0.3575 0.4115 0.3627 0.5346 0.2834 0.3869 0.2672 0.2098 0.2251 0.034 -0.2403 0.221 -0.0226 -0.1898 -0.1267 0.0326 -0.2003 0.2634 -0.0763 -0.0295 -0.0037 -0.0383 -0.1386 0.0215 0.1344 0.3444 0.1264 0.3587 0.4295 0.4368 1 0.6455 0.6702 0.4835 0.4302 0.4188 0.4686 0.4844 0.3663 0.5344 0.4138 0.3649 0.3532 0.5827 0.3955 0.4563 0.3971 0.4111 0.4432 0.4811 0.3475 0.4434 0.394 0.3077 0.4171 0.4131 0.4625 0.377 0.3499 0.1295 0.3812 0.4505 0.3877 0.3536 0.3659 0.2845 0.3115 0.4608 0.3598 0.4975 0.5035 0.2536 0.4565 0.494 0.2886 0.4972 0.538 0.3629 0.4321 0.5579 0.4478 0.5275 0.2469 0.2269 0.3453 0.5815 0.3915 0.2266 -0.0358 0.3724 0.2852 0.0628 0.3004 0.2428 0.0845 0.0236 0.2714 0.2239 0.1658 0.2009 0.2855 0.2668 0.2813 0.2577 0.2178 0.2842 0.0757 0.1172 0.0663 0.2743 0.1117 0.1991 0.1117 0.3916 0.2422 0.3087 0.2357 0.2588 0.0548 0.1457 0.0675 0.2072 0.0415 0.1289 0.0516 0.3841 0.1437 0.1076 0.1018 0.1899 0.0893 0.1202 0.1855 0.0587 -0.0565 -0.0861 0.0077 -0.0192 0.0051
TA13C -0.2301 -0.3775 -0.2005 -0.0857 0.2226 0.5074 0.0796 0.3651 -0.1137 0.1464 0.1004 -0.0009 -0.0329 -0.0412 -0.181 -0.1014 -0.0125 0.0273 -0.0743 -0.0679 -0.2649 -0.0358 0.112 0.0075 0.0788 0.258 0.6138 0.6697 0.4454 0.5667 0.3979 0.4819 0.5937 0.4097 0.3966 0.5465 0.5021 0.115 0.0425 0.1631 0.0065 -0.0083 0.3058 0.2801 -0.0905 0.0006 0.2286 0.138 0.3006 0.1886 0.1553 0.1922 0.0549 0.1982 0.0509 0.213 -0.0701 0.3108 0.1181 0.8749 0.4932 0.6455 1 0.7075 0.3397 0.239 0.1051 0.4351 0.4025 0.182 0.5019 0.4202 0.3378 0.5896 0.4857 0.329 0.2899 0.1918 0.0898 0.3294 0.3565 0.1733 0.5582 0.5685 0.2514 0.371 0.1177 0.4584 0.3616 0.2898 0.0239 0.495 0.3998 0.3405 0.3676 0.3365 -0.0451 0.4075 0.3742 0.2068 0.5758 0.2971 0.0552 0.704 0.4646 0.2611 0.4668 0.5708 0.1862 0.499 0.4318 0.2552 0.5053 0.1966 0.3326 0.6397 0.4282 0.43 0.2282 0.0933 0.1457 0.2755 0.118 0.3903 0.2159 0.0377 -0.0159 0.1958 0.217 0.238 0.1787 0.2252 -0.1548 0.1198 0.1765 -0.0166 -0.0564 0.0245 0.0331 -0.1445 -0.0336 0.0261 -0.0124 -0.1508 0.0344 0.1349 0.0321 -0.0225 0.0112 0.0382 0.1064 -0.1134 -0.0256 -0.0083 0.0666 -0.1624 0.2123 0.2328 0.361 0.1381 -0.1648 -0.0702 0.0361 -0.0799 0.2149 0.1388 0.1254 0.1748 0.3552 0.1388
TA13G -0.2386 0.0874 0.1611 0.0731 0.1594 0.1081 0.0456 -0.0272 -0.0053 0.0414 -0.0043 -0.043 -0.0148 -0.0328 -0.0104 0.1488 0.0025 0.1233 0.1073 0.0312 0.0756 0.1228 0.1578 0.2261 0.0751 0.2693 0.5361 0.4577 0.3689 0.4877 0.6085 0.4323 0.4995 0.3703 0.5334 0.4225 0.4202 0.2487 0.1358 0.0306 0.1493 -0.2259 0.119 -0.1587 -0.1823 -0.1373 -0.0227 -0.1954 0.1296 -0.0621 0.0294 -0.1563 0.2104 -0.0887 0.021 0.081 0.0733 0.1283 0.1721 0.5262 0.6508 0.6702 0.7075 1 0.2248 0.338 0.3741 0.3329 0.3587 0.2245 0.3057 0.4904 0.3611 0.3847 0.2942 0.3219 0.153 0.3007 0.4176 0.3147 0.3488 0.2139 0.3903 0.3639 0.307 0.3805 0.2895 0.3819 0.2783 0.3256 0.1134 0.2795 0.4073 0.2813 0.3434 0.3387 0.2358 0.2918 0.3686 0.2249 0.4819 0.5592 0.2025 0.4807 0.3152 0.3161 0.4299 0.5296 0.3335 0.5445 0.3057 0.3122 0.4554 0.3278 0.3587 0.4075 0.3552 0.3306 0.1667 -0.0585 0.3378 0.2382 0.2649 0.213 0.126 0.1191 0.0884 0.0831 0.3591 0.1479 0.2277 0.2411 0.1735 0.2895 0.2716 0.1074 0.0997 0.0755 -0.0032 0.0049 0.0879 0.0935 0.0927 0.0043 0.142 0.1332 0.1962 0.0364 0.1083 0.1 0.0233 -0.0043 0.0615 0.0811 0.0277 -0.0188 0.2882 0.0106 0.1602 0.0699 0.0558 0.1212 0.064 0.0657 0.2111 0.0432 0.11 0.1307 -0.0127 0.0782
FW11C 0.026 -0.1988 -0.0388 -0.0247 0.143 -0.0592 0.1142 0.1357 0.3221 -0.0218 0.2047 0.1362 0.2271 0.0874 0.2295 0.1052 0.0762 0.1032 0.2665 0.0389 -0.2305 -0.1317 -0.4004 0.0216 -0.2705 0.1691 0.1353 -0.1144 0.0111 0.0389 0.1058 -0.1115 0.0902 -0.0119 0.0781 0 -0.1383 0.5194 0.502 0.2351 -0.1705 -0.247 -0.3468 -0.1852 -0.2366 -0.3351 -0.134 -0.1942 -0.1873 -0.2671 -0.2402 -0.0033 -0.239 -0.1245 0.0053 -0.0724 -0.1289 0.1655 0.3554 -0.1562 0.1618 0.4835 0.3397 0.2248 1 0.5519 0.4823 0.176 0.7994 0.8078 0.6644 0.4276 0.3312 0.0402 0.6849 0.5961 0.9976 0.5441 0.477 0.159 0.792 0.8007 0.8287 0.1298 0.4772 0.6943 0.3863 0.6533 0.9145 0.5248 0.4739 0.1619 0.8091 0.788 0.8807 0.515 0.4388 0.1038 0.7624 0.7581 0.6076 0.5567 0.2618 0.2342 0.6958 0.6212 0.6831 0.518 0.1552 0.2582 0.6907 0.7081 0.6673 0.3831 0.1239 0.0647 0.6265 0.5002 0.7403 0.2713 0.3673 0.192 0.4791 0.4509 0.8041 0.3714 0.504 0.2152 0.685 0.5476 0.7953 0.4334 0.4208 0.2474 0.6633 0.6803 0.2945 0.1974 0.1509 0.2734 0.201 0.2581 0.2468 0.3057 0.2488 0.3856 0.3776 0.3952 0.19 0.1659 0.1373 0.2411 0.2214 0.1681 0.1449 0.2753 -0.0446 -0.0011 0.0536 -0.0649 0.1551 0.1918 0.2368 0.4018 0.3033 0.2257 0.0213 0.1033 0.0074 0.0171
FW12C -0.0844 -0.0408 0.0991 -0.0208 0.0755 0.1594 0.2162 0.1976 0.317 0.2286 0.2702 0.2427 0.1922 0.3399 0.1694 0.2903 0.2977 0.2405 0.382 0.2132 0.0334 0.0755 -0.0882 -0.1837 0.0859 0.1086 0.1289 -0.1403 -0.1013 -0.0687 0.1966 -0.0717 0.0523 -0.1495 0.0097 -0.1239 -0.0944 0.3142 0.3939 0.0715 -0.1099 -0.1764 -0.454 -0.2241 -0.345 -0.2893 -0.1068 -0.2381 -0.1986 -0.4411 -0.2396 -0.016 -0.2788 -0.1812 -0.1719 0.1528 -0.0763 0.0527 0.2328 -0.1467 0.2374 0.4302 0.239 0.338 0.5519 1 0.7042 0.2696 0.5436 0.562 0.3625 0.5844 0.4844 0.0929 0.3884 0.3368 0.5662 0.9966 0.7051 0.4047 0.5538 0.56 0.483 0.0796 0.8513 0.4682 0.7227 0.5293 0.5295 0.9303 0.6458 0.082 0.5077 0.5024 0.4697 0.9054 0.606 0.1074 0.4835 0.5146 0.1813 0.653 0.5786 0.2251 0.3763 0.3872 0.3 0.6132 0.3256 0.185 0.3715 0.3586 0.2956 0.4787 0.2754 -0.0767 0.3337 0.3183 0.5328 0.6923 0.6194 0.1949 0.378 0.358 0.4934 0.8047 0.6306 0.1421 0.4284 0.37 0.4776 0.8286 0.5352 0.3511 0.4389 0.4776 0.4966 0.4096 0.3437 0.2224 0.4539 0.4065 0.3623 0.3095 0.4217 0.3639 0.2784 0.3326 0.4634 0.3907 0.3252 0.1901 0.4691 0.3919 0.3628 0.1864 0.2278 0.0176 0.1919 0.1012 0.4767 0.264 0.2738 0.1808 0.1751 0.0759 -0.0305 0.0823 -0.1451 -0.0481
FW13C -0.0453 -0.1852 0.0868 -0.5449 -0.3338 0.2355 0.4458 0.0929 0.3858 0.4025 0.3171 0.4428 0.5136 0.2538 0.1224 0.2456 0.4217 0.4517 0.2349 0.1496 0.2786 -0.0563 -0.0524 -0.1982 0.0835 0.0657 0.2284 0.5487 0.2402 0.2069 0.0926 0.3587 0.1151 0.1198 -0.0413 0.1877 0.3687 -0.0483 0.1658 -0.0232 0.1136 0.0126 -0.1567 -0.4808 -0.1196 -0.1998 0.0035 -0.0455 0.0843 -0.1912 0.1062 0.0531 -0.1295 0.1835 -0.0523 -0.0725 0.1087 0.114 -0.0594 0.0744 -0.1279 0.4188 0.1051 0.3741 0.4823 0.7042 1 0.2904 0.5426 0.512 0.2136 0.3164 0.5637 -0.142 0.2811 0.2122 0.5052 0.6885 0.9982 0.397 0.5219 0.4814 0.4375 0.0088 0.6119 0.3657 0.8397 0.2708 0.5467 0.7056 0.9285 0.3464 0.5236 0.5313 0.5795 0.714 0.934 0.2283 0.5166 0.43 -0.1154 0.4458 0.4689 -0.0138 0.2823 -0.0025 0.0717 0.4456 0.6151 -0.1016 0.371 0.1925 0.1118 0.1865 0.4421 -0.1102 0.31 0.2187 0.5062 0.5421 0.8042 0.0257 0.3354 0.3822 0.5096 0.6227 0.8736 0.4251 0.3903 0.4298 0.6104 0.5844 0.8937 0.3105 0.4001 0.3362 0.3247 0.3379 0.2394 0.1228 0.1972 0.3079 0.2643 0.2137 0.0478 0.2487 0.2582 0.2031 0.3137 0.3339 0.2012 0.138 0.3648 0.3485 0.2695 0.1714 -0.1032 -0.2986 0.1295 -0.0469 0.2991 0.1733 0.3557 0.1484 0.343 0.1866 0.0323 0.1488 0.0112 0.2046
FW11G -0.0811 -0.0501 0.0555 -0.0473 0.0784 0.3934 0.2012 0.319 0.1161 0.2775 -0.1101 -0.0384 0.0632 -0.0002 0.1087 -0.0135 0.0488 0.0234 0.0879 0.0989 0.0016 0.1708 -0.0181 0.2266 -0.0132 -0.0432 0.0386 0.2317 0.1106 0.1477 -0.0028 0.0574 0.1556 0.0708 0.0116 0.1318 0.0547 0.174 -0.1009 0.2294 0.1238 -0.1208 0.1494 -0.1755 -0.3369 -0.0843 0.2312 0.1165 0.3361 -0.2204 0.0839 0.0305 -0.0757 -0.1659 0.1168 0.1372 0.1776 0.1014 0.2009 0.3013 -0.0595 0.4686 0.4351 0.3329 0.176 0.2696 0.2904 1 0.4992 0.6271 0.1293 0.1139 0.0524 0.7034 0.4133 0.4861 0.1491 0.3461 0.2986 0.9975 0.499 0.6202 0.1581 0.8919 0.2031 0.3867 0.3178 0.6152 0.1403 0.1656 0.0239 0.9285 0.4652 0.6576 0.1504 0.1838 0.0474 0.9344 0.5099 0.6689 0.1456 0.4973 0.0684 0.8378 0.4112 0.5188 0.0205 0.2788 0.1189 0.7697 0.4773 0.5515 0.0852 0.2511 0.0375 0.6733 0.4548 0.5246 0.094 -0.103 0.382 0.6407 0.0946 0.3524 0.1603 0.0292 0.0234 0.7102 0.3244 0.4428 0.1113 0.0695 0.0781 0.8526 0.3592 0.5394 0.3908 0.1877 0.1375 0.0412 0.3806 0.2396 0.2185 0.0813 0.5134 0.3382 0.2911 0.1903 0.2346 0.1721 0.1405 0.0497 0.2323 0.1601 0.1809 0.0474 0.1481 -0.0773 0.1673 0.0348 0.3173 0.1462 0.138 0.1551 0.0153 -0.003 -0.1575 0.0339 0.0688 -0.14
FW12G -0.0375 -0.1685 -0.1315 -0.1455 -0.1159 0.0977 0.1758 0.2253 0.1957 0.1885 0.1904 0.2698 0.2411 0.1242 0.2699 0.2193 0.2749 0.1429 0.346 0.1735 -0.0374 -0.0172 -0.2205 -0.0389 -0.1253 0.1604 0.366 0.355 0.3708 0.369 0.5541 0.341 0.3998 0.3118 0.4915 0.2914 0.3105 0.3518 0.3322 0.2583 -0.2398 -0.4693 -0.4545 -0.4509 -0.4679 -0.5294 -0.2414 -0.3529 -0.1141 -0.3816 -0.4037 -0.2924 -0.0544 0.1282 -0.0686 0.1259 0.0605 0.1508 0.3141 0.0491 0.2106 0.4844 0.4025 0.3587 0.7994 0.5436 0.5426 0.4992 1 0.8113 0.6448 0.4046 0.3584 0.3314 0.7368 0.6446 0.7852 0.5572 0.5581 0.5851 0.998 0.8035 0.676 0.1862 0.4079 0.8138 0.5659 0.6672 0.7426 0.4562 0.4607 0.2721 0.9354 0.7103 0.6738 0.4681 0.4735 0.1964 0.9157 0.7142 0.5654 0.5847 0.4988 0.3754 0.7604 0.6589 0.6282 0.5273 0.309 0.3022 0.7365 0.6639 0.647 0.2683 0.1082 0.1686 0.644 0.5521 0.5756 0.0945 0.4514 0.019 0.4378 0.1927 0.6414 0.2716 0.4484 0.2381 0.758 0.4609 0.5592 0.4156 0.5111 0.2257 0.8247 0.5933 0.4177 0.2972 0.2029 0.229 0.3718 0.3316 0.2631 0.2524 0.3936 0.3846 0.3315 0.2985 0.3887 0.2584 0.1699 0.1966 0.3924 0.2617 0.1759 0.2056 0.2049 0.0546 0.1086 0.0528 0.3581 0.2715 0.3193 0.318 0.1732 0.0791 -0.0958 0.0485 0.0284 -0.0848
FW13G -0.1068 -0.1394 0.0018 -0.1299 -0.2492 0.04 0.1608 0.1029 0.1827 0.1323 0.3286 0.2195 0.2154 -0.0365 0.2662 0.2285 0.2249 0.1361 0.2411 0.165 -0.1067 -0.0202 -0.1489 0.009 -0.1847 0.1553 0.0937 -0.0616 -0.0679 0.1798 -0.1482 -0.0492 0.0979 -0.1048 -0.1261 0.0585 -0.074 0.1772 0.2613 0.1075 -0.1938 -0.2788 -0.4325 -0.3555 -0.4132 -0.2565 0.0694 -0.1326 -0.08 -0.4762 -0.351 -0.0173 -0.3209 -0.085 -0.1222 0.073 0.2023 0.089 0.2385 -0.1061 0.2675 0.3663 0.182 0.2245 0.8078 0.562 0.512 0.6271 0.8113 1 0.503 0.5093 0.3816 0.4944 0.6266 0.7074 0.7915 0.578 0.4844 0.6596 0.8079 0.9976 0.7281 0.3129 0.5075 0.6461 0.6851 0.8103 0.7663 0.4777 0.4403 0.3586 0.7996 0.9402 0.7166 0.507 0.5629 0.3478 0.7869 0.931 0.5334 0.6431 0.6712 0.4928 0.6568 0.6611 0.5684 0.6546 0.5053 0.4673 0.6623 0.7262 0.5279 0.5189 0.3336 0.2414 0.5735 0.6374 0.6817 0.1714 0.4766 0.163 0.2506 0.4847 0.666 0.2521 0.2762 0.2265 0.633 0.7309 0.6494 0.3742 0.4599 0.4008 0.6968 0.8405 0.2531 0.2862 0.2421 0.286 0.1974 0.3439 0.3045 0.3221 0.247 0.4014 0.351 0.3399 0.1631 0.2652 0.2132 0.2706 0.1579 0.2662 0.2214 0.2745 0.1125 0.0767 0.0862 0.1095 0.1979 0.1662 0.191 0.2366 0.0825 -0.1192 -0.0929 0.0155 -0.0665 0.0299
SW11C 0.275 -0.2061 -0.1118 -0.198 -0.0656 0.0208 0.0247 0.1562 0.0392 0.0704 0.0997 0.0089 0.213 0.1544 0.3614 -0.1413 -0.026 0.0942 0.275 0.2583 -0.3883 -0.072 -0.349 -0.0749 -0.1672 0.3715 0.1588 0.226 0.1402 0.1523 0.0757 0.1289 0.2146 0.1472 0.0083 0.1185 0.0739 0.2078 0.4113 0.0378 -0.1278 -0.2014 0.0197 0.0754 -0.1808 -0.42 -0.2081 -0.2187 0.1045 -0.1036 -0.0605 -0.1334 -0.1846 0.1041 -0.0728 -0.1554 -0.454 0.0532 0.3042 0.0342 0.3074 0.5344 0.5019 0.3057 0.6644 0.3625 0.2136 0.1293 0.6448 0.503 1 0.672 0.6394 0.3914 0.8505 0.8136 0.6109 0.3401 0.1741 0.1021 0.6091 0.4565 0.4988 0.0374 0.2687 0.561 0.0181 0.4039 0.5355 0.3254 0.3945 0.0419 0.6112 0.5151 0.5363 0.3146 0.1638 -0.0087 0.5907 0.524 0.646 0.5599 0.2585 0.3758 0.7525 0.6693 0.8373 0.5869 0.672 0.4188 0.8274 0.808 0.8579 0.5917 0.7165 0.4238 0.8242 0.7702 0.228 -0.0595 -0.1585 -0.083 0.1137 -0.0096 0.3 0.0785 0.2351 -0.0028 0.2928 0.0746 0.3105 0.1122 -0.0832 0.0644 0.2926 0.2183 0.4165 0.1017 -0.036 0.1056 0.1795 0.1192 0.0089 0.1675 0.2171 0.2644 0.1176 0.2914 0.2586 0.0767 -0.0565 0.0825 0.2276 0.0364 -0.088 0.0518 0.2588 0.1566 0.3004 0.1926 0.2208 0.0673 0.2307 0.2927 0.071 0.1242 0.0894 -0.0103 -0.0483 -0.0835
SW12C -0.0951 -0.0793 0.0198 0.0154 0.0514 0.1767 0.257 0.2037 0.2439 0.084 0.2973 0.169 0.2311 0.2309 0.2992 0.2634 0.1887 0.3033 0.35 0.3598 -0.0828 0.0059 -0.0543 -0.1977 0.1041 0.4668 0.2579 0.0931 -0.0247 0.1238 0.0678 0.2203 0.2777 -0.0224 -0.0387 0.0251 0.1521 0.2895 0.3719 0.1813 -0.0714 -0.0428 -0.1058 -0.2563 -0.269 -0.3231 -0.2258 -0.1131 -0.0732 -0.2616 -0.1876 -0.25 -0.1734 -0.2133 -0.2729 0.0507 -0.2286 0.1252 0.0999 0.0618 0.3904 0.4138 0.4202 0.4904 0.4276 0.5844 0.3164 0.1139 0.4046 0.5093 0.672 1 0.815 0.532 0.6476 0.75 0.416 0.5156 0.2993 0.1411 0.3935 0.474 0.3323 -0.0659 0.563 0.3389 0.2646 0.4659 0.3642 0.5781 0.4435 -0.0804 0.332 0.5155 0.3801 0.6334 0.34 -0.1377 0.3662 0.513 0.2101 0.7206 0.3766 0.2057 0.4751 0.5551 0.5094 0.8241 0.7011 0.3466 0.5999 0.6883 0.5632 0.8526 0.7919 0.2339 0.5788 0.7307 0.2935 0.1813 0.1343 -0.1035 0.0197 0.0501 0.1906 0.2566 0.301 -0.168 0.0622 0.14 0.2838 0.3295 0.0585 -0.0735 0.1555 0.2944 0.4452 0.4131 0.378 0.2649 0.3644 0.4444 0.4612 0.3686 0.3322 0.503 0.4505 0.4326 0.4013 0.3938 0.3712 0.2314 0.3651 0.3418 0.3245 0.1578 0.392 0.3779 0.4832 0.4086 0.3806 0.3513 0.4314 0.3221 0.2553 0.092 0.1195 0.2119 -0.0566 0.1671
SW13C -0.0217 -0.1617 -0.0097 -0.2772 -0.2338 0.3267 0.4588 0.1949 0.4119 0.2499 0.3286 0.2026 0.3806 0.2589 0.1535 0.3764 0.1878 0.3676 0.1851 0.1005 0.0497 -0.0238 -0.2584 -0.2938 -0.0251 0.4608 0.2183 0.8113 0.1901 0.1853 0.1017 0.2428 0.3259 0.2035 0.0099 0.2174 0.2165 -0.1391 0.3033 0.4337 0.3395 0.3904 0.0604 0.1132 -0.0143 -0.1085 0.0534 -0.0324 0.0741 0.1761 0.1716 0.0507 0.0043 -0.2366 -0.123 -0.0873 0.0516 0.0293 -0.1619 0.4491 0.0207 0.3649 0.3378 0.3611 0.3312 0.4844 0.5637 0.0524 0.3584 0.3816 0.6394 0.815 1 0.1807 0.672 0.533 0.3906 0.4209 0.5132 0.2703 0.264 0.3427 0.297 0.0291 0.4913 0.3396 0.4665 0.3029 0.2303 0.4602 0.5402 0.1238 0.2751 0.3378 0.3018 0.4867 0.4814 -0.1466 0.3315 0.4108 0.0936 0.5376 0.5467 0.1699 0.5444 0.1134 0.4322 0.6779 0.7822 0.0018 0.6657 0.4994 0.4545 0.6506 0.7324 0.0277 0.5926 0.5337 0.1173 0.2723 0.1943 -0.1073 0.0033 0.3169 0.0145 0.2183 0.3404 0.123 -0.0463 0.0623 0.2469 0.1231 0.2637 -0.1737 0.0352 0.1375 0.4372 0.4557 0.2986 0.1761 0.2515 0.4142 0.3443 0.22 0.1681 0.3579 0.3093 0.1992 0.394 0.4532 0.3207 0.1884 0.3563 0.4015 0.2852 0.1038 0.3841 0.3111 0.6458 0.4161 0.2543 0.3372 0.3702 0.3163 0.2757 0.1512 0.0986 0.1481 0.1792 0.2808
SW11G 0.0085 -0.0651 0.0429 -0.0325 0.152 0.2057 -0.0309 -0.1431 -0.3239 -0.1261 -0.0511 -0.1947 0.0217 0.0021 0.2566 -0.1817 -0.1124 0.1047 0.191 0.2409 -0.1692 0.2136 0.1296 0.265 -0.0661 0.2766 -0.0899 0.1581 -0.0065 0.118 -0.0971 -0.0909 0.033 0.013 -0.134 0.0391 -0.1021 -0.0776 -0.1146 0.0989 0.1469 -0.186 0.4826 -0.0792 -0.2921 -0.0798 0.0923 -0.3482 0.3976 -0.2221 -0.0951 -0.0825 -0.094 -0.2323 0.0038 -0.0779 -0.3347 -0.0299 0.1397 0.2659 0.0765 0.3532 0.5896 0.3847 0.0402 0.0929 -0.142 0.7034 0.3314 0.4944 0.3914 0.532 0.1807 1 0.5027 0.7856 0.006 0.0526 -0.1594 0.6512 0.3239 0.4492 0.0687 0.6598 0.0047 0.1706 -0.2043 0.5194 -0.0419 0.0428 -0.2022 0.6842 0.3031 0.5644 0.0989 0.1151 -0.1604 0.6759 0.3083 0.5176 0.2081 0.337 -0.2579 0.7158 0.3374 0.5329 0.2518 0.5066 0.2452 0.7968 0.5121 0.6448 0.3361 0.6022 0.4224 0.7274 0.5177 0.8248 -0.0886 -0.228 -0.11 0.3257 -0.1748 0.1993 -0.1559 -0.242 -0.2765 0.327 0.0556 0.2475 -0.0463 -0.1129 -0.3271 0.5151 0.038 0.157 0.1719 -0.0689 -0.0303 -0.0166 0.1843 0.0291 0.1942 0.0683 0.393 0.2838 0.3578 0.2818 0.0379 -0.0985 -0.0074 -0.0439 0.0478 -0.1037 0.0251 -0.0504 -0.0225 -0.0942 -0.0136 0.0123 0.208 0.0428 0.1296 0.0424 -0.0207 -0.0012 -0.1627 0.206 -0.042 0.0157
SW12G 0.0634 -0.1278 -0.0824 0.0331 -0.0223 0.0637 0.1771 0.1896 0.1904 0.1932 0.1497 0.1712 0.2273 0.1553 0.2957 0.1413 0.1789 0.2132 0.3466 0.1864 -0.0192 -0.0093 -0.1404 -0.0736 -0.1757 0.3142 0.1548 0.1059 0.1913 0.1037 0.2039 0.1598 0.2248 0.1536 0.1691 0.0175 0.126 0.2637 0.3257 0.2848 -0.1763 -0.2524 -0.0432 -0.1003 -0.2904 -0.364 -0.217 -0.2087 0.1841 -0.0277 -0.1467 -0.1437 -0.184 -0.0229 -0.2115 -0.0864 -0.3196 -0.0822 0.206 0.1278 0.326 0.5827 0.4857 0.2942 0.6849 0.3884 0.2811 0.4133 0.7368 0.6266 0.8505 0.6476 0.672 0.5027 1 0.808 0.6352 0.3408 0.324 0.4501 0.6923 0.6004 0.5701 0.2212 0.306 0.6614 0.238 0.5486 0.5925 0.3302 0.3515 0.2627 0.6741 0.5677 0.591 0.3961 0.3545 0.189 0.7478 0.617 0.605 0.5706 0.3302 0.5014 0.8083 0.6479 0.7549 0.6446 0.6723 0.4674 0.9399 0.8055 0.7787 0.5934 0.622 0.4837 0.9147 0.7396 0.3816 -0.0476 0.1807 0.0089 0.0752 0.0768 0.3978 0.0477 0.2327 0.1362 0.27 0.1547 0.3938 0.1717 0.1622 0.1191 0.4487 0.3651 0.498 0.3258 0.2511 0.2819 0.394 0.3429 0.3229 0.3078 0.3974 0.4159 0.3845 0.3617 0.4465 0.3001 0.2363 0.2623 0.4231 0.2804 0.2046 0.2366 0.3638 0.2178 0.2689 0.2276 0.4003 0.3367 0.375 0.2945 0.0235 -0.0261 -0.1337 0.0048 -0.0638 -0.0367
SW13G -0.0198 -0.0839 -0.0203 0.0909 -0.136 0.1382 0.1583 0.0541 0.1014 0.1478 0.1184 0.1682 0.1733 0.1208 0.3511 0.138 0.2077 0.1274 0.3475 0.3446 -0.0983 0.0659 -0.0289 -0.1066 -0.0553 0.4166 0.0667 0.0131 -0.0392 0.1472 -0.1789 0.0424 0.1076 -0.0738 -0.2676 -0.0084 -0.0241 0.1039 0.2114 0.0457 0.0428 -0.1701 -0.0273 -0.1639 -0.3013 -0.2391 -0.0299 -0.1478 0.1616 -0.3687 -0.2292 -0.101 -0.2811 -0.2582 -0.1392 -0.1131 -0.1302 -0.1022 0.2144 -0.041 0.4332 0.3955 0.329 0.3219 0.5961 0.3368 0.2122 0.4861 0.6446 0.7074 0.8136 0.75 0.533 0.7856 0.808 1 0.5223 0.2822 0.1821 0.4885 0.6051 0.6571 0.5589 0.2464 0.3197 0.5064 0.1898 0.5955 0.477 0.2897 0.2428 0.2536 0.6098 0.6927 0.4982 0.3745 0.2592 0.2325 0.6291 0.6919 0.5375 0.645 0.3524 0.5442 0.6813 0.7107 0.7369 0.726 0.573 0.6399 0.8122 0.936 0.7069 0.7648 0.6283 0.477 0.7581 0.9059 0.4047 -0.1027 -0.0122 0.0927 -0.0418 0.104 0.2262 -0.034 0.0668 0.0055 0.2476 0.2291 0.3227 0.1122 -0.0085 0.2215 0.3549 0.4025 0.341 0.2595 0.1696 0.2457 0.1764 0.3034 0.277 0.2746 0.2131 0.4198 0.3291 0.3279 0.2178 0.2374 0.161 0.2381 0.2004 0.2087 0.1401 0.2158 0.201 0.2064 0.2672 0.2251 0.2358 0.2082 0.2519 0.2093 0.0993 0.0229 -0.127 0.1536 0.0236 0.1049
FlW11C 0.0171 -0.1578 0.0144 -0.0071 0.1558 -0.1149 0.1 0.1687 0.3187 -0.0267 0.2205 0.1211 0.3095 0.086 0.2277 0.1214 0.0613 0.1231 0.2543 0.0487 -0.2332 -0.1283 -0.4143 -0.0103 -0.2625 0.1115 0.1145 -0.1663 -0.0189 -0.0055 0.0856 -0.1333 0.0583 -0.0273 0.0447 -0.0253 -0.1533 0.5199 0.5182 0.328 -0.2094 -0.2681 -0.3818 -0.2092 -0.2921 -0.3635 -0.1817 -0.2213 -0.2481 -0.2854 -0.269 -0.0445 -0.3315 -0.2225 -0.0721 -0.1572 -0.1301 0.2161 0.3483 -0.211 0.1047 0.4563 0.2899 0.153 0.9976 0.5662 0.5052 0.1491 0.7852 0.7915 0.6109 0.416 0.3906 0.006 0.6352 0.5223 1 0.5565 0.4968 0.158 0.7806 0.7878 0.8277 0.1094 0.4927 0.6705 0.4252 0.6225 0.9199 0.5282 0.4809 0.1469 0.8038 0.7683 0.8838 0.5033 0.4565 0.0939 0.7555 0.7344 0.5906 0.5488 0.2904 0.1892 0.6643 0.566 0.6329 0.4831 0.1506 0.2259 0.6397 0.6476 0.6127 0.3665 0.1282 0.0032 0.5684 0.4135 0.761 0.2955 0.4011 0.1864 0.4612 0.4386 0.8296 0.3916 0.5117 0.1989 0.6915 0.5337 0.8077 0.4302 0.4379 0.239 0.6695 0.6682 0.2698 0.2215 0.1027 0.3449 0.1984 0.2905 0.201 0.4416 0.2423 0.4022 0.3232 0.5114 0.1775 0.1888 0.0837 0.3012 0.2168 0.1938 0.1045 0.3173 -0.0844 -0.0917 0.043 -0.0198 0.1535 0.2187 0.179 0.4512 0.2741 0.223 0.0159 0.1092 0.0001 -0.0384
FlW12C -0.0461 -0.0499 0.0687 -0.0282 0.0306 0.1714 0.1867 0.2619 0.2872 0.2617 0.249 0.218 0.1555 0.3026 0.1405 0.2414 0.2711 0.213 0.3508 0.1628 0.0007 0.0778 -0.0631 -0.1344 0.0459 0.0489 0.2185 -0.015 -0.0568 0.0121 0.2457 0.0072 0.1553 -0.1002 0.0742 -0.0242 -0.0053 0.2675 0.3655 0.0975 -0.1318 -0.177 -0.4795 -0.268 -0.3603 -0.2947 -0.0864 -0.1774 -0.2569 -0.4218 -0.2166 0.0147 -0.2624 -0.2013 -0.172 0.1654 -0.0204 0.0419 0.193 -0.0288 0.2195 0.3971 0.1918 0.3007 0.5441 0.9966 0.6885 0.3461 0.5572 0.578 0.3401 0.5156 0.4209 0.0526 0.3408 0.2822 0.5565 1 0.6846 0.4994 0.5724 0.5816 0.4793 0.1272 0.8531 0.4836 0.722 0.5517 0.5357 0.9182 0.6203 0.1742 0.5323 0.5147 0.4568 0.8869 0.5614 0.1635 0.4985 0.5278 0.2005 0.6119 0.6012 0.2155 0.3612 0.3727 0.3035 0.5784 0.221 0.1781 0.3487 0.3031 0.313 0.4358 0.1318 -0.1205 0.3126 0.2495 0.5157 0.6944 0.5927 0.3299 0.4251 0.4111 0.5017 0.8186 0.6152 0.2899 0.4728 0.4281 0.4576 0.8395 0.5247 0.4389 0.4747 0.5255 0.5086 0.4595 0.3181 0.1835 0.4673 0.4505 0.3297 0.2724 0.4453 0.3978 0.2582 0.3017 0.4722 0.4476 0.2959 0.1495 0.4713 0.4501 0.3424 0.1511 0.2652 -0.0305 0.2005 0.0616 0.4347 0.2879 0.233 0.1495 0.2114 0.1066 0.0111 0.0762 -0.1369 -0.0453
FlW13C 0.0101 -0.1602 0.1252 -0.5482 -0.3303 0.2269 0.4158 0.0831 0.3484 0.4011 0.2593 0.3917 0.5073 0.2205 0.1163 0.2419 0.3871 0.4457 0.2182 0.1485 0.2869 -0.0137 -0.0356 -0.1522 0.089 0.0534 0.222 0.5138 0.2482 0.203 0.1065 0.4112 0.0968 0.1443 -0.0186 0.1807 0.3716 -0.0402 0.18 -0.0176 0.0901 0.0035 -0.2001 -0.5062 -0.205 -0.4156 -0.0008 -0.1239 0.0326 -0.2103 0.057 0.0048 -0.1356 0.2091 -0.088 -0.0196 0.1238 0.0379 -0.0479 0.0417 -0.1663 0.4111 0.0898 0.4176 0.477 0.7051 0.9982 0.2986 0.5581 0.4844 0.1741 0.2993 0.5132 -0.1594 0.324 0.1821 0.4968 0.6846 1 0.3953 0.5396 0.4813 0.4339 0.0071 0.5611 0.3441 0.8127 0.2174 0.5536 0.6937 0.913 0.3519 0.543 0.4797 0.5822 0.6932 0.936 0.2481 0.5416 0.3806 -0.1273 0.4112 0.4475 -0.0264 0.2874 0.0121 0.0419 0.4081 0.5823 -0.1059 0.3843 0.2042 0.0848 0.1505 0.4062 -0.1167 0.3219 0.2503 0.5183 0.4904 0.8146 0.0344 0.2969 0.3022 0.5296 0.6169 0.8761 0.4339 0.4062 0.3719 0.6166 0.5813 0.9021 0.3356 0.4222 0.2691 0.3079 0.3007 0.2946 0.1522 0.1968 0.259 0.3056 0.2241 0.0451 0.196 0.2735 0.1843 0.3041 0.2953 0.2463 0.1618 0.3577 0.3087 0.3278 0.2 -0.1252 -0.3481 0.1169 -0.0523 0.2929 0.193 0.3438 0.2016 0.332 0.2185 0.0705 0.1389 -0.0237 0.1431
FlW11G -0.0447 -0.0614 0.0331 -0.0061 0.0806 0.4426 0.2779 0.2429 0.2254 0.3487 0.038 0.0088 0.1297 0.0702 0.1764 0.0579 0.1214 0.0793 0.1441 0.1892 0.0243 0.2001 -0.0481 0.1725 -0.0008 -0.0123 0.0133 0.1961 0.0566 0.1362 -0.0445 0.0185 0.1193 0.036 -0.056 0.1133 0.0131 0.1373 -0.0647 0.3068 0.1024 -0.1763 -0.1346 -0.2191 -0.3464 -0.1005 0.247 -0.1115 0.2784 -0.2701 0.0696 0.061 -0.1241 -0.2544 0.0093 0.0932 0.1566 0.1735 0.1658 0.2938 -0.0511 0.4432 0.3294 0.3147 0.159 0.4047 0.397 0.9975 0.5851 0.6596 0.1021 0.1411 0.2703 0.6512 0.4501 0.4885 0.158 0.4994 0.3953 1 0.5914 0.6552 0.1315 0.8644 0.3203 0.4566 0.5004 0.6442 0.1186 0.2843 0.1204 0.9124 0.5658 0.6576 0.1192 0.2616 0.1135 0.9199 0.5945 0.6652 0.0722 0.5301 0.3008 0.8132 0.4487 0.5418 -0.0323 0.2517 0.2534 0.7407 0.5103 0.5313 0.0601 0.3289 0.1361 0.6301 0.4902 0.4659 0.1226 0.0576 0.4748 0.6411 0.1442 0.3707 0.1564 0.1939 0.0938 0.7273 0.4239 0.4576 0.1226 0.1532 0.1109 0.8552 0.4187 0.5692 0.4835 0.2177 0.1192 0.1283 0.4438 0.269 0.2375 0.1733 0.5183 0.3427 0.2981 0.2539 0.3445 0.2119 0.123 0.1248 0.3562 0.2055 0.1611 0.1044 0.1546 -0.0738 0.1472 0.158 0.3266 0.1705 0.1202 0.2025 -0.0159 -0.0156 -0.2174 0.1262 -0.0355 -0.1722
FlW12G 0.012 -0.1609 -0.1232 -0.1371 -0.0932 0.0942 0.1782 0.2102 0.1843 0.1837 0.181 0.2452 0.2244 0.1256 0.2409 0.2041 0.2534 0.1284 0.3136 0.1355 -0.0434 -0.0061 -0.205 -0.0269 -0.1528 0.139 0.3784 0.3635 0.3691 0.3695 0.5426 0.3367 0.408 0.3092 0.5138 0.2933 0.3078 0.3509 0.3158 0.2321 -0.2409 -0.4707 -0.52 -0.4748 -0.4976 -0.5142 -0.2382 -0.3597 -0.1634 -0.4139 -0.4388 -0.2977 -0.0407 0.1455 -0.0636 0.1468 0.0584 0.1491 0.3174 0.0349 0.2022 0.4811 0.3565 0.3488 0.792 0.5538 0.5219 0.499 0.998 0.8079 0.6091 0.3935 0.264 0.3239 0.6923 0.6051 0.7806 0.5724 0.5396 0.5914 1 0.8019 0.6707 0.1769 0.4141 0.7992 0.5656 0.6523 0.7401 0.4637 0.4454 0.261 0.9329 0.7019 0.6664 0.4767 0.4585 0.1947 0.9074 0.7011 0.5489 0.5822 0.4933 0.3575 0.7415 0.6883 0.6021 0.5264 0.2137 0.2872 0.7228 0.6265 0.6195 0.2587 -0.0033 0.1422 0.6396 0.5109 0.5811 0.1037 0.4525 0.0167 0.4318 0.1871 0.6501 0.2833 0.4445 0.2327 0.779 0.4702 0.5623 0.4316 0.5164 0.2338 0.8347 0.5959 0.4208 0.3067 0.255 0.2586 0.3799 0.3452 0.301 0.2753 0.3942 0.4061 0.3448 0.304 0.399 0.2647 0.2232 0.2213 0.4051 0.2704 0.2365 0.2386 0.1924 0.0488 0.0931 0.0249 0.3545 0.2854 0.3612 0.333 0.1565 0.0509 -0.1098 0.0698 0.0348 -0.0907
FlW13G -0.1165 -0.1404 0.0039 -0.1472 -0.2523 0.0349 0.152 0.1042 0.1784 0.1263 0.3338 0.2023 0.213 -0.0617 0.249 0.2362 0.2076 0.1323 0.2195 0.142 -0.1046 -0.0186 -0.1551 0.0382 -0.1911 0.1374 0.0938 -0.0672 -0.0629 0.1769 -0.1383 -0.0458 0.0945 -0.0962 -0.1062 0.0627 -0.0762 0.1796 0.2576 0.1156 -0.2087 -0.2745 -0.4714 -0.3631 -0.4263 -0.2907 0.0761 -0.1427 -0.1278 -0.4708 -0.3637 -0.0188 -0.3138 -0.0641 -0.1283 0.1038 0.2191 0.092 0.2339 -0.1095 0.2345 0.3475 0.1733 0.2139 0.8007 0.56 0.4814 0.6202 0.8035 0.9976 0.4565 0.474 0.3427 0.4492 0.6004 0.6571 0.7878 0.5816 0.4813 0.6552 0.8019 1 0.7197 0.3093 0.5003 0.6371 0.687 0.8048 0.7676 0.4721 0.3978 0.3574 0.7925 0.9362 0.7131 0.4957 0.5367 0.348 0.7781 0.9255 0.5156 0.6235 0.6575 0.4715 0.6431 0.6473 0.5345 0.6275 0.4662 0.4346 0.6347 0.689 0.4943 0.4824 0.2843 0.2098 0.5423 0.6003 0.6846 0.1714 0.4915 0.1648 0.2592 0.4988 0.6842 0.2578 0.2779 0.2414 0.646 0.7562 0.6579 0.3763 0.474 0.4059 0.7055 0.8566 0.2359 0.2733 0.254 0.2837 0.1934 0.3282 0.3079 0.315 0.2427 0.3786 0.3483 0.3256 0.1522 0.2528 0.2223 0.2671 0.1485 0.2545 0.2334 0.2712 0.0997 0.065 0.0829 0.1079 0.1878 0.168 0.1784 0.2422 0.074 -0.1237 -0.0744 -0.0001 -0.078 0.009
FpD11C -0.1651 -0.1391 0.0295 -0.0006 0.1971 0.1291 0.3273 0.2065 0.4285 0.184 0.2375 0.2204 0.1243 0.0175 0.0987 0.1885 0.239 0.1324 0.254 -0.0657 -0.1904 0.0258 -0.118 0.0175 -0.2167 0.0263 0.2088 -0.1626 0.1081 0.0894 0.1891 -0.0602 0.1035 0.0529 0.1346 0.0387 -0.0735 0.5319 0.4405 0.1265 0.0439 -0.0855 -0.2299 0.0168 -0.0477 -0.2886 -0.0052 -0.038 0.0086 -0.1087 -0.0863 0.0763 -0.2873 -0.3783 -0.0159 -0.1012 -0.2047 0.1979 0.2792 -0.0877 0.2086 0.4434 0.5582 0.3903 0.8287 0.483 0.4375 0.1581 0.676 0.7281 0.4988 0.3323 0.297 0.0687 0.5701 0.5589 0.8277 0.4793 0.4339 0.1315 0.6707 0.7197 1 0.278 0.5609 0.8125 0.6165 0.7695 0.8796 0.4882 0.4265 0.0735 0.6924 0.746 0.8627 0.4698 0.3395 0.104 0.6797 0.727 0.7949 0.5956 0.4235 0.3934 0.7605 0.7801 0.6028 0.3605 0.0147 0.2544 0.5571 0.5722 0.5952 0.2937 0.0373 0.1017 0.5074 0.4601 0.8371 0.3687 0.5847 0.3839 0.6313 0.4839 0.801 0.4221 0.4967 0.1229 0.6085 0.5935 0.8123 0.4203 0.348 0.2846 0.6211 0.6626 0.2787 0.2604 0.1251 0.2567 0.2006 0.2886 0.2205 0.265 0.2542 0.3319 0.3477 0.332 0.1807 0.258 0.1288 0.2449 0.2294 0.2567 0.1563 0.2668 -0.1204 -0.1139 0.1201 -0.0091 0.0875 0.2586 0.17 0.3597 0.3341 0.1365 0.0451 0.0969 0.1767 0.127
FpD11G -0.1202 0.0209 0.1218 0.0648 0.1796 0.4006 0.152 0.3681 0.1161 0.2153 -0.2448 -0.1574 -0.0461 -0.1956 -0.0821 -0.1201 -0.0719 -0.0253 -0.1382 -0.1252 0.0361 0.194 0.0857 0.2335 -0.08 -0.0825 0.0883 0.1188 0.1926 0.0338 0.1715 0.0436 0.1079 0.1816 0.2086 0.0638 0.0675 0.0975 -0.1496 0.3299 0.3527 0.143 0.3262 0.0939 -0.0289 0.1006 0.4202 0.4158 0.2705 0.0884 0.3415 0.1402 -0.1964 -0.22 0.0587 -0.0029 0.0454 0.0616 0.1855 0.3704 -0.1 0.394 0.5685 0.3639 0.1298 0.0796 0.0088 0.8919 0.1862 0.3129 0.0374 -0.0659 0.0291 0.6598 0.2212 0.2464 0.1094 0.1272 0.0071 0.8644 0.1769 0.3093 0.278 1 0.207 0.3047 0.2362 0.5465 0.1376 0.0508 -0.2665 0.86 0.2122 0.3671 0.2254 0.1146 -0.2572 0.8927 0.2525 0.4157 0.2921 0.3068 0.1446 0.8971 0.2458 0.3299 0.01 0.0477 -0.2233 0.7678 0.2431 0.3002 0.0145 0.1343 -0.17 0.7003 0.239 0.2652 0.1416 0.0247 0.2205 0.7782 0.1729 0.4144 0.1619 0.0236 -0.2246 0.6256 0.1307 0.2423 0.2425 0.0605 -0.1572 0.8048 0.1709 0.3721 0.0153 -0.0265 0.0063 -0.1009 0.2111 0.0334 0.0932 -0.0611 0.333 0.1466 0.1809 0.0595 0.0754 -0.023 0.0115 -0.0894 0.0711 -0.0345 0.0384 -0.1097 0.0654 -0.0954 0.0656 0.0414 0.1466 -0.0447 -0.0305 0.0377 -0.0094 -0.0823 0.0083 0.0008 0.0924 -0.0548
FpD12C -0.2226 0.0322 0.1295 0.1514 0.1526 0.1413 0.2429 0.1869 0.34 0.206 0.186 0.1517 0.1473 0.183 0.109 0.239 0.2499 0.239 0.2981 0.2071 0.0769 0.1776 -0.0088 -0.0527 0.1725 0.0929 0.0731 -0.3109 -0.1718 -0.1861 0.2198 -0.1527 0.0044 -0.2049 0.038 -0.2401 -0.1795 0.321 0.3892 0.187 0.0099 -0.0096 -0.4851 -0.0244 -0.1587 -0.2217 0.015 -0.0798 -0.2063 -0.2388 -0.1049 0.024 -0.3591 -0.2705 -0.3152 0.0957 -0.0985 0.1182 0.1408 -0.2126 0.2787 0.3077 0.2514 0.307 0.4772 0.8513 0.6119 0.2031 0.4079 0.5075 0.2687 0.563 0.4913 0.0047 0.306 0.3197 0.4927 0.8531 0.5611 0.3203 0.4141 0.5003 0.5609 0.207 1 0.5331 0.7823 0.5894 0.5342 0.8852 0.5984 0.0386 0.3772 0.4554 0.5186 0.8891 0.4711 0.1173 0.3787 0.4817 0.2315 0.7488 0.6615 0.2587 0.4004 0.4509 0.2276 0.5376 0.2863 0.0997 0.2663 0.3037 0.1829 0.5087 0.3031 -0.1757 0.2177 0.2313 0.6199 0.7928 0.5939 0.2813 0.4657 0.3739 0.5401 0.8061 0.5569 0.0487 0.3243 0.3376 0.5946 0.7995 0.356 0.3123 0.369 0.4791 0.4655 0.4645 0.3286 0.1968 0.4799 0.4738 0.3998 0.2645 0.423 0.4085 0.3326 0.2818 0.5065 0.4624 0.3159 0.1755 0.4877 0.4422 0.3254 0.1461 0.3724 0.1444 0.3513 0.2022 0.4354 0.3105 0.2616 0.2067 0.2251 0.0906 0.0458 0.0755 -0.0643 0.0151
FpD12G -0.1327 -0.081 -0.0851 -0.0428 -0.0317 0.147 0.2935 0.2657 0.3087 0.2237 0.1099 0.2432 0.139 0.1344 0.1871 0.2563 0.3069 0.139 0.391 0.1115 0.0543 0.1039 -0.1028 -0.0039 -0.0839 0.243 0.323 0.1584 0.2997 0.2466 0.4481 0.2568 0.3093 0.224 0.3287 0.2001 0.2459 0.3931 0.3082 0.3327 -0.0168 -0.1973 -0.314 -0.1346 -0.2587 -0.3745 -0.0342 -0.1417 -0.0389 -0.0225 -0.177 -0.1317 -0.0775 -0.0384 -0.0762 0.0386 0.1357 0.1334 0.1608 -0.0191 0.2743 0.4171 0.371 0.3805 0.6943 0.4682 0.3657 0.3867 0.8138 0.6461 0.561 0.3389 0.3396 0.1706 0.6614 0.5064 0.6705 0.4836 0.3441 0.4566 0.7992 0.6371 0.8125 0.3047 0.5331 1 0.6325 0.7618 0.7351 0.3884 0.2902 0.2023 0.8034 0.5701 0.7338 0.444 0.31 0.1866 0.825 0.671 0.7055 0.6008 0.6793 0.3978 0.8398 0.7065 0.5906 0.3321 0.2934 0.2396 0.6518 0.5302 0.6226 0.2778 0.0855 0.0898 0.5569 0.3864 0.6702 0.2362 0.3754 0.2298 0.6721 0.2719 0.6486 0.2836 0.1982 0.1882 0.6349 0.356 0.6407 0.3744 0.3137 0.2661 0.7576 0.6271 0.4426 0.3613 0.1954 0.2105 0.4495 0.3769 0.3042 0.2329 0.4374 0.3715 0.3811 0.2796 0.4815 0.3382 0.1847 0.1907 0.4722 0.3262 0.1682 0.1746 0.323 0.1369 0.2443 0.1618 0.4092 0.3492 0.3382 0.3109 0.2207 0.052 -0.1356 0.0113 0.0922 -0.0201
FpD13C -0.2217 -0.1941 -0.004 -0.3737 -0.264 0.1431 0.4737 0.2363 0.4148 0.4343 0.2586 0.3653 0.4169 0.177 0.1209 0.2775 0.3583 0.3306 0.1921 0.1509 0.429 -0.0095 0.0037 -0.0696 0.0945 -0.004 0.3765 0.3053 0.1193 -0.1107 0.0679 0.1836 0.2361 0.0177 -0.0353 -0.11 0.1704 0.0415 0.14 0.1293 -0.0011 0.0481 -0.2582 -0.5184 -0.1637 -0.1458 0.239 0.0559 0.0539 -0.6396 0.0125 0.0284 -0.0542 0.1205 -0.1515 0.0314 0.1119 0.3797 -0.1225 0.2128 -0.0354 0.4131 0.1177 0.2895 0.3863 0.7227 0.8397 0.3178 0.5659 0.6851 0.0181 0.2646 0.4665 -0.2043 0.238 0.1898 0.4252 0.722 0.8127 0.5004 0.5656 0.687 0.6165 0.2362 0.7823 0.6325 1 0.5736 0.4194 0.6383 0.7809 0.2208 0.5375 0.6092 0.3995 0.6711 0.7808 0.2785 0.5128 0.5879 0.1218 0.6322 0.7654 0.0264 0.4669 0.5077 -0.1646 0.2975 0.5142 -0.1514 0.2428 0.1154 -0.2205 0.2628 0.3245 -0.1043 0.1646 0.1142 0.573 0.6456 0.8594 0.3329 0.6017 0.3778 0.439 0.6115 0.6877 0.3578 0.4744 0.5486 0.4972 0.5014 0.7331 0.3631 0.4741 0.5657 0.3667 0.5295 0.3518 0.2565 0.3058 0.5413 0.3721 0.3162 0.174 0.4048 0.2911 0.2666 0.3717 0.5367 0.3044 0.247 0.4349 0.5653 0.3522 0.2735 -0.1475 -0.1474 0.1872 0.0461 0.4003 0.4379 0.4316 0.207 0.3224 0.0875 0.0234 0.1392 -0.057 0.1951
FpD13G -0.158 -0.0203 0.0718 -0.0769 -0.076 0.1284 0.1551 0.0934 0.0993 0.1229 0.1433 0.0811 0.0153 -0.0891 0.0575 0.2071 0.1411 0.0883 0.0836 0.0577 0.0479 0.131 0.0188 0.0302 -0.0095 0.1845 0.0948 -0.1432 -0.107 0.0728 0.0014 -0.0833 0.0444 -0.1354 0.1116 -0.0103 -0.1072 0.1394 0.1739 0.0274 0.0068 -0.1659 -0.1955 0.0321 -0.3169 -0.0276 0.3142 0.067 0.0401 -0.1137 -0.125 0.1736 -0.2669 -0.2131 -0.1764 -0.0072 0.1662 -0.0278 0.2323 0.0872 0.4137 0.4625 0.4584 0.3819 0.6533 0.5293 0.2708 0.6152 0.6672 0.8103 0.4039 0.4659 0.3029 0.5194 0.5486 0.5955 0.6225 0.5517 0.2174 0.6442 0.6523 0.8048 0.7695 0.5465 0.5894 0.7618 0.5736 1 0.6507 0.4487 0.1245 0.367 0.6916 0.7691 0.6564 0.4826 0.1767 0.4217 0.702 0.7901 0.5727 0.6932 0.5876 0.6637 0.683 0.7511 0.443 0.5717 0.2332 0.5414 0.5553 0.6175 0.4623 0.4576 0.1543 0.3495 0.4965 0.5268 0.7122 0.2567 0.3564 0.4501 0.4417 0.6743 0.585 0.281 -0.0235 0.2036 0.5557 0.5751 0.6028 0.3858 0.0972 0.4797 0.624 0.7212 0.1769 0.1635 0.1767 0.202 0.1371 0.2373 0.2718 0.2296 0.2095 0.3057 0.3587 0.2649 0.1139 0.178 0.1737 0.2097 0.0828 0.1758 0.1608 0.1949 0.206 0.115 0.0763 0.1645 0.1222 0.0853 0.0748 0.1485 0.1102 -0.1048 -0.0631 -0.0403 -0.0156 0.0305
FcD11C -0.0823 -0.156 0.074 -0.0566 0.2053 0.0091 0.2045 0.1912 0.3895 0.0087 0.2058 0.1617 0.2247 0.0467 0.0694 0.1463 0.1617 0.1922 0.2442 -0.08 -0.2261 -0.0021 -0.1957 0.0483 -0.1929 0.0934 0.2276 -0.1544 0.038 0.0426 0.1911 -0.0236 0.1604 -0.012 0.1889 -0.0406 -0.0405 0.579 0.4814 0.1992 -0.0696 -0.192 -0.3093 -0.1697 -0.1072 -0.3336 -0.0821 -0.14 -0.1519 -0.0814 -0.1519 0.0345 -0.2777 -0.2757 -0.082 -0.1094 -0.218 0.1433 0.2013 -0.184 0.1364 0.377 0.3616 0.2783 0.9145 0.5295 0.5467 0.1403 0.7426 0.7663 0.5355 0.3642 0.2303 -0.0419 0.5925 0.477 0.9199 0.5357 0.5536 0.1186 0.7401 0.7676 0.8796 0.1376 0.5342 0.7351 0.4194 0.6507 1 0.5715 0.5295 0.0773 0.7679 0.765 0.9087 0.5285 0.4902 0.0699 0.7371 0.708 0.6398 0.5188 0.1604 0.2147 0.6966 0.588 0.6258 0.4339 0.1032 0.1842 0.5912 0.5497 0.6292 0.3235 0.1501 0.0102 0.5384 0.4092 0.7923 0.3934 0.4929 0.2974 0.56 0.4792 0.9354 0.4872 0.5873 0.1837 0.6925 0.637 0.8455 0.4761 0.4664 0.2651 0.6806 0.6659 0.3122 0.1788 0.1237 0.2363 0.2079 0.2446 0.2392 0.2748 0.2515 0.3711 0.369 0.3504 0.2112 0.156 0.1222 0.2178 0.2505 0.1569 0.167 0.2654 -0.0648 -0.2133 0.0611 -0.1331 0.1831 0.232 0.1911 0.4062 0.2987 0.1999 0.0292 0.1362 0.1389 0.1047
FcD12C -0.1218 -0.0142 0.1314 0.0608 0.1161 0.1323 0.1597 0.1162 0.2953 0.1876 0.2443 0.2159 0.176 0.2588 0.1084 0.2167 0.2963 0.2341 0.3455 0.1943 -0.0141 0.1385 -0.1069 -0.0957 0.1451 0.07 0.1045 -0.184 -0.1153 -0.159 0.2296 -0.1262 0.0289 -0.1694 0.0422 -0.2302 -0.1553 0.3024 0.4538 0.1274 -0.0943 -0.156 -0.4164 -0.1533 -0.2508 -0.2743 -0.1275 -0.2846 -0.1784 -0.328 -0.2071 -0.0126 -0.3469 -0.1646 -0.2517 0.0588 -0.1768 0.0514 0.1971 -0.1765 0.231 0.3499 0.2898 0.3256 0.5248 0.9303 0.7056 0.1656 0.4562 0.4777 0.3254 0.5781 0.4602 0.0428 0.3302 0.2897 0.5282 0.9182 0.6937 0.2843 0.4637 0.4721 0.4882 0.0508 0.8852 0.3884 0.6383 0.4487 0.5715 1 0.7177 0.0215 0.4552 0.4596 0.518 0.9535 0.62 0.0524 0.434 0.4462 0.1802 0.6026 0.4067 0.2094 0.2894 0.2998 0.2872 0.6012 0.2955 0.1315 0.3075 0.2934 0.2547 0.4652 0.3497 -0.1266 0.2819 0.2767 0.5434 0.7733 0.5953 0.1508 0.3422 0.345 0.5507 0.8988 0.7211 0.0839 0.4 0.3711 0.5421 0.8876 0.5137 0.2901 0.4042 0.4191 0.4597 0.3412 0.3084 0.1679 0.3873 0.3382 0.3326 0.2211 0.3511 0.299 0.2471 0.2247 0.4269 0.3351 0.2976 0.1451 0.4236 0.3258 0.3274 0.146 0.2546 0.0115 0.2251 0.0619 0.3628 0.1567 0.2874 0.133 0.2275 0.1463 0.0551 0.1314 -0.0476 0.0442
FcD13C -0.1784 -0.2846 0.0692 -0.5468 -0.3876 0.1635 0.4585 0.0871 0.4025 0.3777 0.3648 0.4045 0.4734 0.232 0.0623 0.2229 0.4168 0.4642 0.2098 0.177 0.1875 0.0094 -0.0374 -0.1958 0.164 0.1144 0.076 0.1362 0.0731 -0.1865 -0.096 0.0438 0.0224 -0.0504 -0.1928 -0.1628 -0.0204 -0.0448 0.2109 0.052 0.2139 0.1263 -0.2476 -0.5327 0.04 -0.1053 -0.0161 0.0137 0.1182 -0.3021 0.1333 0.0688 -0.2865 0.3319 -0.1749 -0.144 -0.0537 0.1173 -0.0998 -0.2642 -0.1336 0.1295 0.0239 0.1134 0.4739 0.6458 0.9285 0.0239 0.4607 0.4403 0.3945 0.4435 0.5402 -0.2022 0.3515 0.2428 0.4809 0.6203 0.913 0.1204 0.4454 0.3978 0.4265 -0.2665 0.5984 0.2902 0.7809 0.1245 0.5295 0.7177 1 0.153 0.4949 0.4999 0.554 0.7113 0.8957 0.1473 0.4612 0.3971 -0.0625 0.4731 0.4466 -0.2554 0.1988 0.1832 0.1394 0.4992 0.6052 -0.1143 0.3502 0.1841 0.155 0.3666 0.5028 -0.1283 0.3034 0.2674 0.5021 0.516 0.746 -0.1786 0.2921 0.0036 0.481 0.6169 0.9486 0.2422 0.3707 0.3955 0.5741 0.4892 0.802 0.2216 0.3396 0.2676 0.2771 0.5185 0.3055 0.3274 0.1095 0.4734 0.3445 0.3675 -0.1178 0.3624 0.3199 0.291 0.2688 0.5178 0.2639 0.3375 0.3212 0.5321 0.3183 0.3667 -0.1453 -0.189 0.2513 0.0739 0.2702 0.3414 0.515 0.2451 0.388 0.1938 0.0537 0.2139 0.0409 0.3741
FcD11G -0.0087 -0.0678 0.1014 0.0528 0.0816 0.3626 0.0792 0.2222 0.0564 0.2342 -0.2641 -0.1277 0.0893 -0.0919 -0.0118 -0.1614 -0.0666 0.0202 -0.0431 -0.0287 -0.0246 0.1501 -0.0765 0.1758 -0.0391 -0.0282 0.0272 0.1888 0.151 0.081 0.1035 0.0047 0.1345 0.1411 0.2055 0.0764 0.0169 0.1567 -0.1263 0.3205 0.1129 0.0046 0.0925 -0.1201 -0.1954 0.029 0.264 0.3417 0.4506 -0.0288 0.287 0.1619 -0.0986 -0.1307 -0.0307 -0.0665 0.2076 -0.0905 0.2203 0.3996 -0.0836 0.3812 0.495 0.2795 0.1619 0.082 0.3464 0.9285 0.2721 0.3586 0.0419 -0.0804 0.1238 0.6842 0.2627 0.2536 0.1469 0.1742 0.3519 0.9124 0.261 0.3574 0.0735 0.86 0.0386 0.2023 0.2208 0.367 0.0773 0.0215 0.153 1 0.3374 0.4524 0.1131 0.0335 0.1393 0.9331 0.3495 0.4266 0.1582 0.1236 -0.1146 0.7505 0.1513 0.1216 0.0287 0.0819 0.0981 0.7777 0.3102 0.2845 0.0428 0.0868 0.0213 0.717 0.3231 0.3094 -0.007 -0.0679 0.3816 0.6628 0.1314 0.388 0.0755 -0.0337 0.2035 0.8535 0.2593 0.377 0.0698 -0.0169 0.2071 0.8361 0.2413 0.3583 0.0319 -0.0827 0.0376 -0.1007 0.1844 -0.0659 0.0508 -0.1004 0.2713 -0.0007 0.0998 -0.0516 0.0928 -0.0854 0.0443 -0.076 0.0983 -0.0798 0.0856 -0.0793 0.0286 -0.1224 -0.0818 -0.0244 0.1407 -0.136 -0.0213 -0.0064 0.0223 0.0493 -0.0535 -0.0165 -0.0199 -0.0676
FcD12G -0.0721 -0.2041 -0.1286 -0.1889 -0.1483 0.1523 0.1757 0.1859 0.2187 0.2461 0.1518 0.2374 0.2297 0.1087 0.2423 0.2014 0.246 0.1345 0.3248 0.1212 -0.0551 -0.0098 -0.2212 -0.0003 -0.1658 0.1483 0.3649 0.3539 0.3291 0.3673 0.5107 0.3072 0.3994 0.2707 0.4434 0.3074 0.2954 0.3533 0.2959 0.221 -0.1689 -0.3663 -0.391 -0.4064 -0.3921 -0.47 -0.1616 -0.2663 -0.0535 -0.3032 -0.3122 -0.17 -0.0036 0.1626 0.0205 -0.0181 0.0227 0.1287 0.2233 0.1 0.2414 0.4505 0.3998 0.4073 0.8091 0.5077 0.5236 0.4652 0.9354 0.7996 0.6112 0.332 0.2751 0.3031 0.6741 0.6098 0.8038 0.5323 0.543 0.5658 0.9329 0.7925 0.6924 0.2122 0.3772 0.8034 0.5375 0.6916 0.7679 0.4552 0.4949 0.3374 1 0.7467 0.7308 0.4437 0.528 0.2492 0.9561 0.7716 0.5791 0.4777 0.45 0.3791 0.675 0.6118 0.6277 0.4383 0.2699 0.3481 0.6988 0.6574 0.6476 0.2389 0.108 0.2229 0.6327 0.5203 0.5938 0.1308 0.4538 0.0492 0.5344 0.2855 0.6727 0.306 0.4945 0.298 0.872 0.5114 0.631 0.3896 0.5605 0.2644 0.8864 0.6816 0.3674 0.2534 0.2334 0.2192 0.3406 0.2752 0.2605 0.214 0.334 0.3201 0.2954 0.2357 0.3754 0.2237 0.2257 0.2 0.396 0.2354 0.235 0.225 0.1131 0.0469 0.0381 -0.0162 0.341 0.2543 0.3375 0.2642 0.2276 0.1477 -0.052 0.0652 0.0408 0.0117
FcD13G -0.1493 -0.2184 -0.1074 -0.2052 -0.2651 0.0863 0.1924 0.0967 0.1795 0.1678 0.3414 0.2529 0.1919 -0.0249 0.2479 0.1516 0.2429 0.1593 0.2445 0.1563 -0.1723 -0.0661 -0.1439 0.0221 -0.1728 0.2027 0.0939 -0.0634 -0.0734 0.2364 -0.2105 -0.0623 0.0684 -0.1145 -0.2065 0.0993 -0.0801 0.1644 0.2015 0.043 -0.1252 -0.2219 -0.2302 -0.3833 -0.3363 -0.1852 0.1941 -0.0353 0.1084 -0.4086 -0.2406 0.0654 -0.2216 -0.1159 -0.0395 -0.0195 0.1894 0.102 0.2277 -0.0849 0.3449 0.3877 0.3405 0.2813 0.788 0.5024 0.5313 0.6576 0.7103 0.9402 0.5151 0.5155 0.3378 0.5644 0.5677 0.6927 0.7683 0.5147 0.4797 0.6576 0.7019 0.9362 0.746 0.3671 0.4554 0.5701 0.6092 0.7691 0.765 0.4596 0.4999 0.4524 0.7467 1 0.7645 0.4717 0.608 0.4622 0.717 0.9119 0.5522 0.5666 0.4446 0.5203 0.5665 0.6037 0.5758 0.655 0.5519 0.5389 0.6214 0.697 0.5862 0.5271 0.423 0.3091 0.5444 0.6559 0.6932 0.1432 0.4813 0.2137 0.2335 0.4892 0.6608 0.2183 0.2797 0.326 0.5884 0.833 0.684 0.3155 0.454 0.5406 0.6152 0.8134 0.1327 0.2193 0.22 0.2474 0.0419 0.2326 0.2579 0.2598 0.1239 0.2889 0.3135 0.2834 0.0243 0.2122 0.2085 0.2438 0.024 0.2118 0.2131 0.2459 0.013 0.0943 0.08 0.101 0.0346 0.0499 0.1753 0.1615 0.1191 -0.1058 -0.079 0.0575 0.0114 0.102
FsD11C -0.1219 -0.1858 -0.0492 -0.0827 0.2479 0.069 0.1468 0.0496 0.3246 -0.0325 0.2113 0.1207 0.1555 0.0022 0.1316 0.1818 0.1069 0.2836 0.2892 -0.0423 -0.1929 -0.0307 -0.1169 0.1867 -0.2437 0.1625 0.1185 -0.2974 -0.0276 -0.0224 0.1443 -0.1399 0.0321 -0.0618 0.099 -0.1468 -0.1648 0.5419 0.4367 0.136 0.02 -0.0515 -0.1765 -0.0366 -0.0025 -0.1978 0.0283 -0.0459 -0.0212 0.0111 -0.0741 0.1075 -0.1883 -0.3738 0.0611 -0.1375 -0.1717 0.1079 0.2227 -0.2356 0.1722 0.3536 0.3676 0.3434 0.8807 0.4697 0.5795 0.1504 0.6738 0.7166 0.5363 0.3801 0.3018 0.0989 0.591 0.4982 0.8838 0.4568 0.5822 0.1192 0.6664 0.7131 0.8627 0.2254 0.5186 0.7338 0.3995 0.6564 0.9087 0.518 0.554 0.1131 0.7308 0.7645 1 0.5298 0.5582 0.1329 0.7213 0.7552 0.6236 0.4995 0.1284 0.2931 0.6701 0.5751 0.6404 0.4131 0.2435 0.3132 0.6203 0.5857 0.6546 0.4128 0.2448 0.1221 0.5748 0.4408 0.7894 0.3856 0.4876 0.3197 0.5918 0.5011 0.8166 0.4301 0.5673 0.0794 0.6209 0.6086 0.9472 0.4352 0.5033 0.264 0.638 0.708 0.2263 0.2076 0.2514 0.2709 0.1922 0.2675 0.3804 0.3169 0.2284 0.3892 0.5406 0.3922 0.1809 0.1892 0.259 0.257 0.2359 0.1893 0.2878 0.2982 -0.1473 -0.0794 0.0805 -0.0904 0.1085 0.3848 0.2986 0.4705 0.3793 0.2411 0.1114 0.132 0.1771 0.1672
FsD12C -0.1582 -0.0238 0.0788 0.1064 0.137 0.1255 0.1564 0.1296 0.2827 0.1227 0.2546 0.2127 0.1872 0.2689 0.1311 0.2387 0.2876 0.2914 0.3663 0.1947 -0.0154 0.1253 -0.0593 -0.1221 0.102 0.1324 0.079 -0.2168 -0.1479 -0.1575 0.2735 -0.1124 0.0091 -0.205 0.0879 -0.2258 -0.1463 0.3202 0.4335 0.1663 -0.0823 -0.1071 -0.4225 -0.1497 -0.2461 -0.2594 -0.1216 -0.2429 -0.1687 -0.3354 -0.1955 -0.0317 -0.2879 -0.1137 -0.2807 0.1456 -0.2091 0.0302 0.2205 -0.2368 0.2307 0.3659 0.3365 0.3387 0.515 0.9054 0.714 0.1838 0.4681 0.507 0.3146 0.6334 0.4867 0.1151 0.3961 0.3745 0.5033 0.8869 0.6932 0.2616 0.4767 0.4957 0.4698 0.1146 0.8891 0.444 0.6711 0.4826 0.5285 0.9535 0.7113 0.0335 0.4437 0.4717 0.5298 1 0.6302 0.0838 0.4678 0.4988 0.1457 0.6364 0.4627 0.2595 0.3479 0.3688 0.2852 0.6315 0.3528 0.2007 0.3716 0.3769 0.2561 0.5416 0.3767 -0.0965 0.3296 0.3374 0.5464 0.7407 0.5884 0.1309 0.3698 0.312 0.4955 0.8224 0.6811 -0.0029 0.3452 0.3182 0.5425 0.9066 0.5118 0.2641 0.4208 0.4545 0.467 0.4484 0.3915 0.2298 0.452 0.4575 0.4242 0.2913 0.3962 0.4323 0.3302 0.3139 0.479 0.4358 0.3815 0.2028 0.4703 0.4216 0.4028 0.1906 0.3092 0.1109 0.3042 0.1427 0.4183 0.2901 0.3834 0.2349 0.2543 0.1503 0.0596 0.1439 -0.0704 0.0693
FsD13C -0.0535 -0.1645 0.0838 -0.5865 -0.4329 0.0876 0.3288 -0.0386 0.3592 0.3431 0.2901 0.3332 0.4952 0.2032 0.0995 0.2282 0.3483 0.4599 0.1865 0.1058 0.2475 0.0386 -0.0432 -0.1779 0.0293 0.0997 0.1272 0.0256 0.0145 -0.1344 -0.094 0.1723 -0.005 -0.0802 -0.16 -0.2017 0.1356 0.0206 0.226 0.104 0.1609 0.0924 -0.1694 -0.6203 -0.0932 -0.2961 0.0317 -0.1176 0.0543 -0.2868 0.0565 -0.1101 -0.1645 0.3971 -0.0563 -0.1202 0.0874 0.08 -0.0984 -0.4821 -0.1427 0.2845 -0.0451 0.2358 0.4388 0.606 0.934 0.0474 0.4735 0.5629 0.1638 0.34 0.4814 -0.1604 0.3545 0.2592 0.4565 0.5614 0.936 0.1135 0.4585 0.5367 0.3395 -0.2572 0.4711 0.31 0.7808 0.1767 0.4902 0.62 0.8957 0.1393 0.528 0.608 0.5582 0.6302 1 0.1249 0.5204 0.525 -0.1508 0.3357 0.4742 -0.2446 0.2289 0.1933 0.1149 0.4438 0.6346 -0.017 0.395 0.3052 0.1845 0.2489 0.4124 -0.0904 0.3248 0.2944 0.4369 0.4205 0.7701 -0.1707 0.2948 0.0771 0.4319 0.4998 0.825 0.1585 0.3839 0.4461 0.5373 0.4497 0.9392 0.1893 0.3941 0.3966 0.2711 0.4234 0.3155 0.3653 0.1589 0.4022 0.3613 0.4411 0.0018 0.3433 0.3801 0.415 0.26 0.412 0.2613 0.3548 0.315 0.4295 0.3318 0.4092 -0.1582 -0.2863 0.1728 0.0086 0.3067 0.4454 0.5001 0.3468 0.3703 0.1864 0.0424 0.1706 -0.0723 0.305
FsD11G -0.1276 -0.1425 0.045 -0.0407 0.0339 0.4061 0.1113 0.2668 0.0999 0.1916 -0.2095 -0.0847 0.0801 -0.0779 0.029 -0.1258 -0.017 0.1207 -0.0419 0.0144 -0.019 0.1467 0.0719 0.1703 -0.0367 -0.0779 -0.1042 0.0402 0.005 -0.0207 -0.091 -0.0864 -0.0363 -0.0105 -0.0671 -0.0383 -0.0754 0.1287 -0.1881 0.2825 0.244 0.1003 0.0347 -0.0049 -0.1414 0.0562 0.4553 0.4111 0.3597 0.0387 0.3452 0.2523 -0.2173 -0.1938 -0.021 -0.1109 0.04 -0.0249 0.1418 0.2966 -0.1406 0.3115 0.4075 0.2918 0.1038 0.1074 0.2283 0.9344 0.1964 0.3478 -0.0087 -0.1377 -0.1466 0.6759 0.189 0.2325 0.0939 0.1635 0.2481 0.9199 0.1947 0.348 0.104 0.8927 0.1173 0.1866 0.2785 0.4217 0.0699 0.0524 0.1473 0.9331 0.2492 0.4622 0.1329 0.0838 0.1249 1 0.2755 0.4646 0.1413 0.1187 -0.2059 0.7662 0.1123 0.1781 -0.0383 0.0109 -0.0553 0.7672 0.2287 0.2583 0.008 0.1245 0.0345 0.7178 0.2608 0.2806 0.0495 0.0181 0.5146 0.7229 0.1592 0.4037 0.0963 0.003 0.1902 0.7318 0.1918 0.4062 0.1234 -0.0064 0.141 0.947 0.1864 0.4259 0.0569 0.0516 0.0772 -0.0442 0.1883 0.0403 0.1008 -0.039 0.2333 0.0713 0.1616 0.0021 0.1186 0.0577 0.075 -0.0247 0.125 0.0653 0.1324 -0.0259 0.0398 -0.1886 -0.0216 -0.0072 0.1303 -0.0402 0.0285 0.0169 -0.0849 -0.0903 -0.1107 -0.0563 0.0364 -0.0541
FsD12G -0.0835 -0.1786 -0.1355 -0.1368 -0.1351 0.1209 0.1904 0.1675 0.2132 0.2433 0.1481 0.2503 0.1988 0.1096 0.2448 0.2126 0.2577 0.1453 0.3482 0.1205 -0.0319 -0.0156 -0.1469 0.0233 -0.1769 0.1737 0.2804 0.265 0.27 0.2754 0.4228 0.2697 0.3227 0.2039 0.4073 0.2139 0.257 0.3476 0.2723 0.2226 -0.128 -0.3225 -0.2942 -0.3462 -0.3713 -0.4345 -0.1468 -0.1983 0.0143 -0.2464 -0.2652 -0.1509 -0.0355 0.1221 -0.0044 -0.0169 -0.0057 0.04 0.1775 0.0569 0.206 0.4608 0.3742 0.3686 0.7624 0.4835 0.5166 0.5099 0.9157 0.7869 0.5907 0.3662 0.3315 0.3083 0.7478 0.6291 0.7555 0.4985 0.5416 0.5945 0.9074 0.7781 0.6797 0.2525 0.3787 0.825 0.5128 0.702 0.7371 0.434 0.4612 0.3495 0.9561 0.717 0.7213 0.4678 0.5204 0.2755 1 0.8002 0.599 0.4932 0.4575 0.4149 0.7217 0.6042 0.6353 0.4585 0.3699 0.3564 0.7669 0.6892 0.6664 0.3215 0.1558 0.2175 0.7038 0.5565 0.569 0.1158 0.4207 0.092 0.5153 0.3103 0.6333 0.2727 0.4269 0.292 0.767 0.4504 0.6134 0.3822 0.5452 0.2885 0.9005 0.7 0.3861 0.2786 0.2794 0.2318 0.3477 0.2971 0.3069 0.2283 0.3382 0.3337 0.3364 0.2548 0.3798 0.2485 0.2686 0.216 0.3906 0.2599 0.2798 0.2403 0.1643 0.0429 0.0524 -0.0061 0.3494 0.2978 0.37 0.2838 0.2186 0.1229 -0.0863 0.0375 0.034 0.0209
FsD13G -0.1515 -0.2085 -0.0758 -0.1662 -0.2665 0.1249 0.2165 0.139 0.2207 0.1631 0.3286 0.2069 0.1353 0.0304 0.2741 0.2033 0.2184 0.1277 0.2812 0.1823 -0.1513 -0.0073 -0.1267 -0.0535 -0.1734 0.2097 0.0747 -0.1735 -0.1239 0.1395 -0.2624 -0.1017 0.0763 -0.1622 -0.253 0.0121 -0.1341 0.161 0.2035 0.1273 -0.026 -0.1188 -0.2694 -0.0839 -0.2629 -0.121 0.1941 -0.0575 0.05 -0.2635 -0.212 0.1206 -0.2054 -0.209 -0.0561 -0.0109 0.2924 0.0394 0.1558 -0.1407 0.2241 0.3598 0.2068 0.2249 0.7581 0.5146 0.43 0.6689 0.7142 0.931 0.524 0.513 0.4108 0.5176 0.617 0.6919 0.7344 0.5278 0.3806 0.6652 0.7011 0.9255 0.727 0.4157 0.4817 0.671 0.5879 0.7901 0.708 0.4462 0.3971 0.4266 0.7716 0.9119 0.7552 0.4988 0.525 0.4646 0.8002 1 0.5534 0.5739 0.5861 0.5077 0.6227 0.6097 0.5843 0.6382 0.5625 0.5331 0.6837 0.7408 0.6123 0.5939 0.4584 0.3339 0.6267 0.6548 0.6613 0.1751 0.3672 0.3066 0.3541 0.5145 0.5862 0.2042 0.1626 0.2576 0.5792 0.6737 0.6631 0.3155 0.3433 0.5075 0.6742 0.9192 0.2247 0.2772 0.2546 0.2744 0.158 0.2973 0.3035 0.2836 0.2039 0.3439 0.3534 0.2865 0.1354 0.2604 0.2435 0.2796 0.1249 0.2605 0.2456 0.2747 0.1169 0.1027 0.0915 0.1483 0.1798 0.1713 0.1574 0.1981 0.1251 -0.0686 -0.0967 0.0067 -0.0218 0.1416
SpD11C 0.0525 0.0654 0.0568 0.001 0.1328 0.1035 0.1767 0.0945 0.1692 0.2016 0.0717 -0.0143 -0.127 -0.3246 0.0441 -0.0739 0.0134 -0.1722 0.044 -0.1895 -0.3225 0.0622 -0.0635 0.2559 -0.3291 0.115 0.3758 0.1767 0.4018 0.2995 0.2328 0.1868 0.3566 0.3723 0.3659 0.2632 0.1824 0.336 0.2881 -0.0409 0.0147 -0.1553 0.0947 0.1938 0.0436 -0.323 -0.111 0.0675 0.2519 0.0151 0.0365 -0.0664 -0.1799 -0.0606 -0.0077 -0.1809 -0.2126 0.3202 0.2462 0.1492 0.2797 0.4975 0.5758 0.4819 0.6076 0.1813 -0.1154 0.1456 0.5654 0.5334 0.646 0.2101 0.0936 0.2081 0.605 0.5375 0.5906 0.2005 -0.1273 0.0722 0.5489 0.5156 0.7949 0.2921 0.2315 0.7055 0.1218 0.5727 0.6398 0.1802 -0.0625 0.1582 0.5791 0.5522 0.6236 0.1457 -0.1508 0.1413 0.599 0.5534 1 0.478 0.3744 0.5193 0.7957 0.7416 0.7857 0.3422 0.0348 0.3676 0.6222 0.5237 0.7533 0.129 -0.0633 0.2965 0.6019 0.4407 0.3335 -0.0482 -0.0997 0.133 0.3709 0.2027 0.4238 0.0385 -0.0874 0.131 0.4063 0.3627 0.4451 0.1148 -0.1384 0.2271 0.4557 0.4566 0.2314 -0.0173 -0.1072 0.0708 0.0612 -0.0629 -0.1054 0.0327 0.2232 0.0094 0.0169 0.1028 0.0462 -0.0116 -0.1149 0.0628 0.0132 -0.0353 -0.1113 0.068 0.1627 -0.0552 0.157 0.0006 0.0129 -0.0847 0.015 0.2049 0.0996 -0.0426 0.0552 -0.1448 0.0536 0.0148
SpD12C -0.1614 0.0816 0.1803 0.2473 0.1429 0.1503 0.2198 0.1986 0.2197 0.18 0.082 0.0508 0.0303 0.0386 0.175 0.2162 0.1132 0.1024 0.2011 0.2468 0.1281 0.1216 0.0848 0.0063 0.1491 0.2741 0.3384 0.2148 0.1366 0.2462 0.2711 0.2879 0.3066 0.1401 0.207 0.2233 0.2437 0.2752 0.2653 0.1106 -0.0025 -0.0719 -0.2558 -0.2809 -0.2654 -0.3264 -0.1797 0.0204 -0.0305 -0.4579 -0.1862 -0.2631 -0.2048 -0.1527 -0.2163 0.2146 -0.0846 0.2767 0.2775 0.1189 0.3711 0.5035 0.2971 0.5592 0.5567 0.653 0.4458 0.4973 0.5847 0.6431 0.5599 0.7206 0.5376 0.337 0.5706 0.645 0.5488 0.6119 0.4112 0.5301 0.5822 0.6235 0.5956 0.3068 0.7488 0.6008 0.6322 0.6932 0.5188 0.6026 0.4731 0.1236 0.4777 0.5666 0.4995 0.6364 0.3357 0.1187 0.4932 0.5739 0.478 1 0.7229 0.5655 0.6836 0.8167 0.5234 0.7442 0.4133 0.3954 0.5335 0.6631 0.4723 0.6055 0.418 0.0108 0.4279 0.5731 0.464 0.1897 0.3644 0.0813 0.2298 0.079 0.3883 0.333 0.3673 -0.0113 0.2902 0.2248 0.4591 0.4473 0.1734 0.2634 0.403 0.445 0.4644 0.4068 0.2625 0.1553 0.4411 0.4456 0.4271 0.2846 0.4593 0.4889 0.4888 0.4045 0.4322 0.384 0.2403 0.1168 0.3855 0.3393 0.2028 0.0562 0.4569 0.2876 0.442 0.3065 0.466 0.3562 0.2465 0.2923 0.2264 -0.0086 0.0852 0.051 -0.1287 -0.0427
SpD13C 0.0487 0.0632 -0.0408 -0.076 -0.2023 0.0976 0.3449 0.2474 0.4298 0.3221 0.0197 0.0612 0.2451 0.0604 0.1545 0.2205 0.0915 0.1459 0.086 0.0492 0.3959 0.0727 -0.0112 0.0199 -0.1204 0.0852 0.3953 0.4033 0.1568 0.07 0.1913 0.1295 0.3952 0.178 0.1393 0.0493 0.0853 -0.1186 0.1363 0.3183 0.0525 0.1565 -0.2761 -0.0489 -0.1487 -0.1589 0.1072 -0.0354 -0.1192 -0.6343 -0.038 -0.1894 0.0321 0.0301 -0.2045 0.1044 0.2286 0.4495 -0.1563 0.2876 0.0332 0.2536 0.0552 0.2025 0.2618 0.5786 0.4689 0.0684 0.4988 0.6712 0.2585 0.3766 0.5467 -0.2579 0.3302 0.3524 0.2904 0.6012 0.4475 0.3008 0.4933 0.6575 0.4235 0.1446 0.6615 0.6793 0.7654 0.5876 0.1604 0.4067 0.4466 -0.1146 0.45 0.4446 0.1284 0.4627 0.4742 -0.2059 0.4575 0.5861 0.3744 0.7229 1 0.1044 0.7103 0.6861 0.0679 0.2765 0.5647 -0.1961 0.3474 0.3647 -0.0632 0.2959 0.3337 -0.3039 0.1815 0.1945 0.1993 0.3921 0.3288 0.1276 0.4271 0.1121 0.1322 0.3882 0.2975 0.0337 0.3211 0.2463 0.2206 0.3271 0.389 -0.0395 0.4077 0.5252 0.3658 0.5736 0.4859 0.331 0.2608 0.557 0.5011 0.3715 0.1997 0.4368 0.2882 0.3049 0.3334 0.5683 0.4783 0.318 0.3333 0.5536 0.4637 0.2881 0.1625 0.2569 0.4866 0.2849 0.2943 0.6037 0.4999 0.4188 0.1653 0.03 0.1044 0.0112 0.0552 0.1474
SpD11G 0.0113 0.0925 0.17 0.1179 0.1502 0.3456 0.252 0.23 0.108 0.2782 -0.1496 -0.1354 0.0291 -0.1285 0.0532 -0.1507 -0.048 0.0592 -0.0956 0.0749 -0.0884 0.2168 0.0222 0.1536 0.0293 -0.0273 0.2932 0.2767 0.3106 0.2543 0.5141 0.148 0.3329 0.2957 0.5342 0.2714 0.1451 0.0615 -0.0433 0.2469 0.138 -0.0768 0.448 -0.005 -0.1858 -0.1714 0.0598 0.1672 0.4255 -0.0554 0.1286 -0.0705 -0.1861 -0.1716 0.231 0.0974 -0.2321 0.0687 0.3603 0.2432 -0.0047 0.4565 0.704 0.4807 0.2342 0.2251 -0.0138 0.8378 0.3754 0.4928 0.3758 0.2057 0.1699 0.7158 0.5014 0.5442 0.1892 0.2155 -0.0264 0.8132 0.3575 0.4715 0.3934 0.8971 0.2587 0.3978 0.0264 0.6637 0.2147 0.2094 -0.2554 0.7505 0.3791 0.5203 0.2931 0.2595 -0.2446 0.7662 0.4149 0.5077 0.5193 0.5655 0.1044 1 0.5528 0.6166 0.3512 0.4399 0.024 0.8472 0.5369 0.5419 0.3343 0.2077 0.0301 0.752 0.4905 0.4668 0.0877 -0.0662 -0.0351 0.4206 -0.0901 0.2768 0.1156 0.0349 -0.287 0.4221 0.1597 0.2498 0.1776 0.1927 -0.2323 0.6323 0.2124 0.3642 0.3795 0.13 0.0227 -0.0253 0.3601 0.2163 0.1985 0.0113 0.5435 0.3694 0.3004 0.1468 0.2347 0.1163 0.0345 -0.0312 0.2231 0.0881 0.0342 -0.0664 0.2015 0.0211 0.2584 0.1344 0.3536 0.1798 0.1347 0.0782 0.0594 -0.0526 0.012 0.0731 -0.0824 -0.0981
SpD12G 0.0275 0.0145 -0.0201 0.0976 0.0121 0.0748 0.2631 0.2732 0.2296 0.1567 0.0827 0.1897 0.1537 0.1212 0.2225 0.1765 0.2195 0.183 0.341 0.1109 0.0364 0.0357 -0.0536 0.0017 -0.1541 0.2925 0.4303 0.2627 0.3829 0.2958 0.4534 0.3304 0.4459 0.3362 0.4155 0.2349 0.301 0.2891 0.3198 0.3805 -0.1015 -0.2715 -0.2168 -0.1074 -0.3483 -0.4568 -0.1617 -0.1987 -0.0077 -0.0588 -0.2772 -0.2527 -0.1407 0.0108 -0.1588 0.0671 0.0264 0.0998 0.2095 -0.0098 0.2773 0.494 0.4646 0.3152 0.6958 0.3763 0.2823 0.4112 0.7604 0.6568 0.7525 0.4751 0.5444 0.3374 0.8083 0.6813 0.6643 0.3612 0.2874 0.4487 0.7415 0.6431 0.7605 0.2458 0.4004 0.8398 0.4669 0.683 0.6966 0.2894 0.1988 0.1513 0.675 0.5665 0.6701 0.3479 0.2289 0.1123 0.7217 0.6227 0.7957 0.6836 0.7103 0.5528 1 0.8164 0.719 0.4984 0.495 0.4011 0.8286 0.7149 0.7339 0.3459 0.3076 0.2898 0.6907 0.5365 0.5025 -0.0157 0.1555 -0.0312 0.1624 0.0288 0.544 0.087 0.0637 0.0395 0.3444 0.2185 0.516 0.2403 0.1509 0.1318 0.538 0.4831 0.5242 0.4117 0.2181 0.2429 0.4617 0.4421 0.3475 0.3021 0.5105 0.4866 0.4438 0.3856 0.4922 0.3729 0.1854 0.2103 0.4494 0.3364 0.1503 0.1645 0.4955 0.2268 0.416 0.2979 0.4429 0.4021 0.3835 0.3318 0.0593 -0.0533 -0.1418 -0.0069 0.0638 -0.1337
SpD13G -0.0523 0.0665 0.0723 -0.0194 -0.1254 0.0175 0.1342 0.1689 0.0938 0.1177 0.104 0.1249 0.0246 -0.002 0.2237 0.197 0.2081 0.0809 0.2213 0.279 0.0333 0.1627 0.0551 0.0069 0.0558 0.2804 0.337 0.1709 0.1592 0.2624 0.0678 0.2083 0.2863 0.124 0.1022 0.2335 0.1481 0.0717 0.1648 0.0809 0.0319 -0.2011 -0.4489 -0.1074 -0.3637 -0.2742 0.0444 -0.0559 -0.2055 -0.3599 -0.3536 -0.1926 -0.2014 -0.0962 -0.2298 0.051 -0.0987 0.0621 0.3687 -0.003 0.2874 0.2886 0.2611 0.3161 0.6212 0.3872 -0.0025 0.5188 0.6589 0.6611 0.6693 0.5551 0.1134 0.5329 0.6479 0.7107 0.566 0.3727 0.0121 0.5418 0.6883 0.6473 0.7801 0.3299 0.4509 0.7065 0.5077 0.7511 0.588 0.2998 0.1832 0.1216 0.6118 0.6037 0.5751 0.3688 0.1933 0.1781 0.6042 0.6097 0.7416 0.8167 0.6861 0.6166 0.8164 1 0.5765 0.5848 0.0927 0.5015 0.6205 0.7053 0.5854 0.4828 0.0143 0.2134 0.4755 0.587 0.5728 -0.0767 0.2868 0.1093 0.1413 0.019 0.4421 0.0761 0.161 -0.0696 0.3875 0.2813 0.4599 0.2369 0.1696 0.2843 0.5068 0.4636 0.2748 0.301 0.2116 0.2675 0.2303 0.3785 0.3813 0.3277 0.316 0.4354 0.484 0.4011 0.1875 0.2937 0.1796 0.2393 0.1468 0.2591 0.135 0.1987 0.2864 0.2612 0.315 0.3022 0.2685 0.3052 0.282 0.2558 0.0815 -0.0864 -0.0857 0.0672 0.0194 -0.0108
ScD11C 0.1871 0.0296 -0.0057 0.0951 0.1553 0.0412 0.0775 0.0446 0.0882 0.0553 0.0938 -0.0529 0.0521 -0.1047 0.2257 -0.1379 -0.0474 -0.0283 0.1983 0.0186 -0.3975 0.0254 -0.2907 0.1606 -0.2947 0.3708 0.3344 0.1983 0.291 0.2954 0.1843 0.2097 0.3269 0.2921 0.2535 0.2198 0.1899 0.298 0.381 -0.0074 -0.0999 -0.198 0.3011 0.0094 -0.0114 -0.3503 -0.2314 -0.063 0.1595 -0.093 0.0666 -0.1155 -0.1121 0.0036 0.0742 -0.1969 -0.369 0.0206 0.287 -0.121 0.3638 0.4972 0.4668 0.4299 0.6831 0.3 0.0717 0.0205 0.6282 0.5684 0.8373 0.5094 0.4322 0.2518 0.7549 0.7369 0.6329 0.3035 0.0419 -0.0323 0.6021 0.5345 0.6028 0.01 0.2276 0.5906 -0.1646 0.443 0.6258 0.2872 0.1394 0.0287 0.6277 0.5758 0.6404 0.2852 0.1149 -0.0383 0.6353 0.5843 0.7857 0.5234 0.0679 0.3512 0.719 0.5765 1 0.6577 0.5489 0.4095 0.7912 0.7395 0.9205 0.4506 0.485 0.3444 0.78 0.612 0.2283 -0.0936 -0.295 -0.1566 0.2411 0.154 0.3095 -0.0017 -0.0297 0 0.3635 0.2305 0.3928 0.1299 -0.0668 0.059 0.401 0.4045 0.3963 0.0377 -0.068 0.1134 0.1308 0.0438 -0.0437 0.1507 0.2448 0.2214 0.1432 0.2671 0.1708 0.0084 -0.0786 0.0917 0.1108 -0.0289 -0.0994 0.0737 0.3369 0.0893 0.2592 0.1122 0.1936 0.0097 0.0599 0.3426 0.1397 0.0568 0.0439 -0.0886 0.0443 0.058
ScD12C -0.0588 0.0088 0.0993 0.1841 0.1587 0.1348 0.186 0.1341 0.1083 0.0812 0.279 0.0744 0.0887 0.0353 0.2154 0.1767 0.116 0.1939 0.2234 0.2328 -0.1156 0.0758 0.0109 -0.041 0.0473 0.3656 0.4761 0.3009 0.187 0.303 0.3144 0.3075 0.4609 0.1801 0.2815 0.2289 0.2723 0.2616 0.3683 0.1464 -0.1841 -0.1323 0.052 -0.2317 -0.2664 -0.391 -0.27 -0.0569 0.0666 -0.3627 -0.2059 -0.2591 -0.1007 -0.1198 -0.1346 0.1696 -0.15 0.0992 0.2479 0.0611 0.3536 0.538 0.5708 0.5296 0.518 0.6132 0.4456 0.2788 0.5273 0.6546 0.5869 0.8241 0.6779 0.5066 0.6446 0.726 0.4831 0.5784 0.4081 0.2517 0.5264 0.6275 0.3605 0.0477 0.5376 0.3321 0.2975 0.5717 0.4339 0.6012 0.4992 0.0819 0.4383 0.655 0.4131 0.6315 0.4438 0.0109 0.4585 0.6382 0.3422 0.7442 0.2765 0.4399 0.4984 0.5848 0.6577 1 0.5322 0.4694 0.6412 0.757 0.6072 0.6337 0.6086 0.3034 0.5778 0.7188 0.1946 0.1134 0.1969 -0.2191 -0.0272 0.1789 0.2024 0.1902 0.3784 -0.0479 0.1735 0.2681 0.2654 0.4281 0.2166 0.0618 0.2738 0.4582 0.3574 0.2395 0.2475 0.2112 0.2584 0.2862 0.3523 0.3364 0.3211 0.4335 0.436 0.46 0.2568 0.2077 0.2272 0.1719 0.205 0.1614 0.1839 0.1216 0.3839 0.2615 0.3646 0.2891 0.2609 0.1817 0.2791 0.3086 0.2786 0.1153 0.1271 0.0996 -0.0752 0.0839
ScD13C -0.0588 -0.1202 -0.0623 -0.4215 -0.3489 0.1735 0.3663 0.1445 0.2722 0.2527 0.0832 0.095 0.5098 0.0671 0.1418 0.2546 0.0707 0.4834 0.0189 0.0397 0.3276 -0.0423 -0.1935 -0.1515 -0.161 0.5041 -0.0473 0.5682 -0.0542 0.0269 -0.2615 0.0979 0.0042 -0.0292 -0.1938 -0.0603 0.0961 -0.2321 0.1391 0.207 0.1621 0.3109 0.0028 -0.0793 0.0206 -0.1578 0.0013 -0.0667 0.0984 0.2252 0.2288 -0.0007 -0.0325 0.0841 -0.1908 -0.2119 0.1352 -0.0651 -0.2111 0.1203 0.2047 0.3629 0.1862 0.3335 0.1552 0.3256 0.6151 0.1189 0.309 0.5053 0.672 0.7011 0.7822 0.2452 0.6723 0.573 0.1506 0.221 0.5823 0.2534 0.2137 0.4662 0.0147 -0.2233 0.2863 0.2934 0.5142 0.2332 0.1032 0.2955 0.6052 0.0981 0.2699 0.5519 0.2435 0.3528 0.6346 -0.0553 0.3699 0.5625 0.0348 0.4133 0.5647 0.024 0.495 0.0927 0.5489 0.5322 1 0.0993 0.7128 0.5921 0.5457 0.7103 0.8074 0.1429 0.639 0.6205 0.0226 0.0479 0.2875 -0.3626 -0.0246 0.2382 -0.0253 0.0372 0.3222 0.0232 -0.0773 0.2275 0.2477 -0.0849 0.3982 -0.1445 0.0517 0.2522 0.3244 0.478 0.1832 0.2641 0.1219 0.4231 0.1907 0.3294 -0.009 0.3832 0.1735 0.3343 0.2825 0.4597 0.1833 0.2783 0.2472 0.4186 0.1796 0.2318 0.317 0.0884 0.5822 0.3245 0.188 0.4919 0.3211 0.4239 0.1331 0.0491 0.092 -0.1284 -0.0101 0.2016
ScD11G 0.0237 -0.0825 0.1091 0.1473 0.0862 0.2604 0.1252 0.1298 -0.0376 0.0881 -0.2407 -0.1832 0.066 -0.0075 0.1317 -0.1809 -0.0868 0.0879 0.0514 0.1314 -0.0335 0.2441 0.0293 0.116 -0.0272 0.1677 0.1988 0.245 0.1726 0.2474 0.3791 0.1466 0.2232 0.1884 0.4518 0.22 0.1419 0.0116 -0.0887 0.2147 0.1686 -0.05 0.3817 -0.0577 -0.1898 -0.1238 0.1251 0.09 0.3876 -0.0294 0.1699 -0.0551 -0.1186 -0.1654 0.0449 -0.0248 -0.4044 -0.1284 0.2989 0.29 0.1311 0.4321 0.499 0.5445 0.2582 0.185 -0.1016 0.7697 0.3022 0.4673 0.4188 0.3466 0.0018 0.7968 0.4674 0.6399 0.2259 0.1781 -0.1059 0.7407 0.2872 0.4346 0.2544 0.7678 0.0997 0.2396 -0.1514 0.5414 0.1842 0.1315 -0.1143 0.7777 0.3481 0.5389 0.3132 0.2007 -0.017 0.7672 0.3564 0.5331 0.3676 0.3954 -0.1961 0.8472 0.4011 0.5015 0.4095 0.4694 0.0993 1 0.5119 0.636 0.4418 0.4375 0.1532 0.8057 0.5227 0.5981 0.0675 -0.1351 -0.0742 0.3724 -0.1495 0.2274 0.0431 -0.0807 -0.1462 0.3362 0.1338 0.2084 0.139 0.0407 -0.0902 0.6089 0.1162 0.3159 0.3225 0.0527 0.0261 0.0314 0.3184 0.1178 0.1659 0.0665 0.4579 0.2701 0.2773 0.1658 0.1977 0.032 0.0357 0.0248 0.1892 0.0135 0.0553 0.0035 0.1637 -0.0299 0.1442 0.1041 0.3808 0.1635 0.0927 0.0266 0.1403 0.1626 0.0988 0.1483 -0.1424 0.0002
ScD12G 0.0934 -0.0614 -0.051 0.0365 -0.0447 0.1343 0.2482 0.2348 0.2305 0.2044 0.1498 0.1984 0.2288 0.1688 0.2945 0.1907 0.1962 0.2212 0.3709 0.147 0.0033 -0.0338 -0.169 -0.0716 -0.2205 0.3653 0.284 0.2726 0.2879 0.2277 0.2196 0.2475 0.3101 0.2518 0.1954 0.1414 0.2265 0.253 0.3081 0.3164 -0.1907 -0.2553 -0.0049 -0.1436 -0.3053 -0.3777 -0.2053 -0.1665 0.1553 -0.0361 -0.1576 -0.1378 -0.0881 -0.0021 -0.1343 -0.1066 -0.2307 -0.1095 0.2036 0.0932 0.2467 0.5579 0.4318 0.3057 0.6907 0.3715 0.371 0.4773 0.7365 0.6623 0.8274 0.5999 0.6657 0.5121 0.9399 0.8122 0.6397 0.3487 0.3843 0.5103 0.7228 0.6347 0.5571 0.2431 0.2663 0.6518 0.2428 0.5553 0.5912 0.3075 0.3502 0.3102 0.6988 0.6214 0.6203 0.3716 0.395 0.2287 0.7669 0.6837 0.6222 0.5335 0.3474 0.5369 0.8286 0.6205 0.7912 0.6412 0.7128 0.5119 1 0.8362 0.7997 0.5469 0.5909 0.517 0.9405 0.7433 0.345 -0.0894 0.1249 -0.0519 0.0546 0.0769 0.3799 0.0093 0.1755 0.1708 0.2593 0.203 0.4217 0.1514 0.2128 0.1555 0.4451 0.4457 0.5211 0.366 0.2467 0.2949 0.42 0.3837 0.3107 0.3241 0.4175 0.4506 0.3747 0.3753 0.4834 0.3327 0.2186 0.2741 0.4494 0.3013 0.1981 0.2407 0.4468 0.1892 0.3641 0.2721 0.4367 0.3505 0.3885 0.3263 0.0565 0.0023 -0.1154 0.0338 -0.0243 -0.0139
ScD13G 0.0146 -0.0683 -0.0421 0.0658 -0.123 0.0429 0.1072 0.0715 0.1084 0.1531 0.1963 0.1606 0.1207 0.1361 0.3514 0.1644 0.1846 0.0907 0.3396 0.3214 -0.158 0.0236 -0.0745 -0.1282 -0.0887 0.4338 0.0328 -0.0087 -0.0224 0.1172 -0.2865 0.0631 0.0373 -0.052 -0.3499 0.0097 0.0015 0.0957 0.2136 0.0616 0.0469 -0.1282 0.0329 -0.1597 -0.2928 -0.2006 0.0067 -0.1316 0.0543 -0.3666 -0.2336 -0.0941 -0.2526 -0.2305 -0.0791 -0.0947 -0.0979 -0.0872 0.2631 -0.0469 0.3504 0.4478 0.2552 0.3122 0.7081 0.3586 0.1925 0.5515 0.6639 0.7262 0.808 0.6883 0.4994 0.6448 0.8055 0.936 0.6476 0.3031 0.2042 0.5313 0.6265 0.689 0.5722 0.3002 0.3037 0.5302 0.1154 0.6175 0.5497 0.2934 0.1841 0.2845 0.6574 0.697 0.5857 0.3769 0.3052 0.2583 0.6892 0.7408 0.5237 0.6631 0.3647 0.5419 0.7149 0.7053 0.7395 0.757 0.5921 0.636 0.8362 1 0.7367 0.7465 0.5877 0.4366 0.76 0.8794 0.439 -0.1429 -0.0678 0.0739 -0.0445 0.1463 0.3146 -0.0452 0.0272 -0.0022 0.2981 0.1838 0.4152 0.1214 0.0928 0.2174 0.438 0.4766 0.2924 0.2442 0.1561 0.2264 0.1785 0.3041 0.2637 0.2924 0.2466 0.4289 0.3333 0.378 0.183 0.2143 0.1514 0.2195 0.1496 0.1842 0.1107 0.1903 0.2498 0.2497 0.2596 0.2386 0.2486 0.2271 0.2098 0.2014 0.0703 0.0308 -0.16 -0.0013 0.0135 0.0045
SsD11C 0.239 -0.1042 -0.1308 -0.1895 0.0982 0.0522 0.0962 0.0516 0.08 -0.0248 0.0844 -0.0245 0.0431 0.0195 0.2003 -0.1214 -0.0352 0.0857 0.296 0.0479 -0.3886 -0.0133 -0.25 0.1535 -0.208 0.4073 0.2947 0.1579 0.239 0.2306 0.218 0.219 0.2849 0.2446 0.2271 0.0942 0.1999 0.3195 0.37 -0.0196 -0.0949 -0.1722 0.4409 0.0576 -0.0639 -0.3257 -0.1751 -0.1131 0.3124 0.0131 0.0192 -0.0422 -0.0589 -0.0604 0.1782 -0.2111 -0.2253 -0.051 0.2509 -0.1315 0.322 0.5275 0.5053 0.4554 0.6673 0.2956 0.1118 0.0852 0.647 0.5279 0.8579 0.5632 0.4545 0.3361 0.7787 0.7069 0.6127 0.313 0.0848 0.0601 0.6195 0.4943 0.5952 0.0145 0.1829 0.6226 -0.2205 0.4623 0.6292 0.2547 0.155 0.0428 0.6476 0.5862 0.6546 0.2561 0.1845 0.008 0.6664 0.6123 0.7533 0.4723 -0.0632 0.3343 0.7339 0.5854 0.9205 0.6072 0.5457 0.4418 0.7997 0.7367 1 0.511 0.6317 0.4176 0.8268 0.7029 0.2562 -0.1213 -0.2775 -0.0222 0.2815 0.1764 0.3479 -0.0174 -0.005 0.0131 0.3779 0.247 0.3777 0.0808 -0.0371 0.1181 0.4059 0.3914 0.3624 -0.0812 -0.0356 0.141 0.0409 -0.0743 -0.0106 0.2192 0.1761 0.1067 0.1611 0.3267 0.0812 -0.106 -0.035 0.1257 0.0495 -0.1386 -0.0497 0.1013 0.1741 0.0691 0.1783 0.1703 0.0993 -0.0632 0.1073 0.3261 0.1984 0.1096 0.0849 -0.0245 0.0857 0.0626
SsD12C -0.2342 -0.1919 -0.085 0.0974 0.1146 0.1725 0.2701 0.2259 0.2608 0.0658 0.2096 0.1291 0.1794 0.2184 0.2715 0.2232 0.1617 0.273 0.3041 0.3473 -0.0121 0.0419 -0.0184 -0.1155 0.1247 0.5069 -0.1245 -0.2664 -0.3191 -0.1665 -0.2928 -0.0422 -0.0821 -0.3224 -0.3975 -0.2536 -0.1103 0.2219 0.2194 0.1378 0.0059 0.171 -0.0289 -0.1091 -0.0476 -0.1099 0.0165 0.0623 0.1389 -0.1974 0.0145 -0.0449 -0.2539 -0.5363 -0.3178 -0.0864 -0.273 -0.0049 -0.0212 -0.0961 0.3305 0.2469 0.1966 0.3278 0.3831 0.4787 0.1865 0.2511 0.2683 0.5189 0.5917 0.8526 0.6506 0.6022 0.5934 0.7648 0.3665 0.4358 0.1505 0.3289 0.2587 0.4824 0.2937 0.1343 0.5087 0.2778 0.2628 0.4576 0.3235 0.4652 0.3666 0.0868 0.2389 0.5271 0.4128 0.5416 0.2489 0.1245 0.3215 0.5939 0.129 0.6055 0.2959 0.2077 0.3459 0.4828 0.4506 0.6337 0.7103 0.4375 0.5469 0.7465 0.511 1 0.7688 0.2725 0.5841 0.8263 0.3767 0.199 0.157 0.2074 0.0681 0.1279 0.2003 0.2261 0.1658 -0.062 -0.0262 0.1096 0.375 0.1363 -0.0293 0.199 0.0915 0.3542 0.4155 0.437 0.3153 0.2712 0.3309 0.4587 0.3531 0.341 0.2847 0.4792 0.3121 0.3585 0.3838 0.4289 0.311 0.2504 0.3625 0.3916 0.2851 0.1931 0.3122 0.2841 0.4217 0.3547 0.3668 0.3795 0.3291 0.2478 0.2209 0.0542 0.0885 0.1415 -0.171 0.1399
SsD13C -0.2924 -0.2434 0.0038 -0.178 -0.1983 0.1745 0.3518 0.124 0.2576 0.2654 0.2213 0.098 0.358 0.1841 0.1546 0.3316 0.0922 0.5037 0.1386 0.1422 0.1601 -0.0074 -0.0211 -0.2143 0.0199 0.5286 -0.1089 0.3594 -0.0843 -0.1187 -0.2645 -0.1372 -0.0419 -0.0697 -0.2774 -0.2205 -0.1723 -0.3378 0.0629 0.2083 0.2092 0.2738 0.1209 0.0096 0.0935 -0.0574 0.0931 0.0244 0.2603 0.2903 0.3326 0.2339 -0.337 -0.1094 -0.3385 -0.3764 -0.0861 -0.0797 -0.2534 0.1636 0.2666 0.2269 0.3326 0.3587 0.1239 0.2754 0.4421 0.0375 0.1082 0.3336 0.7165 0.7919 0.7324 0.4224 0.622 0.6283 0.1282 0.1318 0.4062 0.1361 -0.0033 0.2843 0.0373 -0.17 0.3031 0.0855 0.3245 0.1543 0.1501 0.3497 0.5028 0.0213 0.108 0.423 0.2448 0.3767 0.4124 0.0345 0.1558 0.4584 -0.0633 0.418 0.3337 0.0301 0.3076 0.0143 0.485 0.6086 0.8074 0.1532 0.5909 0.5877 0.6317 0.7688 1 0.4172 0.6721 0.7562 0.0218 0.0673 0.2021 -0.2866 -0.1886 0.2084 0.0042 0.0466 0.2854 -0.095 -0.1946 0.0993 0.2063 -0.112 0.0744 -0.2118 -0.2056 0.0602 0.2216 0.4102 0.1165 0.1521 0.0494 0.348 0.1057 0.1593 -0.1154 0.2628 0.0344 0.0732 0.2287 0.4233 0.1681 0.2005 0.2066 0.3902 0.1683 0.1468 0.2238 0.0617 0.5058 0.3086 0.0896 0.3236 0.176 0.2 0.1148 0.0198 0.025 0.0141 0.138 0.2075
SsD11G -0.0655 -0.0234 0.091 0.0115 0.059 0.2656 0.1764 0.0317 -0.0116 0.2292 -0.0661 -0.1342 0.1267 -0.013 0.2007 -0.119 -0.1117 0.1009 0.0298 0.1652 -0.0584 0.0951 -0.067 0.0633 -0.0657 0.1846 0.1256 0.2217 0.1086 0.1849 0.2402 0.1037 0.1551 0.1149 0.2625 0.1453 0.0951 0.0627 -0.065 0.1623 0.0548 -0.1269 0.3818 0.041 -0.0911 -0.0989 0.0622 0.1802 0.4789 0.1232 0.3017 0.1205 -0.1377 -0.1507 0.1041 -0.0217 -0.2417 -0.1056 0.1864 0.238 0.0789 0.3453 0.6397 0.4075 0.0647 -0.0767 -0.1102 0.6733 0.1686 0.2414 0.4238 0.2339 0.0277 0.7274 0.4837 0.477 0.0032 -0.1205 -0.1167 0.6301 0.1422 0.2098 0.1017 0.7003 -0.1757 0.0898 -0.1043 0.3495 0.0102 -0.1266 -0.1283 0.717 0.2229 0.3091 0.1221 -0.0965 -0.0904 0.7178 0.2175 0.3339 0.2965 0.0108 -0.3039 0.752 0.2898 0.2134 0.3444 0.3034 0.1429 0.8057 0.517 0.4366 0.4176 0.2725 0.4172 1 0.6105 0.5336 -0.1317 -0.2607 0.0606 0.3691 -0.2505 0.2691 -0.1295 -0.3534 -0.1664 0.4064 -0.0441 0.0681 -0.0891 -0.262 -0.2653 0.456 -0.1194 0.0999 0.2775 0.0469 -0.1054 0.0137 0.2809 0.1011 -0.0711 -0.0165 0.3669 0.2315 0.0133 0.0426 0.2106 0.0372 -0.0782 0.0193 0.217 0.0175 -0.0919 -0.0136 0.0984 0.0846 0.1561 0.151 0.3411 0.1689 0.0061 0.0428 0.0469 -0.045 0.0762 0.1146 -0.0747 0.0262
SsD12G 0.0872 -0.1116 -0.05 0.0213 -0.0336 0.1361 0.221 0.189 0.2185 0.2283 0.128 0.1645 0.2147 0.1954 0.2569 0.1508 0.156 0.1798 0.3522 0.1143 -0.0383 -0.0421 -0.2125 -0.1234 -0.2124 0.3338 0.1857 0.2033 0.1911 0.1315 0.1315 0.2012 0.2268 0.1589 0.0895 0.0318 0.1875 0.243 0.2887 0.2703 -0.1622 -0.2182 0.0971 -0.0602 -0.2257 -0.2842 -0.1181 -0.1449 0.301 0.0245 -0.0272 -0.0287 -0.1262 -0.0661 -0.1285 -0.1736 -0.2191 -0.1348 0.1404 0.1308 0.2917 0.5815 0.4282 0.3552 0.6265 0.3337 0.31 0.4548 0.644 0.5735 0.8242 0.5788 0.5926 0.5177 0.9147 0.7581 0.5684 0.3126 0.3219 0.4902 0.6396 0.5423 0.5074 0.239 0.2177 0.5569 0.1646 0.4965 0.5384 0.2819 0.3034 0.3231 0.6327 0.5444 0.5748 0.3296 0.3248 0.2608 0.7038 0.6267 0.6019 0.4279 0.1815 0.4905 0.6907 0.4755 0.78 0.5778 0.639 0.5227 0.9405 0.76 0.8268 0.5841 0.6721 0.6105 1 0.7605 0.2913 -0.0586 0.146 0.0458 0.0701 0.1655 0.3201 0.0072 0.1615 0.2115 0.2107 0.1599 0.3527 0.082 0.0943 0.1874 0.3247 0.365 0.53 0.3031 0.2228 0.3202 0.3952 0.2987 0.2246 0.2902 0.3654 0.3451 0.2402 0.2765 0.4805 0.2857 0.224 0.3218 0.4535 0.2594 0.209 0.3012 0.4104 0.1658 0.3087 0.2379 0.4257 0.3027 0.3256 0.2882 0.0612 0.0091 -0.0994 0.0591 -0.0477 0.0402
SsD13G -0.0167 -0.1186 0.0108 -0.0765 -0.1379 0.072 0.0757 -0.0024 -0.0119 0.126 0.1032 0.0911 0.0429 0.1582 0.2622 0.0811 0.1288 0.0297 0.2749 0.2988 -0.1169 0.0696 -0.0582 -0.1188 0.0159 0.5239 -0.0985 -0.0184 -0.0825 0.0552 -0.2922 -0.0091 -0.0562 -0.1005 -0.377 -0.0863 -0.0748 0.0517 0.1924 -0.0377 0.1069 -0.1195 0.0934 -0.18 -0.2611 -0.167 0.112 -0.1626 0.2877 -0.3388 -0.1531 -0.0337 -0.2407 -0.2244 -0.1052 -0.0894 -0.0916 -0.1161 0.1269 0.0256 0.3291 0.3915 0.43 0.3306 0.5002 0.3183 0.2187 0.5246 0.5521 0.6374 0.7702 0.7307 0.5337 0.8248 0.7396 0.9059 0.4135 0.2495 0.2503 0.4659 0.5109 0.6003 0.4601 0.2652 0.2313 0.3864 0.1142 0.5268 0.4092 0.2767 0.2674 0.3094 0.5203 0.6559 0.4408 0.3374 0.2944 0.2806 0.5565 0.6548 0.4407 0.5731 0.1945 0.4668 0.5365 0.587 0.612 0.7188 0.6205 0.5981 0.7433 0.8794 0.7029 0.8263 0.7562 0.5336 0.7605 1 0.3348 -0.1547 0.1097 0.1014 -0.0598 0.1435 0.204 -0.0589 0.1668 0.0676 0.1725 0.2222 0.2562 0.0344 0.0188 0.2083 0.255 0.3042 0.2096 0.175 0.1648 0.1923 0.0393 0.1644 0.2069 0.1862 0.0999 0.2412 0.2406 0.2197 0.0722 0.1617 0.1695 0.1963 0.0484 0.1338 0.1528 0.1747 0.1496 0.1783 0.2275 0.1913 0.1287 0.1491 0.2359 0.1278 0.0421 -0.011 -0.1945 0.0551 0.0135 0.0997
FlpD11C -0.2782 -0.2209 0.0249 -0.0262 0.1773 0.0583 0.3218 0.2066 0.4649 0.0942 0.2171 0.3051 0.3123 0.2034 0.1212 0.2955 0.3021 0.3411 0.2879 0.0669 0.0369 -0.0319 -0.2084 -0.1193 -0.0575 -0.0479 -0.0571 -0.4776 -0.2419 -0.1536 -0.029 -0.2752 -0.201 -0.2898 -0.1144 -0.223 -0.3004 0.5357 0.3927 0.1481 0.0202 -0.0743 -0.4647 -0.1463 -0.1117 -0.1676 0.0946 -0.1241 -0.1276 -0.1564 -0.1621 0.1844 -0.3355 -0.5274 -0.1158 -0.0144 -0.1433 0.0226 0.2065 -0.3407 0.255 0.2266 0.2282 0.1667 0.7403 0.5328 0.5062 0.094 0.5756 0.6817 0.228 0.2935 0.1173 -0.0886 0.3816 0.4047 0.761 0.5157 0.5183 0.1226 0.5811 0.6846 0.8371 0.1416 0.6199 0.6702 0.573 0.7122 0.7923 0.5434 0.5021 -0.007 0.5938 0.6932 0.7894 0.5464 0.4369 0.0495 0.569 0.6613 0.3335 0.464 0.1993 0.0877 0.5025 0.5728 0.2283 0.1946 0.0226 0.0675 0.345 0.439 0.2562 0.3767 0.0218 -0.1317 0.2913 0.3348 1 0.5767 0.7006 0.4652 0.6841 0.5937 0.8625 0.5864 0.5937 0.0823 0.6094 0.6224 0.866 0.4819 0.4645 0.247 0.5958 0.6471 0.2259 0.3604 0.1556 0.399 0.2739 0.4341 0.2899 0.4479 0.2063 0.4228 0.3751 0.4706 0.2525 0.3525 0.165 0.3907 0.3433 0.3767 0.204 0.427 -0.2676 -0.1611 -0.0142 -0.0155 0.1899 0.4386 0.116 0.4422 0.3618 0.1995 0.0418 0.1768 0.1735 0.1241
FlpD12C -0.1289 -0.049 0.0036 -0.0091 0.0783 0.0809 0.1292 0.0946 0.3079 0.1204 0.2061 0.226 0.2134 0.2639 0.0616 0.1673 0.2709 0.2834 0.2766 0.099 0.0059 0.0734 -0.0857 -0.1185 0.0633 -0.1459 -0.1867 -0.555 -0.3696 -0.4636 0.0866 -0.4532 -0.2473 -0.419 -0.1172 -0.5095 -0.4627 0.2178 0.309 0.1352 0.0181 -0.0133 -0.4974 0.0428 -0.0306 -0.0449 0.1785 -0.134 -0.3014 -0.0364 -0.018 0.2215 -0.3887 -0.2725 -0.2848 -0.0587 -0.0518 -0.116 -0.0296 -0.3009 0.0968 -0.0358 0.0933 -0.0585 0.2713 0.6923 0.5421 -0.103 0.0945 0.1714 -0.0595 0.1813 0.2723 -0.228 -0.0476 -0.1027 0.2955 0.6944 0.4904 0.0576 0.1037 0.1714 0.3687 0.0247 0.7928 0.2362 0.6456 0.2567 0.3934 0.7733 0.516 -0.0679 0.1308 0.1432 0.3856 0.7407 0.4205 0.0181 0.1158 0.1751 -0.0482 0.1897 0.3921 -0.0662 -0.0157 -0.0767 -0.0936 0.1134 0.0479 -0.1351 -0.0894 -0.1429 -0.1213 0.199 0.0673 -0.2607 -0.0586 -0.1547 0.5767 1 0.594 0.3307 0.4544 0.498 0.5163 0.8879 0.5227 0.0383 0.2235 0.2927 0.533 0.7729 0.3756 0.1868 0.1838 0.2788 0.2568 0.3178 0.2292 0.1503 0.3001 0.2972 0.1807 0.1336 0.1971 0.1685 0.029 0.0495 0.3512 0.3356 0.2274 0.1482 0.3753 0.3561 0.2868 0.1755 0.0863 -0.1105 0.0506 -0.0442 0.1952 0.1629 0.1775 0.0375 0.1148 0.1458 -0.0084 0.0418 0.0001 0.0362
FlpD13C -0.3059 -0.272 0.1025 -0.5008 -0.2317 0.1182 0.354 0.1602 0.2053 0.3894 0.2885 0.3638 0.4268 0.1602 0.0558 0.252 0.3721 0.3706 0.1765 0.1872 0.3538 0.0182 0.0127 -0.0591 0.2443 -0.0859 0.2523 0.0001 0.0574 -0.2363 -0.0252 0.2237 0.046 -0.06 -0.1197 -0.2117 0.1722 0.1574 0.1641 0.0477 -0.0414 -0.0291 -0.2206 -0.6458 -0.2592 -0.4573 0.2673 -0.0002 0.0748 -0.4431 -0.0269 0.1099 -0.1009 0.1496 -0.1302 0.0369 0.0185 0.1158 -0.0623 0.0559 -0.0919 0.3724 0.1457 0.3378 0.3673 0.6194 0.8042 0.382 0.4514 0.4766 -0.1585 0.1343 0.1943 -0.11 0.1807 -0.0122 0.4011 0.5927 0.8146 0.4748 0.4525 0.4915 0.5847 0.2205 0.5939 0.3754 0.8594 0.3564 0.4929 0.5953 0.746 0.3816 0.4538 0.4813 0.4876 0.5884 0.7701 0.5146 0.4207 0.3672 -0.0997 0.3644 0.3288 -0.0351 0.1555 0.2868 -0.295 0.1969 0.2875 -0.0742 0.1249 -0.0678 -0.2775 0.157 0.2021 0.0606 0.146 0.1097 0.7006 0.594 1 0.3639 0.4965 0.2778 0.5521 0.5784 0.7729 0.4578 0.4438 0.5263 0.5684 0.4534 0.7668 0.5171 0.3835 0.3374 0.2313 0.3009 0.2645 0.1756 0.2545 0.3143 0.2619 0.1944 0.1123 0.1921 0.2552 0.1204 0.2774 0.3139 0.1886 0.1641 0.3589 0.3618 0.2818 0.2255 -0.2915 -0.4293 -0.0853 -0.1244 0.3424 0.2272 0.244 0.0795 0.34 0.1673 0.042 0.1857 -0.1776 0.0903
FlpD11G -0.1927 -0.131 -0.0208 0.1331 0.1724 0.506 0.3332 0.2343 0.3037 0.1827 0.0045 0.0321 -0.0699 -0.085 -0.0613 0.0532 0.1209 -0.0423 0.035 -0.0516 0.1586 0.1139 0.1656 0.2632 0.0298 -0.1125 -0.0288 -0.0877 -0.1867 -0.2016 -0.2051 -0.1495 -0.0649 -0.2437 -0.1685 -0.2409 -0.1412 0.1371 -0.1087 0.0337 0.4118 0.1421 -0.0039 0.1509 0.1474 0.2951 0.5311 0.3553 0.2667 0.1597 0.4575 0.3389 -0.222 -0.3543 -0.1422 0.0412 0.3467 -0.0302 -0.0623 0.3418 0.0318 0.2852 0.2755 0.2382 0.192 0.1949 0.0257 0.6407 0.019 0.163 -0.083 -0.1035 -0.1073 0.3257 0.0089 0.0927 0.1864 0.3299 0.0344 0.6411 0.0167 0.1648 0.3839 0.7782 0.2813 0.2298 0.3329 0.4501 0.2974 0.1508 -0.1786 0.6628 0.0492 0.2137 0.3197 0.1309 -0.1707 0.7229 0.092 0.3066 0.133 0.0813 0.1276 0.4206 -0.0312 0.1093 -0.1566 -0.2191 -0.3626 0.3724 -0.0519 0.0739 -0.0222 0.2074 -0.2866 0.3691 0.0458 0.1014 0.4652 0.3307 0.3639 1 0.4367 0.5299 0.415 0.2978 -0.0839 0.6843 0.1042 0.2184 0.3688 0.0875 -0.0308 0.7537 0.0882 0.3311 0.217 -0.1503 -0.05 -0.15 0.1967 -0.1345 0.0362 -0.177 0.2081 -0.0817 0.0659 -0.1097 0.0904 -0.1155 -0.0247 -0.1289 0.1077 -0.1047 0.0021 -0.1331 -0.0286 -0.0764 -0.1399 -0.0491 0.013 -0.2095 -0.1583 -0.0437 0.032 0.0522 0.0026 0.1175 -0.0193 0.1491
FlpD12G -0.2751 -0.1791 -0.128 -0.2313 -0.0198 0.1829 0.1969 0.0672 0.2528 0.2355 0.0726 0.1454 0.0029 0.118 0.0161 0.1825 0.219 -0.0291 0.1916 0.0331 0.0169 0.1247 -0.0967 -0.0167 0.0608 0.0562 0.0578 -0.0932 0.0302 0.0334 0.2201 0.0083 -0.0033 -0.0482 0.1286 0.0102 0.0221 0.3038 0.0891 0.0122 0.1003 -0.026 -0.3166 -0.0863 -0.0029 -0.0055 0.1428 -0.018 -0.06 0.0406 0.0731 0.1463 0.0285 -0.0829 0.0497 -0.0202 0.2338 0.0532 0.0417 -0.0195 0.1679 0.0628 0.118 0.2649 0.4791 0.378 0.3354 0.0946 0.4378 0.2506 0.1137 0.0197 0.0033 -0.1748 0.0752 -0.0418 0.4612 0.4251 0.2969 0.1442 0.4318 0.2592 0.6313 0.1729 0.4657 0.6721 0.6017 0.4417 0.56 0.3422 0.2921 0.1314 0.5344 0.2335 0.5918 0.3698 0.2948 0.1592 0.5153 0.3541 0.3709 0.2298 0.4271 -0.0901 0.1624 0.1413 0.2411 -0.0272 -0.0246 -0.1495 0.0546 -0.0445 0.2815 0.0681 -0.1886 -0.2505 0.0701 -0.0598 0.6841 0.4544 0.4965 0.4367 1 0.4647 0.5865 0.4102 0.2824 0.2669 0.6841 0.3256 0.6032 0.3808 0.3919 0.2716 0.6431 0.469 0.0111 0.0168 0.0675 -0.0178 0.1226 -0.0024 0.0537 -0.0585 0.023 -0.0827 0.04 -0.089 0.1351 0.0355 0.0939 -0.0123 0.1848 0.0711 0.1228 0.0279 -0.1694 -0.1047 -0.2065 -0.183 0.0849 0.0096 0.0768 0.0605 0.2636 0.1101 -0.0949 -0.0174 0.0752 0.0958
FlpD13G -0.1836 -0.1105 0.0288 -0.0905 0.0271 0.1782 0.0798 -0.055 0.0431 0.0476 0.1223 -0.0163 -0.011 -0.135 -0.165 0.1094 -0.019 0.0417 -0.1132 -0.2176 0.0448 0.016 -0.0106 0.0483 -0.0637 -0.0295 -0.2023 -0.3846 -0.3374 -0.2311 -0.073 -0.3487 -0.2282 -0.3407 0.0624 -0.3159 -0.3159 0.1406 0.087 -0.0558 -0.0208 -0.0281 0.1878 0.1594 -0.0366 0.2607 0.4657 0.1649 0.2677 0.2212 0.2344 0.4723 -0.2423 -0.1995 0.0165 -0.0794 0.3371 -0.107 0.0164 0.1281 0.3605 0.3004 0.3903 0.213 0.4509 0.358 0.3822 0.3524 0.1927 0.4847 -0.0096 0.0501 0.3169 0.1993 0.0768 0.104 0.4386 0.4111 0.3022 0.3707 0.1871 0.4988 0.4839 0.4144 0.3739 0.2719 0.3778 0.6743 0.4792 0.345 0.0036 0.388 0.2855 0.4892 0.5011 0.312 0.0771 0.4037 0.3103 0.5145 0.2027 0.079 0.1121 0.2768 0.0288 0.019 0.154 0.1789 0.2382 0.2274 0.0769 0.1463 0.1764 0.1279 0.2084 0.2691 0.1655 0.1435 0.5937 0.498 0.2778 0.5299 0.4647 1 0.5155 0.3529 -0.2241 0.3716 0.3454 0.556 0.5271 0.3185 -0.0287 0.3787 0.311 0.5737 -0.0513 -0.1157 0.0156 -0.0052 -0.0579 -0.0842 -0.0326 -0.0218 -0.0468 -0.0426 -0.0138 -0.0405 -0.0459 -0.0858 0.0434 0.0341 -0.0471 -0.0496 0.0747 0.0554 -0.0166 -0.1241 -0.2507 -0.086 -0.1234 -0.2218 -0.202 -0.0666 0.0802 -0.054 0.006 -0.1368 -0.0467 0.0575
FlcD11C -0.1789 -0.1665 0.1053 -0.1065 0.1682 -0.0439 0.1969 0.1959 0.4035 -0.0069 0.1505 0.1851 0.2535 0.0472 -0.0177 0.1871 0.1785 0.2245 0.1679 -0.104 -0.0572 -0.0219 -0.1513 0.0265 -0.1015 -0.0629 0.1134 -0.2694 -0.1149 -0.0717 0.0829 -0.1261 0.0236 -0.1732 0.0761 -0.1335 -0.1351 0.5668 0.4041 0.1999 -0.0707 -0.1866 -0.5062 -0.2123 -0.1303 -0.2407 -0.0135 -0.1714 -0.2321 -0.0642 -0.2245 0.0986 -0.3085 -0.3321 -0.1798 -0.0391 -0.1186 0.1685 0.1298 -0.1819 0.1211 0.2428 0.2159 0.126 0.8041 0.4934 0.5096 0.1603 0.6414 0.666 0.3 0.1906 0.0145 -0.1559 0.3978 0.2262 0.8296 0.5017 0.5296 0.1564 0.6501 0.6842 0.801 0.1619 0.5401 0.6486 0.439 0.585 0.9354 0.5507 0.481 0.0755 0.6727 0.6608 0.8166 0.4955 0.4319 0.0963 0.6333 0.5862 0.4238 0.3883 0.1322 0.1156 0.544 0.4421 0.3095 0.2024 -0.0253 0.0431 0.3799 0.3146 0.3479 0.2003 0.0042 -0.1295 0.3201 0.204 0.8625 0.5163 0.5521 0.415 0.5865 0.5155 1 0.5915 0.5856 0.2126 0.6976 0.6726 0.852 0.5046 0.4661 0.2843 0.6656 0.6227 0.1789 0.1823 0.0987 0.2373 0.1847 0.254 0.2143 0.2675 0.1801 0.2973 0.276 0.3056 0.1689 0.1731 0.1051 0.2248 0.2417 0.1959 0.1685 0.2935 -0.2303 -0.3126 -0.0822 -0.2178 0.1389 0.2611 0.1269 0.3418 0.2456 0.1849 0.0104 0.1252 0.1559 0.0338
FlcD12C -0.0716 -0.0443 0.0655 -0.0073 0.0585 0.1044 0.0598 0.1067 0.2893 0.1691 0.1452 0.2409 0.1666 0.2876 0.0387 0.1589 0.2942 0.1992 0.2956 0.1098 0.0407 0.0984 -0.1093 -0.0765 0.1149 -0.1536 -0.125 -0.3124 -0.2267 -0.3228 0.1607 -0.3005 -0.204 -0.2857 -0.0327 -0.3537 -0.3182 0.205 0.3547 0.086 -0.0146 -0.1377 -0.5481 -0.1585 -0.1732 -0.1384 -0.0076 -0.2719 -0.299 -0.2527 -0.1574 0.0713 -0.384 -0.172 -0.2715 -0.015 -0.1151 -0.0143 0.0975 -0.1636 0.0962 0.0845 0.0377 0.1191 0.3714 0.8047 0.6227 0.0292 0.2716 0.2521 0.0785 0.2566 0.2183 -0.242 0.0477 -0.034 0.3916 0.8186 0.6169 0.1939 0.2833 0.2578 0.4221 0.0236 0.8061 0.2836 0.6115 0.281 0.4872 0.8988 0.6169 -0.0337 0.306 0.2183 0.4301 0.8224 0.4998 0.003 0.2727 0.2042 0.0385 0.333 0.3882 0.0349 0.087 0.0761 -0.0017 0.1902 0.0372 -0.0807 0.0093 -0.0452 -0.0174 0.2261 0.0466 -0.3534 0.0072 -0.0589 0.5864 0.8879 0.5784 0.2978 0.4102 0.3529 0.5915 1 0.68 0.126 0.3892 0.3249 0.5422 0.8556 0.4849 0.2841 0.3514 0.2772 0.3793 0.3573 0.2397 0.074 0.3396 0.3273 0.2201 0.0842 0.2638 0.1939 0.0801 0.0353 0.3925 0.3721 0.2299 0.0602 0.416 0.3895 0.292 0.0938 0.1121 -0.1456 0.0868 -0.1113 0.2462 0.1544 0.217 -0.0039 0.154 0.1534 0.0433 0.0857 -0.0252 -0.0032
FlcD13C -0.067 -0.2549 0.1754 -0.5111 -0.3453 0.1446 0.3741 0.0215 0.3245 0.3653 0.3325 0.4084 0.3844 0.243 0.0592 0.1947 0.4263 0.3569 0.2369 0.2002 0.0866 0.0455 -0.0218 -0.172 0.2405 -0.0616 0.1115 0.0848 0.1781 -0.1541 0.0686 0.1156 0.0255 0.0426 -0.0783 -0.0653 0.0126 0.019 0.2379 0.0452 0.195 0.0294 -0.3164 -0.71 -0.0729 -0.339 -0.0194 -0.0551 0.0428 -0.3964 0.0167 0.0376 -0.3257 0.3229 -0.1734 -0.0411 -0.0752 0.0293 -0.0363 -0.2866 -0.2402 0.0236 -0.0159 0.0884 0.504 0.6306 0.8736 0.0234 0.4484 0.2762 0.2351 0.301 0.3404 -0.2765 0.2327 0.0668 0.5117 0.6152 0.8761 0.0938 0.4445 0.2779 0.4967 -0.2246 0.5569 0.1982 0.6877 -0.0235 0.5873 0.7211 0.9486 0.2035 0.4945 0.2797 0.5673 0.6811 0.825 0.1902 0.4269 0.1626 -0.0874 0.3673 0.2975 -0.287 0.0637 0.161 -0.0297 0.3784 0.3222 -0.1462 0.1755 0.0272 -0.005 0.1658 0.2854 -0.1664 0.1615 0.1668 0.5937 0.5227 0.7729 -0.0839 0.2824 -0.2241 0.5856 0.68 1 0.3356 0.4628 0.2683 0.5975 0.5736 0.7955 0.3057 0.3819 0.0804 0.23 0.4068 0.3583 0.3128 0.1339 0.3577 0.3876 0.3078 -0.0853 0.2314 0.332 0.1683 0.2487 0.4103 0.3035 0.3157 0.3258 0.4416 0.3837 0.3747 -0.2823 -0.3173 0.0901 -0.031 0.2815 0.2291 0.476 0.1901 0.4159 0.2758 0.1096 0.2991 0.0225 0.311
FlcD11G 0.0476 -0.0283 0.0292 0.019 0.0322 0.4067 0.2923 0.1103 0.2635 0.32 0.0559 0.0595 0.092 0.0067 -0.0043 -0.0442 0.1058 -0.0818 0.0528 0.0251 -0.0631 0.0604 -0.1981 0.1171 0.0623 -0.0875 0.1203 0.1823 0.0922 0.102 -0.1553 -0.0471 0.1284 0.0336 -0.1007 0.0892 -0.0514 0.2171 -0.03 0.1088 -0.0964 -0.1043 -0.2911 -0.2073 -0.1207 0.0424 0.073 0.2696 0.3056 -0.0902 0.2581 0.2744 -0.0671 -0.1005 -0.08 0.0559 0.501 -0.0275 0.1493 0.3291 -0.1152 0.2714 0.1958 0.0831 0.2152 0.1421 0.4251 0.7102 0.2381 0.2265 -0.0028 -0.168 0.123 0.327 0.1362 0.0055 0.1989 0.2899 0.4339 0.7273 0.2327 0.2414 0.1229 0.6256 0.0487 0.1882 0.3578 0.2036 0.1837 0.0839 0.2422 0.8535 0.298 0.326 0.0794 -0.0029 0.1585 0.7318 0.292 0.2576 0.131 -0.0113 0.0337 0.4221 0.0395 -0.0696 0 -0.0479 0.0232 0.3362 0.1708 -0.0022 0.0131 -0.062 -0.095 0.4064 0.2115 0.0676 0.0823 0.0383 0.4578 0.6843 0.2669 0.3716 0.2126 0.126 0.3356 1 0.2979 0.432 0.0283 0.0183 0.2913 0.7479 0.2368 0.2891 0.2789 -0.1581 -0.0461 -0.1827 0.2113 -0.173 -0.0402 -0.2336 0.2749 -0.1506 -0.0243 -0.2159 0.1527 -0.1483 -0.0378 -0.1538 0.1531 -0.1419 -0.0243 -0.157 0.0926 -0.016 -0.1284 -0.0665 0.0959 -0.2741 -0.1022 -0.0369 0.0331 0.037 -0.0985 0.0278 -0.1085 -0.0256
FlcD12G -0.1559 -0.2389 -0.1374 -0.2955 -0.1414 0.1196 0.0743 0.0765 0.1369 0.2161 0.0943 0.1594 0.1395 0.0526 0.1093 0.1134 0.1663 0.0163 0.1538 0.0499 -0.0969 -0.0032 -0.1784 0.0451 -0.0694 -0.0418 0.333 0.3008 0.2523 0.3494 0.4793 0.2504 0.3526 0.1944 0.4492 0.3192 0.2448 0.3048 0.1719 0.0416 -0.111 -0.3168 -0.4358 -0.468 -0.3261 -0.3591 -0.0922 -0.2411 -0.144 -0.3964 -0.305 -0.1206 0.0556 0.2291 0.1027 0.0468 0.1445 0.226 0.1828 0.0741 0.1683 0.2239 0.217 0.3591 0.685 0.4284 0.3903 0.3244 0.758 0.633 0.2928 0.0622 -0.0463 0.0556 0.27 0.2476 0.6915 0.4728 0.4062 0.4239 0.779 0.646 0.6085 0.1307 0.3243 0.6349 0.4744 0.5557 0.6925 0.4 0.3707 0.2593 0.872 0.5884 0.6209 0.3452 0.3839 0.1918 0.767 0.5792 0.4063 0.2902 0.3211 0.1597 0.3444 0.3875 0.3635 0.1735 -0.0773 0.1338 0.2593 0.2981 0.3779 -0.0262 -0.1946 -0.0441 0.2107 0.1725 0.6094 0.2235 0.4438 0.1042 0.6841 0.3454 0.6976 0.3892 0.4628 0.2979 1 0.557 0.6095 0.4103 0.5173 0.2616 0.8922 0.6245 0.0921 0.0577 0.1514 0.0439 0.1351 0.0734 0.1259 0.018 0.128 0.082 0.1176 0.0128 0.1327 0.0434 0.1606 0.03 0.1878 0.0838 0.1923 0.0903 -0.1977 -0.0889 -0.2324 -0.2524 0.1355 0.071 0.1907 0.094 0.2384 0.1644 -0.0127 0.0372 0.0678 -0.0046
FlcD13G -0.208 -0.2495 -0.1134 -0.3226 -0.2618 0.0876 0.1636 0.0579 0.1486 0.0925 0.3296 0.2295 0.1674 -0.1525 0.0585 0.0955 0.1941 0.1367 0.0569 -0.0298 -0.1253 -0.1243 -0.1017 0.154 -0.1515 -0.0525 0.1109 -0.0628 -0.0728 0.2229 -0.0756 -0.1182 0.0718 -0.1076 -0.0285 0.1133 -0.0943 0.1722 0.1207 -0.0068 -0.2098 -0.2289 -0.248 -0.4278 -0.2494 -0.114 0.2631 0.0408 0.0797 -0.2629 -0.1636 0.1477 -0.1086 0.0389 0.0115 0.0479 0.2461 0.2008 0.1217 -0.0529 0.1847 0.1658 0.238 0.1479 0.5476 0.37 0.4298 0.4428 0.4609 0.7309 0.0746 0.14 0.0623 0.2475 0.1547 0.2291 0.5337 0.4281 0.3719 0.4576 0.4702 0.7562 0.5935 0.2423 0.3376 0.356 0.5486 0.5751 0.637 0.3711 0.3955 0.377 0.5114 0.833 0.6086 0.3182 0.4461 0.4062 0.4504 0.6737 0.3627 0.2248 0.2463 0.2498 0.2185 0.2813 0.2305 0.2681 0.2275 0.2084 0.203 0.1838 0.247 0.1096 0.0993 0.0681 0.1599 0.2222 0.6224 0.2927 0.5263 0.2184 0.3256 0.556 0.6726 0.3249 0.2683 0.432 0.557 1 0.6278 0.3209 0.4082 0.531 0.4958 0.7382 -0.0576 0.0853 0.1611 0.1377 -0.0821 0.0722 0.1301 0.1138 -0.0211 0.0593 0.1622 0.0936 -0.117 0.0986 0.1429 0.1332 -0.0919 0.1219 0.1804 0.1587 -0.1785 -0.0874 -0.106 -0.061 -0.1687 -0.0992 0.0821 0.0484 0.1166 -0.1548 0.0293 0.0852 -0.0029 0.132
FlsD11C -0.2392 -0.1515 0.0024 -0.0048 0.2485 0.0304 0.1358 0.0452 0.3641 -0.0109 0.1938 0.1237 0.209 -0.0232 0.0935 0.2316 0.1087 0.328 0.2393 -0.0316 -0.0453 -0.035 -0.1035 0.1841 -0.1809 0.0306 0.0021 -0.4751 -0.1666 -0.119 -0.0094 -0.2557 -0.1052 -0.1852 -0.0817 -0.2171 -0.2761 0.5106 0.3851 0.1629 0.0345 -0.0125 -0.4636 -0.0916 0.0162 -0.1115 0.0876 -0.0505 -0.2196 -0.023 -0.102 0.1421 -0.2326 -0.5719 -0.0201 -0.1009 -0.1766 0.1449 0.1862 -0.2852 0.1933 0.2009 0.1787 0.2277 0.7953 0.4776 0.6104 0.1113 0.5592 0.6494 0.3105 0.2838 0.2469 -0.0463 0.3938 0.3227 0.8077 0.4576 0.6166 0.1226 0.5623 0.6579 0.8123 0.2425 0.5946 0.6407 0.4972 0.6028 0.8455 0.5421 0.5741 0.0698 0.631 0.684 0.9472 0.5425 0.5373 0.1234 0.6134 0.6631 0.4451 0.4591 0.2206 0.1776 0.516 0.4599 0.3928 0.2654 0.2477 0.139 0.4217 0.4152 0.3777 0.375 0.2063 -0.0891 0.3527 0.2562 0.866 0.533 0.5684 0.3688 0.6032 0.5271 0.852 0.5422 0.5975 0.0283 0.6095 0.6278 1 0.4857 0.5015 0.2261 0.6183 0.6909 0.0923 0.3208 0.2489 0.3439 0.1927 0.3979 0.3908 0.4568 0.1738 0.4305 0.5173 0.4825 0.1617 0.3104 0.2599 0.3201 0.2424 0.3239 0.3027 0.3515 -0.2678 -0.1528 0.0386 -0.0988 0.0818 0.5164 0.2384 0.5 0.3497 0.2098 0.0856 0.1028 0.2354 0.1109
FlsD12C -0.0197 0.0464 0.1005 0.089 0.1044 0.0784 0.0182 0.0844 0.1894 0.0975 0.2 0.2096 0.1381 0.1954 0.0476 0.1662 0.2541 0.2262 0.2692 0.059 -0.0168 0.0821 -0.0316 -0.0791 0.0211 -0.1382 0.1706 -0.0926 0.0034 -0.0766 0.4812 -0.0895 0.0728 -0.0659 0.3589 -0.1199 -0.1001 0.2554 0.3928 0.126 -0.1021 -0.2317 -0.4079 -0.2055 -0.2746 -0.257 -0.1534 -0.2699 -0.2861 -0.323 -0.2501 -0.0645 -0.2233 0.051 -0.1689 0.2254 -0.0223 0.0129 0.285 -0.1567 0.0949 0.2855 0.2252 0.2411 0.4334 0.8286 0.5844 0.0695 0.4156 0.3742 0.1122 0.3295 0.1231 -0.1129 0.1717 0.1122 0.4302 0.8395 0.5813 0.1532 0.4316 0.3763 0.4203 0.0605 0.7995 0.3744 0.5014 0.3858 0.4761 0.8876 0.4892 -0.0169 0.3896 0.3155 0.4352 0.9066 0.4497 -0.0064 0.3822 0.3155 0.1148 0.4473 0.3271 0.1927 0.2403 0.2369 0.1299 0.4281 -0.0849 0.0407 0.1514 0.1214 0.0808 0.1363 -0.112 -0.262 0.082 0.0344 0.4819 0.7729 0.4534 0.0875 0.3808 0.3185 0.5046 0.8556 0.5736 0.0183 0.4103 0.3209 0.4857 1 0.4933 0.1854 0.4523 0.3713 0.3585 0.364 0.2961 0.1179 0.3851 0.3669 0.3218 0.168 0.3544 0.3336 0.2416 0.2025 0.3854 0.3544 0.2796 0.0893 0.3837 0.3603 0.3205 0.1089 0.2261 -0.0336 0.1417 -0.0394 0.279 0.1992 0.3006 0.1566 0.2069 0.1745 0.0564 0.0759 -0.0088 -0.0023
FlsD13C 0.0807 -0.0821 0.1071 -0.5916 -0.3976 0.0649 0.2477 -0.0841 0.2902 0.2905 0.2116 0.3145 0.4096 0.1464 0.0412 0.1648 0.3325 0.3022 0.1522 0.0424 0.2266 0.0508 -0.0613 -0.1031 0.0066 -0.0744 0.1882 -0.0119 0.109 -0.0174 0.0584 0.3574 0.0094 0.0037 -0.0173 -0.0431 0.3191 0.1334 0.23 0.06 0.0913 0.0048 -0.2308 -0.6497 -0.2182 -0.5076 -0.0014 -0.1821 -0.0603 -0.3904 -0.1074 -0.2635 -0.0456 0.4413 0.0488 0.0626 0.1618 0.0602 -0.0008 -0.4779 -0.2763 0.2668 -0.1548 0.1735 0.4208 0.5352 0.8937 0.0781 0.5111 0.4599 -0.0832 0.0585 0.2637 -0.3271 0.1622 -0.0085 0.4379 0.5247 0.9021 0.1109 0.5164 0.474 0.348 -0.1572 0.356 0.3137 0.7331 0.0972 0.4664 0.5137 0.802 0.2071 0.5605 0.454 0.5033 0.5118 0.9392 0.141 0.5452 0.3433 -0.1384 0.1734 0.389 -0.2323 0.1509 0.1696 -0.0668 0.2166 0.3982 -0.0902 0.2128 0.0928 -0.0371 -0.0293 0.0744 -0.2653 0.0943 0.0188 0.4645 0.3756 0.7668 -0.0308 0.3919 -0.0287 0.4661 0.4849 0.7955 0.2913 0.5173 0.4082 0.5015 0.4933 1 0.3128 0.5494 0.3644 0.2176 0.2569 0.3263 0.326 0.1722 0.2526 0.3758 0.4012 0.084 0.2351 0.4148 0.3957 0.2032 0.2379 0.2428 0.2965 0.2688 0.2656 0.3256 0.3757 -0.244 -0.3536 -0.0097 -0.1129 0.3146 0.3359 0.4621 0.3311 0.3697 0.2275 0.0675 0.1729 -0.1499 0.2158
FlsD11G -0.0848 -0.1801 -0.0215 -0.0076 -0.0079 0.4799 0.3243 0.2409 0.2909 0.1716 -0.0237 0.0505 0.0547 0.0406 0.0651 -0.0538 0.1607 0.0991 0.0868 0.1256 -0.0423 0.1776 0.0947 0.1473 0.0849 -0.1204 -0.0121 0.0121 -0.0728 0.0209 -0.2236 -0.1183 -0.0413 -0.1286 -0.2155 -0.0084 -0.1259 0.1324 -0.1396 0.088 0.2066 0.0498 -0.2964 -0.0666 -0.1145 0.0252 0.4018 0.2816 0.2385 -0.0624 0.2876 0.2798 -0.249 -0.2409 -0.0744 -0.0217 0.1791 0.0181 0.1362 0.2103 -0.0887 0.2813 0.1198 0.2895 0.2474 0.3511 0.3105 0.8526 0.2257 0.4008 0.0644 -0.0735 -0.1737 0.5151 0.1191 0.2215 0.239 0.4389 0.3356 0.8552 0.2338 0.4059 0.2846 0.8048 0.3123 0.2661 0.3631 0.4797 0.2651 0.2901 0.2216 0.8361 0.2644 0.5406 0.264 0.2641 0.1893 0.947 0.2885 0.5075 0.2271 0.2634 -0.0395 0.6323 0.1318 0.2843 0.059 0.0618 -0.1445 0.6089 0.1555 0.2174 0.1181 0.199 -0.2118 0.456 0.1874 0.2083 0.247 0.1868 0.5171 0.7537 0.2716 0.3787 0.2843 0.2841 0.3057 0.7479 0.2616 0.531 0.2261 0.1854 0.3128 1 0.248 0.5231 0.4226 0.073 0.0877 -0.057 0.2977 0.0397 0.1921 -0.0539 0.3517 0.0569 0.2624 -0.0036 0.2249 0.0846 0.0768 -0.0461 0.2168 0.0907 0.1355 -0.0453 0.1782 -0.1787 0.0065 -0.0277 0.1868 -0.0625 0.0521 0.0004 -0.0382 -0.0153 -0.1346 0.0118 -0.0695 -0.0133
FlsD12G -0.1621 -0.1732 -0.1474 -0.2003 -0.1436 0.0831 0.1247 0.1017 0.1496 0.1973 0.1151 0.2222 0.1259 0.0398 0.156 0.1772 0.2349 0.0763 0.2349 0.0817 -0.0311 -0.0029 -0.0605 0.1026 -0.1014 0.0321 0.2714 0.2115 0.245 0.286 0.4055 0.2394 0.2955 0.1745 0.4375 0.2615 0.2271 0.3204 0.1779 0.1121 -0.0773 -0.2947 -0.3837 -0.4054 -0.3586 -0.3934 -0.1293 -0.173 -0.156 -0.3299 -0.3307 -0.1761 0.0302 0.2009 0.0617 0.082 0.1142 0.109 0.1606 -0.011 0.1087 0.2577 0.1765 0.2716 0.6633 0.4389 0.4001 0.3592 0.8247 0.6968 0.2926 0.1555 0.0352 0.038 0.4487 0.3549 0.6695 0.4747 0.4222 0.4187 0.8347 0.7055 0.6211 0.1709 0.369 0.7576 0.4741 0.624 0.6806 0.4042 0.3396 0.2413 0.8864 0.6152 0.638 0.4208 0.3941 0.1864 0.9005 0.6742 0.4557 0.403 0.4077 0.2124 0.538 0.5068 0.401 0.2738 0.0517 0.1162 0.4451 0.438 0.4059 0.0915 -0.2056 -0.1194 0.3247 0.255 0.5958 0.1838 0.3835 0.0882 0.6431 0.311 0.6656 0.3514 0.3819 0.2368 0.8922 0.4958 0.6183 0.4523 0.5494 0.248 1 0.7054 0.1596 0.1672 0.2364 0.0825 0.2016 0.1954 0.2608 0.098 0.2096 0.2127 0.284 0.1432 0.1858 0.1384 0.2208 0.0589 0.2198 0.1723 0.25 0.1055 -0.0626 -0.0643 -0.1439 -0.1788 0.1932 0.1936 0.2892 0.1777 0.2426 0.1408 -0.0689 -0.0035 0.0723 -0.0148
FlsD13G -0.1837 -0.1991 -0.1 -0.1584 -0.2589 0.122 0.2253 0.1644 0.2745 0.1298 0.3628 0.2135 0.1402 -0.0553 0.1948 0.2202 0.209 0.1367 0.1974 0.0678 -0.132 -0.0439 -0.1035 0.0122 -0.2134 -0.0057 0.146 -0.2121 -0.1076 0.1342 -0.1396 -0.118 0.125 -0.1468 -0.0776 0.0515 -0.1237 0.1867 0.1652 0.1758 -0.087 -0.1018 -0.3398 0.0046 -0.1927 -0.0731 0.1827 0.0016 -0.1079 -0.1268 -0.1879 0.1631 -0.1301 -0.1273 -0.019 0.0349 0.3697 0.1014 0.1298 -0.2008 0.122 0.2178 -0.0166 0.1074 0.6803 0.4776 0.3362 0.5394 0.5933 0.8405 0.2183 0.2944 0.1375 0.157 0.3651 0.4025 0.6682 0.5255 0.2691 0.5692 0.5959 0.8566 0.6626 0.3721 0.4791 0.6271 0.5657 0.7212 0.6659 0.4191 0.2676 0.3583 0.6816 0.8134 0.708 0.4545 0.3966 0.4259 0.7 0.9192 0.4566 0.445 0.5252 0.3642 0.4831 0.4636 0.4045 0.4582 0.2522 0.3159 0.4457 0.4766 0.3914 0.3542 0.0602 0.0999 0.365 0.3042 0.6471 0.2788 0.3374 0.3311 0.469 0.5737 0.6227 0.2772 0.0804 0.2891 0.6245 0.7382 0.6909 0.3713 0.3644 0.5231 0.7054 1 0.1643 0.2376 0.2283 0.2278 0.1841 0.2787 0.2704 0.2492 0.2098 0.3008 0.3234 0.2434 0.1312 0.2239 0.2077 0.2295 0.1301 0.2395 0.2182 0.2342 0.0694 0.0336 -0.0159 0.0808 0.1514 0.1339 0.0761 0.1714 0.1418 -0.0703 -0.0119 -0.0199 -0.0366 0.1252
LP12C 0.1247 0.0288 0.0736 0.1153 -0.095 0.2466 0.1261 0.288 0.256 0.2024 0.089 0.1203 0.2658 0.2467 0.253 0.1327 0.1546 0.2204 0.2361 0.2128 0.0297 0.0703 -0.1497 -0.2111 -0.0055 0.0968 0.1836 0.0979 0.1305 0.0024 0.2838 0.2116 0.1994 0.0708 0.2568 -0.0678 0.1761 0.3615 0.4019 0.2479 -0.1277 -0.1074 -0.3176 -0.125 -0.2843 -0.4054 -0.1342 -0.1436 -0.1327 -0.1537 -0.1402 -0.1109 -0.1867 -0.2211 -0.2752 0.1868 0.0339 -0.1949 -0.0387 -0.2526 0.2186 0.2842 -0.0564 0.0997 0.2945 0.4966 0.3247 0.3908 0.4177 0.2531 0.4165 0.4452 0.4372 0.1719 0.498 0.341 0.2698 0.5086 0.3079 0.4835 0.4208 0.2359 0.2787 0.0153 0.4655 0.4426 0.3667 0.1769 0.3122 0.4597 0.2771 0.0319 0.3674 0.1327 0.2263 0.467 0.2711 0.0569 0.3861 0.2247 0.2314 0.4644 0.3658 0.3795 0.5242 0.2748 0.3963 0.3574 0.3244 0.3225 0.5211 0.2924 0.3624 0.4155 0.2216 0.2775 0.53 0.2096 0.2259 0.2568 0.2313 0.217 0.0111 -0.0513 0.1789 0.3793 0.23 0.2789 0.0921 -0.0576 0.0923 0.3585 0.2176 0.4226 0.1596 0.1643 1 0.4981 0.3632 0.3056 0.8514 0.4781 0.3603 0.3072 0.7456 0.4393 0.265 0.2345 0.8841 0.4964 0.3349 0.3129 0.8647 0.4863 0.3327 0.297 0.5491 0.1807 0.3031 0.2128 0.7999 0.3925 0.3071 0.3211 0.0795 0.1013 0.0361 0.0953 -0.2604 0.0233
LP13C 0.0344 -0.0608 -0.097 -0.1421 -0.2096 0.1525 0.2063 0.2429 0.2893 0.0937 0.2346 0.287 0.288 0.3211 0.3011 0.314 0.2493 0.3601 0.3083 0.1961 0.1278 -0.114 -0.0691 -0.1803 -0.1333 0.1676 0.0154 -0.0295 0.0796 0.0339 0.2041 -0.0132 0.0125 0.0479 0.1071 0.0252 -0.0374 0.2715 0.2441 0.2911 0.0313 0.0507 -0.3151 -0.2125 -0.2412 -0.1738 0.0922 0.0559 -0.1119 -0.3116 -0.1699 -0.106 -0.3463 -0.2211 -0.2908 0.0936 0.1444 0.017 0.0305 -0.2639 0.0691 0.0757 0.0245 0.0755 0.1974 0.4096 0.3379 0.1877 0.2972 0.2862 0.1017 0.4131 0.4557 -0.0689 0.3258 0.2595 0.2215 0.4595 0.3007 0.2177 0.3067 0.2733 0.2604 -0.0265 0.4645 0.3613 0.5295 0.1635 0.1788 0.3412 0.5185 -0.0827 0.2534 0.2193 0.2076 0.4484 0.4234 0.0516 0.2786 0.2772 -0.0173 0.4068 0.5736 0.13 0.4117 0.301 0.0377 0.2395 0.478 0.0527 0.366 0.2442 -0.0812 0.437 0.4102 0.0469 0.3031 0.175 0.3604 0.3178 0.3009 -0.1503 0.0168 -0.1157 0.1823 0.3573 0.4068 -0.1581 0.0577 0.0853 0.3208 0.364 0.2569 0.073 0.1672 0.2376 0.4981 1 0.5558 0.5733 0.5346 0.9637 0.5279 0.5427 0.3993 0.8083 0.3796 0.4091 0.6217 0.9929 0.5315 0.561 0.6078 0.9857 0.5622 0.5364 0.4084 0.1858 0.5494 0.386 0.4696 0.8407 0.5295 0.4911 0.1248 0.0691 -0.0166 -0.0926 -0.1505 0.0555
LP12G 0.0727 -0.1901 -0.1027 0.0311 -0.0409 0.1691 0.0743 0.1248 0.226 -0.0066 0.1668 0.2258 0.1918 0.2259 0.2681 0.1708 0.1715 0.2746 0.2259 0.154 0.0034 -0.1191 0.0023 -0.0543 -0.1463 0.0664 0.0038 -0.2117 0.0245 -0.0732 -0.0106 -0.0673 0.0781 -0.0177 -0.0881 -0.1408 -0.1374 0.3359 0.2574 0.275 0.1516 0.2393 -0.1189 -0.0251 -0.1122 0.0178 0.2922 0.1822 0.0503 -0.1249 -0.1013 0.059 0.0751 -0.0703 -0.0662 0.0886 0.1999 -0.0295 -0.0762 -0.1423 -0.0931 0.1172 0.0331 -0.0032 0.1509 0.3437 0.2394 0.1375 0.2029 0.2421 -0.036 0.378 0.2986 -0.0303 0.2511 0.1696 0.1027 0.3181 0.2946 0.1192 0.255 0.254 0.1251 0.0063 0.3286 0.1954 0.3518 0.1767 0.1237 0.3084 0.3055 0.0376 0.2334 0.22 0.2514 0.3915 0.3155 0.0772 0.2794 0.2546 -0.1072 0.2625 0.4859 0.0227 0.2181 0.2116 -0.068 0.2475 0.1832 0.0261 0.2467 0.1561 -0.0356 0.3153 0.1165 -0.1054 0.2228 0.1648 0.1556 0.2292 0.2645 -0.05 0.0675 0.0156 0.0987 0.2397 0.3583 -0.0461 0.1514 0.1611 0.2489 0.2961 0.3263 0.0877 0.2364 0.2283 0.3632 0.5558 1 0.5588 0.3699 0.4729 0.9071 0.493 0.1988 0.2872 0.6657 0.3236 0.4411 0.5619 0.9823 0.5468 0.4342 0.552 0.9736 0.5548 0.2616 0.4346 0.3121 0.2253 0.3334 0.4145 0.7548 0.4521 0.1985 0.1399 0.0343 0.1929 0.1322 0.1859
LP13G 0.1525 0.0218 -0.0485 -0.0109 -0.0787 0.0887 0.17 0.1921 0.2486 0.0781 0.1671 0.2485 0.3334 0.1942 0.3157 0.1621 0.2066 0.3035 0.3313 0.2072 -0.0441 -0.1309 -0.219 -0.111 -0.1325 0.192 0.0766 -0.0845 -0.0022 0.0205 -0.0922 0.1003 0.0614 -0.0025 -0.1534 -0.056 0.0632 0.366 0.365 0.4008 0.06 0.1383 -0.1946 0.0312 -0.184 -0.1199 0.1805 0.0483 -0.0766 -0.1134 -0.1392 -0.109 -0.4009 -0.2564 -0.0269 -0.0048 0.1668 0.0684 -0.1894 -0.3324 0.0495 0.0663 -0.1445 0.0049 0.2734 0.2224 0.1228 0.0412 0.229 0.286 0.1056 0.2649 0.1761 -0.0166 0.2819 0.2457 0.3449 0.1835 0.1522 0.1283 0.2586 0.2837 0.2567 -0.1009 0.1968 0.2105 0.2565 0.202 0.2363 0.1679 0.3274 -0.1007 0.2192 0.2474 0.2709 0.2298 0.3653 -0.0442 0.2318 0.2744 0.0708 0.1553 0.331 -0.0253 0.2429 0.2675 0.1134 0.2112 0.2641 0.0314 0.2949 0.2264 0.141 0.2712 0.1521 0.0137 0.3202 0.1923 0.399 0.1503 0.1756 -0.15 -0.0178 -0.0052 0.2373 0.074 0.3128 -0.1827 0.0439 0.1377 0.3439 0.1179 0.326 -0.057 0.0825 0.2278 0.3056 0.5733 0.5588 1 0.2718 0.4963 0.4927 0.9229 0.1252 0.3686 0.3261 0.7192 0.3585 0.574 0.547 0.9846 0.3492 0.5577 0.5489 0.9715 0.2376 0.2417 0.3485 0.5438 0.3158 0.5435 0.4772 0.8016 0.3355 0.256 0.136 0.2164 0.1448 0.1937
LS12C 0.102 0.0228 0.0148 0.0695 -0.1148 0.1558 0.0469 0.2114 0.1903 0.1267 0.0962 0.1158 0.2796 0.1938 0.2626 0.1739 0.1455 0.2551 0.1907 0.1577 0.1038 0.0665 -0.1054 -0.1987 -0.1117 0.0539 0.1455 0.2006 0.1761 0.0247 0.3489 0.236 0.102 0.1468 0.3407 -0.0315 0.2085 0.3076 0.3404 0.3353 -0.0948 -0.0854 -0.264 -0.1783 -0.2974 -0.4009 -0.0792 -0.11 -0.1885 -0.1128 -0.2204 -0.2392 -0.2043 -0.2474 -0.3051 0.2828 -0.0034 -0.1018 -0.077 -0.1433 0.178 0.2743 -0.0336 0.0879 0.201 0.4539 0.1972 0.3806 0.3718 0.1974 0.1795 0.3644 0.2515 0.1843 0.394 0.1764 0.1984 0.4673 0.1968 0.4438 0.3799 0.1934 0.2006 0.2111 0.4799 0.4495 0.3058 0.1371 0.2079 0.3873 0.1095 0.1844 0.3406 0.0419 0.1922 0.452 0.1589 0.1883 0.3477 0.158 0.0612 0.4411 0.2608 0.3601 0.4617 0.2303 0.1308 0.2584 0.1219 0.3184 0.42 0.1785 0.0409 0.3309 0.0494 0.2809 0.3952 0.0393 0.2739 0.3001 0.2545 0.1967 0.1226 -0.0579 0.1847 0.3396 0.1339 0.2113 0.1351 -0.0821 0.1927 0.3851 0.1722 0.2977 0.2016 0.1841 0.8514 0.5346 0.3699 0.2718 1 0.5694 0.4292 0.3308 0.9105 0.5488 0.377 0.3132 0.9274 0.5235 0.3335 0.2575 0.9201 0.5241 0.3346 0.2434 0.5145 0.1731 0.254 0.1798 0.8891 0.4526 0.2859 0.3175 0.0962 0.0893 0.0395 0.1091 -0.3427 -0.0146
LS13C 0.0595 -0.0464 -0.1334 -0.1262 -0.2124 0.1129 0.1708 0.1846 0.2521 0.0273 0.2459 0.255 0.2951 0.2888 0.2987 0.336 0.2094 0.3702 0.2767 0.1891 0.1396 -0.11 -0.0588 -0.1768 -0.139 0.1547 0.0514 0.0662 0.0971 0.0507 0.2832 0.0199 0.0415 0.0748 0.1966 0.0444 -0.0018 0.2608 0.2354 0.2889 -0.0612 0.0156 -0.2914 -0.2854 -0.2741 -0.238 -0.0121 0.0146 -0.2097 -0.3538 -0.2412 -0.2462 -0.3477 -0.2437 -0.3388 0.1341 0.1211 0.0063 0.0773 -0.2207 0.1423 0.1117 0.0261 0.0935 0.2581 0.4065 0.3079 0.2396 0.3316 0.3439 0.1192 0.4444 0.4142 0.0291 0.3429 0.3034 0.2905 0.4505 0.259 0.269 0.3452 0.3282 0.2886 0.0334 0.4738 0.3769 0.5413 0.2373 0.2446 0.3382 0.4734 -0.0659 0.2752 0.2326 0.2675 0.4575 0.4022 0.0403 0.2971 0.2973 -0.0629 0.4456 0.557 0.2163 0.4421 0.3785 0.0438 0.2862 0.4231 0.1178 0.3837 0.3041 -0.0743 0.4587 0.348 0.1011 0.2987 0.1644 0.4341 0.2972 0.3143 -0.1345 -0.0024 -0.0842 0.254 0.3273 0.3577 -0.173 0.0734 0.0722 0.3979 0.3669 0.2526 0.0397 0.1954 0.2787 0.4781 0.9637 0.4729 0.4963 0.5694 1 0.5145 0.5337 0.4918 0.9117 0.4356 0.4798 0.6012 0.9428 0.44 0.4752 0.5894 0.9399 0.4726 0.4506 0.3878 0.1415 0.4986 0.3425 0.4845 0.8603 0.4952 0.4736 0.112 0.0673 -0.0267 -0.0973 -0.1908 0.0175
LS12G 0.0892 -0.0977 -0.066 0.0884 0.0093 0.1315 0.052 0.056 0.214 -0.1313 0.1466 0.1887 0.1476 0.1707 0.2443 0.1968 0.1326 0.2951 0.2306 0.149 0.0493 -0.1091 0.1128 -0.0447 -0.1108 0.0871 0.044 -0.1322 0.0704 0.001 0.0265 -0.0254 0.1013 0.0338 -0.0442 -0.0535 -0.0994 0.3213 0.2335 0.3172 0.175 0.1417 -0.1431 -0.0522 -0.1678 -0.0551 0.2224 0.1207 -0.0499 -0.1087 -0.1814 -0.1131 0.0553 -0.178 -0.1002 0.1459 0.1794 0.0431 -0.0387 -0.1104 -0.0756 0.1991 -0.0124 0.0927 0.2468 0.3623 0.2643 0.2185 0.2631 0.3045 0.0089 0.4612 0.3443 0.1942 0.3229 0.277 0.201 0.3297 0.3056 0.2375 0.301 0.3079 0.2205 0.0932 0.3998 0.3042 0.3721 0.2718 0.2392 0.3326 0.3445 0.0508 0.2605 0.2579 0.3804 0.4242 0.3613 0.1008 0.3069 0.3035 -0.1054 0.4271 0.5011 0.1985 0.3475 0.3813 -0.0437 0.3523 0.1907 0.1659 0.3107 0.2637 -0.0106 0.3531 0.1057 -0.0711 0.2246 0.2069 0.2899 0.1807 0.2619 0.0362 0.0537 -0.0326 0.2143 0.2201 0.3876 -0.0402 0.1259 0.1301 0.3908 0.3218 0.3758 0.1921 0.2608 0.2704 0.3603 0.5279 0.9071 0.4927 0.4292 0.5145 1 0.5282 0.3503 0.4169 0.8929 0.4844 0.4061 0.5139 0.8842 0.4597 0.3957 0.5061 0.8719 0.4606 0.2601 0.4091 0.2772 0.2158 0.4008 0.4411 0.7557 0.4751 0.2319 0.168 0.0134 0.2206 0.0736 0.1895
LS13G 0.1866 0.0625 -0.0788 -0.0191 -0.079 0.0363 0.1424 0.1995 0.2222 0.0128 0.1805 0.2236 0.351 0.1741 0.3129 0.1699 0.1804 0.3673 0.3241 0.2147 -0.0345 -0.1087 -0.134 -0.1323 -0.1161 0.2159 0.1139 -0.0346 -0.0151 0.0463 -0.1024 0.1166 0.0678 -0.0034 -0.1444 -0.0295 0.0856 0.3123 0.3427 0.3298 -0.0195 0.1055 -0.1539 -0.059 -0.2775 -0.1867 0.0843 -0.0108 -0.2425 -0.1816 -0.2427 -0.2884 -0.4463 -0.3041 -0.0447 0.0459 0.1717 0.1179 -0.1561 -0.3031 0.1297 0.1117 -0.1508 0.0043 0.3057 0.3095 0.2137 0.0813 0.2524 0.3221 0.1675 0.3686 0.22 0.0683 0.3078 0.2746 0.4416 0.2724 0.2241 0.1733 0.2753 0.315 0.265 -0.0611 0.2645 0.2329 0.3162 0.2296 0.2748 0.2211 0.3675 -0.1004 0.214 0.2598 0.3169 0.2913 0.4411 -0.039 0.2283 0.2836 0.0327 0.2846 0.3715 0.0113 0.3021 0.3277 0.1507 0.3364 0.3294 0.0665 0.3241 0.2924 0.2192 0.341 0.1593 -0.0165 0.2902 0.1862 0.4479 0.1336 0.1944 -0.177 -0.0585 -0.0218 0.2675 0.0842 0.3078 -0.2336 0.018 0.1138 0.4568 0.168 0.4012 -0.0539 0.098 0.2492 0.3072 0.5427 0.493 0.9229 0.3308 0.5337 0.5282 1 0.2525 0.4926 0.4546 0.9085 0.3383 0.5205 0.4609 0.9027 0.3301 0.5136 0.4746 0.8941 0.2212 0.1509 0.2692 0.4827 0.3637 0.5365 0.4345 0.7969 0.2759 0.2034 0.0617 0.1446 0.156 0.1326
LBW12C 0.1332 0.0623 -0.0286 0.0873 -0.073 0.0325 -0.0597 0.1343 0.0287 0.0129 0.0334 -0.0117 0.1794 0.0939 0.2073 0.0784 0.0075 0.1643 0.0829 0.0932 0.0055 0.0688 -0.1031 -0.1262 -0.1343 0.1029 0.2383 0.3531 0.2394 0.1205 0.4131 0.2652 0.1848 0.2309 0.4435 0.068 0.2456 0.2012 0.2854 0.2787 -0.2753 -0.1656 -0.1257 -0.1917 -0.32 -0.4152 -0.15 -0.1435 -0.2054 -0.1708 -0.2618 -0.329 -0.1449 -0.261 -0.219 0.3311 0.0702 -0.0359 0.0604 -0.0748 0.2118 0.3916 0.0344 0.142 0.2488 0.4217 0.0478 0.5134 0.3936 0.247 0.2171 0.3322 0.1681 0.393 0.3974 0.2131 0.2423 0.4453 0.0451 0.5183 0.3942 0.2427 0.2542 0.333 0.423 0.4374 0.174 0.2095 0.2515 0.3511 -0.1178 0.2713 0.334 0.1239 0.2284 0.3962 0.0018 0.2333 0.3382 0.2039 0.2232 0.4593 0.1997 0.5435 0.5105 0.316 0.2448 0.3211 -0.009 0.4579 0.4175 0.2466 0.1761 0.2847 -0.1154 0.3669 0.3654 0.0999 0.2063 0.1971 0.1123 0.2081 0.023 -0.0468 0.1801 0.2638 -0.0853 0.2749 0.128 -0.0211 0.1738 0.3544 0.084 0.3517 0.2096 0.2098 0.7456 0.3993 0.1988 0.1252 0.9105 0.4918 0.3503 0.2525 1 0.5736 0.4056 0.3646 0.7368 0.3682 0.1642 0.0902 0.7219 0.3695 0.1498 0.0731 0.4516 0.1389 0.174 0.1146 0.8166 0.3973 0.2083 0.2422 0.1147 0.1061 0.0131 0.1159 -0.3329 -0.0727
LBW13C 0.0846 -0.03 -0.1719 -0.084 -0.1657 0.0749 0.1456 0.1489 0.1677 -0.0704 0.2447 0.155 0.2745 0.1798 0.2444 0.3075 0.1058 0.3493 0.1988 0.1299 0.074 -0.0882 -0.0384 -0.1322 -0.1551 0.1697 0.2135 0.1977 0.19 0.1266 0.3304 0.0942 0.2012 0.1799 0.3024 0.1041 0.0751 0.2086 0.2175 0.2523 -0.2015 -0.0127 -0.1125 -0.2931 -0.2949 -0.2913 -0.211 -0.0415 -0.289 -0.3671 -0.3226 -0.3833 -0.2316 -0.2306 -0.3344 0.1809 0.1724 -0.0011 0.1429 -0.1407 0.2469 0.2422 0.1349 0.1332 0.3856 0.3639 0.2487 0.3382 0.3846 0.4014 0.2644 0.503 0.3579 0.2838 0.4159 0.4198 0.4022 0.3978 0.196 0.3427 0.4061 0.3786 0.3319 0.1466 0.4085 0.3715 0.4048 0.3057 0.3711 0.299 0.3624 -0.0007 0.3201 0.2889 0.3892 0.4323 0.3433 0.0713 0.3337 0.3439 0.0094 0.4889 0.4368 0.3694 0.4866 0.4354 0.2214 0.4335 0.3832 0.2701 0.4506 0.4289 0.1067 0.4792 0.2628 0.2315 0.3451 0.2412 0.4228 0.1685 0.1921 -0.0817 -0.0827 -0.0426 0.2973 0.1939 0.2314 -0.1506 0.082 0.0593 0.4305 0.3336 0.2351 0.0569 0.2127 0.3008 0.4393 0.8083 0.2872 0.3686 0.5488 0.9117 0.4169 0.4926 0.5736 1 0.4603 0.5671 0.506 0.7614 0.2542 0.3465 0.4906 0.7524 0.2704 0.3145 0.351 0.1074 0.4424 0.3092 0.4447 0.7802 0.3788 0.4711 0.1186 0.1044 0.0022 -0.1425 -0.1957 0.0054
LBW12G 0.0639 -0.0167 -0.0111 0.0621 0.0065 0.0919 0.024 0.0165 0.1219 -0.2237 0.1285 0.1065 0.0652 0.0675 0.1818 0.1771 0.0646 0.2293 0.1739 0.1183 0.0609 -0.0722 0.1915 -0.0256 -0.0661 0.0985 0.1339 -0.0135 0.1424 0.1165 0.1109 0.02 0.1525 0.1154 0.0904 0.0802 -0.0395 0.2508 0.1573 0.2796 0.1855 0.0526 -0.0084 -0.0994 -0.1953 -0.1029 0.1736 0.1198 -0.1554 -0.0517 -0.2098 -0.1688 0.1476 -0.1236 -0.0617 0.1436 0.1066 0.0977 0.0699 -0.0444 -0.0192 0.3087 0.0321 0.1962 0.3776 0.2784 0.2582 0.2911 0.3315 0.351 0.1176 0.4505 0.3093 0.3578 0.3845 0.3291 0.3232 0.2582 0.2735 0.2981 0.3448 0.3483 0.3477 0.1809 0.3326 0.3811 0.2911 0.3587 0.369 0.2471 0.3199 0.0998 0.2954 0.3135 0.5406 0.3302 0.3801 0.1616 0.3364 0.3534 0.0169 0.4888 0.2882 0.3004 0.4438 0.484 0.1432 0.436 0.1735 0.2773 0.3747 0.3333 0.1611 0.3121 0.0344 0.0133 0.2402 0.2406 0.3751 0.029 0.2552 0.0659 0.04 -0.0138 0.276 0.0801 0.332 -0.0243 0.1176 0.1622 0.5173 0.2416 0.4148 0.2624 0.284 0.3234 0.265 0.3796 0.6657 0.3261 0.377 0.4356 0.8929 0.4546 0.4056 0.4603 1 0.5618 0.2754 0.3451 0.6171 0.2761 0.2591 0.3392 0.6011 0.2678 0.2205 0.3039 0.1909 0.1692 0.3578 0.3739 0.6055 0.4026 0.1748 0.0986 -0.0686 0.162 0.0498 0.1358
LBW13G 0.1744 0.1186 -0.0736 0.008 -0.0583 0.0029 0.0825 0.1753 0.1199 -0.0714 0.1544 0.1509 0.2858 0.1005 0.274 0.1178 0.102 0.3394 0.2653 0.2018 -0.046 -0.103 -0.0383 -0.0939 -0.0769 0.2296 0.1723 0.083 0.0002 0.1082 -0.0942 0.1292 0.1072 0.0085 -0.0957 0.041 0.1077 0.2262 0.2604 0.2323 -0.0836 0.0333 0.0257 -0.1469 -0.3069 -0.2054 -0.0403 -0.0467 -0.3112 -0.2444 -0.288 -0.4023 -0.323 -0.2549 0.0496 0.1368 0.1377 0.1986 -0.0604 -0.2161 0.2356 0.2357 -0.0225 0.0364 0.3952 0.3326 0.2031 0.1903 0.2985 0.3399 0.2914 0.4326 0.1992 0.2818 0.3617 0.3279 0.5114 0.3017 0.1843 0.2539 0.304 0.3256 0.332 0.0595 0.2818 0.2796 0.2666 0.2649 0.3504 0.2247 0.291 -0.0516 0.2357 0.2834 0.3922 0.3139 0.415 0.0021 0.2548 0.2865 0.1028 0.4045 0.3049 0.1468 0.3856 0.4011 0.2671 0.46 0.3343 0.1658 0.3753 0.378 0.3267 0.3585 0.0732 0.0426 0.2765 0.2197 0.4706 0.0495 0.1204 -0.1097 -0.089 -0.0405 0.3056 0.0353 0.1683 -0.2159 0.0128 0.0936 0.4825 0.2025 0.3957 -0.0036 0.1432 0.2434 0.2345 0.4091 0.3236 0.7192 0.3132 0.4798 0.4844 0.9085 0.3646 0.5671 0.5618 1 0.2169 0.3609 0.2769 0.6739 0.206 0.3583 0.2832 0.6653 0.1692 0.0931 0.1735 0.3706 0.3397 0.4689 0.3621 0.6965 0.2008 0.1197 -0.0164 0.0565 0.1347 0.0386
LL12C 0.0934 -0.0002 0.0564 0.061 -0.111 0.2694 0.1274 0.2713 0.2957 0.2401 0.1021 0.1777 0.3154 0.2754 0.2735 0.1979 0.2179 0.2798 0.2647 0.182 0.1267 0.0845 -0.1343 -0.2461 -0.0901 0.0698 0.1451 0.1294 0.1636 0.0113 0.3616 0.2205 0.1423 0.123 0.3028 -0.041 0.1879 0.3759 0.3643 0.3626 0.0081 -0.0111 -0.2615 -0.1249 -0.2744 -0.3466 -0.0016 -0.0801 -0.0807 -0.0513 -0.1531 -0.0773 -0.2173 -0.1825 -0.3594 0.1892 -0.0289 -0.18 -0.1912 -0.1656 0.2114 0.2588 0.0112 0.1083 0.19 0.4634 0.3137 0.2346 0.3887 0.1631 0.2586 0.4013 0.394 0.0379 0.4465 0.2178 0.1775 0.4722 0.3041 0.3445 0.399 0.1522 0.1807 0.0754 0.5065 0.4815 0.3717 0.1139 0.2112 0.4269 0.2688 0.0928 0.3754 0.0243 0.1809 0.479 0.26 0.1186 0.3798 0.1354 0.0462 0.4322 0.3334 0.2347 0.4922 0.1875 0.1708 0.2568 0.2825 0.1977 0.4834 0.183 0.0812 0.3838 0.2287 0.2106 0.4805 0.0722 0.2525 0.3512 0.2774 0.0904 0.1351 -0.0459 0.1689 0.3925 0.2487 0.1527 0.1327 -0.117 0.1617 0.3854 0.2032 0.2249 0.1858 0.1312 0.8841 0.6217 0.4411 0.3585 0.9274 0.6012 0.4061 0.3383 0.7368 0.506 0.2754 0.2169 1 0.6273 0.4168 0.3684 0.9851 0.6166 0.4198 0.3499 0.5878 0.2034 0.371 0.2498 0.8356 0.4841 0.3148 0.3545 0.0831 0.0706 0.0645 0.1049 -0.2992 0.0176
LL13C 0.0015 -0.0654 -0.0847 -0.1331 -0.1952 0.1723 0.2112 0.2378 0.297 0.1146 0.2318 0.2765 0.252 0.3071 0.2775 0.3202 0.2503 0.3313 0.2895 0.1779 0.1398 -0.0947 -0.0511 -0.1616 -0.1294 0.1599 0.0056 -0.0662 0.059 -0.0011 0.1993 -0.0322 0.0012 0.0235 0.0997 -0.0062 -0.0517 0.2676 0.2272 0.2937 0.0744 0.0731 -0.3094 -0.1827 -0.2068 -0.1369 0.1418 0.0819 -0.0639 -0.2767 -0.115 -0.0455 -0.3464 -0.2242 -0.284 0.067 0.1137 0.0048 0.0191 -0.244 0.0738 0.0548 0.0382 0.1 0.1659 0.3907 0.3339 0.1721 0.2584 0.2652 0.0767 0.3938 0.4532 -0.0985 0.3001 0.2374 0.1888 0.4476 0.2953 0.2119 0.2647 0.2528 0.258 -0.023 0.4624 0.3382 0.5367 0.178 0.156 0.3351 0.5178 -0.0854 0.2237 0.2122 0.1892 0.4358 0.412 0.0577 0.2485 0.2604 -0.0116 0.384 0.5683 0.1163 0.3729 0.2937 0.0084 0.2077 0.4597 0.032 0.3327 0.2143 -0.106 0.4289 0.4233 0.0372 0.2857 0.1617 0.3525 0.3356 0.3139 -0.1155 0.0355 -0.0858 0.1731 0.3721 0.4103 -0.1483 0.0434 0.0986 0.3104 0.3544 0.2379 0.0846 0.1384 0.2239 0.4964 0.9929 0.5619 0.574 0.5235 0.9428 0.5139 0.5205 0.3682 0.7614 0.3451 0.3609 0.6273 1 0.5437 0.5694 0.6122 0.9904 0.5722 0.5431 0.4174 0.2014 0.568 0.397 0.4641 0.8164 0.5297 0.4673 0.1393 0.0811 -0.0025 -0.0606 -0.1335 0.0813
LL12G 0.0579 -0.1853 -0.0989 0.0619 0.0117 0.1793 0.0778 0.1198 0.2485 0.0065 0.1584 0.2086 0.1545 0.2261 0.2322 0.1522 0.1557 0.2494 0.2152 0.1126 -0.0349 -0.116 0.0163 -0.0424 -0.1616 0.0762 0.012 -0.2136 0.0091 -0.0825 0.0159 -0.067 0.1035 -0.0281 -0.0767 -0.1538 -0.1316 0.3309 0.2356 0.2756 0.1808 0.2504 -0.0611 -0.0062 -0.0705 0.0653 0.2954 0.1803 0.104 -0.1086 -0.0535 0.0947 0.0723 -0.11 -0.0267 0.0767 0.2138 -0.0359 -0.0941 -0.1194 -0.0428 0.1457 0.1064 0.0233 0.1373 0.3252 0.2012 0.1405 0.1699 0.2132 -0.0565 0.3712 0.3207 -0.0074 0.2363 0.161 0.0837 0.2959 0.2463 0.123 0.2232 0.2223 0.1288 0.0115 0.3159 0.1847 0.3044 0.1737 0.1222 0.2976 0.2639 0.0443 0.2257 0.2085 0.259 0.3815 0.2613 0.075 0.2686 0.2435 -0.1149 0.2403 0.4783 0.0345 0.1854 0.1796 -0.0786 0.2272 0.1833 0.0357 0.2186 0.1514 -0.035 0.311 0.1681 -0.0782 0.224 0.1695 0.165 0.2274 0.1886 -0.0247 0.0939 0.0434 0.1051 0.2299 0.3035 -0.0378 0.1606 0.1429 0.2599 0.2796 0.2428 0.0768 0.2208 0.2077 0.3349 0.5315 0.9823 0.547 0.3335 0.44 0.8842 0.4609 0.1642 0.2542 0.6171 0.2769 0.4168 0.5437 1 0.5475 0.4056 0.5282 0.9799 0.5504 0.2692 0.492 0.3398 0.2484 0.3 0.3908 0.7391 0.4334 0.2153 0.1477 0.059 0.2171 0.1672 0.2335
LL13G 0.1201 0.0111 -0.0458 -0.0014 -0.0642 0.1068 0.1963 0.1961 0.2629 0.0948 0.1741 0.2357 0.3065 0.1865 0.2756 0.1735 0.2038 0.2866 0.3045 0.1662 -0.0526 -0.1064 -0.2003 -0.1121 -0.1437 0.177 0.0868 -0.1223 0.0051 -0.0191 -0.0641 0.0849 0.0762 0.003 -0.1198 -0.0915 0.0522 0.3698 0.3441 0.4038 0.0994 0.1715 -0.1553 0.0627 -0.1359 -0.076 0.2223 0.0963 -0.0312 -0.0721 -0.0927 -0.0252 -0.4095 -0.2543 -0.016 -0.0358 0.2083 0.0093 -0.1998 -0.3195 0.0515 0.0675 -0.1134 -0.0043 0.2411 0.1901 0.138 0.0497 0.1966 0.2706 0.0825 0.2314 0.1884 -0.0439 0.2623 0.2381 0.3012 0.1495 0.1618 0.1248 0.2213 0.2671 0.2449 -0.0894 0.1755 0.1907 0.247 0.2097 0.2178 0.1451 0.3375 -0.076 0.2 0.2438 0.257 0.2028 0.3548 -0.0247 0.216 0.2796 0.0628 0.1168 0.318 -0.0312 0.2103 0.2393 0.0917 0.1719 0.2783 0.0248 0.2741 0.2195 0.1257 0.2504 0.2005 0.0193 0.3218 0.1963 0.3907 0.1482 0.1641 -0.1289 -0.0123 0.0341 0.2248 0.0602 0.3157 -0.1538 0.03 0.1332 0.3201 0.0893 0.2965 -0.0461 0.0589 0.2295 0.3129 0.561 0.5468 0.9846 0.2575 0.4752 0.4597 0.9027 0.0902 0.3465 0.2761 0.6739 0.3684 0.5694 0.5475 1 0.3562 0.548 0.5459 0.9838 0.2572 0.2633 0.3767 0.5656 0.3029 0.5221 0.4368 0.777 0.3493 0.2793 0.1674 0.2475 0.1838 0.2554
LBL12C 0.0853 -0.0356 0.0448 0.0346 -0.1359 0.2686 0.1398 0.2608 0.3323 0.2661 0.1044 0.198 0.3365 0.2897 0.2949 0.2057 0.237 0.3001 0.2887 0.204 0.1498 0.0764 -0.1347 -0.2554 -0.0855 0.048 0.0795 0.1241 0.127 -0.025 0.3186 0.1705 0.0854 0.0843 0.2366 -0.0784 0.135 0.3712 0.3502 0.3234 0.0191 -0.0077 -0.2969 -0.1701 -0.2901 -0.3492 0.0019 -0.0865 -0.0876 -0.0639 -0.1786 -0.0839 -0.2386 -0.2114 -0.3303 0.1705 -0.0329 -0.1685 -0.1635 -0.175 0.1513 0.2072 -0.0256 0.0615 0.2214 0.4691 0.3648 0.2323 0.3924 0.1579 0.2276 0.3651 0.3563 0.0478 0.4231 0.2004 0.2168 0.4713 0.3577 0.3562 0.4051 0.1485 0.2294 0.0711 0.4877 0.4722 0.4349 0.0828 0.2505 0.4236 0.3212 0.0983 0.396 0.024 0.2359 0.4703 0.315 0.125 0.3906 0.1249 0.0132 0.3855 0.3333 0.2231 0.4494 0.1468 0.1108 0.205 0.2472 0.1892 0.4494 0.1496 0.0495 0.3625 0.2066 0.217 0.4535 0.0484 0.3433 0.3753 0.3589 0.1077 0.1848 -0.0471 0.2417 0.416 0.3258 0.1531 0.1878 -0.0919 0.2424 0.3837 0.2688 0.2168 0.2198 0.1301 0.8647 0.6078 0.4342 0.3492 0.9201 0.5894 0.3957 0.3301 0.7219 0.4906 0.2591 0.206 0.9851 0.6122 0.4056 0.3562 1 0.6158 0.426 0.3535 0.4401 0.1162 0.281 0.1764 0.8172 0.4805 0.3089 0.334 0.0803 0.0626 0.0382 0.1049 -0.315 -0.0082
LBL13C 0.0202 -0.0802 -0.0982 -0.1473 -0.2193 0.1586 0.1884 0.2158 0.2897 0.1151 0.2251 0.2915 0.2707 0.3251 0.2943 0.314 0.2663 0.36 0.3062 0.1962 0.1708 -0.0909 -0.0349 -0.1731 -0.1268 0.126 -0.054 -0.0908 0.0242 -0.0215 0.1764 -0.0737 -0.0549 -0.0135 0.0728 -0.024 -0.0886 0.2523 0.1963 0.2471 0.0502 0.0478 -0.3453 -0.2204 -0.2276 -0.1428 0.1394 0.0728 -0.071 -0.2878 -0.1351 -0.0459 -0.3615 -0.2301 -0.2987 0.0547 0.1242 -0.0276 0.0194 -0.2374 0.0581 0.0415 -0.0083 0.0811 0.1681 0.3919 0.3485 0.1601 0.2617 0.2662 0.0364 0.3418 0.4015 -0.1037 0.2804 0.2087 0.1938 0.4501 0.3087 0.2055 0.2704 0.2545 0.2567 -0.0345 0.4422 0.3262 0.5653 0.1758 0.1569 0.3258 0.5321 -0.0798 0.2354 0.2118 0.1893 0.4216 0.4295 0.0653 0.2599 0.2605 -0.0353 0.3393 0.5536 0.0881 0.3364 0.2591 -0.0289 0.1614 0.4186 0.0135 0.3013 0.1842 -0.1386 0.3916 0.3902 0.0175 0.2594 0.1338 0.3767 0.3561 0.3618 -0.1047 0.0711 -0.0496 0.1959 0.3895 0.4416 -0.1419 0.0838 0.1219 0.3239 0.3603 0.2656 0.0907 0.1723 0.2395 0.4863 0.9857 0.552 0.5577 0.5241 0.9399 0.5061 0.5136 0.3695 0.7524 0.3392 0.3583 0.6166 0.9904 0.5282 0.548 0.6158 1 0.5718 0.543 0.3467 0.1169 0.4485 0.2959 0.4535 0.811 0.5162 0.4393 0.1124 0.0726 -0.032 -0.0916 -0.1742 0.0585
LBL12G 0.0808 -0.2382 -0.1222 0.0162 -0.0326 0.1896 0.0726 0.1075 0.2412 0.0117 0.1492 0.2295 0.1857 0.2616 0.2559 0.1467 0.1765 0.2963 0.2392 0.1411 -0.0159 -0.1166 0.053 -0.0651 -0.1491 0.0754 -0.0254 -0.2019 -0.0285 -0.0961 -0.0348 -0.1109 0.0647 -0.0713 -0.1363 -0.1693 -0.1691 0.2936 0.2244 0.2334 0.1675 0.2463 -0.0988 -0.0422 -0.1045 0.0641 0.3036 0.1697 0.0986 -0.1099 -0.0593 0.0977 0.0399 -0.1435 -0.0383 0.048 0.1894 -0.0792 -0.1282 -0.0942 -0.068 0.1289 0.0666 0.0277 0.1449 0.3628 0.2695 0.1809 0.1759 0.2214 -0.088 0.3245 0.2852 0.0251 0.2046 0.1401 0.1045 0.3424 0.3278 0.1611 0.2365 0.2334 0.1563 0.0384 0.3254 0.1682 0.3522 0.1608 0.167 0.3274 0.3183 0.0856 0.235 0.2131 0.2878 0.4028 0.3318 0.1324 0.2798 0.2456 -0.1113 0.2028 0.4637 0.0342 0.1503 0.135 -0.0994 0.1839 0.1796 0.0553 0.1981 0.1107 -0.0497 0.2851 0.1683 -0.0919 0.209 0.1528 0.204 0.2868 0.2818 0.0021 0.1228 0.0747 0.1685 0.292 0.3837 -0.0243 0.1923 0.1804 0.3027 0.3205 0.3256 0.1355 0.25 0.2182 0.3327 0.5622 0.9736 0.5489 0.3346 0.4726 0.8719 0.4746 0.1498 0.2704 0.6011 0.2832 0.4198 0.5722 0.9799 0.5459 0.426 0.5718 1 0.5729 0.1848 0.3082 0.2491 0.1434 0.2926 0.4021 0.7301 0.4263 0.1939 0.1329 0.015 0.1938 0.1323 0.2062
LBL13G 0.1553 -0.0298 -0.063 -0.0289 -0.0821 0.0775 0.1576 0.1721 0.2586 0.0965 0.1517 0.2477 0.3185 0.1916 0.2831 0.1581 0.2176 0.3 0.3183 0.1718 -0.0244 -0.0962 -0.1874 -0.0988 -0.1442 0.1385 0.0183 -0.1189 -0.0251 -0.0381 -0.0927 0.0401 0.0188 -0.0424 -0.1472 -0.1075 0.0096 0.355 0.3246 0.3495 0.0542 0.1481 -0.1829 0.0257 -0.1691 -0.081 0.2171 0.0901 -0.0119 -0.0975 -0.1242 -0.0322 -0.4198 -0.2332 -0.018 -0.04 0.2241 -0.0059 -0.2011 -0.3071 0.0588 0.0516 -0.1624 -0.0188 0.2753 0.1864 0.1714 0.0474 0.2056 0.2745 0.0518 0.1578 0.1038 -0.0504 0.2366 0.2158 0.3173 0.1511 0.2 0.1044 0.2386 0.2712 0.2668 -0.1097 0.1461 0.1746 0.2735 0.1949 0.2654 0.146 0.3667 -0.0793 0.225 0.2459 0.2982 0.1906 0.4092 -0.0259 0.2403 0.2747 0.068 0.0562 0.2881 -0.0664 0.1645 0.1987 0.0737 0.1216 0.2318 0.0035 0.2407 0.1903 0.1013 0.1931 0.1468 -0.0136 0.3012 0.1747 0.427 0.1755 0.2255 -0.1331 0.0279 0.0554 0.2935 0.0938 0.3747 -0.157 0.0903 0.1587 0.3515 0.1089 0.3757 -0.0453 0.1055 0.2342 0.297 0.5364 0.5548 0.9715 0.2434 0.4506 0.4606 0.8941 0.0731 0.3145 0.2678 0.6653 0.3499 0.5431 0.5504 0.9838 0.3535 0.543 0.5729 1 0.1703 0.1586 0.2394 0.4086 0.2856 0.4958 0.4334 0.755 0.3328 0.2851 0.1345 0.224 0.1498 0.233
PL12C 0.0842 0.1652 0.0814 0.162 0.0693 0.1443 0.008 0.2027 -0.0091 -0.0014 0.0385 -0.0024 0.0691 0.0763 0.0345 0.064 0.0249 0.0796 0.0262 -0.014 -0.0586 0.0819 -0.0792 -0.0834 -0.0666 0.1408 0.3925 0.1018 0.2624 0.1975 0.4355 0.3536 0.3534 0.2474 0.5052 0.1604 0.3576 0.2251 0.2672 0.3679 -0.0446 -0.0223 0.049 0.1338 -0.0788 -0.1582 -0.016 -0.0147 -0.0054 0.0278 0.0392 -0.0096 -0.0094 0.031 -0.3081 0.2056 0.0047 -0.1419 -0.2191 -0.0585 0.3689 0.3841 0.2123 0.2882 -0.0446 0.2278 -0.1032 0.1481 0.2049 0.1125 0.2588 0.392 0.3841 -0.0225 0.3638 0.201 -0.0844 0.2652 -0.1252 0.1546 0.1924 0.0997 -0.1204 0.0654 0.3724 0.323 -0.1475 0.206 -0.0648 0.2546 -0.1453 0.0286 0.1131 0.013 -0.1473 0.3092 -0.1582 0.0398 0.1643 0.1169 0.1627 0.4569 0.1625 0.2015 0.4955 0.2864 0.3369 0.3839 0.317 0.1637 0.4468 0.2498 0.1741 0.3122 0.2238 0.0984 0.4104 0.1496 -0.2676 0.0863 -0.2915 -0.0286 -0.1694 -0.0166 -0.2303 0.1121 -0.2823 0.0926 -0.1977 -0.1785 -0.2678 0.2261 -0.244 0.1782 -0.0626 0.0694 0.5491 0.4084 0.2616 0.2376 0.5145 0.3878 0.2601 0.2212 0.4516 0.351 0.2205 0.1692 0.5878 0.4174 0.2692 0.2572 0.4401 0.3467 0.1848 0.1703 1 0.5228 0.6148 0.4908 0.5126 0.2852 0.1924 0.2898 0.056 0.0763 0.1571 0.0534 -0.0719 0.1342
PL12G -0.0715 0.1158 0.0019 0.1709 0.1438 0.056 0.0749 0.0778 0.127 -0.0298 0.1127 0.0144 -0.0676 -0.0392 -0.0121 0.0631 -0.0315 -0.0886 -0.0183 -0.072 -0.1577 -0.0993 -0.1317 0.013 -0.1144 0.0964 0.2037 -0.1029 0.1395 0.0484 0.2247 0.1715 0.2328 0.1475 0.225 0.042 0.1456 0.28 0.1445 0.2762 0.1141 0.1537 0.1911 0.1197 0.1404 0.0281 0.042 0.11 0.0682 -0.0695 0.0099 0.0162 0.188 0.1136 0.0592 0.1495 0.2108 0.1811 0.1344 -0.1579 0.1013 0.1437 0.2328 0.0106 -0.0011 0.0176 -0.2986 -0.0773 0.0546 0.0767 0.1566 0.3779 0.3111 -0.0942 0.2178 0.2064 -0.0917 -0.0305 -0.3481 -0.0738 0.0488 0.065 -0.1139 -0.0954 0.1444 0.1369 -0.1474 0.115 -0.2133 0.0115 -0.189 -0.1224 0.0469 0.0943 -0.0794 0.1109 -0.2863 -0.1886 0.0429 0.1027 -0.0552 0.2876 0.2569 0.0211 0.2268 0.2612 0.0893 0.2615 0.0884 -0.0299 0.1892 0.2497 0.0691 0.2841 0.0617 0.0846 0.1658 0.1783 -0.1611 -0.1105 -0.4293 -0.0764 -0.1047 -0.1241 -0.3126 -0.1456 -0.3173 -0.016 -0.0889 -0.0874 -0.1528 -0.0336 -0.3536 -0.1787 -0.0643 0.0336 0.1807 0.1858 0.4346 0.2417 0.1731 0.1415 0.4091 0.1509 0.1389 0.1074 0.3039 0.0931 0.2034 0.2014 0.492 0.2633 0.1162 0.1169 0.3082 0.1586 0.5228 1 0.6236 0.598 0.1911 0.1436 0.3549 0.2209 0.1506 0.0572 0.172 0.2203 0.207 0.2215
PL13C -0.1108 0.0532 0.0351 0.0265 0.0708 0.1757 0.2397 0.2492 0.2034 0.0527 0.1483 0.051 0.0139 0.0574 0.0298 0.1918 0.0364 -0.0124 0.0573 -0.0253 -0.1529 -0.0728 -0.1297 -0.0187 -0.0835 0.2819 0.407 0.1291 0.2388 0.1335 0.2841 0.2498 0.4004 0.2344 0.2371 0.1133 0.2184 0.2453 0.2997 0.4227 0.1954 0.1823 0.0253 0.1598 0.0286 -0.0142 0.074 0.095 0.0033 -0.0632 0.0707 -0.0129 -0.0572 -0.0785 -0.0421 0.1143 0.0133 0.1955 0.0076 -0.1789 0.1158 0.1076 0.361 0.1602 0.0536 0.1919 0.1295 0.1673 0.1086 0.0862 0.3004 0.4832 0.6458 -0.0136 0.2689 0.2672 0.043 0.2005 0.1169 0.1472 0.0931 0.0829 0.1201 0.0656 0.3513 0.2443 0.1872 0.0763 0.0611 0.2251 0.2513 -0.0818 0.0381 0.08 0.0805 0.3042 0.1728 -0.0216 0.0524 0.0915 0.157 0.442 0.4866 0.2584 0.416 0.315 0.2592 0.3646 0.5822 0.1442 0.3641 0.2596 0.1783 0.4217 0.5058 0.1561 0.3087 0.2275 -0.0142 0.0506 -0.0853 -0.1399 -0.2065 -0.2507 -0.0822 0.0868 0.0901 -0.1284 -0.2324 -0.106 0.0386 0.1417 -0.0097 0.0065 -0.1439 -0.0159 0.3031 0.5494 0.3121 0.3485 0.254 0.4986 0.2772 0.2692 0.174 0.4424 0.1909 0.1735 0.371 0.568 0.3398 0.3767 0.281 0.4485 0.2491 0.2394 0.6148 0.6236 1 0.7709 0.2864 0.4493 0.3177 0.3703 0.2305 0.0938 0.1736 0.1678 0.1957 0.1747
PL13G -0.0961 0.1997 0.0532 0.14 0.0539 0.1893 0.2718 0.2142 0.1603 0.0401 0.19 0.0603 0.0957 0.0758 0.1002 0.1639 0.0342 0.0843 0.0951 0.0564 -0.1581 -0.102 -0.1609 -0.1163 -0.0683 0.2649 0.3448 -0.0809 0.1329 0.0767 0.0776 0.2495 0.2987 0.212 0.0394 0.0201 0.2286 0.2705 0.2608 0.4347 0.202 0.1643 0.0159 0.1857 0.0833 -0.0107 0.1007 0.0657 -0.0879 0.0733 0.0962 0.0224 -0.1135 -0.2235 0.0005 0.0015 0.0571 0.0803 -0.0671 -0.2215 -0.008 0.1018 0.1381 0.0699 -0.0649 0.1012 -0.0469 0.0348 0.0528 0.1095 0.1926 0.4086 0.4161 0.0123 0.2276 0.2251 -0.0198 0.0616 -0.0523 0.158 0.0249 0.1079 -0.0091 0.0414 0.2022 0.1618 0.0461 0.1645 -0.1331 0.0619 0.0739 -0.0244 -0.0162 0.101 -0.0904 0.1427 0.0086 -0.0072 -0.0061 0.1483 0.0006 0.3065 0.2849 0.1344 0.2979 0.3022 0.1122 0.2891 0.3245 0.1041 0.2721 0.2386 0.1703 0.3547 0.3086 0.151 0.2379 0.1913 -0.0155 -0.0442 -0.1244 -0.0491 -0.183 -0.086 -0.2178 -0.1113 -0.031 -0.0665 -0.2524 -0.061 -0.0988 -0.0394 -0.1129 -0.0277 -0.1788 0.0808 0.2128 0.386 0.2253 0.5438 0.1798 0.3425 0.2158 0.4827 0.1146 0.3092 0.1692 0.3706 0.2498 0.397 0.2484 0.5656 0.1764 0.2959 0.1434 0.4086 0.4908 0.598 0.7709 1 0.2296 0.3733 0.2259 0.4826 0.252 0.1154 0.2329 0.2293 0.2526 0.2283
LW12C 0.0834 0.0446 0.0364 0.0463 -0.086 0.067 0.1088 0.271 0.2205 0.171 0.0494 0.1086 0.222 0.2289 0.2058 0.1525 0.1293 0.1251 0.2544 0.1305 0.1149 0.04 -0.1842 -0.2171 -0.0554 0.1938 0.1176 0.1558 0.1715 0.054 0.3397 0.3258 0.0435 0.133 0.2895 -0.002 0.2989 0.3006 0.3397 0.3263 -0.1002 -0.1731 -0.4148 -0.1182 -0.3077 -0.4788 -0.0715 -0.1349 -0.2545 -0.0851 -0.1932 -0.2724 -0.1448 -0.1593 -0.196 0.2987 0.0311 -0.0549 -0.1871 -0.1996 0.0716 0.1899 -0.1648 0.0558 0.1551 0.4767 0.2991 0.3173 0.3581 0.1979 0.2208 0.3806 0.2543 0.208 0.4003 0.2358 0.1535 0.4347 0.2929 0.3266 0.3545 0.1878 0.0875 0.1466 0.4354 0.4092 0.4003 0.1222 0.1831 0.3628 0.2702 0.1407 0.341 0.0346 0.1085 0.4183 0.3067 0.1303 0.3494 0.1798 0.0129 0.466 0.2943 0.3536 0.4429 0.2685 0.1936 0.2609 0.188 0.3808 0.4367 0.2486 0.0993 0.3668 0.0896 0.3411 0.4257 0.1287 0.1899 0.1952 0.3424 0.013 0.0849 -0.1234 0.1389 0.2462 0.2815 0.0959 0.1355 -0.1687 0.0818 0.279 0.3146 0.1868 0.1932 0.1514 0.7999 0.4696 0.3334 0.3158 0.8891 0.4845 0.4008 0.3637 0.8166 0.4447 0.3578 0.3397 0.8356 0.4641 0.3 0.3029 0.8172 0.4535 0.2926 0.2856 0.5126 0.1911 0.2864 0.2296 1 0.4414 0.2835 0.3274 0.1631 0.0655 0.0506 0.1879 -0.2358 0.0842
LW13C 0.0291 -0.0109 -0.1283 -0.174 -0.2099 0.0921 0.1439 0.0595 0.2318 0.0328 0.1347 0.1813 0.2739 0.263 0.3101 0.3098 0.1224 0.3319 0.2434 0.1815 0.2005 -0.1409 -0.0498 -0.1622 -0.1647 0.2051 0.0208 0.0102 0.0505 -0.0133 0.2459 0.0493 -0.0093 0.0523 0.2202 -0.0292 0.0138 0.3162 0.2188 0.2633 0.1932 0.1037 -0.2246 -0.1823 -0.1511 -0.2384 0.1862 -0.0258 -0.201 -0.305 -0.1699 -0.2562 -0.172 -0.1347 -0.2167 0.1655 0.1809 0.0517 0.0623 -0.2566 0.0354 0.0893 -0.0702 0.1212 0.1918 0.264 0.1733 0.1462 0.2715 0.1662 0.0673 0.3513 0.3372 0.0428 0.3367 0.2082 0.2187 0.2879 0.193 0.1705 0.2854 0.168 0.2586 -0.0447 0.3105 0.3492 0.4379 0.0853 0.232 0.1567 0.3414 -0.136 0.2543 0.0499 0.3848 0.2901 0.4454 -0.0402 0.2978 0.1713 -0.0847 0.3562 0.6037 0.1798 0.4021 0.3052 0.0097 0.1817 0.4919 0.1635 0.3505 0.2271 -0.0632 0.3795 0.3236 0.1689 0.3027 0.1491 0.4386 0.1629 0.2272 -0.2095 0.0096 -0.2218 0.2611 0.1544 0.2291 -0.2741 0.071 -0.0992 0.5164 0.1992 0.3359 -0.0625 0.1936 0.1339 0.3925 0.8407 0.4145 0.5435 0.4526 0.8603 0.4411 0.5365 0.3973 0.7802 0.3739 0.4689 0.4841 0.8164 0.3908 0.5221 0.4805 0.811 0.4021 0.4958 0.2852 0.1436 0.4493 0.3733 0.4414 1 0.4537 0.5146 0.1829 0.1272 0.029 -0.0528 -0.1235 0.0792
LW12G 0.1357 -0.1874 -0.1616 -0.0248 -0.0762 0.033 0.0316 0.0829 0.1165 -0.0266 0.1362 0.2302 0.2161 0.1793 0.3065 0.1078 0.1468 0.3021 0.2143 0.2378 -0.0322 -0.1934 -0.0191 0.0262 -0.0538 0.1135 0.0622 -0.0383 0.0553 0.0503 0.0227 0.0446 0.1438 -0.0174 -0.1116 0.0226 -0.0123 0.243 0.2634 0.2619 0.0977 0.0393 -0.2539 -0.2194 -0.2768 -0.2872 0.0093 -0.0812 -0.0599 -0.1871 -0.2418 -0.2486 0.0634 -0.0186 -0.1337 0.048 0.1625 -0.0297 0.1679 -0.0927 -0.1655 0.1202 0.0361 0.064 0.2368 0.2738 0.3557 0.138 0.3193 0.191 0.2307 0.4314 0.3702 0.1296 0.375 0.2519 0.179 0.233 0.3438 0.1202 0.3612 0.1784 0.17 -0.0305 0.2616 0.3382 0.4316 0.0748 0.1911 0.2874 0.515 -0.0213 0.3375 0.1753 0.2986 0.3834 0.5001 0.0285 0.37 0.1574 0.015 0.2465 0.4999 0.1347 0.3835 0.282 0.0599 0.2791 0.3211 0.0927 0.3885 0.2098 0.1073 0.3291 0.176 0.0061 0.3256 0.2359 0.116 0.1775 0.244 -0.1583 0.0768 -0.202 0.1269 0.217 0.476 -0.1022 0.1907 0.0821 0.2384 0.3006 0.4621 0.0521 0.2892 0.0761 0.3071 0.5295 0.7548 0.4772 0.2859 0.4952 0.7557 0.4345 0.2083 0.3788 0.6055 0.3621 0.3148 0.5297 0.7391 0.4368 0.3089 0.5162 0.7301 0.4334 0.1924 0.3549 0.3177 0.2259 0.2835 0.4537 1 0.4624 0.2174 0.2041 -0.0073 0.1787 0.0831 0.145
LW13G 0.1536 0.1081 0.0253 0.104 0.0183 0.0934 0.1567 0.255 0.2508 0.0686 0.1909 0.1723 0.3001 0.132 0.2616 0.2156 0.1507 0.3179 0.2639 0.1612 -0.0309 -0.0535 -0.1585 -0.0647 -0.1221 0.1832 0.3015 0.2467 0.1816 0.292 0.0144 0.2214 0.2796 0.174 0.0273 0.2301 0.1778 0.3777 0.3825 0.4112 0.0577 0.0593 -0.2366 -0.0728 -0.2376 -0.2153 0.0184 0.0044 -0.2929 -0.1719 -0.2577 -0.3255 -0.2939 -0.1728 -0.0693 0.2205 0.4047 0.1718 -0.074 -0.1262 -0.0307 0.1855 -0.0799 0.0657 0.4018 0.1808 0.1484 0.1551 0.318 0.2366 0.2927 0.3221 0.3163 0.0424 0.2945 0.2093 0.4512 0.1495 0.2016 0.2025 0.333 0.2422 0.3597 0.0377 0.2067 0.3109 0.207 0.1485 0.4062 0.133 0.2451 -0.0064 0.2642 0.1615 0.4705 0.2349 0.3468 0.0169 0.2838 0.1981 0.2049 0.2923 0.4188 0.0782 0.3318 0.2558 0.3426 0.3086 0.4239 0.0266 0.3263 0.2014 0.3261 0.2478 0.2 0.0428 0.2882 0.1278 0.4422 0.0375 0.0795 -0.0437 0.0605 -0.0666 0.3418 -0.0039 0.1901 -0.0369 0.094 0.0484 0.5 0.1566 0.3311 0.0004 0.1777 0.1714 0.3211 0.4911 0.4521 0.8016 0.3175 0.4736 0.4751 0.7969 0.2422 0.4711 0.4026 0.6965 0.3545 0.4673 0.4334 0.777 0.334 0.4393 0.4263 0.755 0.2898 0.2209 0.3703 0.4826 0.3274 0.5146 0.4624 1 0.3448 0.2296 0.1541 0.1309 0.0746 0.1277
CC11C -0.1023 -0.1378 -0.0976 0.1828 0.1839 0.0159 0.021 0.0092 0.0726 -0.0989 0.0855 0.1128 0.0384 0.0068 -0.0821 0.1232 0.1645 0.0117 0.1929 -0.0976 0.0427 0.1034 -0.0818 0.1077 -0.0246 0.1198 0.249 0.17 0.1397 0.1882 0.2277 0.1337 0.2079 0.1344 0.1656 0.1705 0.1413 0.367 0.3323 0.4355 0.227 0.1342 0.0766 0.0489 0.0292 0.0079 -0.0085 0.095 0.1128 0.0359 -0.0379 -0.0769 0.2692 -0.0038 0.2832 0.2166 0.2236 0.2798 -0.0731 0.0309 -0.0743 0.0587 0.2149 0.2111 0.3033 0.1751 0.343 0.0153 0.1732 0.0825 0.071 0.2553 0.2757 -0.0207 0.0235 0.0993 0.2741 0.2114 0.332 -0.0159 0.1565 0.074 0.3341 -0.0094 0.2251 0.2207 0.3224 0.1102 0.2987 0.2275 0.388 0.0223 0.2276 0.1191 0.3793 0.2543 0.3703 -0.0849 0.2186 0.1251 0.0996 0.2264 0.1653 0.0594 0.0593 0.0815 0.1397 0.2786 0.1331 0.1403 0.0565 0.0703 0.1984 0.2209 0.1148 0.0469 0.0612 0.0421 0.3618 0.1148 0.34 0.032 0.2636 0.0802 0.2456 0.154 0.4159 0.0331 0.2384 0.1166 0.3497 0.2069 0.3697 -0.0382 0.2426 0.1418 0.0795 0.1248 0.1985 0.3355 0.0962 0.112 0.2319 0.2759 0.1147 0.1186 0.1748 0.2008 0.0831 0.1393 0.2153 0.3493 0.0803 0.1124 0.1939 0.3328 0.056 0.1506 0.2305 0.252 0.1631 0.1829 0.2174 0.3448 1 0.7388 0.7354 0.6694 0.1736 0.6409
CC12C 0.0581 -0.0413 -0.0539 0.0866 0.1132 -0.0367 -0.1112 -0.0521 -0.0958 -0.1925 0.0043 -0.0037 0.1363 -0.0502 -0.0467 0.0047 0.0393 0.0576 0.1582 -0.0831 -0.0204 0.096 -0.1549 0.1955 -0.072 -0.0007 0.2528 0.0567 0.0964 0.0886 0.274 0.0753 0.2601 0.0897 0.2191 0.1062 0.0668 0.3256 0.3594 0.3317 0.0572 0.025 -0.0364 -0.1164 -0.1293 -0.1331 -0.2204 -0.0483 -0.0442 0.0827 -0.1566 -0.1849 0.3282 0.1257 0.091 -0.0101 0.2121 -0.0795 -0.0156 0.0992 -0.0145 -0.0565 0.1388 0.0432 0.2257 0.0759 0.1866 -0.003 0.0791 -0.1192 0.1242 0.092 0.1512 -0.0012 -0.0261 0.0229 0.223 0.1066 0.2185 -0.0156 0.0509 -0.1237 0.1365 -0.0823 0.0906 0.052 0.0875 -0.1048 0.1999 0.1463 0.1938 0.0493 0.1477 -0.1058 0.2411 0.1503 0.1864 -0.0903 0.1229 -0.0686 -0.0426 -0.0086 0.03 -0.0526 -0.0533 -0.0864 0.0568 0.1153 0.0491 0.1626 0.0023 0.0308 0.1096 0.0542 0.0198 -0.045 0.0091 -0.011 0.1995 0.1458 0.1673 0.0522 0.1101 -0.054 0.1849 0.1534 0.2758 0.037 0.1644 -0.1548 0.2098 0.1745 0.2275 -0.0153 0.1408 -0.0703 0.1013 0.0691 0.1399 0.256 0.0893 0.0673 0.168 0.2034 0.1061 0.1044 0.0986 0.1197 0.0706 0.0811 0.1477 0.2793 0.0626 0.0726 0.1329 0.2851 0.0763 0.0572 0.0938 0.1154 0.0655 0.1272 0.2041 0.2296 0.7388 1 0.6108 0.5048 0.0683 0.4857
CC13C -0.0306 -0.0392 0.0022 0.2118 0.1744 0.0718 -0.0957 0.0213 -0.0824 -0.1239 0.0259 0.0004 0.0383 -0.1598 -0.1511 -0.011 0.0162 -0.0517 -0.0473 -0.2233 -0.0408 0.0389 -0.1395 0.1873 -0.15 -0.1212 0.3216 0.1604 0.1295 0.1408 0.2092 0.1805 0.2932 0.1473 0.2606 0.1292 0.2 0.1975 0.1865 0.3232 0.1127 0.0449 0.0613 0.3044 0.1769 0.0667 -0.0684 0.0879 0.0993 0.1628 0.037 -0.0551 0.3816 0.2591 0.2714 0.1596 0.124 0.2654 -0.2079 0.1401 -0.0488 -0.0861 0.1254 0.11 0.0213 -0.0305 0.0323 -0.1575 -0.0958 -0.0929 0.0894 0.1195 0.0986 -0.1627 -0.1337 -0.127 0.0159 0.0111 0.0705 -0.2174 -0.1098 -0.0744 0.0451 0.0083 0.0458 -0.1356 0.0234 -0.0631 0.0292 0.0551 0.0537 -0.0535 -0.052 -0.079 0.1114 0.0596 0.0424 -0.1107 -0.0863 -0.0967 0.0552 0.0852 0.1044 0.012 -0.1418 -0.0857 0.0439 0.1271 0.092 0.0988 -0.1154 -0.16 0.0849 0.0885 0.025 0.0762 -0.0994 -0.1945 0.0418 -0.0084 0.042 0.0026 -0.0949 0.006 0.0104 0.0433 0.1096 -0.0985 -0.0127 0.0293 0.0856 0.0564 0.0675 -0.1346 -0.0689 -0.0119 0.0361 -0.0166 0.0343 0.136 0.0395 -0.0267 0.0134 0.0617 0.0131 0.0022 -0.0686 -0.0164 0.0645 -0.0025 0.059 0.1674 0.0382 -0.032 0.015 0.1345 0.1571 0.172 0.1736 0.2329 0.0506 0.029 -0.0073 0.1541 0.7354 0.6108 1 0.6138 0.152 0.5393
CC11G -0.0162 -0.1929 -0.0986 0.1196 0.14 0.0803 0.0216 0.0492 0.0968 -0.0573 0.1951 0.1446 0.0807 0.128 -0.0082 0.0544 0.1623 -0.0201 0.1417 -0.0437 -0.1984 0.0182 -0.1481 -0.1075 -0.0449 0.1521 0.1816 0.1685 0.0768 0.1408 0.1726 -0.0382 0.1687 0.0551 0.0173 0.104 -0.044 0.1373 0.129 0.352 0.1884 0.0714 0.0648 0.1098 0.0983 0.1324 -0.0345 0.0357 0.0939 0.0266 0.0323 -0.0461 0.1896 -0.0615 0.2454 0.1429 -0.3568 0.4345 -0.0851 0.0903 -0.2344 0.0077 0.1748 0.1307 0.1033 0.0823 0.1488 0.0339 0.0485 0.0155 -0.0103 0.2119 0.1481 0.206 0.0048 0.1536 0.1092 0.0762 0.1389 0.1262 0.0698 -0.0001 0.0969 0.0008 0.0755 0.0113 0.1392 -0.0403 0.1362 0.1314 0.2139 -0.0165 0.0652 0.0575 0.132 0.1439 0.1706 -0.0563 0.0375 0.0067 -0.1448 0.051 0.0112 0.0731 -0.0069 0.0672 -0.0886 0.0996 -0.1284 0.1483 0.0338 -0.0013 -0.0245 0.1415 0.0141 0.1146 0.0591 0.0551 0.1768 0.0418 0.1857 0.1175 -0.0174 -0.1368 0.1252 0.0857 0.2991 0.0278 0.0372 0.0852 0.1028 0.0759 0.1729 0.0118 -0.0035 -0.0199 0.0953 -0.0926 0.1929 0.2164 0.1091 -0.0973 0.2206 0.1446 0.1159 -0.1425 0.162 0.0565 0.1049 -0.0606 0.2171 0.2475 0.1049 -0.0916 0.1938 0.224 0.0534 0.2203 0.1678 0.2293 0.1879 -0.0528 0.1787 0.1309 0.6694 0.5048 0.6138 1 0.2753 0.6811
CC12G -0.1418 -0.0893 -0.1729 -0.0044 0.0495 -0.0196 -0.0562 0.0427 -0.0439 -0.0622 -0.0279 0.0196 -0.1612 -0.1145 -0.0894 -0.1398 -0.0161 -0.1907 -0.0009 -0.127 -0.2544 -0.1056 -0.0074 0.0588 -0.0832 0.0347 0.1598 -0.0682 -0.0004 -0.0489 0.1334 0.026 0.1431 0.0154 0.0831 -0.101 0.0395 0.0601 -0.0105 0.0697 0.3941 0.1733 0.3047 -0.0178 0.1313 0.1566 0.1326 0.0227 -0.0208 -0.055 0.0946 0.0559 -0.0075 -0.0501 0.2645 -0.1367 -0.1823 0.1558 -0.0931 -0.1173 -0.078 -0.0192 0.3552 -0.0127 0.0074 -0.1451 0.0112 0.0688 0.0284 -0.0665 -0.0483 -0.0566 0.1792 -0.042 -0.0638 0.0236 0.0001 -0.1369 -0.0237 -0.0355 0.0348 -0.078 0.1767 0.0924 -0.0643 0.0922 -0.057 -0.0156 0.1389 -0.0476 0.0409 -0.0199 0.0408 0.0114 0.1771 -0.0704 -0.0723 0.0364 0.034 -0.0218 0.0536 -0.1287 0.0552 -0.0824 0.0638 0.0194 0.0443 -0.0752 -0.0101 -0.1424 -0.0243 0.0135 0.0857 -0.171 0.138 -0.0747 -0.0477 0.0135 0.1735 0.0001 -0.1776 -0.0193 0.0752 -0.0467 0.1559 -0.0252 0.0225 -0.1085 0.0678 -0.0029 0.2354 -0.0088 -0.1499 -0.0695 0.0723 -0.0366 -0.2604 -0.1505 0.1322 0.1448 -0.3427 -0.1908 0.0736 0.156 -0.3329 -0.1957 0.0498 0.1347 -0.2992 -0.1335 0.1672 0.1838 -0.315 -0.1742 0.1323 0.1498 -0.0719 0.207 0.1957 0.2526 -0.2358 -0.1235 0.0831 0.0746 0.1736 0.0683 0.152 0.2753 1 0.3095
CC13G -0.0759 -0.0636 -0.0607 0.0833 0.1797 0.1637 0.1148 -0.0324 0.1478 -0.1155 0.1574 0.0756 -0.0414 -0.029 -0.2368 0.1023 0.1222 -0.0219 -0.0117 -0.262 -0.0157 0.1012 0.0662 -0.0435 -0.0653 0.1268 0.2081 -0.0674 0.0265 0.0892 0.0948 -0.1289 0.2353 0.0099 0.0916 -0.0198 -0.087 0.1862 0.1509 0.2898 0.4003 0.1944 0.1359 0.2695 0.3966 0.2839 0.1213 0.158 0.1217 0.2375 0.2263 0.1006 0.2206 -0.1586 0.2729 -0.0349 0.0348 0.2625 -0.4042 -0.0155 -0.0966 0.0051 0.1388 0.0782 0.0171 -0.0481 0.2046 -0.14 -0.0848 0.0299 -0.0835 0.1671 0.2808 0.0157 -0.0367 0.1049 -0.0384 -0.0453 0.1431 -0.1722 -0.0907 0.009 0.127 -0.0548 0.0151 -0.0201 0.1951 0.0305 0.1047 0.0442 0.3741 -0.0676 0.0117 0.102 0.1672 0.0693 0.305 -0.0541 0.0209 0.1416 0.0148 -0.0427 0.1474 -0.0981 -0.1337 -0.0108 0.058 0.0839 0.2016 0.0002 -0.0139 0.0045 0.0626 0.1399 0.2075 0.0262 0.0402 0.0997 0.1241 0.0362 0.0903 0.1491 0.0958 0.0575 0.0338 -0.0032 0.311 -0.0256 -0.0046 0.132 0.1109 -0.0023 0.2158 -0.0133 -0.0148 0.1252 0.0233 0.0555 0.1859 0.1937 -0.0146 0.0175 0.1895 0.1326 -0.0727 0.0054 0.1358 0.0386 0.0176 0.0813 0.2335 0.2554 -0.0082 0.0585 0.2062 0.233 0.1342 0.2215 0.1747 0.2283 0.0842 0.0792 0.145 0.1277 0.6409 0.4857 0.5393 0.6811 0.3095 1
1 = = = =2 = = = =3 = = = =4 = = = =5 = = = =6 = = = =7 = = = =8 = = = =
==
Leaf blade lengthPetiole lengthLeaf weightChlorophyll content
Fruit develepment periodLeaf fallIntensity skin colorPercentage skin colorSolid soluble content
Flesh cheek diameterFlesh suture diameterLeaf perimeterLeaf surfaceLeaf blede widthLeaf length
Flesh weightFruit polar diameterFruit cheek diameterFruit suture Stone polar Stone cheek
31323334
Beginning of shootingBeginning of floweringEnd of floweringFlowering durationFruit productionMaturity date
252627282930
1516
1718192021222324
91011121314
Pistil SizeBlooming
Stone suture Flesh polar diameter
Titratable acidityFruit weightStone weight
31
32
33
34
25
26
27
28
29
30
19
20
21
22
23
24
13
14
15
16
17
18
8
9
10
11
12
2
3
4
5
6
7
30 31 32 33 34
1
24 25 26 27 28 2918 19 20 21 22 2311 12 13 14 15 163 4 5 178 9 106 71 2
Annex 8
All putative QTLs identified in this study using the TxE and T1E progenies, including trait name, location, population where it was identified, QTL name (according to the GDR recommendations), year when
phenotypic data was obtained, LOD score of the maximum peak, nearest marker, position of the maximum peak, and parameters for genic action estimation (a, d, d/a) and gene action. In TxE is
((A+B)/2), being the A the almond allele and in T1E is A-H, being A the homozygous almond allele. U: underdominant, D: dominance for peach allele; AD: partial dominance for peach allele; A: additive,
AR: partial dominance for a allele; R: dominant for peach allele, O: overdominant.
185
Trait AcronymPopulati
onLocation Year G LOD Nearest marker
Position
(cM)R2 a d d / a
Genic
action
1 3.05 SNP_IGA_107417 39.4 8.4 0.29
4 7.13 CPDCT045 24.7 18.4 -0.47
TxE Gimenells 2011-2013 6 25.44 CPPCT030 76.2 74.4 0.28 1.21 4.39 O
2012 1 6.70 CPPCT029 49.2 25.7 -1.14
2013 1 7.54 SNP_IGA_109897 42.2 23.8 -1.23
TxE Gimenells 2013 1 2.54 SNP_IGA_129422 81.6 14.50 0.94 0.08 0.09 A
Trait CodePopulati
onLocation Year G LOD Nearest marker
Position
(cM)R2 a d d / a
Genic
action
2011 1 2.59 SNP_IGA_123719 53.6 7.4 2.94
8 3.93 CPPCT006 13.7 10.8 3.54
2012 4 4.38 SNP_IGA_383492 13.8 12.7 2.97
8 4.38 SNP_IGA_803758 7.0 12.7 2.84
2013 8 3.75 SNP_IGA_796755 1.6 11.6 4.93
2012 2 3.61 SNP_IGA_144919 3.8 12.1 2.38
8 2.55 SNP_IGA_802339 6.2 8.6 2.02
2013 2 4.54 CPSCT044 19.0 13.5 1.97
2012 6 3.14 SNP_IGA_694098 74.4 16.6 -0.73 2.81 -3.85 U
2013 6 2.53 CPPCT030 76.2 13.4 -1.47 3.57 -2.43 U
2011 7 4.24 SNP_IGA_779386 41.4 12.1 3.73
2012 4 3.11 SNP_IGA_370357 6.3 9.2 2.41
7 7.51 SNP_IGA_779386 41.4 21.8 3.72
2013 7 8.13 SNP_IGA_779386 41.4 23.5 7.03
Gimenells 2012 7 3.28 SNP_IGA_781455 45.3 11.0 2.30
2011 2 2.77 SNP_IGA_288668 47.3 9.1 -2.94
8 3.63 SNP_IGA_802339 6.2 11.5 3.26
2012 1 4.27 SNP_IGA_99943 28.4 12.3 -3.06
5 4.80 SNP_IGA_601135 34.5 13.8 -3.24
8 5.66 SNP_IGA_803758 7.0 16.0 -3.48
2013 1 3.95 SNP_IGA_31646 14.3 12.4 -6.52
5 3.95 SNP_IGA_601135 34.5 12.7 -6.39
8 4.02 SNP_IGA_796755 1.6 12.7 6.40
2012 1 8.62 SNP_IGA_109897 42.2 26.3 -3.31
2 3.14 pchgms1 28.6 10.5 -2.07
2013 1 6.39 SNP_IGA_101331 31.4 19.1 -2.82
2 2.86 CPPCT044 7.5 9.0 -1.94
2012 1 4.47 CPPCT010 80.1 23.8 -2.12 0.10 -0.05 A
2013 1 3.68 CPPCT010 80.1 19.8 -2.32 0.56 -0.24 A
2011 7 2.50 SNP_IGA_769471 45.3 11.0 2.30
2012 7 3.36 SNP_IGA_769471 28 8.7 2.84
2011 8 3.08 SNP_IGA_796755 1.6 12.1 3.42
2012 1 4.53 SNP_IGA_91583 23.3 13.1 -2.95
2 2.65 UDA-023 49.9 7.8 -2.32
5 2.57 SNP_IGA_601135 34.5 7.7 -2.25
8 4.63 CPSCT018 0.0 13.3 2.96
2013 1 6.70 SNP_IGA_96232 24.8 20.6 -6.45
2 2.85 SNP_IGA_288668 47.3 9.4 -4.38
8 5.44 SNP_IGA_796755 1.6 17.0 5.86
2012 1 6.79 SNP_IGA_10635 4.1 23.3 -2.42
2 3.41 SNP_IGA_275057 20.6 12.3 -1.74
2013 1 6.37 SNP_IGA_91583 23.3 19.8 -3.37
2012 1 4.29 SNP_IGA_10520 3.2 23.0 -1.95 0.27 -0.14 A
3 4.26 EPDCU0532 43.7 24.0 2.02 -0.54 -0.27 A
2011 7 3.62 SNP_IGA_776994 36.8 13.6 3.61
2012 7 4.65 SNP_IGA_778138 40.8 14.3 3.07
2013 7 2.50 SNP_IGA_776994 36.8 8.9 4.24
2012 5 3.05 EPDCU4658 28.8 9.0 1.11
2013 5 2.53 CPSCT022 36.9 8.3 2.23
Gimenells 2012 1 6.24 SNP_IGA_109223 40.1 22.5 1.72
TxE Gimenells 2012 7 3.08 SNP_IGA_782427 40.9 19.7 -1.08 -0.43 0.40 AR
T1ECabrils -
Gimenells2011-2013 6 13.94 SNP_IGA_683956 30.6 33.3 1.19
TxE Gimenells 2011-2013 6 11.39 CPPCT030 76.2 45.7 0.36 1.21 3.40 O
2011 4 8.16 SNP_IGA_413115 36.1 44.8 30.99
8 3.06 SNP_IGA_859354 12.2 20.0 20.93
2012 4 12.06 SNP_IGA_409167 31.6 35.9 29.38
2013 4 4.47 SNP_IGA_412662 34.3 32.9 17.67
2011 4 10.91 SNP_IGA_420316 40.6 57.9 40.01
2012 4 11.81 SNP_IGA_413115 36.1 43.1 32.08
2013 4 9.71 EPPCU2000 37.0 44.9 33.49
2011 4 10.05 SNP_IGA_413115 35.2 81.9 45.31 -2.79 -0.06 A
2012 4 11.41 SNP_IGA_412380 34.3 77.7 36.71 1.02 0.03 A
2013 4 9.28 SNP_IGA_412380 34.3 76.1 37.05 4.18 0.11 A
E Cabrils 2012 4 4.92 BPPCT015 52.6 18.6 -20.01
2011 4 6.96 SNP_IGA_413115 36.1 43.2 29.43
2012 4 11.36 SNP_IGA_412380 31.6 34.2 29.07
2013 4 3.74 SNP_IGA_412380 33.4 28.3 18.15
2012 4 11.89 SNP_IGA_413115 36.1 48.8 34.63
2013 4 9.02 EPPCU2000 37.0 43.8 33.74
2012 4 11.52 SNP_IGA_412380 34.3 79.5 37.48 3.88 0.10 A
2013 4 7.91 SNP_IGA_412380 34.3 75.3 38.11 6.67 0.18 A
E Cabrils 2012 4 4.29 BPPCT015 52.6 16.9 -18.98
2010-2011 8 3.78 SNP_IGA_796755 1.6 11.1 12.20
2011-2012 1 3.29 SNP_IGA_55903 16.5 8.8 10.66
3 3.53 SNP_IGA_364833 39.4 9.6 11.05
8 4.27 SNP_IGA_796755 1.6 11.3 11.95
2012-2013 3 2.96 SNP_IGA_364833 39.4 9.0 8.81
8 3.53 SNP_IGA_869040 23.1 10.7 9.68
Juvenility
periodJuv T1E Cabrils 2006-2012 6 3.94 BPPCT025 24.1 12.6 -0.61
Leaf fall LF T1E Cabrils
Fruit
develepme
nt period
FDP
T1E
Cabrils
Gimenells
TxE Gimenells
Fruit
productionFP
Maturity
dateMD
T1E
Cabrils
Gimenells
TxE Gimenells
E Cabrils
Flowering
durationFD
T1ECabrils
Gimenells
E Cabrils
Endl of
flowering
time
EFT
T1E
Cabrils
Gimenells
TxE Gimenells
TxE Gimenells
ECabrils
Begining of
flowering
time
BFT
T1E
Cabrils
Gimenells
TxE
Bloming
densityBD
T1E Gimenells
QTLs Phenology
Beginning
of shooting BS
T1E
Cabrils
Gimenells
QTLs Flower
Pistil length PiLT1E
Cabrils -
Gimenells2011-2013
186
Trait CodePopulati
onLocation Year G LOD Nearest marker
Position
(cM)R2 a d d / a
Genic
action
Blood flesh Bf TxE Gimenells 2011-2013 3 3.95 SNP_IGA_317001 18.0 50.7 -0.50 -0.14 0.29 AR
Juiciness Jui TxE Gimenells 2011-2013 1 2.76 SNP_IGA_129422 81.6 31.8 0.40 0.21 0.53 AR
2012 1 3.64 CPPCT053 48.7 17.0 0.68
4 3.24 M12a 31.6 15.3 -0.66
2013 1 8.33 SNP_IGA_88751 22.6 59.9 1.40
2011 1 3.38 SNP_IGA_23251 5.5 25.1 0.91
2012 1 6.33 SNP_IGA_91583 23.3 25.2 0.92
4 5.55 SNP_IGA_409167 31.6 22.4 -0.88
2013 1 4.61 EPPCU5331 12.2 23.3 0.83
4 3.53 M12a 31.6 18.4 -0.76
2011 1 3.16 SNP_IGA_123719 53.6 25.5 1.03
4 4.60 M12a 31.6 33.0 -1.13
2012 1 6.63 SNP_IGA_126668 52.8 30.3 0.98
4 2.93 SNP_IGA_412380 33.4 14.5 -0.68
8 3.07 CPPCT006 13.7 15.0 0.69
2013 1 8.08 BPPCT028 51.2 57.9 1.52
4 2.50 M12a 31.6 23.5 -0.95
2011 1 2.55 SNP_IGA_126668 52.8 19.9 0.88
2012 1 7.99 BPPCT028 51.2 30.5 1.09
4 6.25 M12a 31.6 24.8 -0.98
2013 1 3.96 SNP_IGA_123719 53.6 22.1 1.01
4 6.63 M12a 31.6 32.1 -1.21
8 3.12 SNP_IGA_885121 47.5 18.5 0.92
2011 3 3.99 SNP_IGA_317001 18.2 57.6 -1.50 0.35 -0.23 A
2012 3 4.26 SNP_IGA_887061 24.7 41.7 -1.32 0.57 -0.43 AD
4 3.75 SNP_IGA_418582 39.4 37.4 -1.12 0.34 -0.30 AD
2013 3 3.00 SNP_IGA_321565 21.5 37.4 -1.33 1.23 -0.93 D
4 3.22 SNP_IGA_412380 34.3 39.6 -0.81 -1.90 2.35 U
2011 1 2.55 CPPCT004 7.9 20.6 2.68
2012 1 4.98 EPPCU5331 12.2 26.3 3.94
Gimenells 2012 4 3.09 UDA-021 40.6 15.0 2.01
Cabrils 2013 1 3.17 EPDCU3489 35.3 27.2 3.89
2011 1 2.80 CPPCT003 21.2 21.6 3.65
2012 6 3.55 CPPCT21245 0 18.1 4.20
2013 1 3.58 CPPCT029 49.2 19.3 3.94
6 2.75 SNP_IGA_623894 9.2 15.2 3.37
2011 2 3.29 SNP_IGA_290243 49.9 67.7 3.78 -1.90 -0.50 AD
2012 6 3.21 MA14a 71.6 46 6.09 -3.11 -0.51 AD
2013 6 3.31 SNP_IGA_691196 69 43.6 7.37 -2.32 -0.31 AD
2012 1 3.20 SNP_IGA_17419 4.8 14.4 -20.74
2 4.98 UDA-023 49.9 21.3 -25.08
2011 6 2.71 CPP21413 0.0 21.3 24.80
2012 6 5.30 CPP21413 0.0 21.7 28.60
7 3.09 SNP_IGA_769687 13.9 13.5 22.47
8 3.11 CPSCT018 0.0 13.4 22.52
2013 6 3.58 CPP21413 0.0 18.9 28.08
7 3.18 PPCT057 18 17.7 -27.42
2011 4 6.56 SNP_IGA_410265 31.7 66.6 -13.87 24.80 -1.79 U
2012 4 6.93 SNP_IGA_410265 31.7 57.2 -15.68 26.76 -1.71 U
2013 4 4.65 SNP_IGA_410265 31.7 48.5 -10.73 33.94 -3.16 U
2011 6 3.61 SNP_IGA_682735 28.8 28.1 -2.78
2012 2 4.29 PceGA34 45.1 19.3 2.21
6 9.35 CPPCT047 27.6 37.4 -2.98
8 3.24 SNP_IGA_796755 1.6 15.7 -1.92
2013 8 3.56 BPPCT006 7.8 33.7 -2.76
2011 2 2.69 SNP_IGA_284602 41.3 22.9 2.46
6 4.90 CPPCT047 27.6 37.5 -3.44
7 3.04 SNP_IGA_783262 29.9 25.3 2.38
2012 6 8.99 CPPCT047 27.6 35.3 -3.32
8 3.95 CPSCT018 0.0 17.4 -2.28
2013 2 3.63 UDP98-411 26.3 19.3 2.70
6 7.84 CPPCT047 27.6 37.1 -3.82
7 3.38 UDP98-408 12.9 18.1 2.52
8 3.90 SNP_IGA_795756 0.8 20.7 -2.69
2012 2 5.08 pchgms1 33.7 47.8 -2.11 -1.69 0.80 R
6 4.05 SNP_IGA_686609 61.3 40.6 2.61 -0.79 -0.30 AD
2013 2 3.80 pchgms1 33.7 41.2 -2.80 -1.13 0.40 AR
6 4.69 MA14a 71.6 48.1 6.30 -4.55 -0.72 AD
Cabrils 2012 2 3.75 UDA-023 49.9 17.1 -20.57
2011 7 3.34 SNP_IGA_790122 38.3 27.5 -25.17
2012 1 3.06 EPDCU3122 0.8 13.8 -21.53
4 3.28 SNP_IGA_409167 31.6 14.7 22.44
6 5.06 CPP21413 0.0 21.8 26.93
7 2.88 SNP_IGA_769687 13.9 13.3 -21.03
2013 6 3.59 CPP21413 0.0 19.1 26.59
7 2.86 CPPCT047 18.0 16.3 -24.75
2011 4 6.56 SNP_IGA_410265 31.7 66.6 -13.40 23.94 -1.79 U
2012 4 6.70 SNP_IGA_410265 31.7 58.0 -15.60 26.35 -1.69 U
5 3.24 SNP_IGA_586202 16.1 35.9 -12.11 -26.77 2.21 O
6 3.09 SNP_IGA_613848 2.0 35.1 -26.45 -15.59 0.59 AR
2013 4 4.78 SNP_IGA_410265 31.7 49.4 -10.29 31.86 -3.09 U
5 2.85 SNP_IGA_586202 16.1 37.3 -19.29 -18.21 0.94 R
Flesh weight FlW
T1EGimenells
TxE Gimenells
Stone weight SW
T1E
Cabrils
Gimenells
TxE Gimenells
Fruit weight FW
T1E
Cabrils
Gimenells
TxE Gimenells
Soluble
solid
content
SSC T1ECabrils
Titratable
acidityTA
T1EGimenells
TxE Gimenells
Percentage
skin colorPSC
T1E
Cabrils
Gimenells
TxE Gimenells
QTLs fruit quality
Intensity
skin colorISC T1E
Cabrils
Gimenells
187
Cabrils 2012 1 3.15 SNP_IGA_17419 4.8 14.5 -0.65
2012 6 4.05 CPP21413 0.0 17 0.58
2013 6 3.72 CPP21413 0.0 19.7 0.64
7 3.17 pchgms6 11.4 17.1 -0.59
2011 4 5.72 SNP_IGA_410265 31.7 61.7 -0.61 0.78 -1.28 U
2012 4 5.62 SNP_IGA_410265 31.7 50.0 -0.47 0.79 -1.69 U
2013 4 2.90 SNP_IGA_410265 31.7 35.8 -0.31 0.85 -2.73 U
Cabrils 2012 2 3.68 SNP_IGA_288668 47.3 16.3 -0.66
2011 7 3.31 EPPCU5176 30.6 23.4 -0.71
2012 6 3.94 Ps7a2 1.1 16.6 0.57
7 3.56 SNP_IGA_769687 13.9 15.5 -0.55
8 3.22 CPSCT018 0.0 13.8 0.52
2013 7 3.66 CPPCT057 18.0 20.3 -0.61
2011 4 7.94 SNP_IGA_410265 31.7 73.3 -0.74 1.08 -1.45 U
2012 4 8.36 SNP_IGA_410265 31.7 64 -0.64 1.03 -1.60 U
2013 4 5.29 SNP_IGA_410265 31.7 55.1 -0.53 1.07 -2.01 U
2012 1 3.35 SNP_IGA_17419 4.8 15.2 -0.63
2 3.30 UDA-023 49.9 14.8 -0.61
2012 6 5.86 Ps7a2 1.1 23.6 0.64
7 3.51 SNP_IGA_769687 13.9 15.1 -0.51
8 3.21 CPSCT018 0.0 13.8 0.49
2013 6 4.01 Ps7a2 1.1 21.1 0.62
7 3.01 pchgms6 11.4 16.3 -0.55
2011 4 8.04 SNP_IGA_410265 31.7 73.9 -0.65 0.85 -1.31 U
2012 4 8.16 SNP_IGA_410265 31.7 63.2 -0.64 0.85 -1.33 U
2013 4 4.42 SNP_IGA_410265 31.7 48.9 -0.49 0.91 -1.87 U
2012 5 3.78 EPDCU5183 26.9 17.1 0.42
6 5.39 CPP21413 0.0 23.4 0.49
2012 5 5.68 BPPCT037 17.9 23.2 0.51
6 7.80 SNP_IGA_623894 9.20 30.5 0.58
2013 5 7.24 BPPCT037 17.9 34.4 0.61
6 4.48 SNP_IGA_623894 9.2 23.3 0.51
2011 5 3.33 SNP_IGA_5947445 28.3 42.2 0.42 -0.05 -0.12 A
2012 5 3.44 SNP_IGA_5947445 28.3 35.6 0.44 -0.08 -0.18 A
2013 2 3.47 pchgms1 33.7 39.3 -0.37 -0.34 0.92 R
6 3.08 SNP_IGA_676571 50.1 40.7 0.50 -0.38 -0.76 D
2011 6 4.14 SNP_IGA_629177 14.5 31.6 0.39
2012 6 7.64 SNP_IGA_680864 28.2 31.7 0.39
2013 6 2.77 BPPCT025 27.3 27.3 0.28
2011 6 4.17 BPPCT008 16.0 34.0 0.47
2012 6 11.44 CPPCT047 27.6 41.3 0.46
8 4.74 CPSCT018 0.0 19.8 0.32
2013 6 10.58 CPPCT047 27.6 46.0 0.54
7 3.35 pchgms6 11.4 17.7 -0.32
8 3.45 SNP_IGA_803758 7.0 18.6 0.32
2012 2 3.91 pchgms1 33.7 39.4 -0.23 -0.23 1.00 R
6 3.38 SNP_IGA_680032 56.7 35.2 0.29 -0.05 -0.17 A
2013 2 3.33 pchgms1 33.7 38.1 -0.29 -0.16 0.57 AR
2011 6 3.86 SNP_IGA_682735 28.8 30.9 0.38
2012 2 3.12 SNP_IGA_285058 35.1 14.8 -0.25
6 8.95 CPPCT047 27.6 35.8 0.39
2013 6 3.60 EPPCU4092 37.0 34.0 0.30
2011 6 4.41 pchcms5 20.7 33.4 0.33
2012 6 10.24 SNP_IGA_683956 30.6 38.4 0.38
8 4.31 CPSCT018 0.0 18.2 0.26
2013 2 3.12 SNP_IGA_284602 41.3 16.7 -0.25
6 10.17 SNP_IGA_683956 30.6 45.1 0.40
7 3.12 pchgms6 11.4 16.7 -0.23
8 3.10 SNP_IGA_7965756 0.8 16.7 0.23
2012 2 3.56 pchgms1 33.7 36.6 -0.21 -0.19 0.89 R
6 3.81 AMPA130 67.7 38.6 0.31 -0.10 -0.31 AD
2011 4 7.17 SNP_IGA_410955 33.8 69.3 -0.60 0.63 -1.05 D
6 3.32 SNP_IGA_612754 3.1 42.1 -0.67 -0.12 0.18 A
2012 4 8.25 EPPCU2000 36.9 65.2 -0.62 0.56 -0.90 D
5 4 SNP_IGA_571548 8.0 40.0 -0.20 -0.78 3.90 O
2013 4 4.54 SNP_IGA_410955 32.2 49.1 -0.36 0.62 -1.72 U
5 2.75 SNP_IGA_586202 16.1 33.5 -0.36 -0.63 1.75 O
Cabrils 2012 1 3.45 CPPCT004 7.9 16.0 -0.52
Gimenells 2012 7 3.69 SNP_IGA_778002 17.7 15.9 -0.41
2011 4 8.67 SNP_IGA_412380 34.3 77.5 -0.88 1.02 -1.17 D
2012 4 8.28 SNP_IGA_410955 32.6 66.5 -0.60 1.01 -1.67 U
6 3.28 SNP_IGA_611511 5.0 35.2 -0.87 -0.20 0.23 A
2013 4 5.78 SNP_IGA_410265 31.7 58.1 -0.46 0.84 -1.82 U
2012 6 3.66 CPP21413 0.0 15.6 0.39
7 3.72 SNP_IGA_769687 13.9 16.4 -0.40
2013 6 2.53 SNP_IGA_607013 0.7 13.9 0.40
2011 4 8.18 SNP_IGA_412380 34.3 76.9 -0.75 0.84 -1.12 D
2012 4 7.72 SNP_IGA_412380 34.3 63.2 -0.58 0.78 -1.36 U
5 3.00 SNP_IGA_571548 8.2 32.2 -0.16 -0.87 5.26 O
2013 4 4.12 SNP_IGA_410265 31.7 46.5 -0.43 0.78 -1.83 U
Flesh
suture
diameter
FlsD
T1E Gimenells
TxE Gimenells
Flesh polar
diameterFlpD TxE Gimenells
Flesh cheek
diameterFlcD
T1E
TxE Gimenells
Stone
suture
diameter
FsD
T1E
Cabrils
Gimenells
TxE Gimenells
Stone
cheek
diameter
ScD
T1E
Cabrils
Gimenells
TxE Gimenells
Stone polar
diameter SpD
T1E
Cabrils
Gimenells
TxE Gimenells
Fruit suture
diameter FsD
T1E
Cabrils
Gimenells
TxE Gimenells
Fruit cheek
diameter FcD
T1EGimenells
TxE Gimenells
Fruit polar
diameter FpD
T1EGimenells
TxE Gimenells
188
Trait CodePopulati
onLocation Year G LOD Nearest marker
Position
(cM)R2 a d d / a
Genic
action
2012 1 5.02 CPPCT004 7.9 16.9 -353.18
2013 1 7.14 CPPCT004 7.9 23.4 -393.61
8 5.10 SNP_IGA_799291 3.1 16.7 326.32
2012 8 4.12 SNP_IGA_795756 0.8 13.1 215.69
2013 1 2.79 CPPCT004 7.9 9.0 -177.85
8 5.70 SNP_IGA_796755 1.6 17.0 243.57
2012 1 3.40 CPPCT026 45.0 18.5 -228.65 3.64 -0.02 A
3 4.48 EPPCU5990 0.0 24.4 -228.89 -198.03 0.87 R
2012 1 5.25 SNP_IGA_9197 3.4 17.4 -45506.30
2013 1 6.77 SNP_IGA_23351 5.5 21.8 -71488.70
7 3.04 CPPCT017 39.1 10.3 46565.50
8 3.50 SNP_IGA_800634 4.7 11.8 50407.50
2012 2 3.32 CPSCT021 38.1 10.7 -33464.50
7 3.30 EPDCU3392 41.9 10.7 33266.00
8 3.35 SNP_IGA_795756 0.8 10.8 33737.40
2013 1 3.71 SNP_IGA_2651 0.0 11.5 -35530.10
7 2.82 EPPCU5176 30.6 8.8 30825.00
8 3.99 SNP_IGA_796755 1.6 12.2 36602.50
2013 1 3.27 CPPCT026 45.0 18.2 -31120.70 2587.07 -0.08 A
3 5.13 EPPCU5990 0.0 27.1 -33901.10 -26779.80 0.79 R
2012 1 2.74 SNP_IGA_2651 0.0 9.5 -23.32
6 3.10 pchcms5 20.7 10.6 23.68
2013 1 4.21 EPDCU3122 0.8 13.8 -35.36
6 4.57 BPPCT025 24.1 14.9 34.91
2013 1 3.14 SNP_IGA_2651 0.0 9.8 -21.64
6 4.63 pchcms5 20.7 14.0 25.66
2012 3 3.45 EPPCU5990 0.0 19.0 -20.49 -22.90 1.12 R
2013 2 3.17 SNP_IGA_279439 29.5 17.5 -27.37 6.11 -0.22 A
2012 1 6.78 CPPCT004 7.9 22.2 -138.87
8 2.89 SNP_IGA_800634 4.7 10.2 91.56
2013 1 6.40 CPPCT004 7.9 21.3 -165.32
8 5.45 SNP_IGA_799291 3.1 17.7 146.99
2012 8 4.01 SNP_IGA_795756 0.8 12.8 87.39
2013 8 5.68 SNP_IGA_796755 1.6 17.0 100.44
2012 1 3.62 CPPCT026 45.0 19.7 -98.52 -10.64 0.11 A
3 4.26 EPPCU5990 0.0 22.7 -94.95 -78.30 0.82 R
2012 1 7.91 CPPCT004 7.9 25.3 -133.56
2013 1 8.05 CPPCT004 7.9 25.9 -167.89
8 4.13 SNP_IGA_799291 3.1 13.8 119.29
2012 8 3.47 SNP_IGA_795756 0.8 11.4 76.11
2013 1 2.78 CPPCT004 7.9 8.9 -71.43
8 4.27 SNP_IGA_796755 1.6 13.0 85.91
TxE Gimenells 2012 3 4.05 EPPCU5990 0.0 21.8 -88.43 -57.88 0.65 AR
2012 5 4.13 SNP_IGA_598784 27.4 13.8 20.22
6 3.37 MA14a 34.9 11.4 18.39
7 2.68 MA20a 25.8 9.2 16.53
8 4.48 SNP_IGA_859354 12.2 14.9 21.25
2013 5 3.44 SNP_IGA_590546 13.5 11.6 18.15
6 4.10 MA14a 34.9 13.5 19.63
7 4.16 CPPCT033 24.1 13.8 19.79
8 13.61 SNP_IGA_870509 28.3 39 34.07
2012 5 2.66 SNP_IGA_590546 13.5 8.9 15.34
7 3.12 PMS02 27.9 10.3 16.55
8 6.78 SNP_IGA_869040 23.1 22.6 25.47
2013 5 3.94 SNP_IGA_589750 12.9 12.4 18.09
6 2.64 MA040a 34.4 8.3 14.75
7 3.82 CPPCT033 24.1 11.7 17.59
8 10.61 SNP_IGA_869040 23.1 29.9 29.01
2012 5 3.06 SNP_IGA_594745 28.3 16.7 23.73 5.68 0.24 A
7 3.32 SNP_IGA_781352 33.6 18.4 38.70 -36.47 -0.94 D
8 2.66 SNP_IGA_876610 36.3 15 18.74 20.10 1.07 R
2013 5 4.83 SNP_IGA_584315 14.8 28.1 29.22 14.09 0.48 AR
8 7.35 SNP_IGA_881120 44.8 35.8 33.09 5.94 0.18 A
2012 1 3.89 SNP_IGA_9197 3.4 14.4 -0.06
6 3.35 pchcms5 20.7 12.3 0.05
2013 1 4.81 SNP_IGA_23251 5.5 15.9 -0.08
6 3.71 pchcms5 20.7 12.3 0.06
7 3.38 EPPCU5176 30.6 11.3 0.06
8 3.58 SNP_IGA_800634 4.7 11.9 0.06
2012 1 3.89 SNP_IGA_18927 5.5 13.5 -0.04
6 2.83 SNP_IGA_687583 33.8 9.5 0.04
7 3.38 EPDCU3392 41.9 11.2 0.04
8 4.02 CPSCT018 0.0 13.2 0.04
2013 1 3.59 SNP_IGA_17419 4.8 11.3 -0.04
8 6.21 SNP_IGA_796755 1.6 18.4 0.06
TxE Gimenells 2012 1 3.32 PaCITA005 17.3 17 -0.04 -0.01 0.12 A
2011 1 3.32 SNP_IGA_121740 49.7 9.3 3.33
2 3.33 UDP96-013 21.6 8.5 -3.13
6 5.27 SNP_IGA_695974 42.0 14.5 -4.09
8 4.65 BPPCT006 7.8 12.8 3.85
2012 6 5.40 CPPCT021 43.0 15.8 -3.82
2013 1 3.51 SNP_IGA_2651 0.0 10.6 2.93
6 5.35 SNP_IGA_695974 42.0 15.7 -3.49
8 2.87 SNP_IGA_802339 6.2 8.7 2.59
2011 1 3.14 CPPCT053 48.7 9.6 2.20
8 2.72 SNP_IGA_800377 3.9 8.4 2.11
2013 1 4.45 CPPCT019 46.7 12.1 2.54
8 3.47 CPSCT018 0.0 9.6 2.25
TxE Gimenells 2013 5 3.20 CPPCT013 30.1 16.7 -2.52 -1.03 0.41 AR
Chlorophyll
content CC
T1E
Cabrils
Gimenells
TxE Gimenells
Leaf weight LWT1E
Cabrils
Gimenells
Leaf blade
lengthLBL
T1E
Cabrils
Gimenells
Petiole
lengthPL
T1E
Cabrils
Gimenells
Leaf length LL
T1E
Cabrils
Gimenells
TxE Gimenells
Leaf blade
widthLBW
T1E
Cabrils
Gimenells
TxE Gimenells
Leaf surface LS
T1E
Cabrils
Gimenells
TxE Gimenells
QTLs Leaf
Leaf
perimeterLP
T1E
Cabrils
Gimenells
TxE Gimenells
189
ABREVIACIONES
ADN: Deoxyribonucleic acid. Ácido desoxirribonucleico.
AFLP: Amplified Fragment Length Polymorphism. Polimorfismo de longitud de fragmentos
amplificados.
ANOVA: Analysis of variance. Análisis de varianza.
BC: Backcross. Retrocruzamiento
BD: Blooming density Densidad de la floración.
BFT: Beginning of flowering time. Comienzo del período de floración.
BS: Beginning of shooting. Comienzo del período de brotación.
CC: Chlorophyll content. Contenido de clorofila.
CIM: Composite interval mapping. Mapeo por intervalos compuesto.
cM: centimorgan. centimorgan.
CRAG: Centre de Recerca en Agrigenòmica. Centro de investigación en Agrigenómica.
CTAB: Cetrimonium bromide. Bromuro de hexadeciltrimetilamonio
DH: Double Haploid Line. Línea doble haploide.
E: Genetic map of ‘Earlygold’ from T1E. Mapa genético del parental ‘Earlygold’ en T1E.
EFT: End of flowering time. Final del período de floración.
FAO: Food and Agricultural Organization of the United Nations. Organización para los
alimentos y la agricultura de las Naciones Unidas.
FcD: Fruit cheek diameter. Diámetro mejilla del fruto
FD: Flowering duration. Duración de la floración.
FDP: Fruit development period. Período de desarrollo del fruto.
FlpD: Flesh polar diameter. Diámetro polar de la pulpa
FlcD: Flesh cheek diameter. Diámetro mejilla de la pulpa
FlsD: Flesh suture diameter. Diámetro sutura de la pulpa
FlW: Flesh weight. Peso de la pulpa
FpD: Fruit polar diameter. Diámetro polar del fruto
FP: Fruit production. Producción de fruta.
FsD: Fruit suture diameter. Diámetro sutura del fruto
FW: Fruit weight. Peso de la fruta
G: Linkage group. Grupo de ligamiento.
GDR: Genome database for Rosaceae. Base de datos genómica para Rosaceae.
IRTA: Institut de Recerca i Tecnologia Agroalimentàries. Instituto de Investigación y Tecnología
Agroalimentarias.
ISC: Intensity of skin color. Intensidad del color de la piel.
Juv: Juvenility period. Período juvenil.
Jui: Juiciness. Jugosidad.
LBL: leaf blade length. Longitud de la lamina foliar.
LBW: leaf blade width. Anchura de la hoja
LD: Linkage disequilibrium. Desequilibrio de ligamiento.
LF: Leaf fall. Período de caída de hoja.
LL: Leaf length. Longitud de la hoja.
LS: Leaf surface. Área de la hoja
190
LP: Leaf perimeter. Perímetro de la hoja.
LOD: Log of Odds. Logaritmo de probabilidades.
LW: Leaf dry weight. Peso seco de la hoja.
MAI: Marker Assisted Introgression. Introgresión asistida por marcadores.
MAS: Marker Assisted Selection. Selección asistida por marcadores.
Mb: Mega pairs base. Mega pares de bases.
MD: Maturity date. Fecha de maduración de la fruta.
NIL: Near Isogenic Line. Línea casi isogénica.
PCR: Polymerase Chain Reaction. Reacción en cadena de la polimerasa.
PL: Petiole length. Longitud del peciolo.
PiL: Pistil length. Longitud de pistilo.
PPR: Pentatricopeptide. Pentatricopeptidos
PSC: percentage of surface covered by anthocyanin coloration. Porcentaje de coloración
antociánico en la piel de los frutos.
QTL: Quantitative Trait locus. Locus de carácter cuantitativo.
RAPD: Random Amplified Polymorphic DNA. DNA polimórfico amplificado aleatoriamente.
RIL: Recombinant Inbred Line. Línea recombinante consanguínea.
RNase: Ribonuclease. Ribonucleasa.
Rf: Restorer of fertility. Restauradores de la fertilidad.
RFLP: Restriction Fragment Length Polymorphism. Polimorfismo de longitud de fragmentos de
restricción.
ScD: Stone cheek diameter. Diámetro mejilla del hueso.
SIM: Simple interval maping. Mapeo simple por intervalo.
SNP: Single Nucleotide Polymorphism. Polimorfismo de un sólo nucleótido.
SpD: Stone polar diameter. Diámetro polar del hueso
SSC: Soluble solid content. Contenido de sólidos soluble.
SsD: Stone suture diameter. Diámetro sutura del hueso
SSR: Simple Sequence Repeat. Secuencia repetida en tandem, (microsatélite).
SW: Stone weight. Peso del hueso
TA: Titratable acidity. Acidez titulable.
191
LISTA DE TABLAS Y FIGURAS
Tabla 1. Principales países productores de melocotón, año 2012. Tabla 2. Características de las principales poblaciones usadas en estudios genéticos. Tabla 3. Genes mayores documentados que afectan caracteres morfológicos y agronómicos en
melocotonero. Table 4. Characteristics of the SSR markers in linkage group 6 developed for linkage analysis in the
‘Texas’ x ‘Earlygold’ BC1 population. Table 5. PPR genes found in the regions containing Rf1 and Rf2 in the Prunus genome. Table 6. Segregation of single genes mapped in this study. Table 7. Summary of consistent QTLs identified in this study using the TxE and T1E progenies Table 8. The two sets of SSR markers used for the selection of the T1E lines with low numbers of
introgressions. Table 9. Percentage of the individuals having at least one introgression as estimated in the different
stages of the selection for plants with three or less introgressions in the backcross one generation of ‘Texas’ almond x ‘Earlygold’ peach.
Table 10. Genotypes of the set of selected preNILs.
Table 11. Characteristics of the introgressions of the 18 preNILs selected in the T1E offspring.
Table 12. Mapping of major genes segregating in the T1E offspring using the 18 preNIL set and comparison with results with the entire T1E mapping population.
Figura 1. Mapa del Mediterráneo oriental. Figura 2. Árbol de máxima verosimilitud de las secuencias de ADN plastidial de cuatro genes
concatenados para filogenética de Prunus. Figura 3. Distribución natural de melocotoneros y almendros en China. Figura 4. Los principales hábitos de crecimiento definidos en melocotoneros. Figura 5. Estados fenológicos del melocotonero. Figura 6. Diseminación temprana del melocotonero. Figura 7. Diagrama de los principales tipo de poblaciones utilizadas para el mapeo genético. Figure 8. a) Male sterile flower with white anthers and absence of pollen, and b) fertile flower with
colored anthers and presence of pollen. Figure 9. Linkage maps obtained, one with the almond (‘Texas’) x peach (‘Earlygold’) F2 population (TxE),
and two more with the backcross one population to peach, one for the hybrid female parent (T1E) and the other for the peach ‘Earlygold’ male parent (E).
Figure 10. Scheme of a) fruit, stone and b) leaf dimensions. Figure 11. Images of the fruits fromTexas, MB1.37, Earlygold and some individuals from TxE and T1E
progenies. Figura 12. Location of putative QTLs controlling flower, phenology, fruit quality and leaf morphology
traits on TxE, T1E and E maps. Figure 13. Genes and consistent QTLs mapped in this work in the TxE and T1E progenies and
represented in the Prunus reference map. Figure 14. Graphical genotypes of 18 backcross 1 lines that cover the whole peach genome with almond
introgressions. Figure 15. Identification of the map position of the powdery mildew resistance gene (Vr3) with the
preNIL set. Figure 16. Identification of the map position of the fertility restores genes with the preNIL set. Figure 17 Identification of the map position of the maturity date QTL with the preNIL set. Figure 18. Identification of the map position of the stone weight QTL with the preNIL set. Figure 19. Scheme of the method for marker-assisted introgression from relatives or wild species into
peach to obtain a near-isogenic line (NIL) collection or to develop a new cultivar.
193
AGRADECIMIENTOS
Es muy difícil expresar los sentimientos de gratitud que me embargan en este momento.
Tendría que remontarme al año 2010 cuando recibí un correo de Pere Arús comentándome la
posibilidad de concederme una beca para realizar el doctorado en el IRTA. En ese momento
intuí el camino. Luego recibí la confirmación de la beca y la excedencia de mi Instituto (INIA)
por cuatro años.
Por alguna regla oculta de la naturaleza la vida nos lleva al lugar donde están las instancias
para aprender. Agradezco a la vida (Dios) por permitirme vivir esta experiencia que ha
cambiado mi vida y la de mi familia para siempre.
Agradezco a mis directores de tesis. A Pere Arús quien confió en mí y tuvo la visión y el coraje
de emprender el proyecto de las NILs, me regaló parte de su amor por la genética y grandes
enseñanzas. A Iban Eduardo quien me mostró la senda del rigor científico y me ayudó a
comprender aspectos técnicos y teóricos de nuestro trabajo.
A mi tutora Charlotte Poschenrieder que desde el año 2009 cuando postulé por primera vez al
máster en Biología Y Biotecnología Vegetal mostró una gran disposición para orientarme en
todos los aspectos y luego tomar la tutoría de esta Tesis.
A Octavio Serra quien me ha ayudado de una manera sin igual. Gracias siempre.
A Esteve Collell, siempre disponible para mis dudas sobre cualquier cosa.
A todos los compañeros de despacho: Chema, Vero, Lara, Adrià, por su cordialidad, amistad y
permitirme apagar el aire acondicionado aún cuando (casi) todos querían tenerlo prendido.
A todas las personas del programa de Genómica y Biotecnología del IRTA: Amparo, Txosse,
Werner, Marta, Jordi, Monste M., Noemí, Kostas, Mark, José Ramón, Carlos, Jason, Laura. A los
que ya no están: Ana, Gisela, Andrea, Michael, Pablo M., Juan, Álvaro.
A Montse S. y Celia, desde el primer momento pude contar con ustedes y estaré eternamente
agradecido de sus consejos, apoyo, amistad. A Carmen, una grandísima persona, el mapQTL lo
sé usar gracias a ti.
194
A Cristian Fontich por ayudarme con todos los aspectos relacionados al manejo de frutales.
A Dani por compartir grandes platicas de fútbol y defender la calidad de Alexis las veces que
fuese necesario.
A Angel siempre cordial y buen amigo. A Vanesa y Fuensi siempre cordiales y amables.
A Toni Ortigosa por su buena disposición y gran profesionalidad.
A todos los trabajadores del IRTA de Gimenells, Mollerusa, Cabrils y Torre Marimon. Sin ellos
nada de nuestro trabajo sería posible.
A mis grandes amigos del INIA: don Gamalier Lemus, Jorge Carrasco y don Nilo cavacevich, sin
su apoyo y amistad no lo hubiese logrado.
A mis grandes amigos de la vida: Poli y Pepe Jarana. Y cada uno de mis amigos que me escribió
y apoyo desde el otro lado de la cordillera.
A don Eduardo Astorga Barriga, de quien escuche por primera vez hablar de mejora genética.
A don Carlos Muñoz por confiar en mí.
A Reinaldo Campos-Vargas por sus consejos y amistad.
A Patricio Hinrichsen mi tutor INIA
A mis padres y hermanos.
A mi familia: mi mujer Jacqueline y a mis hijos, Fernanda y Néstor, por quererme tanto,
apoyarme en este periplo y comprender tantos momentos sin el papá.
![Tesis Doctoral Europea / European Doctoral Thesishera.ugr.es/tesisugr/18886656.pdfLISTA DE PUBLICACIONES [LIST OF PUBLICATIONS] La presente memoria de Tesis Doctoral está compuesta](https://img.pdfslide.fr/doc/110x75/5ece4bf8b1af104f892b63d0/tesis-doctoral-europea-european-doctoral-lista-de-publicaciones-list-of-publications.jpg)
